CN1301307A

CN1301307A - Methods for producing polypeptides in filamentous fungal mutant cells

Info

Publication number: CN1301307A
Application number: CN 99806230
Authority: CN
Inventors: J·瓦勒斯尼尔; T·克瑞斯特森
Original assignee: Novo Nordisk AS; Novo Nordisk Biotech Inc
Current assignee: Novo Nordisk AS; Novozymes Inc
Priority date: 1998-05-15
Filing date: 1999-05-14
Publication date: 2001-06-27
Also published as: EP1078080A1; JP2002515252A; WO1999060136A1; AU4188099A

Abstract

The present invention relates to methods for producing a polypeptide in enhanced amounts, comprising (a) cultivating a mutant of a parent filamentous fungal cell in a nutrient medium suitable for production of the polypeptide, wherein (i) the mutant cell comprises a first nucleic acid sequence encoding the polypeptide and a modification of one or more second nucleic acid sequences encoding DDC2 and/or DDC3 polypeptides, or homologues thereof, and (ii) the mutant cell produces more of the polypeptide than the parent cell when cultured under the same conditions; and (b) recovering the polypeptide from the nutrient medium of the mutant cell. The present invention also relates to the second nucleic acid sequences, polypeptides encoded by the second nucleic acid sequences, and nucleic acid constructs, recombinant expression vectors, and host cells comprising the sequences. The present invention further relates to mutants of filamentous fungal cells and methods for obtaining the mutant cells.

Description

In filamentous fungal mutant cells, produce the method for polypeptide

The present invention relates to mutant, produce the method for polypeptide in the mutant of filamentous fungal cells at filamentous fungal cells, and the method that obtains this mutant.

Used several methods and improved the method for producing polypeptide by the pair cell mutagenic treatment.For example, produce mutant cell by typicalness mutagenesis and changed proteinic production, described typicalness mutagenesis relates to the frequency that increases catastrophic event with chemical action agent, physical action agent and biological action agent as mutagenesis (bringing out sudden change) agent processing cell.

A kind of method that increases the widespread use of polypeptide output is amplification and produce many copies of the gene of this polypeptide of coding.For example, U.S. Patent No. 5,578,461 disclose: by means of with the placed in-line a kind of selected marker's that increases of a kind of gene homologous recombination, wherein, can select to comprise the cell of the amplification copy board of selected marker by culturing cell in the presence of suitable selective agent.

In addition, by replacing a kind of promotor with different promotors or replacing the output that a kind of signal peptide coding region has increased polypeptide with another kind of signal peptide coding region.Referring to for example U.S. Patent No. 5,641,670.Also the cell (U.S. Patent No. 5,312,735) of excess production (Ruohonen etc., 1997, yeast (yeast), 13:337～351) by secretary protein and generation supersecretion has improved the secretion of polypeptide.

Also by destroy coding can be under the condition of producing polypeptide the dna sequence dna of the proteolytic enzyme of this polypeptide of hydrolysis increased the output of polypeptide.

An object of the present invention is to provide and increase improving one's methods of polypeptide output in the mutant filamentous fungal strains, thereby at a large amount of polypeptide of industrial production.

The present invention relates to produce the method for polypeptide, it comprises:

(A) helping to produce the mutant cell of cultivating the parental generation filamentous fungal cells under the condition of this polypeptide, wherein, when cultivating under the same conditions, described mutant cell is than the more polypeptide of parental cell production, wherein, described mutant cell first kind of nucleotide sequence and one or more of comprising this polypeptide of coding is selected from down the modification of second kind of nucleotide sequence organizing:

(ⅰ) coding has a kind of nucleotide sequence of polypeptide of aminoacid sequence, described aminoacid sequence have at least 50% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5;

(ⅱ) have at least 50% with the nucleotide sequence of the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4;

(ⅲ) nucleotide sequence, it is hybridized with following material under low stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (b) subsequence of (a) of at least 100 Nucleotide, perhaps (c) (a) or complementary strand (b);

(ⅳ) nucleotide sequence of the variant of a coded polypeptide, described polypeptide have the aminoacid sequence of a sequence 2 or sequence 5, described variant comprise one or morely amino acid whosely substitute, disappearance and/or insert;

(ⅴ) (ⅰ), (ⅱ) or allelic variant (ⅲ); And

(ⅵ) (ⅰ), (ⅱ), (ⅲ) or subsequence (ⅴ), wherein, this subsequence coding has the polypeptide fragment of DDC2 or DDC3 polypeptide active; And

(B) substratum from described mutant cell reclaims described polypeptide.

The invention still further relates to the method for mutant and this mutant cell of acquisition of filamentous fungal cells.

The invention still further relates to: isolating second kind of nucleotide sequence of encoding D DC2 or DDC3 polypeptide, by DDC2 this second kind of nucleic acid sequence encoding, isolating or DDC3 polypeptide, and the nucleic acid construct thing, recombinant expression vector and the host cell that comprise this second kind of nucleotide sequence.

Figure 1A and 1B show the genomic nucleic acid sequence of DDC2 and the aminoacid sequence of deduction (being respectively sequence 1 and 2).

Fig. 2 A and 2B show the genomic nucleic acid sequence of DDC2 and the aminoacid sequence of deduction (being respectively sequence 4 and 5).

Fig. 3 shows the restriction figure of pToC391.

Fig. 4 shows the restriction figure of pToC401.

The amount that the present invention relates to improve is produced the method for polypeptide, and it comprises: helping production Cultivate the mutant cell of parental generation filamentous fungal cells under the condition of this polypeptide, thinner from described sudden change Born of the same parents' culture medium separates described polypeptide, and wherein, described mutant cell comprises this polypeptide of coding First kind of nucleotide sequence and one or more second nucleotide sequence (this sequence is that parental generation is thin Born of the same parents' endogenous sequence) a modification (for example destroy or disappearance), wherein, when at identical When cultivating under the part, described modification has improved the polypeptide output (comparing with parental cell) of mutant cell.

In the method for the invention, described one or more second nucleotide sequence has:

(ⅰ) coding has a kind of nucleotide sequence of polypeptide of amino acid sequence, described amino acid order Row have at least 50% with the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5 Homogeneity;

(ⅱ) have at least 50% with the nucleotides 1014～1151 of sequence 1 or the nucleosides of sequence 4 The nucleotide sequence of the homology of acid 1041～1229;

(ⅲ) nucleotide sequence, it is hybridized with following material under low stringency: (a) The nucleotides 1014～1151 of sequence 1 or the nucleotides 1041～1229 of sequence 4, (b) at least The subsequence of (a) of 100 nucleotides, perhaps (c) (a) or complementary strand (b);

(ⅳ) nucleotide sequence of the variant of a coded polypeptide, described polypeptide have a sequence 2 Or the amino acid sequence of sequence 5, described variant comprises one or more amino acid whose alternative, scarce Lose and/or insert;

(ⅴ) (ⅰ), (ⅱ) or allelic variant (ⅲ); And

(ⅵ) (ⅰ), (ⅱ), (ⅲ) or subsequence (ⅴ), wherein, this subsequence coding tool The polypeptide fragment that DDC2 or DDC3 polypeptide active are arranged.

DDC2 and/or DDC3 polypeptide active are defined as one or more such work at this paper The property: when reducing (more preferably eliminating), it increases or improves the output of polypeptide.

In first embodiment, the second nucleic acid sequence encoding has an amino acid sequence Polypeptide, described amino acid sequence has at least about 50%, preferably at least about 60%, preferably at least About 70%, more preferably at least about 80%, further preferably at least about 90%, most preferably at least about 95%, Further most preferably at least about 97% same with the amino acid/11 9～64 (being ripe polypeptide) of sequence 2 Property degree, this polypeptide have DCC2 polypeptide active (hereinafter " DCC2 homeopeptide " or " DCC 2 polypeptide "), perhaps at least about 50%, preferably at least about 60%, preferably at least about 70%, more excellent Choosing at least about 80%, further preferably at least about 90%, most preferably at least about 95%, further Preferably at least about 97% with the homogeneity degree of the amino acid 21～83 (being ripe polypeptide) of sequence 5, Described polypeptide has DCC3 polypeptide active (hereinafter " DCC3 homeopeptide " or " DCC3 Polypeptide "). In a preferred embodiment, the amino acid sequence that has of described homeopeptide Five amino acid is arranged, preferably have four amino acid, three amino acid, further excellent are more preferably arranged Choosing has two amino acid, most preferably has an amino acid to be different from the amino acid/11 9～64 of sequence 2 Or the amino acid 21～83 of sequence 5. For purposes of the invention, same between the two seed amino acid sequences One property degree is to measure by Clustal method (Higgins, 1989, CABIOS 5:151～153) , that is: use LASERGENETM MEGALIGNTM software (DNASTAR, Inc., Madison, WI), Adopt homogeneity table and the multiple reduced parameter of following sequence: gap point penalty (gap penalty) is 10 and gap length point penalty (gap length penalty) be 10. The paired comparison parameter is: Ktuple=1, gap point penalty=3, window (windows)=5, and diagonal (diagonals)=5.

Preferably, the such polypeptide of described second nucleic acid sequence encoding, that is, this polypeptide comprises The amino acid sequence of sequence 2 or its allelic variant; Or it has the fragment of DCC2 polypeptide active. In a preferred embodiment, described second nucleic acid sequence encoding DCC2 polypeptide should Polypeptide comprises the amino acid sequence of sequence 2. In another preferred embodiment, described Two kinds of nucleic acid sequence encoding one peptide species, this polypeptide comprises the amino acid/11 9～64 of sequence 2, or Its allelic variant; Or it has the fragment of DCC2 polypeptide active. In another preferred side of enforcement In the case, described second nucleic acid sequence encoding one peptide species, this polypeptide comprises the amino of sequence 2 Acid 19～64. In still another preferred embodiment, described second nucleic acid sequence encoding one Peptide species, this polypeptide is by amino acid sequence or its allelic variant of sequence 2; Or it has DCC2 The fragment of polypeptide active consists of. In still another preferred embodiment, described second nucleic acid Sequential coding one peptide species, this polypeptide is made of the amino acid sequence of sequence 2. Excellent at another In the embodiment of choosing, described second nucleic acid sequence encoding one peptide species, this polypeptide is by sequence 2 amino acid/11 9～64 or its allelic variant; Or its fragment with DDC2 polypeptide active consists of. In still another preferred embodiment, described second nucleic acid sequence encoding one peptide species should Polypeptide is made of the amino acid/11 9～64 of sequence 2.

Preferably, the such polypeptide of described second nucleic acid sequence encoding, that is, this polypeptide comprises The amino acid sequence of sequence 5 or its allelic variant; Or it has the fragment of DCC3 polypeptide active. In a preferred embodiment, described second nucleic acid sequence encoding DCC3 polypeptide should Polypeptide comprises the amino acid sequence of sequence 5. In another preferred embodiment, described Two kinds of nucleic acid sequence encoding one peptide species, this polypeptide comprises the amino acid 21～83 of sequence 5, or Its allelic variant; Or it has the fragment of DCC3 polypeptide active. In another preferred side of enforcement In the case, described second nucleic acid sequence encoding one peptide species, this polypeptide comprises the amino of sequence 5 Acid 21～83. In still another preferred embodiment, described second nucleic acid sequence encoding one Peptide species, this polypeptide is by amino acid sequence or its allelic variant of sequence 5; Or it has DCC3 The fragment of polypeptide active consists of. In still another preferred embodiment, described second nucleic acid Sequential coding one peptide species, this polypeptide is made of the amino acid sequence of sequence 2. Excellent at another In the embodiment of choosing, described second nucleic acid sequence encoding one peptide species, this polypeptide is by sequence 5 amino acid 21～83, or its allelic variant; Or it has the fragment structure of DDC3 polypeptide active Become. In still another preferred embodiment, described second nucleic acid sequence encoding one peptide species, This polypeptide is made of the amino acid/11 9～64 of sequence 5.

Described second kind of nucleotide sequence also comprises such nucleotide sequence, that is, their a kind of polypeptide of encoding with aminoacid sequence of sequence 2 or sequence 5, they are because the degeneracy of genetic code and be different from sequence 1 or sequence 4 respectively.The invention still further relates to the subsequence (their codings have the fragment of the sequence 2 of DDC2 polypeptide active) of sequence 1 and the subsequence (their codings have the fragment of the sequence 5 of DDC3 polypeptide active) of sequence 4.

The subsequence of sequence 1 or sequence 4 is respectively the nucleotide sequence that sequence 1 or sequence 4 are comprised, different is since 5 ' and/or one or more nucleotide deletions of 3 ' end.Preferably, the subsequence of sequence 1 comprises at least 114 Nucleotide, more preferably at least 138 Nucleotide, most preferably at least 162 Nucleotide.Preferably, the subsequence of sequence 4 comprises at least 159 Nucleotide, more preferably at least 189 Nucleotide, most preferably at least 219 Nucleotide.

The fragment of sequence 2 or sequence 5 is peptide species, and this polypeptide has one or more amino acid from the aminoterminal of this aminoacid sequence and/or carboxy terminal deletion.Preferably, the fragment of sequence 2 comprises at least 38 amino-acid residues, more preferably at least 46 amino-acid residues, most preferably at least 54 amino-acid residues.Preferably, the fragment of sequence 5 comprises at least 53 amino-acid residues, more preferably at least 63 amino-acid residues, most preferably at least 73 amino-acid residues.

Allelic variant represents to occupy any two or more gene alterative version of same chromogene seat.Allelic variation causes naturally by sudden change, may cause the polymorphism in the colony.Transgenation may be reticent (do not have in encoded polypeptides change) or may encode and have the polypeptide of altered aminoacid sequence.The allelic variant of polypeptide is the allelic variant encoded polypeptides by gene.

In second embodiment, described second kind of nucleotide sequence have at least about 50%, preferably at least about 60%, preferably at least about 70%, more preferably at least about 80%, further preferably at least about 90%, most preferably at least about 95%, further most preferably at least about 97% with the homology degree of the mature polypeptide encoded sequence (being Nucleotide 1014～1151) of sequence 1, their active DDC2 polypeptide of encoding; The perhaps allelic variant of sequence 1 and subsequence (their codings have the polypeptide fragment of DDC2 polypeptide active), perhaps have at least about 50%, preferably at least about 60%, preferably at least about 70%, more preferably at least about 80%, further preferably at least about 90%, further preferably at least about 95%, most preferably at least about 97% with the homology degree of the mature polypeptide encoded sequence (being Nucleotide 1041～1229) of sequence 4, their active DDC3 polypeptide of encoding; The perhaps allelic variant of sequence 4 and subsequence (their codings have the polypeptide fragment of DDC3 polypeptide active).For purposes of the invention, homology degree between two kinds of nucleotide sequences is by Wilbur-Lipman method (Wilbur and Lipman, 1983, institute of NAS newspaper (Proceedings of theNational Academy of Science USA) 80:726～730) measure, that is: use LASERGENETM MEGALIGNTM software (DNASTAR, Inc., Madison, WI), adopt identity table and the multiple reduced parameter of following sequence: the gap point penalty is 10, and the gap length point penalty is 10.Paired reduced parameter: Ktuple=1, gap point penalty=3, and window=20.

In the 3rd embodiment, described second kind of nucleotide sequence is in very low stringency, preferred low stringency, more preferably moderate stringency, more preferably-the high stringency, further preferred high stringency, most preferably under the condition of very high severity with a kind of nucleic acid probe hybridization, this nucleic acid probe is hybridized with following material under the same conditions: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (b) subsequence of (a) of at least 100 Nucleotide, perhaps (c) (a) or complementary strand (J.Sambrook (b), E.F.Fritsch, and T.Maniatus, 1989, " molecular cloning; laboratory manual " (Molecular Cloning, ALaboratory Manual), the 2nd edition, Cold Spring Harbor, New York).The subsequence of sequence 1 or sequence 4 may be at least 100 Nucleotide or preferred at least 200 Nucleotide.In addition, this subsequence can be encoded and be had the polypeptide fragment of DDC2 or DDC3 polypeptide active.

The nucleotide sequence of sequence 1 or sequence 4 or its subsequence, thereby and the aminoacid sequence of sequence 2 or sequence 5 or its fragment can be used to the DNA that identification of strains that the designing nucleic acid probe never belongs to together or plant by method well known in the art and clones coding have the polypeptide of DDC2 or DDC3 polypeptide active.Specifically, such probe can be used to by the genomic or cDNA hybridization of the southern blotting technique method of standard operation with interested genus or kind, so that identify and separates wherein gene accordingly.Such probe may be than full length sequence much shorter, but length should be at least 15, preferably at least 25, more preferably at least 35 Nucleotide.Also can use longer probe.Can use these two kinds of dna probe and rna probes.Usually probe is marked to detect corresponding gene (for example, with 32P, 3H, 35S, vitamin H or avidin 9 white marker).The present invention includes such probe.

Therefore, can be used for the DNA screening from such other biological genomic dna for preparing or cDNA library, this DNA and above-mentioned probe hybridization and coding have the polypeptide of DDC2 or DDC3 polypeptide active.Deriving from other so biological genomic dna or other DNA can separate by agarose or polyacrylamide gel electrophoresis, perhaps separates by other isolation technique.The DNA or the separated DNA that derive from described library can be transferred to or be fixed on soluble cotton or other suitable carriers.In order to identify and sequence 1 or sequence 4 or its subsequence homologous clone or DNA, in the southern blotting technique method, use described solid support material.For purposes of the invention, " hybridization " represent that the nucleic acid probe (corresponding to the nucleotide sequence shown in sequence 1 or the sequence 5, its complementary strand or its subsequence) of certain nucleotide sequence and mark hybridizes under very high stringency in very low severity.Use the X-ray sheet and detect the molecule that nucleic acid probe is under these conditions hybridized with it.

In a preferred embodiment, described nucleic acid probe is a sequence 1.In another preferred embodiment, described nucleic acid probe is the nucleotide sequence of the polypeptide of encoding sequence 2 or its subsequence.In still another preferred embodiment, described nucleic acid probe is the Nucleotide 1014～1151 of sequence 1, and its coding has the mature polypeptide of DDC2 polypeptide active.In still another preferred embodiment, described nucleic acid probe is to be contained in clay 18H7[it is contained among colon bacillus (Escherichia coli) DSM 12060] in nucleotide sequence, wherein, this nucleic acid sequence encoding has the polypeptide of DDC2 polypeptide active.In still another preferred embodiment, described nucleic acid probe is the ripe DDC2 polypeptid coding area that is contained among the clay 18H7 (it is contained among the colon bacillus DSM12060).

In a preferred embodiment, described nucleic acid probe is a sequence 4.In another preferred embodiment, described nucleic acid probe is the nucleotide sequence of the polypeptide of encoding sequence 5 or its subsequence.In still another preferred embodiment, described nucleic acid probe is the Nucleotide 1041～1229 of sequence 4, and its coding has the mature polypeptide of DDC3 polypeptide active.In still another preferred embodiment, described nucleic acid probe is the nucleotide sequence that is contained among the clay 34G12 (it is contained among the colon bacillus DSM11924), and wherein, this nucleic acid sequence encoding has the polypeptide of DDC3 polypeptide active.In still another preferred embodiment, described nucleic acid probe is the ripe DDC3 polypeptid coding area that is contained among the clay 34G12 (it is contained among the colon bacillus DSM11924).

Be at least the long probe of 100 Nucleotide with regard to length, " very low severity is to very high stringency " is defined under 42 ℃, at 5X SSPE, 0.3%SDS, 200 μ g/ml shear the also salmon sperm DNA of sex change, and or 25% methane amide (concerning very low severity and low stringency), 35% methane amide (concerning the moderate severity and in-the high stringency), perhaps in 50% methane amide (concerning high severity and very high stringency), by the prehybridization and the hybridization of standard DNA blotting operation.

Be at least the long probe of 100 Nucleotide with regard to length, use 2X SSC at last, 0.2%SDS is preferably at least 45 ℃ (very low severity), more preferably at least 50 ℃ (low severity), more preferably at least 55 ℃ (moderate severity), more preferably at least 60 ℃ (in-high severity), further more preferably at least 65 ℃ (high severity), most preferably under 70 ℃ (very high severity), described solid support material is washed three times each 15 minutes at least.

With regard to length is the short probe of about 15 Nucleotide～about 70 Nucleotide, " stringency " is defined as by the operation of standard DNA blotting prehybridization, hybridization and post-hybridization washing, promptly, be lower than [the computing method (1962 of application Bolton and McCarthy, institute of NAS reports 48:1390)] under about 5 ℃～about 10 ℃ of the Tm that calculate, at 0.9M NaCl, 0.09MTris-HCl (pH7.6), 6mM EDTA, 0.5%NP-40,1X Denhardt solution, the 1mM trisodium phosphate, the 1mM SODIUM PHOSPHATE, MONOBASIC is washed among 0.1mM ATP and the 0.2mg yeast rna/ml.

With regard to length is the short probe of about 15 Nucleotide～about 70 Nucleotide, described solid support material is added the 0.1%SDS washing with 6X SCC once (reach 15 minutes) and use 6X SSC in about 5 ℃ of the Tm that is lower than calculating～about 10 ℃ of following washed twice (each 15 minutes).

Described second kind of nucleotide sequence is to obtain like this: (a) very low severity, low severity, moderate severity, in-condition of high severity, high severity or very high severity under, DNA and following material are hybridized: (ⅰ) Nucleotide 1014～1151 of sequence 1, (ⅱ) subsequence of (ⅰ), perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ); The perhaps Nucleotide 1041～1229 of (ⅰ) sequence 4, (ⅱ) subsequence of (ⅰ), perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ); And (b) separate this nucleotide sequence.Described subsequence is the sequence of at least 100 Nucleotide preferably, and for example, coding has the sequence of the polypeptide fragment of DDC2 or DDC3 polypeptide active.

In the 4th embodiment, described second kind of nucleic acid sequence encoding has the variant polypeptides (comprising one or more amino acid whose replacements, disappearance and/or insertion) of the aminoacid sequence of sequence 2 or sequence 5.

The amino acid sequence of polypeptide of described variation may substitute aminoacid sequence or its mature polypeptide that one or more amino-acid residues are different from sequence 2 or sequence 5 because of the insertion of one or more amino-acid residues or disappearance and/or by different amino-acid residues.Preferably, amino acid change is the change of smallness, i.e. not remarkably influenced Protein Folding and/or active conserved amino acid substitute; A small amount of disappearance (common 1～about 30 amino acid); Little aminoterminal or carboxyl terminal extend (for example aminoterminal methionine residues); The little joint peptide of about at the most 20～25 residues; Perhaps help the little extension (for example polyhistidine tract, epitope or in conjunction with the territory) of purifying by changing static charge or another function.

Conservative alternate example is in following amino acid scope: basic aminoacids (arginine, Methionin and Histidine), acidic amino acid (L-glutamic acid and aspartic acid), polare Aminosaeren (glutamine and l-asparagine), hydrophobic amino acid (leucine, Isoleucine and Xie Ansuan), aromatic amino acid (phenylalanine, tryptophane and tyrosine), and little amino acid (glycine, L-Ala, Serine, Threonine and methionine(Met)).The general amino acid replacement that does not change specific activity is as known in the art, for example, is described in " protein " (The Proteins) by H.Neurath and R.L.Hill (1979), and Academic Press is among the New York.The exchange of normal appearance has: Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, vice versa.

The sequence of variation can be as the peptide coding of sequence 1 or sequence 4 part (for example, its subsequence) is fabricated on the nucleotide sequence basis that provides, and/or by introducing nucleotide substitution (this alternative another aminoacid sequence that does not produce by the polypeptide of nucleic acid sequence encoding, but be equivalent to produce the codon selection of the desired host living beings of polypeptide) and make up, perhaps make up by introducing the nucleotide substitution that may produce the different aminoacids sequence.As for the general description of nucleotide substitution, can be referring to for example: Ford etc., 1991, protein expression and purifying (Protein Expression andPurification) 2:95～107.

It should be apparent to those skilled in the art that outside so alternative district that can play a crucial role and carry out, and still produce active polypeptide in function to molecule.Can identify by methods known in the art for the amino-acid residue that is played a crucial role by the polypeptide active of described second kind of nucleic acid sequence encoding (thereby preferably not experiencing alternative), for example site-directed mutagenesis or alanine scanning mutagenesis are (referring to for example, Cunningham and Wells, science (Science) 244:1081～1085).In a kind of technology in back, mutagenesis on each the positive charge residue in molecule, thus the DDC2 of the mutating molecule that measure to generate again or DDC3 polypeptide active are identified the amino-acid residue that the activity to this molecule plays a crucial role.The site of substrate-enzyme interacting also can be by the assay determination of three-dimensional structure, three-dimensional structure can by for example nuclear magnetic resonance spectroscopy, crystallography or photoaffinity marker determination (referring to for example, de Vos etc., 1992, science 255:306～312; Smith etc., 1992, molecular biology magazine (Journal of Molecular Biolegy) 224:899～904; Wlodaver etc., 1992, FEBS communication (FEBS Letters) 309:59～64).

In a preferred embodiment, two second kind of nucleotide sequences of encoding D DC2 and DDC3 polypeptide have been modified.In a preferred embodiment, the DCC2 and the DDC3 nucleotide sequence that are contained in respectively in sequence 1 and the sequence 4 have been modified.

Described second kind of nucleotide sequence can obtain from the microorganism of any genus.With regard to the present invention, the term that this paper uses " derives from " with given source and gets in touch expression: by the polypeptide of nucleic acid sequence encoding be produce by this source or produce by a kind of cell (wherein, having inserted the nucleotide sequence in this source).In a preferred embodiment, the polypeptide by described second kind of nucleic acid sequence encoding is an exocytosis.

Described second kind of nucleotide sequence can derive from fungic origin, more preferably derive from yeast strain, for example, candiyeast (Candida), Hansenula (Hansenula), genus kluyveromyces (Kluyveromyces), Pichia (Pichia), yeast belong (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or Yarrowia bacterial strain; Perhaps more preferably derive from filamentous fungal strains, for example Acremonium (Acremonium), Aspergillus (Aspergillus), aureobasidium genus (Aureobasidium), Cryptococcus (Cryptococcus), Filibasidium, fusarium (Fusarium), Gibberella (Gibberella), Humicola (Humicola), Magnaporthe, Mucor (Mucor), myceliophthora (Myceliophthora), Myrothecium (Myrothecium), Neocallimastix, Neurospora (Neurospora), paecilomyces (Paecilomyces), Penicillium (Penicillium), Piromyces, Schizophyllum (Schizophyllum), the mould Pseudomonas of basket (Talaromyces), thermophilic ascomycete belongs to (Thermoascus), Thielavia (Thielavia), Tolypocladium or Trichoderma (Trichoderma) bacterial strain.

In a preferred embodiment, described second kind of nucleotide sequence derives from saccharomyces carlsbergensis (Saccharomyces carlsbergensis), yeast saccharomyces cerevisiae (Saccharomycescerevisiae), saccharomyces diastaticus (Saccharomyces diastaticus), Saccharomyces douglasii, Crewe not yeast (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or Saccharomyces oviformis bacterial strain.

In another preferred embodiment, described second kind of nucleotide sequence derives from microorganism Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori (Aspergillus awamori), smelly aspergillus (Aspergillus foetidus), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus oryzae (Aspergillus oryzae), bar spore shape sickle spore (Fusarium bactridioides), Fusarium cerealis, Fusarium crookwellense, machete sickle spore (Fusariumculmorum), fusarium graminaria (Fusarium graminearum), the red sickle spore of standing grain (Fusariumgraminum), different spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusariumvenenatum, Humicola insolens, Humicola lanuginosa, rice black wool mould (Mucor miehei), Myceliophthora thermophila, Neuraspora crassa (Neurospora crassa), penicillium purpurogenum (Penicillium purpurogenum), Trichoderma harzianum, healthy and free from worry wood mould (Trichoderma koningii), Trichoderma longibrachiatum, Trichoderma reesei or viride (Trichoderma viride) bacterial strain.

In a preferred embodiment, second kind of nucleotide sequence of encoding D CC2 polypeptide derives from aspergillus oryzae strain, most preferably derives from aspergillus oryzae IFO4177 or its mutant strain (polypeptide that for example has the aminoacid sequence of sequence 2).In another preferred embodiment, described nucleotide sequence is the sequence that is contained among the clay 18H7 (it is contained among the colon bacillus DSM12060).In another preferred embodiment, described nucleotide sequence is the Nucleotide 1014～1151 of sequence 1.

In another preferred embodiment, second kind of nucleotide sequence of encoding D DC3 polypeptide derives from aspergillus oryzae strain, most preferably derives from aspergillus oryzae IFO4177 or its mutant strain (polypeptide that for example has the aminoacid sequence of sequence 2).In another preferred embodiment, described nucleotide sequence is the sequence that is contained among the clay 34G12 (it is contained among the colon bacillus DSM11924).In another preferred embodiment, described nucleotide sequence is the Nucleotide 1041～1229 of sequence 4.

Should understand that for above-mentioned bacterial classification, the present invention had both comprised perfect state, comprised the imperfect state again, and the equivalent species of other classification (for example anamorph), no matter what their kind name is.Those skilled in the art should discern the individual character of suitable equivalent species easily.For example, described polypeptide can derive from Raper, K.D. and Fennel, and D.I. (1965) is at " Aspergillus " (The GenusAspergillus) (the Wilkins Company, Baitimore) the equivalent species microorganism of the classification of the Aspergillus of definition in is no matter what their kind name is.Aspergillus is a mitospore class fungi; it is characterized in that a kind of like this aspergillus (aspergillum): it comprises conidinphore; in vesicle, there is not known teleomorph state to stop; vesicle itself has the specialized cell (being called as stigma or bottle stalk respectively) of one deck or two-layer synchronous formation again, and the spore of asexual formation (being called as conidium).The known teleomorph of Aspergillus comprises Eurotium (Eurotium), Neosartorya and Emericella.The bacterial strain public of Aspergillus and teleomorph thereof can obtain in some culture presevation units, for example: American type culture collection (ATCC), Germany microbial preservation center (DSM), fungi strain preservation center (CBS) and patent DSMZ of agricultural research institute (NRRL).In addition, such nucleotide sequence can be used above-mentioned probe and [comprises from the isolating microorganism of nature (for example soil, compost, water etc.)] from other source and identify and obtain.From the technology of natural habitat separate microorganism is well known in the art.Can obtain nucleotide sequence by the genomic library or the cDNA library of screening another kind of microorganism similarly then.In case with probe in detecting the nucleic acid encoding sequence, just can by use the known technology of those of ordinary skills (referring to for example Sambrook etc., 1989, above) separate or clone this sequence.

Described second kind of nucleotide sequence can be the mutant nucleic acid sequence, it comprises: at least one sudden change in the mature polypeptide encoded sequence of sequence 1 (wherein, the polypeptide that this mutant nucleic acid sequence encoding is made of the amino acid/11 9～64 of sequence 2), perhaps at least one sudden change in the mature polypeptide encoded sequence of sequence 4 (wherein, this mutant nucleic acid sequence encoding constitute polypeptide) by the amino acid 21～83 of sequence 5.

Be used to separate or the technology of the nucleotide sequence of clones coding polypeptide is known in the art, they comprise: separate from genomic dna, and from the cDNA preparation, or its combination.Can carry out like this from such genomic dna cloning nucleotide sequence of the present invention: for example, the polymerase chain reaction of knowing by application (PCR) or the antibody screening of expression library detect the cloning dna fragmentation with shared structure feature.Referring to for example, Innis etc., 1990, " PCR: methods and applications guide " (PCR:A Guide to Methods and Application), Academic Press, NewYork.Can use other nucleic acid amplification method, for example, ligase chain reaction (LCR) connects that activatory is transcribed (LAT) and based on the amplification (NASBA) of nucleotide sequence.Described second kind of nucleotide sequence can be from Aspergillus or other or relevant microbial bacteria strain clone, so, the allelic variant or the mutation of the polypeptid coding area that for example described second kind of nucleotide sequence can be nucleotide sequence.

The mutant filamentous fungal cells can reduce or eliminate the expression of one or more the second nucleotide sequence as herein described and makes up by using method well known in the art (for example, insert, destroy, substitute or disappearance).Described second kind of nucleotide sequence to be finished or deactivation can be, for example, essential coding region or its part concerning activity perhaps expressed required regulatory element in this coding region or controlling elements.The example of this adjusting sequence or control sequence can be promoter sequence or its funtion part (that is, being enough to influence the part of the expression of this nucleotide sequence).Other control sequence that may modify includes but not limited to: leader sequence, polyadenylation sequence, propeptide sequence, signal sequence, transcription terminator and activating transcription factor.

The modification of described second kind of nucleotide sequence or deactivation can be carried out like this: make the mutagenesis of parental cell experience, select mutant cell (wherein, the expression of described second kind of nucleotide sequence is reduced or has eliminated) again.Described mutagenesis (it can be single-minded or at random) can be carried out like this: for example, by using suitable physical mutagen or chemical mutagen, use suitable oligonucleotide, the mutagenesis that dna sequence dna experience PCR is produced.In addition, the arbitrary combination that also can use these mutafacient system is carried out mutagenesis.

Being fit to the physical mutagen of this purpose or the example of chemical mutagen comprises: ultraviolet ray (UV) irradiation, azanol, N-methyl-N '-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulfonate (EMS), sodium bisulfite, formic acid and nucleotide analog.

When using such agent, usually be performed such mutagenesis: the parental cell that will need mutagenic treatment is in the presence of selected mutagenic compound and be incubated under appropriate condition, and selection shows as the mutant cell that reduced or do not had the expression of described second kind of nucleotide sequence again.

The modification of described second kind of nucleotide sequence or deactivation also can be by introducing, substitute or removing its one or more Nucleotide of transcribing or translate in required sequence or the regulatory element and finish.For example, thus can insert or remove the removing or the change of open reading frame of introducing, initiator codon that Nucleotide causes terminator codon.The mutagenesis that such modification or deactivation can produce by site-directed mutagenesis or the PCR by methods known in the art is finished.But, in general, can modify in vivo, that is, directly on the cell of expressing described second kind of nucleotide sequence to be finished, carry out, preferably carry out external modification like that by described below.

One reduces or eliminates by selected filamentous fungal cells and expresses the example of short-cut method of described second kind of nucleotide sequence based on the technology of gene substitution, genetically deficient or gene disruption.For example, in the gene disruption method, corresponding to the nucleotide sequence of interested endogenous gene or gene fragment and produce damaged nucleotide sequence, again it is transformed into parental cell and produces damaged gene at vitro mutagenesis.By homologous recombination, this damaged nucleotide sequence substitutes endogenous gene or gene fragment.May wish that described damaged gene or gene fragment are also encoded can be used to select the mark of transformant (wherein, nucleotide sequence has been modified or destroyed).

Also can carry out the modification or the deactivation of described second kind of nucleotide sequence by the nucleotide sequence that set antisense technology is used with the nucleic acid array complementation of this gene.More particularly, can reduce or eliminate expression of gene like this by filamentous fungal cells, that is, by introducing the nucleotide sequence with described second kind of nucleic acid array complementation, this sequence can in described cell, be transcribed and can with the mRNA hybridization of producing in the cell.Make complementary antisense base sequences can with the condition of this mRNA hybridization under, so, reduced or eliminated the proteinic amount of translation.

Can derive from following any microbial source with the second kind of nucleotide sequence homology or the complementary nucleotide sequence of sequence 1 or sequence 4.The selection in nucleotide sequence source will depend on filamentous fungal cells, but preferred source is fungic origin (for example yeast and a filamentous fungus).Preferred filamentous fungus source includes but not limited to: Acremonium, Aspergillus, fusarium, Humicola, myceliophthora, Mucor, Neurospora, Penicillium, Phanerochaete, Thielavia, Tolypocladium and Trichoderma.Preferred yeast source includes but not limited to: candiyeast, Hansenula, genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces (Schizosaccharomyces) and Yarrowia.In addition, this nucleotide sequence can be the native sequences of described filamentous fungal cells.

Should understand method of the present invention be not limited to obtain the to suddenly change concrete order of filamentous fungal cells.Can the arbitrary steps when making up the cell of producing polypeptide parental cell be introduced in the modification of second kind of nucleotide sequence as herein described.Preferably, before first kind of nucleotide sequence introducing the coding heterologous polypeptide, modified second kind of nucleotide sequence of sudden change filamentous fungal cells.

In the method for the invention, described filamentous fungal cells can be wild-type cell or its mutant.Preferably, this filamentous fungal cells is Acremonium, Aspergillus, aureobasidium genus, Cryptococcus, Filibasidium, fusarium, Gibberella, Humicola, Magnaporthe, Mucor, myceliophthora, Myrothecium (Myrothecium), Neocallimastix, Neurospora, paecilomyces, Penicillium, Piromyces, Schizophyllum, the mould Pseudomonas of basket, thermophilic ascomycete genus, Thielavia, Tolypocladium or Trichoderma cell.

In a preferred embodiment, described filamentous fungal cells is microorganism Aspergillus aculeatus, Aspergillus awamori, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.

In another preferred embodiment, described filamentous fungal cells is bar spore shape sickle spore, Fusarium crookwellense (different name of Fusarium cerealis), machete sickle spore, fusarium graminaria, the red sickle spore of standing grain, different spore sickle spore, albizzia sickle spore, sharp sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, fusarium solanae (Fusarium solani), intends branch spore sickle spore, Fusarium sulphureum, Fusarium torulosum, Fusariumtrichothecioides or Fusarium venenatum cell.

In still another preferred embodiment, described filamentous fungal cells be that Gibberellapulicaris, Gibberella zeae, Humicola insolens, Humicolalanuginosa, rice black wool are mould, Myceliophthora thermophila, Myrotheciumroridin, Neuraspora crassa or penicillium purpurogenum cell.

In still another preferred embodiment, described filamentous fungal cells be that Trichodermaharzianum, healthy and free from worry wood are mould, Trichoderma longibrachiatum, Trichodermareesei or viride cell.

Described sudden change filamentous fungal cells is to use methods known in the art to cultivate in being fit to the nutritional medium of production by the polypeptide of described first kind of nucleic acid sequence encoding.For example; described cell can be cultivated by shaking culture, by make in suitable medium neutralization described heterologous polypeptide can be expressed and/or isolating condition under carry out, cultivate with the small-scale in fermentor tank or the industrial fermentation jar or large scale fermentation (comprise continuously ferment, batch fermentation, fed-batch fermentation or solid state fermentation) in the laboratory.This cultivation is to use methods known in the art to carry out in suitable nutritional medium (comprising carbon source and nitrogenous source and inorganic salt).Suitable medium can or can prepare by disclosed composition (for example products catalogue of American type culture collection) from supplier's acquisition.Can directly reclaim polypeptide (if excretory words) from substratum.

Described polypeptide can be used methods known in the art (the narrow spectrum method of this polypeptide) and detect.These detection methods can comprise: the disappearance of the application of specific antibody, the generation of enzyme product, enzyme substrates, SDS-PAGE or any other method known in the art.For example, can use the activity that the enzyme assay method is measured described polypeptide.Concerning a lot of enzymes, the method for measuring enzymic activity is known in the art.

The polypeptide that generates can separate by methods known in the art.For example, can be centrifugal by including but not limited to, filtration, extraction, spraying drying, evaporation or sedimentary ordinary method separate described polypeptide from nutritional medium.Then, can be further purified isolated polypeptide by the whole bag of tricks known in the art, these methods include but not limited to: chromatography (for example, ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoretic method (isoelectrofocusing of for example preparation type), differential dissolving (for example ammonium sulfate precipitation), perhaps extract [referring to for example, " protein purification " (Protein Purification), J.C.Janson and Lars Ryden edit, VCHPublishers, New York, 1989].

By the polypeptide of described first kind of nucleic acid sequence encoding can be any polypeptide of natural or external source concerning the sudden change filamentous fungal cells.Term " polypeptide " is at this paper and do not mean that the encoded product of representing length-specific, so it comprises peptide, oligopeptides and protein.It is not natural polypeptide that term " heterologous polypeptide " is defined as concerning described filamentous fungal cells at this paper.The sudden change filamentous fungal cells may comprise the copy of the nucleotide sequence of one or more coding heterologous polypeptides.

In a preferred embodiment, described polypeptide is hormone, hormone variant, enzyme, acceptor or its part, antibody or its part or reporter molecule.In a preferred embodiment, described polypeptide is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.At one further in the embodiment preferred, described polypeptide is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, MUTANASE (mutanase), oxydase, pectic enzyme, peroxidase, Phospholipid hydrolase, phytase, polyphenoloxidase, proteolytic enzyme, rnase, trans-glutaminases or zytase.

The described first kind of nucleotide sequence of interested polypeptide of encoding can derive from any prokaryotic organism source, eukaryote source or other source.

In the method for the invention, the sudden change filamentous fungal cells also can be used to the natural polypeptide of this cell of recombinant production.This natural polypeptide is recombinant production like this: for example, make the gene of this polypeptide of coding be subjected to different promotor control and strengthen polypeptide expression, quicken interested natural polypeptides output cell by using signal sequence, and the gene copy number that increases coding (usually by cells produce) polypeptide.The present invention comprises also that in the scope of term " heterologous polypeptide " the natural endogenous polypeptide of the described filamentous fungal cells of this recombinant production to such degree so that this expression relates to the genic application of described cell non-natural, perhaps is operated and the application of the natural factor that works in the mode that is normally not present in the host cell.

This paper has described and has been used to separate or the technology of the nucleotide sequence of clones coding polypeptide.The nucleotide sequence of coding said polypeptide can be genomic, cDNA, RNA, semisynthetic, synthetic source or its arbitrary combination.

In the method for the invention, described polypeptide can also be the transformation variant of polypeptide.

In the method for the invention, described polypeptide can further comprise polypeptide fusion or heterozygosis, and wherein, another kind of polypeptide is merged at this polypeptide or its segmental N end or C end.Fusion polypeptide be by the nucleotide sequence of the peptide species of will encoding (or its part) be fused to the coding another kind of polypeptide nucleotide sequence (or its part) produce.The technology of production fusion polypeptide is known in the art, and comprises: the encoding sequence that connects coding said polypeptide is in the frame them, so the expression of fusion polypeptide is subjected to the identical promotor and the control of terminator.Hybrid polypeptide can comprise: derive from least two kinds of not combinations of the part or all of peptide sequence of homopolypeptide (wherein, one or more can be the heterology polypeptide of sudden change filamentous fungal cells).

Can encode first kind of nucleotide sequence polypeptide of interest, isolating for polypeptide expression by the several different methods operation." expression " should be understood to include the arbitrary steps that relates in polypeptide production, include but not limited to: transcribe, post transcriptional modificaiton, translation, posttranslational modification and secretion.The operation nucleotide sequence may be that wish or necessary before it inserts carrier, and this depends on expression vector.It is well known in the art utilizing the technology of cloning process modification of nucleic acids sequence.

" nucleic acid construct thing " is defined as a kind of nucleic acid molecule (strand or double-stranded) at this paper, and it is isolating or comprised the sections (this sections be combined in the non-existent mode of nature and side by side) of nucleic acid by modification from natural gene.When this nucleic acid construct thing comprises when expressing the required whole control sequence of encoding sequence, " nucleic acid construct thing " this term just with term " expression cassette " synonym.The sequence that term " encoding sequence " is defined as being transcribed into mRNA and is translated into polypeptide at this paper.The border of encoding sequence generally is to measure by ATG initiator codon (it is positioned at the upstream of 5 ' end place open reading frame of mRNA just) and Transcription Termination subsequence (it is positioned at the downstream of 3 ' end place open reading frame of mRNA just).Encoding sequence may include but not limited to: genomic, cDNA, RNA, semisynthetic, synthetic, reorganization or its arbitrary combination.

Term " control sequence " is defined as comprising necessary or useful whole components for the expression of heterologous polypeptide at this paper.Every kind of control sequence can be the sequence natural or external source of nucleic acid encoding sequence.Such control sequence includes but not limited to: leader sequence, polyadenylation sequence, propeptide sequence, promotor, signal sequence and transcription terminator.Control sequence comprises promotor and transcription termination signal and translation termination signal at least.Control sequence can provide with joint, thereby promotes this control sequence to be connected with the nucleic acid sequence encoding district of coding heterologous polypeptide in order that introduce the specificity restriction site.Term " is operably connected " and is defined as a kind of configuration at this paper, and wherein, control sequence is suitably placed with respect to the position of the encoding sequence of dna sequence dna so that the production of this control sequence directing heterologous polypeptide.

Control sequence can be suitable promoter sequence, nucleotide sequence (it is expressed the filamentous fungal cells identification of this nucleotide sequence).Promoter sequence comprises the transcriptional control sequence of the expression that mediates heterologous polypeptide.Described promotor can be any nucleotide sequence that shows transcriptional activity in filamentous fungal cells, comprises sudden change, brachymemma and promotor heterozygosis, can get this cell homologous of own coding or allogenic, born of the same parents outer or born of the same parents in the gene of polypeptide.

In the method for the invention, instruct the suitable promotor example of transcribing of nucleic acid construct thing have the promotor of gene of the following enzyme of own coding: aspergillus oryzae TAKA amylase, rice black root Acarasiales (Rhizomucor miehei) aspartate protease, the neutral αDian Fenmei of aspergillus niger, aspergillus niger acid acceptance αDian Fenmei, aspergillus niger or Aspergillus awamori glucoamylase (glaA), rice black root Acarasiales lipase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triose-phosphate isomerase, the Aspergillus nidulans acetamidase, aspergillus oryzae acetamidase (amdS), point sickle spore trypsin-like proteolytic enzyme (United States Patent (USP) 4,288,627), and the sudden change, brachymemma and promotor heterozygosis.Particularly preferred promotor is NA2-tpi promotor (a kind of promotor heterozygote that gets the gene of neutral αDian Fenmei of own coding aspergillus niger and aspergillus oryzae triose-phosphate isomerase), glucoamylase promotor and TAKA amylase promotor.

Described control sequence can also be suitable Transcription Termination subsequence, that is, and and a kind of identification and the sequence that stops transcribing by filamentous fungal cells.This Transcription Termination subsequence is operably connected to 3 ' end of the nucleotide sequence of coding heterologous polypeptide.Any terminator that works in described filamentous fungal cells all can be applied to the present invention.

Preferred terminator gets the gene of the following enzyme of own coding: aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger α Polyglucosidase and sharp sickle spore trypsin-like proteolytic enzyme.

Described control sequence can also be suitable leader sequence, i.e. the untranslated district of mRNA (it is important for the translation by filamentous fungal cells).This leader sequence is operably connected to 5 ' end of the nucleotide sequence of coding heterologous polypeptide.Any leader sequence that works in filamentous fungal cells all can be used for the present invention.

Preferred leader sequence gets the gene of own coding aspergillus oryzae TAKA amylase and Aspergillus nidulans triose-phosphate isomerase.

Described control sequence can also be the polyadenylation sequence, be a kind of such sequence: be operably connected to 3 of described nucleotide sequence ' end, and when transcribing, it is added poly-adenosine residue to the mRNA that transcribes by filamentous fungal cells as a signal identification.Any polyadenylation sequence that works in filamentous fungal cells all can be used for the present invention.

Preferred polyadenylation sequence gets the gene of the following enzyme of own coding: aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase and aspergillus niger α Polyglucosidase.

Described control sequence can also be a signal peptide coding region, and the aminoacid sequence that its coding is connected with the aminoterminal of described heterologous polypeptide and guides coded polypeptide to enter the Secretory Pathway of cell.5 of the encoding sequence of described nucleotide sequence ' end may comprise (the coding region sections with the coding secreted polypeptides in the translation frame is connected a naturally) signal peptide coding region originally.5 of described encoding sequence ' end also may comprise the external source signal peptide coding region of this encoding sequence.If described encoding sequence does not contain signal peptide coding region usually, described external source signal peptide coding region may be required.This external source signal peptide coding region also may only substitute the natural signals peptide-coding region so that reach the enhancing secretion of polypeptide.Yet any signal peptide coding region that instructs the heterologous polypeptide of expressing to enter the Secretory Pathway of filamentous fungal cells all can be applicable to the present invention.

To the effective signal peptide coding region of filamentous fungal host cell is the signal peptide coding region that derives from the gene of following enzyme: aspergillus oryzae TAKA amylase, aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, rice black root Acarasiales aspartate protease, Humicola insolens cellulase and Humicola lanuginosa lipase.

Described control sequence also may be a preceding peptide-coding region, and its coding is positioned at the N-terminal aminoacid sequence of polypeptide.The polypeptide that generates is called as " proenzyme " (proenzyme) or " propolypeptide " [or being called as " proenzyme " in some cases (zymogen)].Propolypeptide generally is an inert, catalysis division or autocatalytically division that can be by propetide and be converted into sophisticated active polypeptide from this propolypeptide.Preceding peptide-coding region can derive from meter black root Acarasiales aspartate protease gene or Myceliophthora thermophila laccase gene (WO95/33836).

If the two all is present in the aminoterminal of polypeptide signal peptide district and propetide district, so, the propetide district is positioned at the aminoterminal of contiguous polypeptide, and the signal peptide district then is positioned at the aminoterminal in contiguous propetide district.

Described nucleic acid construct thing also may comprise one or more nucleotide sequence, this nucleic acid sequence encoding is one or more for the useful factor of the expression of directing heterologous polypeptide, for example, activating transcription factor (such as trans-acting factor), chaperone and processing protease.Any factor that works in filamentous fungal cells all can be applicable to the present invention.The nucleic acid of one or more these factors of coding needn't be connected with the nucleotide sequence of coding heterologous polypeptide.

Also may wish to add and regulate sequence, this regulates the expression that sequence can be regulated the heterologous polypeptide relevant with the growth of filamentous fungal cells.The example of regulation system has those, that is, they cause expression of gene response chemical irritant or physical stimulation thing (comprising the existence of regulating compound) and unlatching or close.TAKA αDian Fenmei promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor can be used as the adjusting sequence.Other example of regulating sequence has those that can make gene amplification, for example, and with the metallothionein gene of heavy metal amplification.In these cases, the nucleotide sequence of coding heterologous polypeptide will operationally be connected with this adjusting sequence.

Above-mentioned various nucleotide sequence and control sequence can be joined together and produce the recombinant expression vector that may comprise one or more suitable restriction sites, and described restriction site can be for the nucleotide sequence that inserts or substitute the coding heterologous polypeptide in such site.The nucleotide sequence of coding heterologous polypeptide also can be expressed by this sequence or the nucleic acid construct thing that comprises this sequence are inserted the suitable carrier be used for expressing.When producing expression vector, encoding sequence is in this carrier, so, this encoding sequence be used to express and can secernent suitable control sequence be operably connected.

Described recombinant expression vector can be any carrier (for example plasmid or a virus), and this carrier can experience DNA reorganization operation easily and can cause the expression of the nucleotide sequence of coding heterologous polypeptide.The selection of this carrier generally will be depended on the consistency of the filamentous fungal cells that this carrier and this carrier are introduced into.This carrier can be shape material grain or closed hoop plasmid.This carrier can be a self-replicating type carrier, that is, a kind of carrier that exists as extrachromosomal entity, duplicating with chromosome duplication of it is irrelevant, for example plasmid, extrachromosomal element, minichromosome or artificial chromosome.Described carrier can comprise any agent that ensures self replication.This carrier also can be such carrier: when introducing filamentous fungal cells, it is integrated into genome and is replicated with karyomit(e) (it has been integrated into this karyomit(e)).Described carrier system can be single carrier or plasmid or two or more carriers or plasmid (they comprise jointly and will be introduced into the genomic all DNA of filamentous fungal cells), or a kind of transposon.

Described carrier preferably comprises one or more selected markers that allows easily to select the filamentous fungal cells that transforms.A kind of selected marker is a kind of gene, and its product can provide biocide or virus resistance, to the resistance of heavy metal, to prototroph of auxotroph etc.The selected marker that is used for filamentous fungal host cell can be selected from the material that includes but not limited to down group: amdS (acetamidase), argB (ornithine carbamyl transferase), bar (phosphinothricin acetyl transferase), hygB (hygromix phosphotransferase), niaD (nitrate reductase), pyrG (Orotidine-5 '-'-phosphate decarboxylase), sC (sulfuric acid adenylic acid (AMP) transferring enzyme) and trpC (o-amino benzoyl acid synthase), and the equivalent that derives from other kind.The preferred selected marker that is applied to filamentous fungal cells is the amdS of Aspergillus nidulans or aspergillus oryzae and the bar gene of pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus).

Described carrier preferably comprises such factor, that is, this factor allow described carrier stable integration go into filamentous fungal cells genome or described carrier in this cell with the irrelevant self-replicating of the genome of this cell.

Carrier introducing filamentous fungal cells so that this carrier that " introducing " expression will comprise nucleotide sequence keep as the chromosomal integration body or as the outer carrier of the karyomit(e) of self-replacation.It has been generally acknowledged that it is useful integrating, and remains in the cell because nucleotide sequence more may be stabilized.Vector integration is gone into karyomit(e) and is taken place by homologous recombination, non-homogeneous reorganization or swivel base.

Expression vector is introduced filamentous fungal cells may relate to a kind of method, this method comprises: by the protoplastis formation of original known mode, the conversion and the cell walls regeneration of protoplastis.The proper operation that transforms the Aspergillus host cell is described in EP238 023 and Yelton etc., and 1984, institute of NAS newspaper (Proceedings of the National Academyof Sciences USA) 81:1470～1474.A kind of appropriate method that transforms chain spore genus is described in by (1989) such as Malardier: gene (Gene) 78:147～156 and WO96/00787.

Just be integrated into the genome of filamentous fungal cells, described carrier may rely on the nucleotide sequence of coding heterologous polypeptide or any other (going into this carrier stable integration genomic by homologous recombination or non-homogeneous reorganization) factor of this carrier.This carrier also may comprise and is used in reference to conducting and crosses homologous recombination and be integrated into the genomic other nucleotide sequence of filamentous fungal cells.This other nucleotide sequence can make vector integration go into chromosomal accurate locational genome.In order to increase the possibility of integrating on the accurate position, conformity gene should preferably comprise the nucleic acid of q.s, for example 100～1,500 base pairs, preferred 400～1,500 base pairs, most preferably 800～1,500 base pairs, they are the height homologous with corresponding target sequence, thereby improve the possibility of homologous recombination.Conformity gene can be with the filamentous fungal cells genome in any sequence of target sequence homologous.In addition, conformity gene can also be a nucleotide sequence non-coding or coding.On the other hand, described carrier can be integrated into the genome of cell by non-homogeneous reorganization.

With regard to self-replicating, described carrier can further comprise a kind of copy source, and it can make this carrier self-replicating in described filamentous fungal cells.

The method that is used to connect the factor described herein and makes up recombinant expression vector be well known to those skilled in the art (referring to for example, J.Sambrook, E.F.Fritsch and T.Maniatus, 1989, " molecular cloning, laboratory manual ", the 2nd edition, Cold Spring Harbor, New York).

In another aspect of this invention, described sudden change filamentous fungal cells may comprise the modification of one or more the third nucleotide sequence in addition, and described nucleic acid sequence encoding may and/or be used deleterious protein to production, the recovery of interested polypeptide.Described modification has reduced or eliminated the expression of one or more the third nucleotide sequence, causes such mutant cell: when cultivating under the same conditions, this mutant cell may be than the more polypeptide of mutant cell production of not modifying the third nucleotide sequence.

The third nucleotide sequence may encode any protein or enzyme.For example, this enzyme can be aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, MUTANASE, oxydase, pectic enzyme, peroxidase, Phospholipid hydrolase, phytase, polyphenoloxidase, proteolytic enzyme, rnase, trans-glutaminases or zytase.The third nucleotide sequence optimized encoding proteolytic enzyme, for example, aminopeptidase, carboxypeptidase or proteolytic enzyme.

The invention still further relates to the method for producing the sudden change filamentous fungal cells, this method comprises:

(A) nucleotide sequence of modification one or more parental generation filamentous fungal cells, this cell has following sequence:

(ⅴ) (ⅰ), (ⅱ) or allelic variant (ⅲ); And

(B) identify the mutant of the nucleotide sequence comprise described modification from step (A).

The invention still further relates to the sudden change filamentous fungal cells that is used to produce polypeptide, this sudden change filamentous fungal cells comprises the modification of second kind of nucleotide sequence of first kind of nucleotide sequence of this polypeptide of coding and one or more time group:

(a) coding has a kind of nucleotide sequence of polypeptide of aminoacid sequence, described aminoacid sequence have at least 50% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5;

(b) have at least 50% with the nucleotide sequence of the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4;

(c) nucleotide sequence, it is hybridized with following material under low stringency: (ⅰ) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (ⅱ) subsequence of (ⅰ) of at least 100 Nucleotide, perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ);

(d) nucleotide sequence of the variant of a coded polypeptide, described polypeptide have the aminoacid sequence of a sequence 2 or sequence 5, described variant comprise one or morely amino acid whosely substitute, disappearance and/or insert;

(e) (a) and (b) or allelic variant (c); And

(f) (a) and (b), (c) or subsequence (e), wherein, this subsequence coding has the polypeptide fragment of DDC2 or DDC3 polypeptide active.

The invention still further relates to isolating DDC2 and DDC3 polypeptide, and by fragment, allelic variant and the variant of nucleic acid sequence encoding described herein.Described isolated polypeptide is selected from down the group material:

(a) have a kind of polypeptide of aminoacid sequence, described aminoacid sequence have at least 50% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5;

(b) by a kind of polypeptide of nucleic acid sequence encoding, described nucleotide sequence is hybridized with following material under low stringency: (ⅰ) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (ⅱ) subsequence of (ⅰ) of at least 100 Nucleotide, perhaps (ⅲ) (ⅰ), (ⅱ) or complementary strand (ⅲ);

(c) have the variant polypeptides of the aminoacid sequence of a sequence 2 or sequence 5, it comprise one or morely amino acid whosely substitute, disappearance and/or insert;

(d) (a) or allelic variant (b); And

(e) (a) and (b) or fragment (d), wherein, this fragment has DDC2 or DDC3 polypeptide active.

Isolating DDC2 of the present invention and DDC3 polypeptide have at least 20%, preferred at least 40%, more preferably at least 60%, further preferred at least 80%, the polypeptide active of preferred at least 90%, most preferably at least 100% sequence 2 or sequence 5 further.

DDC2 and DDC3 polypeptide can derive from fungic origin, more preferably derive from yeast strain, for example candiyeast, Hansenula, genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or Yarrowia bacterial strain; Perhaps filamentous fungal strains, for example Acremonium, Aspergillus, aureobasidium genus, Cryptococcus, Filibasidium, fusarium, Gibberella, Humicola, Magnaporthe, Mucor, myceliophthora, Myrothecium, Neocallimastix, Neurospora, paecilomyces, Penicillium, Piromyces, Schizophyllum, the mould Pseudomonas of basket (Talaromyces), thermophilic ascomycete genus, Thielavia, Tolypocladium or Trichoderma bacterial strain.

In a preferred embodiment, DDC2 polypeptide of the present invention derives from aspergillus oryzae strain, most preferably derives from aspergillus oryzae IFO4177 or its mutant strain, for example, has the polypeptide of the aminoacid sequence of sequence 2.

In another preferred embodiment, DDC3 polypeptide of the present invention derives from aspergillus oryzae strain, most preferably derives from aspergillus oryzae IFO4177 or its mutant strain, for example, has the polypeptide of the aminoacid sequence of sequence 2.

Should understand that as previously mentioned, for above-mentioned bacterial classification, the present invention had both comprised perfect state, comprised the imperfect state again, and the equivalent species of other classification (for example anamorph), no matter what their kind name is.

DDC2 and DDC3 polypeptide can use technical point described herein from." isolating " polypeptide of this paper definition is such peptide species: it does not roughly contain other polypeptide, for example, measure by SDS-PAGE, pure at least about 20%, preferably pure at least about 40%, more preferably from about 60% is pure, and further preferred about 80% is pure, further preferred about 90% is pure, and most preferably from about 95% is pure.

The invention still further relates to isolated nucleic acid sequences, this nucleic acid sequence encoding DDC2 and DDC3 polypeptide and fragment thereof (as described herein such).

In a preferred embodiment, described nucleotide sequence is shown in sequence 1.In another preferred embodiment, this nucleotide sequence is the sequence that is contained among the clay 18H7 (it is contained among the colon bacillus DSM12060).In still another preferred embodiment, this nucleotide sequence is the polypeptid coding area of sequence 1.In still another preferred embodiment, this nucleotide sequence is the polypeptid coding area that is contained among the clay 18H7 (it is contained among the colon bacillus DSM12060).

In another preferred embodiment, described nucleotide sequence is shown in sequence 4.In still another preferred embodiment, this nucleotide sequence is the polypeptid coding area of sequence 4.In still another preferred embodiment, this nucleotide sequence is the sequence that is contained among the clay 34G12 (it is contained among the colon bacillus DSM11924).In still another preferred embodiment, this nucleotide sequence is the polypeptid coding area that is contained among the clay 34G12 (it is contained among the colon bacillus DSM11924).

The invention still further relates to isolating mutant nucleic acid sequence, it is included at least once sudden change in the polypeptid coding sequence of sequence 1 or sequence 4, wherein, and the polypeptide that this mutant nucleic acid sequence encoding is made of sequence 2 or sequence 5 respectively.

Be used to separate or the technology of the nucleotide sequence of clones coding polypeptide is known in the art and has been described at this paper.

The such nucleotide sequence of term " isolated nucleic acid sequences " expression that this paper uses: it does not roughly contain other nucleotide sequence, for example, measure by agarose electrophoresis, pure at least about 20%, preferably pure at least about 40%, more preferably pure, further preferred pure, most preferably pure at least about 90% at least about 80% at least about 60%.For example, isolated nucleic acid sequences can obtain by the standard cloning process, and the standard cloning process is used to nucleotide sequence is relocated the site that it will be reproduced product from its physical slot in genetic engineering.Cloning process may comprise: the excision of required nucleic acid fragment (it comprises the nucleic acid encoding sequence) with separate, this fragment is inserted carrier molecule, and recombinant vectors is incorporated into host cell (will duplicate the many copies or the clone of described nucleotide sequence here).Described nucleotide sequence can be genomic, cDNA, RNA, semisynthetic, synthetic source or its arbitrary combination.

Encode the modification of nucleotide sequence of DDC2 of the present invention or DDC3 polypeptide for may being necessary with DDC2 or the similar polypeptide of DDC3 polypeptide synthetic roughly.The non-natural form of representing described polypeptide about the term " roughly similar " of DDC2 or DDC3 polypeptide.These polypeptide in some through engineering approaches mode with different from isolating DDC2 of its natural source or DDC3 polypeptide, for example, at different variants in aspect such as specific activity, thermostability, best pH.The polypeptide of variation can make up by as described in the preamble.

The invention still further relates to by the following method produce, isolated nucleic acid sequences, promptly, (a) very low severity, low severity, moderate severity, in-a kind of DNA is hybridized with following material under the condition of high severity, high severity, very high severity: (ⅰ) Nucleotide 1014～1151 of sequence 1, (ⅱ) subsequence of (ⅰ), perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ); Perhaps with the hybridization of following material: (ⅰ) Nucleotide 1041～1229 of sequence 4, (ⅱ) subsequence of (ⅰ), perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ); And (b) nucleotide sequence is separated with described DNA.Described subsequence is the sequence of at least 100 Nucleotide preferably, and for example, coding has the sequence of the polypeptide fragment of DDC2 or DDC3 polypeptide active.

The invention further relates to the method for producing the mutant nucleic acid sequence, this method comprises: introduce at least one sudden change in the polypeptid coding sequence of sequence 1 or sequence 4 or its subsequence, wherein, the polypeptide that described mutant nucleic acid sequence encoding is made of sequence 2 or sequence 5 respectively, or it has the fragment of DDC2 or DDC3 polypeptide active.

In nucleotide sequence, introduce sudden change and change a kind of Nucleotide into another kind of Nucleotide and can use any means known in the art and undertaken by site-directed mutagenesis.Particularly suitable be this method: its is used has segmental supercoiled, the double-stranded DNA carrier of interested insertion and two kinds of synthetic primers that comprise required sudden change.This Oligonucleolide primers opposite strand complementation of carrier (separately with) stretches by the pfu archaeal dna polymerase in the temperature cycle process.When mixing described primer, produced the mutant plasmid that comprises stagger.After temperature cycle, with DpnI (it be methylate and hemimethylation DNA specific) handle product and digest the parental DNA template and select to be used to contain the synthetic DNA of sudden change.Also can use other method known in the art.

The invention still further relates to the nucleic acid construct thing, be used for the recombinant expression vector and the host cell of the expression of sequence, they comprise the nucleotide sequence of sequence as described herein 1 or sequence 4, its subsequence or homologue.Described construction and carrier can make up by method described herein.Described host cell can be the arbitrary cell that is fit to the expression of nucleotide sequence, and preferably the fungal cell is more preferably and is selected from described herein group filamentous fungal cells.Term " host cell " comprises the anyon generation of parental cell, and it and parental cell are inequality, and this is because the sudden change that occurs in the reproduction process.Host cell be chosen in gene and the source thereof of depending on coded polypeptide to a great extent.

The invention still further relates to the method for producing DDC2 or DDC3 polypeptide, this method comprises: (a) cultivate a kind of bacterial strain (its wild-type can be produced this polypeptide) helping to produce under the condition of DDC2 or DDC3 polypeptide; And (b) reclaim this polypeptide from substratum.Preferably, described bacterial strain is an Aspergillus, is more preferably the bacterial strain of aspergillus oryzae.

The invention still further relates to the method for producing DDC2 of the present invention or DDC3 polypeptide, this method comprises: (a) cultivate a kind of host cell helping to produce under the condition of DDC2 or DDC3 polypeptide; And (b) reclaim this DDC2 or DDC3 polypeptide from substratum.

In production method of the present invention, use as described herein, methods known in the art culturing cell in being fit to produce the nutritional medium of DDC2 or DDC3 polypeptide.DDC2 that generates or DDC3 polypeptide can be by as described herein, methods known in the art recovery and purifying.Signal peptide

The invention still further relates to the nucleic acid construct thing that comprises a kind of proteinic gene of encoding, described protein is operably connected with a kind of nucleotide sequence, the Nucleotide 981～1040 of the sequence 4 of the signal peptide that the Nucleotide 960～1013 of the sequence 1 of the signal peptide that this nucleotide sequence is made of amino acid/11～18 of sequence 2 coding constitutes or is made of amino acid/11～20 of sequence 5 coding constitutes, wherein, the described nucleotide sequence of described gene pairs is an external source.

The invention still further relates to the recombinant expression vector and the recombinant host cell that comprise such nucleic acid construct thing.

The invention still further relates to the production method of protein, this method comprises: (a) be fit to produce this recombinant host cell of cultivation under this proteinic condition; And (b) reclaim this protein.

Described nucleotide sequence can operationally be connected with foreign gene with other control sequence.Other control sequence so above is being described.

Described protein may be the natural or allogenic protein of host cell.Term " protein " is at this paper and do not mean that the coded product of representing length-specific, so it comprises peptide, oligopeptides and protein.Term " protein " also comprises and merging and two or more polypeptide of formation encoded product.This protein also comprises hybrid polypeptide, this hybrid polypeptide comprises the part that derives from least two kinds of different proteins (wherein, one or more may be the allogenic or natural protein of described host cell) or the combination of peptide sequence completely.Protein further comprises the natural allelic variation and the artificial reconstructed variation of above-mentioned protein and hybrid protein.

Preferably, this protein is hormone, hormone variant, enzyme, acceptor or its part, antibody or its part or reporter molecule.In a more preferred embodiment, this protein is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.In a further preferred embodiment, this protein is aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, MUTANASE, oxydase, pectic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, rnase, trans-glutaminases or zytase.

Described gene can derive from any prokaryotic organism source, eukaryote source or other source.

Further described the present invention by following embodiment (they can not be taken as and limit the scope of the invention).The embodiment raw material

As the pharmaceutical chemicals of buffer reagent and substrate all is the commodity of SILVER REAGENT at least.Embodiment 1: produce CAREZYME by aspergillus oryzae strain HC4.01 and 27 ^TM

By having made up the outer β-1 of production born of the same parents, 4-endoglucanase (CAREZYME as described in the WO91/17243 ^TM) aspergillus oryzae strain.CAREZYME ^TMBe by Novo NordiskA/S, Bagsv  d, the Trichoderma harzianum cellulase that Denmark produces.Select the transformant no.27 (WO91/17243) of the pSX320 among the aspergillus oryzae A1560-T40 to be used for mutagenesis so that produce excellent bacterial strain.By NTG mutagenic treatment transformant No.27, separation has the morphologic bacterial strain of altered flat board.The CAREZYME that in shake flask fermentation and jar fermentation, shows one of bacterial strain that these are called as HC4.01 ^TMProductive rate has increased.When the difference of attempting further to characterize between aspergillus oryzae strain HC4.01 and the no.27, (differential display method) compared the mRNA goods that derive from these two kinds of bacterial strains by the differential explicit representation.

The aspergillus oryzae strain HC4.01 and 27 that grows side by side in 34 ℃, 2 liters of fed-batch fermentation things of pH7,800～1100rpm reaches 5 days, and described fermented product is by Nutriose, yeast extract, MgSO ₄7H ₂O, citric acid, K ₂SO ₄, KH ₂PO ₄, urea, Trimethyl glycine and trace-metal solution composition.

CAREZYME has been measured in the viscosity of 1%CMC solution variation (reducing) during with pH7 ^TMActive (with derive from Novo Nordisk A/S, Bagsv  d, the purifying CAREZYME of Denmark ^TMStandard substance relatively).

At 48 hours, by the CAREZYME of these two kinds of bacterial strains productions ^TMLevel begins different.

Embodiment 2: differential shows

By differential mRNA display analysis the hereditary basis of aspergillus oryzae strain HC4.01 and 27 phenotypic difference.The primer of Ying Yonging is listed in the table 1 in these trials.These primers contain 4 Nucleotide at 5 ' end, then are Hind III restriction enzyme sites.Use oligo (dT ₁₂N ₂) this organizes primer, the mRNA group of described two kinds of clones split into 12 subgroups and has produced cDNA at 48 hours.Use same that group oligo (dT then ₁₂N ₂) primer and one group of random primer further divided this cDNA by pcr amplification.Separate the amplicon that derives from these reactions by denaturing polyacrylamide gel electrophoresis again.Shortage (when comparing footprint side by side) by band in one of swimming lane has been identified the gene that differential is expressed between these two kinds of clones.

The method of describing in modern genetics (CurrentGenetics) 29:395～403 by (1996) such as Wahleithner has prepared RNA at 48 hours frozen bacteria filaments from every kind of clone.(GenHunterCorp., Nashville TN) have removed genomic DNA fragment by manufacturer's indication by the processing of DNA enzyme to use MessageClean Kit.

For every kind of anchor formula dT ₁₂N ₂Primer, in two are independently reacted, the total RNA that 3.75 μ g is derived from aspergillus oryzae strain HC4.01 and 27 mixes with following material: 1.0 μ M primers, synthetic buffer reagent (the Life Technologies of 15 μ l5x, first chain, Gaithersburg, MD), 10 μ M dithiothreitol (DTT) and 20 μ M dNTP (cumulative volume is 75 μ l).Under 65 ℃,,, add 500 SuperScript of unit II in cooling fast on ice with this solution insulation 5 minutes ^TMReversed transcriptive enzyme (LifeTechnologies, Gaithersburg, MD).After 1 hour,, store the first chain samples in insulation under 37 ℃ at-20 ℃ by at 5 minutes stopped reaction of 95 ℃ of following thermal treatment.Table 1. is used for the primer oligo (dT that differential shows reaction ₁₂N ₂) ：A GCGCAAGCTTTTTTTTTTTTCT ( 7 ) B GCGCAAGCTTTTTTTTTTTTCC ( 8 ) C GCGCAAGCTTTTTTTTTTTTCG ( 9 ) D GCGCAAGCTTTTTTTTTTTTGT ( 10 ) E GCGCAAGCTTTTTTTTTTTTGG ( 11 ) F GCGCAAGCTTTTTTTTTTTTGA ( 12 ) G GCGCAAGCTTTTTTTTTTTTAT ( 13 ) H GCGCAAGCTTTTTTTTTTTTAC ( 14 ) I GCGCAAGCTTTTTTTTTTTTAG ( 15 ) K GCGCAAGCTTTTTTTTTTTTAA ( 16 ) L GCGCAAGCTTTTTTTTTTTTCA ( 17 ) M GCGCAAGCTTTTTTTTTTTTGC ( 18 ) ：01 CGGGAAGCTTATCGACTCCAAG ( 19 ) 02 CGGGAAGCTTTAGCTAGCATGG ( 20 ) 03 CGGGAAGCTTGCTAAGACTAGC ( 21 ) 04 CGGGAAGCTTTGCAGTGTGTGA ( 22 ) 05 CGGGAAGCTTGTGACCATTGCA ( 23 ) 06 CGGGAAGCTTGTCTGCTAGGTA ( 24 ) 07 CGGGAAGCTTGCATGGTAGTCT ( 25 ) 08 CGGGAAGCTTGTGTTGCACCAT ( 26 ) 09 CGGGAAGCTTAGACGCTAGTGT ( 27 ) 10 CGGGAAGCTTTAGCTAGCAGAC ( 28 ) 11 CGGGAAGCTTCATGATGCTACC ( 29 ) 12 CGGGAAGCTTACTCCATGACTC ( 30 ) 13 CGGGAAGCTTATTACAACGAGG ( 31 ) 14 CGGGAAGCTTATTGGATTGGTC ( 32 ) 15 CGGGAAGCTTATCTTTCTACCC ( 33 ) 16 CGGGAAGCTTATTTTTGGCTCC ( 34 ) 17 CGGGAAGCTTATCGATACAGG ( 35 ) 18 CGGGAAGCTTTATGGTAAAGGG ( 36 ) 19 CGGGAAGCTTTATCGGTCATAG ( 37 ) 20 CGGGAAGCTTTAGGTACTAAGG ( 38 )

Use each primer (240 different primers to) have been caused pcr amplification reaction in triplicate about contrast RNAs and mutant rna s.Amplified material is made up of following material: 1.0 μ l cDNA reactants, 2.0 μ l 10x PCR buffer reagent [500mM KCl; 100mM Tris-HCl (pH9.0); 15mM MgCl ₂1% (w/v) gelatin; 1% (v/v) Triton X-100], 1.5 μ l 25mM dNTP, 2.5 μ l 10mM, 5 ' arbitrary primer, 1.25 μ l 1OmM are rich in the primer of T, 0.15 μ l ³²P-dATP (2000 Ci/mM, New England Nuclear-DuPont, Boston, MA), and 2.5 Taq of unit archaeal dna polymerases (Perkin-Elmer Corp., Brahchburg NJ), use H ₂O adjusted volume to 20 μ l.Using thermal cycler reacts by follow procedure: 98 ℃ once circulated 10 seconds; Four circulations are at every turn 94 ℃ 30 seconds, 42 ℃ 60 seconds and 72 ℃ 30 seconds; And 25 circulations, at every turn 94 ℃ 30 seconds, 60 ℃ 60 seconds and 72 ℃ 30 seconds.

Sex change in methane amide order-checking dye solution such as separatory such as grade with each PCR reaction of 3.5 μ l separates on 6% polyacrylamide, 7M urea sequencing gel.Be adjacent row (in order to compare the band banding pattern) three parts of contrasts of electrophoretic process PCR reactant and derive from a sudden change PCR reactant that primer is right.Desiccant gel on Whatman 3M paper, (fluorescent rulertape) carries out mark to orientation with fluorescence scale band, is exposed to one night of medical X mating plate.The not utilization part freezing fragment that is used under-20 ℃ that differential is shown reaction is screened.

Use the vestige of described fluorescence scale and calibrate described film and gel.The band that the mark differential shows also excises from gel with scalper.This gel slice (comprising Whatman filter paper) was at room temperature soaked 10 minutes, in 1.5ml Eppendorf Eppendorf tube, in 95 ℃ 0.1ml water, be incubated 15 minutes then.Use the DNA of 10 μ l 3M sodium acetates, 5 μ l 10mg/ml glycogens and 0.45 μ l, 100% alcoholic acid solution precipitation wash-out.This DNA sheet is resuspended in the 10 μ l water, use initially be used to the same primers as that increases to under above-mentioned identical condition (but using 60 ℃ of annealing temperatures) heavily increase and 40 take turns PCR.

The band of pcr amplification is connected into pCR2.1 (Invitrogen, La Jolla, CA), this pCR 2.1 has pressed scheme that Hadjeb and Berkowitz (1996) describe with EcoRV linearizing and TA-tailing in biotechnology (Biotechniques) 20:20～22.Connector is transformed into competence colon bacillus DH5 α cell, selects to screen the colony of generation by the agarose plate blue/white that comprises X-gal (5-bromo-4-chloro-3-indyl-β-D-galactopyranoside).For the fragment that every kind of differential shows, it is for further analysis to select six colonies.Embodiment 3: the segmental screening that differential shows

Make each group growth in the 3ml Luria nutrient solution of having added 100 μ g Ampicillin Trihydrate/ml (1% tryptone-0.5% yeast extract-0.5% sodium-chlor) of six groups of colonies describing among the embodiment 2.Pass through centrifugal collecting cell.The cell sheet is resuspended in the 10mM EDTA-50mM Tris-HCl buffer reagent (pH8.0) that 0.3ml contains l00 μ g RNA enzyme A/ml, by then adding 0.3ml 1% SDS-200mM NaOH dissolving.After at room temperature being incubated 5 minutes, add 0.3ml 2.0M potassium acetate (pH5.5).By 15,0000xg (4 ℃) is centrifugal 10 minutes clarification lysates down.Supernatant liquor is gone to Eppendorf tube, add the 0.7ml Virahol then and make the DNA precipitation.By 15,000xg (4 ℃) collected this DNA down in centrifugal 15 minutes.Centrifugal film is resuspended among the 1mM EDTA-10mM Tris-HCl (pH8.0) of 0.1ml, stores sample down at-20 ℃.

The preliminary screening cloned sequence is used for expressing by the differential of hybridizing the initial PCR reaction (in the part of not utilizing of-20 ℃ of described reactants of storing down) of returning them again.Use H ₂O uses the slot blot device then and is coated onto on the double-layer nylon film with the DNA of dilution in 1: 20 from each colony preparation.Each duplicature carry four kinds of self-applications independently primer to those segmental clones of identifying the fragment of the swimming lane excision that comprises the amplicon that derives from oligo E and primer 01,03,06 and 08 (that is, from).In 80 ℃ vacuum drying oven,, hybridize down in high stringency (50% methane amide, 6xSSC, 42 ℃) then film baking 1～2 hour.The hybridization probe that is used for a filter comprises the product of sex change, and this product gets self-application cDNA and four kinds of primer triple responses to increasing corresponding to screened colony from mutant strain; With regard to another filter, cDNA is from contrast bacterial strain synthetic.If colony gets self-application oligo D and primer 01,03,06 and 08 and the aspergillus oryzae HC4.01 cDNA fragment of producing, just those PCR reactants are added in the hybridization mixture.Among 0.5xSSC under 65 ℃, the 0.1%SDS film washing once (is reached 15 minutes), (Molecular Dynamics, Sunnyvale CA) go up analysis at Phosphor Imager.If fragment from aspergillus oryzae HC4.01 cDNA rather than aspergillus oryzae 27 cDNA amplification, is just only returned clone hybridization aspergillus oryzae HC4.01 PCR reaction.To meet that original differential shows, only the clone with the hybridization of one of described two kinds of probes stores, their insertion fragment is used as the probe of Northern in analyzing.

Rna blot analysis is to carry out about the electrophoretic method of formaldehyde gel by (1982, " molecular cloning, laboratory manual ", Cold Spring Harbor Press, Cold Spring Harbor, New York) such as Maniatis.The filter that will comprise the total RNA that derives from aspergillus oryzae strain 27 and HC4.01 respectively is at high stringency (50% methane amide, 6xSSC, 42 ℃) to hybridize with the DNA of radiolabeled sepharose purifying down, this DNA derives from those clones who is positive after preliminary slot blot screening.This DNA be use α [32P] dCTP (Amersham, Arlington Heights, IL) by nick translation (Maniatis, above) radiolabeled, and with about 1 * 10 ⁶The activity of cpm/ml buffer reagent is added in the hybridization buffer.

Two kinds of different insertion fragments show differential hybridizations, wherein, and they and aspergillus oryzae 27 RNA and do not hybridize with aspergillus oryzae HC4.01 RNA.These plasmids are called as pToC367 (insert fragment and be called as DDC2) and pToC370 (insert fragment and be called as DDC3).The cDNA clone of embodiment 4:DDC2 and DDC3 separates and sign

At ABI automated DNA sequenator (Applied Biosystems, Foster City, CA) upward the DDC2 that derives from pToC367 is inserted fragment (approximately 250bp) order-checking and obtains a part of cDNA sequence by manufacturer's indication, it comprises one section adenosine residue (promptly, be positioned at so-called " the polyA tail " of an end, indicate this gene transcription direction).

Synthesized double-stranded cDNA by following scheme.In order to produce the first chain cDNA, adding cumulative volume in 1.0 μ g derive from total RNA of aspergillus oryzae 27 (the 2nd day) is the 1mMCapSwitch of 5 μ l ^TMOligonucleotide (Clontech, Palo Alto, CA) and 1mM (CDS/3 ' PCR primer [Oligo (dT) ₃₀N ₁N, and N ₁=A, C or G] (Clontech, Palo Alto, CA), 72 ℃ of down insulations 2 minutes, then chilling on ice 2 minutes.In microcentrifuge (microfuge) with centrifugal 30 seconds of reactant, add following material then: the synthetic buffering of 2.0 μ l 5x, first chain transcriptase (Life Technologies, Gaithersburg, MD), 1.0 μ l 20mM dithiothreitol (DTT), 1.0 μ l 10mM dNTP and 200 SuperScript of unit ^TMThe II reversed transcriptive enzyme (Life Technologies, Gaithersburg, MD).After 1 hour, store this cDNA down in insulation under 42 ℃ at-20 ℃.The second chain cDNA prepares by pcr amplification, wherein, 2 μ l, the first chain reaction thing is mixed with following material: 10 μ l 10x PCR buffer reagents, 2 μ l 10mM dNTP, 2 μ l, 5 ' PCR primer, 2 μ l CDS/3 ' PCR primers and 2 μ l 50x Advantage KlenTaq polysaccharase mixtures (Clontech, PaloAlto, CA).Increase by follow procedure in thermal cycler: 95 ℃ once circulated 1 minute; 20 circulations are at every turn 95 ℃ of 15 seconds and 68 ℃ 5 minutes.

Based on the insertion fragments sequence information that derives from pToC367, synthesized the specific oligonucleotide of a kind of DDC2 and be used to separate the cDNA clone.Described primer is with the direction orientation opposite with gene transcription.This primer has following sequence: 26186:CATCTCATTATCAGCCATTCC (sequence 39)

Based on the insertion fragments sequence information that derives from pToC370, synthesized the specific oligonucleotide of a kind of DDC3 and be used to separate the cDNA clone.Described primer is with the direction orientation opposite with gene transcription.This primer has following sequence: 26183:CCCAACATACCCGGAAATCG (sequence 40) 26184:GCGGGTGGTTCGGGAACACC (sequence 41)

With primer 2 6186 (DDC2) with derive from CAP Finder Kit (5 ' primer CA) has carried out the PCR reaction to aspergillus oryzae no.27 cDNA for Clontech, PaloAlto.30 PCR circulations (annealing temperature is 60 ℃) have been operated.5 ' primer is the part of CAP Finder Kit, 5 ' end hybridization of the cDNA that it will produce with this test kit.Obtained the fragment of about 400bp.

In order to obtain DDC3 PCR product, carried out nested PCR.(Clontech, Palo Alto, 5 ' primer CA) have operated first PCR reaction and have reached 30 circulations (annealing temperature is 60 ℃) with deriving from CAP Finder Kit with primer 2 6183.5 ' primer is the part of Clontech CAP Finder Kit, 5 ' end hybridization of the cDNA that it will produce with this test kit.With the five equilibrium sample of a this PCR reaction as with the template of the new reaction of primer 2 6184 and 5 ' CAPFinder primer.Operate this reaction once more and reach 30 circulations (annealing temperature is 60 ℃).In second PCR reaction, obtained the fragment of about 400bp.

These fragments are cloned into pCR II carrier (Invitrogen, San Diego CA) by oneself and on ABI automated DNA sequenator by manufacturer's indication order-checking.The DDC2 full length cDNA sequence that obtains and the aminoacid sequence of deduction are shown in sequence 3 and sequence 2 respectively.The DDC3 full length cDNA sequence that obtains and the aminoacid sequence of deduction are shown in sequence 6 and sequence 5 respectively.

By Testcode and Codonpreference (Genetics ComputerGroup, Inc., Madison, coding region Computer Analysis WI) and the translation of the cDNA of DDC2 enlightened the open reading-frame (ORF) of 64 amino acid whose polypeptide of coding (sequence 2) and the open reading-frame (ORF) that the translation of the cDNA of DDC3 has been enlightened 83 amino acid whose polypeptide of coding (sequence 5).Program Sigcleave (Genetics Computer Group, Inc., Madison WI) has indicated that this enlightens described polypeptide and has been secreted about 18 amino acid whose secretion signals of DCC2 polypeptide existence with about 20 amino acid whose secretion signals of DCC3 polypeptide existence.

The DDC3 polypeptide comprises three 18 amino acid whose following sequence: DDGAIRIPVKGVPEPEKR of multiple (sequence 5).Repeat to show the deviation at the C end for the third time, wherein, latter two amino acid in this repetition is Lys and Arg.Known this two bases site (dibasicsite) is the division site of the kex2 proteolytic enzyme that relates in the maturation of secreted protein in yeast and the fungi.Gene structure enlightenment, DDC3 a kind of protein of encoding, this protein is secreted and is processed to may 3 little peptides.The structure of the alpha factor gene of the similar yeast saccharomyces cerevisiae of gene structure of DDC3 (Kurjan etc., 1982, cell (Cell) 30:933～943).

The aminoacid sequence (being respectively sequence 2 and 5) of the deduction of DDC2 and DDC3 polypeptide is contrasted with the sequence among the Genebank by various search rule systems (search algorithms), described search rule system is for example: Fasta (Lipman and Pearson, 1988, institute of NAS newspaper, 85:2444) and Blast (Altschul etc., 1990, molecular biology magazine 215:403).Do not find homologue.Embodiment 5:DDC2 separates with the DDC3 genomic clone

(IL) (Sambrook etc., the above) cDNA of radio-labeling DDC2 clone is with about 1 * 10 by nick translation for Amersham, Arlington Heights to use α [32P] dCTP ⁶The activity of cpm/ml buffer reagent is added in the hybridization buffer, with the probe of doing the cosmid library of aspergillus oryzae IFO4177.This cosmid library is to use SuperCosl Cosmid VectorKit (Stratagene, La Jolla CA) make up by manufacturer's indication.

The genomic dna that has prepared aspergillus oryzae IFO4177 by standard method (Christensen etc., 1988, biotechnology (Biotechnology) 6:1419～1422) from protoplastis.After this protoplastis separated, by LabofugeT (Heto, Denmark) in, under 2500rpm, made their slabbings in centrifugal 5 minutes.Then centrifugal film is suspended in 10mM NaCl, 20mM Tris-HCl (pH8.0), 1mM EDTA, 100 μ g/ml Proteinase Ks and 0.5%SDS (described in the specification sheets of SuperCosl Kit).Carry out all the other steps that this DNA prepares by manufacturer's indication that this test kit is appended.Use CHEF-gel device (BioRad Laboratories, Hercules, CA) size by this genomic dna of electrophoretic analysis.In the time of 200 volts, walk 1% sepharose and reach 20 hours with 10～50 seconds pulse.Should gel-colored and photograph with ethidium bromide.Find this DNA size from about 50 to greater than 100kb.Partly digest this DNA with Sau3A.The size of measuring the dna digestion that obtains by the CHEF-gel analysis method of above-mentioned same type is 20～50kb.Indication by the manufacturer has prepared the banded SuperCosl clay of CsCl gradient.Connect equally and pack by manufacturer's indication.After the titration in this library, once connect deriving from and whole packing mixts of packing be transfected into colon bacillus XL1-Blue MR (Stratagene, La Jolla, CA) and be layered on the LB plate of having added 50 μ g Ampicillin Trihydrate/ml.About 3800 colonies have been obtained.

The clay goods that derive from ten colonies show the insertion fragment that all has desired size.Select these colonies one by one, inoculation goes into to contain in the micro titer plate well of Luria Broth substratum that 100 μ l have added 100 μ g Ampicillin Trihydrate/ml, cultivates a night down at 37 ℃.In every hole, add 100 μ l, 50% glycerine, freezing whole libraries under-80 ℃.Totally 3822 colonies have been stored.This represents about 4.4 times of amplification aspergillus oryzae genomes.

With whole libraries with high-density put nylon membrane (GenomeSystems, Inc., St.Louis, MO) on.Down will in high stringency (2 * SSC, 65 ℃) ³²The DDC2 cDNA of P mark and clay 18H7 hybridization.Down will in high stringency (2 * SSC, 65 ℃) ³²The DDC3 cDNA hybridization and the clay 34G12 of P mark show strong hybridization signal.

18H7 has prepared plasmid DNA from clay, uses the indication order-checking of following primer (these two kinds of primers all are contained in the cDNA sequence) by the manufacturer: 30982:TGCAGATCTCCTGGTTTGCC (sequence 42) 30983:CTCCCTAAGGAATGCAAATGG (sequence 43) on ABI automated DNA sequenator

Also prepared plasmid DNA from clay 34G12, use on ABI automated DNA sequenator from the following primer of cDNA sequence preparation and check order by manufacturer's indication: 30984:CCATGAAGCTCTTCTCTACC (sequence 44) 30985:CTATTTCTCAGCGGGTGGTTCG (sequence 45) has synthesized new primer so that obtain further upstream and downstream sequence.

Be shown in Fig. 1 (being respectively sequence 1 and 2) and Fig. 2 (being respectively sequence 4 and 5) respectively about the genomic nucleic acid sequence of the generation of DDC2 and DCC3 and the aminoacid sequence of deduction.Embodiment 6: about the structure of the disappearance plasmid of DDC2

For the plasmid of the disappearance of DDC2 gene in aspergillus oryzae design is to make up like this: by the 1kb sequence clone in the downstream of the 1kb sequence of the upstream of initiator codon and terminator codon is gone into the carrier that separates by aspergillus oryzae pyrG gene.

Using clay 18H7 is that template utilizes following primer to obtain 5 ' fragment by PCR: 102012:GAAGATCTTGGGGGCAGTCAGTGACGGG (sequence 46) 102013:TCCCCCGGGTATGATTTGATTAGGATG (sequence 47)

Using clay 18H7 is that template utilizes following primer to obtain 3 ' fragment by PCR under above-mentioned identical condition: 102014:TCCCCCGGGAGTGTTATTAATAAGGAGG (sequence 48) 102015:TGCACTGCAGGTATCTGTATCCCAGTCAGC (sequence 49)

With restriction enzyme Sma I and Bgl II cutting 5 ' PCR fragment, the fragment of cutting again from the sepharose purifying.With Sma I and Pst I cutting 3 ' PCR fragment, again from sepharose purifying restricted fragment.This 5 ' fragment and 3 ' fragment cloning are gone into pICl9H (Marsh etc., 1984, gene 32:481～485) with Bgl II and Pst I restriction enzyme digestion.With the plasmid that the cutting of Sma I generates, use alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN) dephosphorylation again.The 3.5kb Hind III fragment that will comprise aspergillus oryzae pyrG gene is separated with pJaL335 (PCT/DK 96/00528), and (Promega, Madison is WI) with dNTP insulation becoming flush end by the Klenow fragment with archaeal dna polymerase.These two fragments are connected and generation plasmid pToC391 as shown in Figure 3.PToC391 can be used to transform aspergillus oryzae pyrG after the linearizing of Pvu I ^-Bacterial strain and production transformant (wherein, DDC2 gene by pyrG gene substitution).Such DDC2 mutant strain can for example be analyzed by Southern or find by the PCR method.This DDC2 mutant strain can be used as the expressive host of any heterologous protein.Isolating like this DDC2 mutant strain can be by selecting that the resistance of fluororotic acid (fluororonic acid) is become pyrG ^-(being) because the 400bp on pJaL335 repeats flank pyrG gene.Embodiment 7: about the structure of the disappearance plasmid of DDC3

For the plasmid of the disappearance of DDC3 in aspergillus oryzae design is to make up like this: the sequence clone of about 1kb in the sequence of about 1kb of upstream from start codon and terminator codon downstream is gone into carrier (wherein, two insert fragments separated by aspergillus oryzae pyrG gene).

Clay 34G12 does not contain enough upstream sequences that can make up the disappearance plasmid.In order to clone more upstream sequence, used inverse PCR.With ³²The DDC3 probe of P mark is analyzed the Southern of the genomic dna that derives from aspergillus oryzae IFO4177 (parental strain of aspergillus oryzae A1560-T40) and has been disclosed about 2.5kb Nsi I fragment.With Nsi I digested genomic dna, connect, be used as the template of the inverse PCR of using following primer: 30985:CTATTTCTCAGCGGGTGGTTCG (sequence 45) 101449:CTCTATGTAACCAACTCCTGC (sequence 50) then

Obtained the fragment of desired size (2.3kb), it has been cloned into carrier pCR II (Invitrogen, San Diego CA).On ABI automated DNA sequenator to this sequencing fragment.

Sequence information is used to the primer of the described disappearance plasmid of design construction.It is as follows to be used to obtain 5 ' segmental primer: it is as follows that 116497:CGAAAGCTTACTCTCTGGAACAGG (sequence 51) 118141:CATGGAGCTCGATGGCCAAATGACTGATTCC (sequence 52) is used to obtain 3 ' segmental primer: 116494:GACACTCGAGTAAGATATGCTGCAGAC (sequence 53) 116495:CATAAGCTTTCGAGTGATAATGTCTTGG (sequence 54)

Use IFO4177 genomic dna (as template) and primer to 116497/118141 or primer carried out two PCR to 116494/116495 and reacted.With restriction enzyme Sac I and Hind III cutting 5 ' fragment, with restriction enzyme Hind III and Xho I cutting 3 ' fragment, from these two cutting fragments of sepharose purifying.With this fragment cloning go into carrier pBluescript with Sac I and Xho I restriction enzyme digestion (Stratagene, La Jolla, CA).With the plasmid that Hind III cutting generates, use again alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN) dephosphorylation, then with the 3.5kb Hind III fragment of pJaL335 (PCT/DK 96/00528) of self-contained pyrG gene is connected.These two fragments connect and generation plasmid pToC401 (as shown in Figure 4).PToC401 can be used to transform aspergillus oryzae (pyrG by the linearizing of Sac I ^-) bacterial strain and production transformant (wherein, DDC3 gene by pyrG gene substitution).Such mutant strain can for example be analyzed by Southern or find by the PCR method.This DDC3 mutant strain can be used as the expressive host of any heterologous protein.Can be by the isolating DDC3 mutant strain of this method by selecting that the resistance of fluororotic acid is become pyrG easily ^-(being) because the 400bp on pJaL335 repeats flank pyrG gene.

The preservation of biomaterial

Following biomaterial is deposited in Germany microbial preservation center by the clause of budapest treaty, Mascheroder Weg 1b, D-38124 Braunschweig, Germany is given following registration number: preservation thing registration number preservation date colon bacillus DH5 α+clay 18H7 DSM12060 colon bacillus DH5 α on March 3rd, 1998+clay 34G12 DSM11924 on January 19th, 1998

The preservation of this bacterial strain, but must guarantee that the people who is determined by patent and the official of trademark office (he is qualified by 37C.F.R. ξ 1.14 and 35 U.S.C. ξ 122) can obtain this culture during this patent application is uncertain.This preservation thing is the pure basically culture of this preservation strain.(the submitted country of correspondence application of this subject application or its son application therein) when requiring, can obtain this preservation thing when the foreign patent method.But should be understood that can obtain a preservation thing do not constitute the permission of implementing the invention of this theme abolished action by government awards patent right.

Described herein and the claimed scope that the invention is not restricted to specific embodiments disclosed herein is because these embodiments are as the elaboration to several aspects of the present invention.Any suitable embodiment all should belong to scope of the present invention.In fact, describe as can be known from the front, except shown in this paper with describe all be conspicuous to those skilled in the art to various modifications of the present invention.Such modification also should belong to the scope of appended claims.Under the situation of conflict, the definition that the disclosure comprises will play dominating role.

This paper has quoted various reference, and it is for referencial use that they incorporate this paper into its whole disclosure.

Sequence table

<110>Jill?Wahleithner

Tove?Christensen

＜120〉method of production polypeptide in filamentous fungal mutant cells

<130>5187.404-WO

<140>To?Be?Assigned

<141>1999-05-14

<160>54

<170>FastSEQ?for?Windows?Version?3.0

<210>l

<211>2011

<212>DNA

＜213〉aspergillus oryzae

<220>

＜223〉n=a, c, g, or t

<400>1atgttcggaa?atggtagttg?ggggcagtca?gtgacggggc?aacggcgaga?agaggtggca 60gaaataaacg?gagacatgat?atcgacgaag?caaagctttc?ttatagtcat?tgtagattca 120tggcagttga?agtagaaccc?gatcttttaa?gactgcatac?ctgcgataat?cacgaccaaa 180atataagaga?tcatggagcg?gaagataaat?gggtaggaag?atagctgcag?cgcacattat 240cacaggtgaa?caaatcctgg?cagaaggttc?aatcctccac?ttcaattcct?aggtgtttgc 300acatggcgtc?caatcctgtt?tgtgattggc?atagttggag?gtgtctcagc?ccatatccaa 360taatcgaatg?gggcttacgc?aagcttctca?ttgtcgagta?acacagaagg?atatccttgg 420ttgaaatttg?gccctgtacg?acaagccttt?gaagcgtaag?cctaaattga?ggtcgagatc 480aaccctaata?aacccttcgg?agcttaccca?accactcaag?ctgatcacac?ggggatcaaa 540gatagtaacg?tgtgatacaa?catagctact?cagaagcttg?gtcgaagagg?taattgaggc 600aattggacac?aggccatcgg?ggcaaggtta?ctccagggaa?aagttgacat?ggctgcctag 660agcactaccg?ggcgtgcgga?gaaagaatgg?gaaacggagg?aaaaacaaca?aagactgaca 720gtgaaattca?gggtccaggg?gaaagggaat?ggttgaagtc?atcagtgagt?gcataaatac 780tcctcgtctt?cccctctcct?gctggtcaca?caggagaatc?atcagtcccc?atccctcatt 840tttatcttca?ggctcgtcca?catcttcatt?tcctatctct?accatcgttt?caactatcaa 900cgcgaaggcc?ttctctattc?tgaacatcct?aatcaaatca?tacccaacct?tcattaaaca 960tgcagatctc?ctggtttgcc?gtcatggcag?ttctgttcac?tgccgtcgca?gccaaatcga 1020gcgcaaccac?tacgactagt?gctgctacta?cttcggccaa?agaaagctct?acttcggctt 1080ctactaagcc?aactaagaat?gcagctgctg?gaaatgccct?gaacaatcca?tttgcattcc 1140ttagggagtt?gtaagatgat?ctggtcaggt?acgtcaaagg?tcgatatggc?ttgactgtac 1200caaggccact?gacattccta?gagtacaacg?aggcattgat?gacaaggagt?gttattaata 1260aggaggaaga?agaggggaat?ggctgataat?gagatgaggg?acagcccact?gttccaatac 1320cctggatctg?gcataccctg?atcgtttccc?agatcccagt?atttcaggca?gggcgaggct 1380tgtcagatga?cggggcaatg?cctttctttg?gactcgagta?atgtattgta?cggaggaagg 1440ggtagtccag?ttaatcttca?gttttgcttt?tcctatgaac?attgtcagtg?tgattgtagt 1500ctaagcctan?aagccatggc?cttccttgta?acgatctgat?gcggcatgtt?ataatacttt 1560ctcttgcttg?gtgatccact?cttcttgtcc?attggggata?tccnnttgcc?tttttgagct 1620cacgggacat?accgtccgga?tcatggtagt?attcaggcgt?tggtactgag?agaaggtcca 1680agaatcaaga?gacgagaatt?cagttgtaga?agtgtcacaa?agaggctgaa?atcccgactt 1740aacaatacaa?agatggcaag?agagacaaag?atgaacgtcc?agtacaaggg?atccaacaat 1800cctacagaca?tcctcccact?ttcacataca?agtcaactgc?tctttaatga?accacatcta 1860agcatacaat?ggagcagaag?aaacaattaa?caagaccaac?aaagtccact?taacaatcag 1920aatagatcaa?gaaggcgata?ctanaaccaa?gataaatata?aaatagaaac?tccttaatac 1980ccgaaaagat?aaataatcaa?tgtgcaggcc?t 2011

<210>2

<211>64

<212>PRT

＜213〉aspergillus oryzae

<400>2Met?Gln?Ile?Ser?Trp?Phe?Ala?Val?Met?Ala?Val?Leu?Phe?Thr?Ala?Val1 5 10 15Ala?Ala?Lys?Ser?Ser?Ala?Thr?Thr?Thr?Thr?Set?Ala?Ala?Thr?Thr?Ser

20 25 30Ala?Lys?Glu?Set?Ser?Thr?Ser?Ala?Ser?Thr?Lys?Pro?Thr?Lys?Ash?Ala

35 40 45Ala?Ala?Gly?Ash?Ala?Leu?Asn?Ash?Pro?Phe?Ala?Phe?Leu?Arg?Glu?Leu

50 55 60

<210>3

<211>608

<212>DNA

＜213〉aspergillus oryzae

＜400〉3acacaggaga atcatcagtc cccatccctc atttttatct tcaggctcgt ccacatcttc 60atttcctatc tctaccatcg tttcaactat caacgcgaag gccttctcta ttctgaacat 120cctaatcaaa tcatacccaa ccttcattaa acatgcagat ctcctggttt gccgtcatgg 180cagttctgtt cactgccgtc gcagccaaat cgagcgcaac cactacgact agtgctgcta 240ctacttcggc caaagaaagc tctacttcgg cttctactaa gccaactaag aatgcagctg 300ctggaaatgc cctgaacaat ccatttgcat tccttaggga gttgtaagat gatagtacaa 360cgaggcattg atgacaagga gtgttattaa taaggaggaa gaagagggga atggctgata 420atgagatgag ggacagccca ctgttccaat accctggatc tggcataccc tgatcgtttc 480ccagatccca gtatttcagg cagggcgagg cttgtcagat gacggggcaa tgcctttctt 540tggactcgag taatgtattg tacggaggaa ggggtagtcc agttaatctt cagttttgct 600tttcctat 608＜210〉4＜211〉1727＜212〉DNA＜213〉＜400〉4agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 60actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 120tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaacacg ggataatacc 180gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 240ctctcaagga tcttaccgct gttgagatcc agtttcgatg taacccactc gtgcacccaa 300ctgatcttca gcatctttta ctttcaccag cgtttctggt gagcaaaaac aggaaggcaa 360aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 420tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 480tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 540gacgtctaag aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg 600ccctttcgtc ttcaagaatt cgcggccgca attaaccctc actaaaggga tcacagtatg 660tctagcaggg attatcccct ccctagatac tacccctcat tttgagatag ggaagagggg 720tatctcaaga tgactcctaa ttcgtctaga acgcacggta gttcctccag cctcgctgga 780taaagagggc caagatgtcc ggaggggggt tggatgtctc cagtatccga gggaaatgtc 840aaacagggat gcaggatacg cgaaggacga aagtctgagt ctatacatag tcctcactat 900tccctgaaac tctcaacccg ataactattc ctccccaaac aatctaccat tgccatatcc 960cttcacgtta aacaaaaacc atgaagctct tctctaccat ccttcaaggc atcactatct 1020tcgccgcctt cgcatcggcg atccctctgt ctctccgctc accagacgac ggtgcgatta 1080gaatccccgt gaagggtgtc ccagagcctg agaaacgcga tgacggtgcg atccgcattc 1140cggtaaaggg tgtccctgag cccgagaaac gggatgatgg agctatcagg attcctgtga 1200agggtgttcc cgaaccaccc gctgagaaat aggaagttgt ggtgagtgca acatccgctt 1260tcgagtgata atgtcttgga gaggtactgt gacacgtgga actgttcatg ttccggctgt 1320gtagctgttc ttccggttcg gatttgctta tgtgagtgac ttgcaggcta catgaaacga 1380tttccgggta tgttgggtat tcgaccatga ttttctttga gttatgggat cagggaagat 1440atgccgcgct acgctatctt ttttaaggca tgctagtgtt tagtaagggt acagataaaa 1500acgcaaaata aattttcgtc ctatgattcc ctccagtggt caacagaatg agccataact 1560accagtaagg aaatagtacg gcgaggaaaa cgcctgtatt ctagtctcag aagcgagaaa 1620aagaatcctt tgtatggaac aatggggaat cccccgggtg gtaccctttt aggaattgaa 1680ccctaaactt aaataatcaa atttaatctc tacttctcac tgcgcct 1727

<210>5

<211>83

<212>PRT

＜213〉aspergillus oryzae

<400>5Met?Lys?Leu?Phe?Ser?Thr?Ile?Leu?Gln?Gly?Ile?Thr?Ile?Phe?Ala?Ala1 5 10 15Phe?Ala?Ser?Ala?Ile?Pro?Leu?Set?Leu?Arg?Ser?Pro?Asp?Asp?G1y?Ala

20 25 30Ile?Arg?Ile?Pro?Val?Lys?Gly?Val?Pro?Glu?Pro?Glu?Lys?Arg?Asp?Asp

35 40 45Gly?Ala?Ile?Arg?Ile?Pro?Val?Lys?Gly?Val?Pro?Glu?Pro?Glu?Lys?Arg

50 55 60Asp?Asp?Gly?Ala?Ile?Arg?Ile?Pro?val?Lys?Gly?Val?Pro?Glu?Pro?Pro65 70 75 80Ala?Glu?Lys

<210>6

<211>575

<212>DNA

＜213〉aspergillus oryzae

<400>6atccgaggga?aatgtcaaac?agggatgcag?gatacgcgaa?ggacgaaagt?ctgagtctat 60acatagtcct?cactattccc?tgaaactctc?aacccgataa?ctattcctcc?ccaaacaatc 120taccattgcc?atatcccttc?acgttaaaca?aaaaccatga?agctcttctc?taccatcctt 180caaggcatca?ctatcttcgc?cgccttcgca?tcggcgatcc?ctctgtctct?ccgctcacca 240gacgacggtg?cgattagaat?ccccgtgaag?ggtgtcccag?agcctgagaa?acgcgatgac 300ggtgcgatcc?gcattccggt?aaagggtgtc?cctgagcccg?agaaacggga?tgatggagct 360atcaggattc?ctgtgaaggg?tgttcccgaa?ccacccgctg?agaaatagga?agttgtggct 420acatgaaacg?atttccgggt?atgttgggta?ttcgaccatg?attttctttg?agttatggga 480tcagggaaga?tatgccgcgc?tacgctatct?tttttaaggc?atgctagtgt?ttagtaaggg 540tacagataaa?aacgcaaaat?aaattttcgt?cctat 575

<210>7

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>7gcgcaagctt?tttttttttt?ct 22

<210>8

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>8 22gcgcaagctt?tttttttttt?cc

<210>9

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>9 22gcgcaagctt?tttttttttt?cg

<210>10

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>10 22gcgcaagctt?tttttttttt?gt

<210>11

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>11 22gcgcaagctt?tttttttttt?gg

<210>12

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>12 22gcgcaagctt?tttttttttt?ga

<210>13

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>13 22gcgcaagctt?tttttttttt?at

<210>14

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>14gcgcaagctt?tttttttttt?ac 22

<210>15

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>15gcgcaagctt?tttttttttt?ag 22

<210>16

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>16gcgcaagctt?tttttttttt?aa 22

<210>17

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>17gcgcaagctt?tttttttttt?ca 22

<210>18

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>18gcgcaagctt?tttttttttt?gc 22

<210>19

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>19 22cgggaagctt?atcgactcca?ag

<210>20

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>20 22cgggaagctt?tagctagcat?gg

<210>21

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>21cgggaagctt?gctaagacta?gc 22

<210>22

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>22cgggaagctt?tgcagtgtgt?ga 22

<210>23

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>23cgggaagctt?gtgaccattg?ca 22

<210>24

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>24cgggaagctt?gtctgctagg?ta 22

<210>25

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>25 22cgggaagctt?gcatggtagt?ct

<210>26

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>26 22cgggaagctt?gtgttgcacc?at

<210>27

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>27 22cgggaagctt?agacgctagt?gt

<210>28

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>28cgggaagctt?tagctagcag?ac 22

<210>29

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>29cgggaagctt?catgatgcta?cc 22

<210>30

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>30cgggaagctt?actccatgac?tc 22

<210>31

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>31 22cgggaagctt?attacaacga?gg

<210>32

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>32 22cgggaagctt?attggattgg?tc

<210>33

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>33 22cgggaagctt?atctttctac?cc

<210>34

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>34 22cgggaagctt?atttttggct?cc

<210>35

<211>21

<212>DNA

＜213〉aspergillus oryzae

<400>35cgggaagctt?atcgatacag?g 21

<210>36

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>36cgggaagctt?tatggtaaag?gg 22

<210>37

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>37cgggaagctt?tatcggtcat?ag 22

<210>38

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>38 22cgggaagctt?taggtactaa?gg

<210>39

<211>21

<212>DNA

＜213〉aspergillus oryzae

<400>39 21catctcatta?tcagccattc?c

<210>40

<211>20

<212>DNA

＜213〉aspergillus oryzae

<400>40 20cccaacatac?ccggaaatcg

<210>41

<211>20

<212>DNA

＜213〉aspergillus oryzae

<400>41 20gcgggtggtt?cgggaacacc

<210>42

<211>20

<212>DNA

＜213〉aspergillus oryzae

<400>42tgcagatctc?ctggtttgcc 20

<210>43

<211>21

<212>DNA

＜213〉aspergillus oryzae

<400>43ctccctaagg?aatgcaaatg?g 21

<210>44

<211>20

<212>DNA

＜213〉aspergillus oryzae

<400>44ccatgaagct?cttctctacc 20

<210>45

<211>22

<212>DNA

＜213〉aspergillus oryzae

<400>45 22ctatttctca?gcgggtggtt?cg

<210>46

<211>28

<212>DNA

＜213〉aspergillus oryzae

<400>46 28gaagatcttg?ggggcagtca?gtgacggg

<210>47

<211>27

<212>DNA

＜213〉aspergillus oryzae

<400>47 27tcccccgggt?atgatttgat?taggatg

<210>48

<211>28

<212>DNA

＜213〉aspergillus oryzae

<400>48 28tcccccggga?gtgttattaa?taaggagg

<210>49

<211>30

<212>DNA

＜213〉aspergillus oryzae

<400>49tgcactgcag?gtatctgtat?cccagtcagc 30

<210>50

<211>21

<212>DNA

＜213〉aspergillus oryzae

<400>50ctctatgtaa?ccaactcctg?c 21

<210>51

<211>24

<212>DNA

＜213〉aspergillus oryzae

<400>51 24cgaaagctta?ctctctggaa?cagg

<210>52

<211>31

<212>DNA

＜213〉aspergillus oryzae

<400>52 31catggagctc?gatggccaaa?tgactgattc?c

<210>53

<211>27

<212>DNA

＜213〉aspergillus oryzae

<400>53 27gacactcgag?taagatatgc?tgcagac

<210>54

<211>28

<212>DNA

＜213〉aspergillus oryzae

<400>54 28cataagcttt?cgagtgataa?tgtcttgg

Claims

1. method of producing polypeptide, it comprises:

(ⅲ) nucleotide sequence, it is hybridized with following material under low stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (b) subsequence of (a) of at least 100 Nucleotide, perhaps (c) (ⅰ) or complementary strand (ⅱ);

(ⅴ) (ⅰ), (ⅱ) or allelic variant (ⅲ); And

(B) substratum from described mutant cell reclaims described polypeptide.

2. the process of claim 1 wherein described first kind of nucleic acid sequence encoding fungal cell's natural polypeptides.

3. the process of claim 1 wherein described first kind of nucleic acid sequence encoding fungal cell's heterologous polypeptide.

4. each method of claim 1～3, wherein, described polypeptide is hormone, hormone variant, enzyme, acceptor or its part, antibody or its part or reporter molecule.

5. the method for claim 4, wherein, described enzyme is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.

6. the method for claim 5, wherein, described enzyme is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, MUTANASE, oxydase, pectic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, rnase, trans-glutaminases or zytase.

7. each method of claim 1～6, wherein, described filamentous fungal cells is Acremonium, Aspergillus, aureobasidium genus, Cryptococcus, Filibasidium, fusarium, Gibberella, Humicola, Magnaporthe, Mucor, myceliophthora, Myrothecium, Neocallimastix, Neurospora, paecilomyces, Penicillium, Piromyces, Schizophyllum, the mould Pseudomonas of basket, thermophilic ascomycete genus, Thielavia, Tolypocladium or Trichoderma cell.

8. the method for claim 7, wherein, described filamentous fungal cells is the Aspergillus cell.

9. the method for claim 8, wherein, described Aspergillus cell is the aspergillus oryzae cell.

10. the method for claim 8, wherein, described Aspergillus cell is the aspergillus niger cell.

11. each method of claim 1～10, wherein, described second kind of nucleotide sequence is the nucleotide sequence of polypeptide that coding has a kind of aminoacid sequence, described aminoacid sequence have at least 50% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

12. the method for claim 11, wherein, described second kind of nucleotide sequence is the nucleotide sequence of polypeptide that coding has a kind of aminoacid sequence, described aminoacid sequence have at least 60% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

13. the method for claim 12, wherein, described second kind of nucleotide sequence is the nucleotide sequence of polypeptide that coding has a kind of aminoacid sequence, described aminoacid sequence have at least 70% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

14. the method for claim 13, wherein, described second kind of nucleotide sequence is the nucleotide sequence of polypeptide that coding has a kind of aminoacid sequence, described aminoacid sequence have at least 80% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

15. the method for claim 14, wherein, described second kind of nucleotide sequence is the nucleotide sequence of polypeptide that coding has a kind of aminoacid sequence, described aminoacid sequence have at least 90% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

16. the method for claim 15, wherein, described second kind of nucleotide sequence is the nucleotide sequence of polypeptide that coding has a kind of aminoacid sequence, described aminoacid sequence have at least 95% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

17. each method of claim 1～10, wherein, described second kind of nucleic acid sequence encoding comprises the polypeptide of the aminoacid sequence of sequence 2 or sequence 5.

18. each method of claim 1～10, wherein, described second kind of nucleic acid sequence encoding one peptide species, this polypeptide is by the aminoacid sequence of sequence 2 or sequence 5; Or its fragment with DDC2 or DDC3 polypeptide active constitutes.

19. the method for claim 18, wherein, the polypeptide that described second kind of nucleic acid sequence encoding is made of the aminoacid sequence of sequence 2 or sequence 5.

20. each method of claim 1～10, wherein, described second kind of nucleic acid sequence encoding one peptide species, this polypeptide is made of the amino acid/11 9～64 of sequence 2 or the amino acid 21～83 of sequence 5.

21. each method of claim 1～10, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it have at least 50% with the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

22. the method for claim 21, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it have at least 60% with the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

23. the method for claim 22, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it have at least 70% with the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

24. the method for claim 23, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it have at least 80% with the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

25. the method for claim 24, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it have at least 90% with the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

26. the method for claim 25, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it have at least 95% with the homology of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

27. each method of claim 1～10, wherein, described second kind of nucleotide sequence that nucleotide sequence is sequence 1 or sequence 4.

28. each method of claim 1～10, wherein, described second kind of nucleotide sequence comprises the nucleotide sequence of the Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4.

29. each method of claim 1～10, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it is hybridized with following material under low stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (b) subsequence of (a) of at least 100 Nucleotide, perhaps (c) (a) or complementary strand (b).

30. the method for claim 29, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it is hybridized with following material under low stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, perhaps (b) complementary strand (a).

31. each method of claim 1～10, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it is hybridized with following material under the moderate stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (b) subsequence of (a) of at least 100 Nucleotide, perhaps (c) (a) or complementary strand (b).

32. the method for claim 31, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it is hybridized with following material under the moderate stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, perhaps (b) complementary strand (a).

33. each method of claim 1～10, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it is hybridized with following material under high stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (b) subsequence of (ⅰ) of at least 100 Nucleotide, perhaps (c) (a) or complementary strand (b).

34. the method for claim 33, wherein, described second kind of nucleotide sequence is a kind of like this nucleotide sequence: it is hybridized with following material under high stringency: (a) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, perhaps (b) complementary strand (a).

35. each method of claim 1～10, the variant of its coded polypeptide, described polypeptide have the aminoacid sequence of a sequence 2 or sequence 5, described variant comprise one or morely amino acid whosely substitute, disappearance and/or insert.

36. each method of claim 1～10, wherein, described second kind of nucleotide sequence is the nucleotide sequence that is contained among the clay 34G12, and this clay is contained among the colon bacillus DSM11924.

37. each method of claim 1～10, wherein, described second kind of nucleotide sequence is the nucleotide sequence that is contained among the clay 18H7, and this clay is contained among the colon bacillus DSM12060.

38. each method of claim 1～37, wherein, described mutant cell further comprises one or more modifications of one or more the third nucleotide sequence, and wherein, this modification has reduced or eliminated the expression of one or more the third nucleotide sequence.

39. the method for claim 38, wherein, a kind of enzyme of described the third nucleic acid sequence encoding, this enzyme is selected from: aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, laccase, lipase, mannosidase, MUTANASE, oxydase, pectic enzyme, peroxidase, proteolytic enzyme, rnase, trans-glutaminases and zytase.

40. the modification that a sudden change filamentous fungal cells that is used to produce polypeptide, this sudden change filamentous fungal cells comprise first kind of nucleotide sequence of this polypeptide of encoding and be selected from down second kind of nucleotide sequence of group:

(e) (a) and (b) or allelic variant (c); And

41. the mutant cell of claim 40, it further comprises one or more modifications of one or more the third nucleotide sequence, and wherein, this modification has reduced or eliminated the expression of one or more the third nucleotide sequence.

42. the mutant cell of claim 41, wherein, a kind of enzyme of described the third nucleic acid sequence encoding, this enzyme is selected from: aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, laccase, lipase, mannosidase, MUTANASE, oxydase, pectic enzyme, peroxidase, proteolytic enzyme, rnase, trans-glutaminases and zytase.

43. produce each the method for mutant cell of claim 40～42 for one kind, it comprises one or more the second nucleotide sequence of modifying the parental generation filamentous fungal cells, this sequence is selected from:

(e) (a) and (b) or allelic variant (c); And

44. an isolated polypeptide, it is selected from:

(b) by a kind of polypeptide of nucleic acid sequence encoding, described nucleotide sequence is hybridized with following material under low stringency: (ⅰ) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (ⅱ) subsequence of (ⅰ) of at least 100 Nucleotide, perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ);

(d) (a) or allelic variant (b); And

45. the polypeptide of claim 44, it comprises a kind of aminoacid sequence, this aminoacid sequence have at least 50% with the identity of the amino acid 21～83 of the amino acid/11 9～64 of sequence 2 or sequence 5.

46. the polypeptide of claim 44, it is by the aminoacid sequence of sequence 2 or sequence 5; Or its fragment with DDC2 or DDC3 polypeptide active constitutes.

47. the polypeptide of claim 46, it is made of the aminoacid sequence of sequence 2 or sequence 5.

48. the polypeptide of claim 46, it is made of the amino acid/11 9～64 of sequence 2 or the amino acid 21～83 of sequence 5.

49. the polypeptide of claim 44, it is by a kind of nucleic acid sequence encoding, described nucleotide sequence is hybridized with following material under low stringency: (ⅰ) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, (ⅱ) subsequence of (ⅰ) of at least 100 Nucleotide, perhaps (ⅲ) (ⅰ) or complementary strand (ⅱ).

50. the polypeptide of claim 44, it is by a kind of nucleic acid sequence encoding, described nucleotide sequence is hybridized with following material under low stringency: (ⅰ) Nucleotide 1041～1229 of the Nucleotide 1014～1151 of sequence 1 or sequence 4, perhaps (ⅱ) complementary strand (ⅰ).

51. the polypeptide of claim 44, it is the variant polypeptides with aminoacid sequence of a sequence 2 or sequence 5, this variant comprise one or morely amino acid whosely substitute, disappearance and/or insert.

52. the polypeptide of claim 44, it is by the nucleic acid sequence encoding that is contained among the clay 34G12, and described clay is contained among the colon bacillus DSM11924.

53. the polypeptide of claim 44, it is by the nucleic acid sequence encoding that is contained among the clay 18H7, and described clay is contained among the colon bacillus DSM12060.

54. an isolated nucleic acid sequences, the polypeptide of its coding claim 44.

55. a nucleic acid construct thing, it comprises operationally and one or more control sequence nucleotide sequence that be connected, claim 54, and described control sequence instructs the expression of polypeptide in suitable expressive host.

56. a recombinant expression vector, it comprises the nucleic acid construct thing of claim 55.

57. a recombinant host cell, it comprises the nucleic acid construct thing of claim 55.

58. a method of producing the polypeptide of claim 44, it comprises: (a) cultivate a kind of bacterial strain under the condition of this polypeptide helping to produce; And (b) reclaim this polypeptide from substratum.

59. a method of producing polypeptide, it comprises: (a) helping to produce the host cell of cultivating claim 57 under the condition of this polypeptide; And (b) reclaim this polypeptide from substratum.

60. nucleic acid construct thing, it comprises a kind of proteinic gene of coding, this gene operationally is connected with the nucleotide sequence of a kind of signal peptide of coding, described nucleotide sequence is made of the Nucleotide 960～1013 of sequence 1 or the Nucleotide 981～1040 of sequence 4, wherein, described gene is the foreign gene of this nucleotide sequence.

61. a recombinant expression vector, it comprises the nucleic acid construct thing of claim 60.

62. a recombinant host cell, it comprises the nucleic acid construct thing of claim 60.

63. produce method of protein for one kind, it comprises: (a) be fit to produce the recombinant host cell of cultivating claim 62 under this proteinic condition; And (b) reclaim this protein.