WO1993004088A1 - Depistage de l'hepatite c a l'aide d'antigenes recombines diriges contre la region ns1 - Google Patents
Depistage de l'hepatite c a l'aide d'antigenes recombines diriges contre la region ns1 Download PDFInfo
- Publication number
- WO1993004088A1 WO1993004088A1 PCT/US1992/007188 US9207188W WO9304088A1 WO 1993004088 A1 WO1993004088 A1 WO 1993004088A1 US 9207188 W US9207188 W US 9207188W WO 9304088 A1 WO9304088 A1 WO 9304088A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ala
- val
- leu
- gly
- arg
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
- C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- This invention relates generally to an assay for identifying the presence in a sample of an antibody which is immunologically reactive with a hepatitis C virus antigen and specifically to an assay for detecting a complex of an antibody and recombinant antigens representing distinct regions of the HCV genome.
- Recombinant antigens derived from the molecular cloning and expression in a heterologous expression system of the synthetic DNA sequences representing distinct antigenic regions of the HCV genome can be used as reagents for the detection of antibodies and antigen in body fluids from individuals exposed to hepatitis C virus (HCV).
- Acute viral hepatitis is clinically diagnosed by a well-defined set of patient symptoms, including jaundice, hepatic tenderness, and an increase in the serum levels of alanine am inotransf erase (ALT) and aspartate aminotransferase.
- ALT alanine am inotransf erase
- Additional serologic immunoassays are generally performed to diagnose the specific type of viral causative agent. Historically, patients presenting clinical hepatitis symptoms and not otherwise infected by hepatitis A, hepatitis B, Epstein-Barr or cytomegalovirus were clinically diagnosed as having non-A non-B hepatitis
- NANBH neurotrophic neoplasm
- hepatitis A virus HAV
- HBV hepatitis B virus
- HBV hepatitis D virus
- HDV High-V-V
- HCV hepatitis C virus
- the cDNA sequences associated with HCV were isolated from a cDNA library prepared from the RNA obtained from pooled serum from a chimpanzee with chronic HCV infection.
- the cDNA library contained cDNA sequences of approximate mean size of about 200 base pairs.
- the cDNA library was screened for encoded epitopes expressed in clones that could bind to antibodies in sera from patients who had previously experienced NANBH.
- SOD superoxide dismutase fusion polypeptides
- c100-3 The most complex SOD fusion polypeptide described in the European Patent Application, designated c100-3, was described as containing 154 amino acids of human SOD at the aminoterminus, 5 amino acid residues derived from the expression of a synthetic DNA adapter containing a restriction site, EcoRI, 363 amino acids derived from the expression of a cloned HCV cDNA fragment, and 5 carboxyl terminal amino acids derived from an MS2 cloning vector nucleotide sequence.
- the DNA sequence encoding this polypeptide was transformed into yeast cells using a plasmid. The transformed cells were cultured and expressed a 54,000 molecular weight polypeptide which was purified to about 80% purity by differential extraction.
- SOD-NANB5-1-1 and SOD- NANB 81 were expressed in recombinant bacteria.
- the E.coli fusion poiypeptides were purified by differential extraction and by chromatography using anion and cation exchange columns. The purification procedures were able to produce SOD- NANB 5- 1 -1 as about 80% pure and SOD-NAN38, as about 50% pure.
- microtiter wells or polystyrene beads coated on microtiter wells or polystyrene beads and used to assay serum samples. Briefly, coated microtiter wells were incubated with a sample in a diluent. After incubation, the microtiter wells were washed and then developed using either a radioactively labelled sheep anti-human antibody or a mouse antihuman IgG-HRP (horseradish peroxidase) conjugate. These assays were used to detect both post acute phase and chronic phase HCV infection.
- assay specificity required adding yeast or E.coli extracts to the samples in order to prevent undesired immunological reactions with any yeast or E.coli antibodies present in samples.
- Ortho Diagnostic Systems Inc. have developed a immunoenzyme assay to detect antibodies to HCV antigens.
- the Ortho assay procedure is a three-stage test for serum/plasma carried out in a microwell coated with the recombinant yeast/hepatitis C virus SOD fusion polypeptide c100-3.
- a test specimen is diluted directly in the test well and incubated for a specified length of time. If antibodies to HCV antigens are present in the specimen, antigen-antibody complexes will be formed on the microwell surface.
- anti-human IgG murine monoclonal antibody horseradish peroxidase conjugate is added to the microwell.
- the conjugate binds specifically to the antibody portion of the antigen-antibody complexes. If antigen-antibody complexes are not present, the unbound conjugate will also be removed by a washing step.
- an enzyme detection system composed of o- phenyienediamine 2HCI (OPD) and hydrogen peroxide is added to the test well. If bound conjugate is present, the OPD will be oxidized, resulting in a colored end product. After formation of the colored end product, dilute sulfuric acid is added to the microwell to stop the color-forming detection reaction.
- OPD o- phenyienediamine 2HCI
- the intensity of the colored end product is measured with a microwell reader.
- the assay may be used to screen patient serum and plasma.
- HCV may be transmitted by contaminated blood and blood products.
- transfused patients as many as 10% will suffer from post- transfusion hepatitis. Of these, approximately 90% are the result of infections diagnosed as HCV.
- the prevention of transmission of HCV by blood and blood products requires reliable, sensitive and specific diagnosis and prognostic tools to identify HCV carriers as well as contaminated blood and blood products.
- an HCV assay which uses reliable and efficient reagents and methods to accurately detect the presence of HCV antibodies in samples.
- the present invention provides an improved assay for detecting the presence of an antibody to an HCV antigen in a sample by contacting the sample with at least one recombinant protein representing a distinct antigenic region of the HCV genome.
- Recombinant antigens which are derived from the molecular cloning and expression of synthetic DNA sequences in heterologous hosts are provided. Briefly, synthetic DNA sequences which encode the desired proteins representing distinct antigenic regions of the HCV genome are optimized for expression in E.coli by specific codon selection. Specifically, recombinant proteins representing five distinct antigenic regions of NS1 of the HCV genome are described. The proteins are expressed as chimeric fusions with E.coli CMP-KDO synthetase (CKS) gene.
- the first protein, expressed by plasmid pHCV-77 (identified as SEQ. ID. NO. 1) represents amino acids 365-579 of the HCV sequence of NS1 and, based on analogy to the genomic organization of other flaviviruses, has been named HCV CKS-NS1S1.
- pHCV-77 will also refer to the fusion protein itself and that pHCV-77' will be the designation for a polypeptide representing the NS1 region from about amino acids 365-579 of the HCV sequence prepared using other recombinant or synthetic methodologies. Other recombinant methodologies would include the preparation of pHCV-77', utilizing different expression systems.
- the methodology for the preparation of synthetic peptides of HCV is described in U.S. Serial No. 456,162, filed December 22, 1989, and U.S. Serial No. 610,180, filed November 7, 1990, which enjoy common ownership and are incorporated herein by reference.
- the next protein is expressed by plasmid pHCV-65, identified as SEQ. ID. NO.
- pHCV-65 has been named HCV CKS-NS1S2 and is expressed by the plasmid pHCV-65.
- the fusion protein itself will also be referred to as pHCV-65 and pHCV- 65' shall be the designation for a polypeptide from the NS-1 region representing from about amino acids 565-731 of the HCV sequence prepared using other recombinant or synthetic methodologies.
- the next recombinant antigen represents amino acids 717-847 of the NS1 region of the HCV sequence, and is expressed by the plasmid pHCV-78 (identified by SEQ. ID. NO. 3).
- the fusion protein will be referred to as pHCV-78 and pHCV-78' shall be the designation for a polypeptide from the NS1 region representing from about amino acids 717-847 of the HCV sequence prepared using other recombinant or synthetic methodologies. It has been designated clone HCV CKS-NS1S3 based on the strategy used in its construction. Figure 44 illustrates the position of pHCV-77, pHCV-65 and pHCV-78 in the NS1 region of the HCV genome.
- the recombinant antigen produced by pHCV-80 is identified as SEQ. ID. NO.4 and is designated HCV CKS-NS1S1-NS1S2.
- the fusion protein is also designated by pHCV-80 and pHCV-80' refers to the polypeptide located in the NS1 region of HCV, representing amino acids 365-731 of the HCV genome prepared using different recombinant methodologies.
- Figure 45 illustrates the position of pHCV-80 within the HCV genome.
- HCV CKS-Full Length NS1 is the designation for the recombinant protein pHCV-92 (SEQ. ID. NO. 5). It represents amino acids 365-847 of the HCV genome.
- the fusion proteins will be referred to as pHCV-92 and pHCV 92' shall be the designation for the polypeptide from the NS1 region representing amino acids 365-847 of the HCV sequence prepared using other recombinant or synthetic methodologies.
- Figure 46 illustrates the position of pHCV-92 in the HCV genome.
- One assay format provides a screening assay for identifying the presence of an antibody that is immunologically reactive with an HCV antigen. Briefly, a fluid sample is incubated with a solid support containing the commonly bound recombinant proteins. Finally, the antibody-antigen complex is detected. In a modification of the screening assay the solid support additionally contains recombinant polypeptide c100-3.
- Another assay format provides a confirmatory assay for unequivocally identifying the presence of an antibody that is immunologically reactive with an HCV antigen.
- the confirmatory assay includes synthetic peptides or recombinant antigens representing the epitopes contained within the NS1 region of the HCV genome, which are the same regions represented by the recombinant proteins described in the screening assay. These are pHCV-77, pHCV-65, pHCV-78, pHCV-
- Recombinant proteins used in the confirmatory assay should have a heterologous source of antigen to that used in the primary screening assay (i.e. should not be an E.coli-derived recombinant antigen nor a recombinant antigen composed in part, of CKS sequences).
- specimens repeatedly reactive in the primary screening assay are retested in the confirmatory assay. Aliquots containing identical amounts of specimen are contacted with a synthetic peptide or recombinant antigen individually coated onto a solid support. Finally, the antibody antigen complex is detected.
- poiypeptides or recombinant proteins can be utilized as indicated or combined with other poiypeptides and recombinant proteins a described herein and also described in U.S. Serial No. 456,162 entitled “Hepatitis C Assay", filed December 22, 1989, which enjoys common ownership and is incorporated herein by reference.
- Another assay format provides a competition assay or neutralization assay directed to the confirmation that positive results are not false by identifying the presence of an antibody that is immunologically reactive with an HCV antigen in a fluid sample where the sample is used to prepare first and second immunologically equivalent aliquots.
- the first aliquot is contacted with solid support containing a bound polypeptide which contains at least one epitope of an HCV antigen under conditions suitable for complexing with the antibody to form a detectable antibodypolypeptide complex and the second aliquot is first contacted with the same solid support containing bound polypeptide.
- the preferred recombinant poiypeptides include pHCV-77, pHCV-65, pHCV-78, pHCV-80 and pHCV-92.
- Another assay format provides an immunodot assay for identifying the presence of an antibody that is immunologically reactive with an HCV antigen by concurrently contacting a sample with recombinant poiypeptides each containing distinct epitopes of an HCV antigen under conditions suitable for complexing the antibody with at least one of the poiypeptides and detecting the antibodypolypeptide complex by reacting the complex with colorproducing reagents.
- the preferred recombinant poiypeptides employed include those recombinant poiypeptides derived from pHCV-77, pHCV-65, pHCV-78, pHCV-80, as well as pHCV-92.
- the sample is preferably diluted before contacting the polypeptide absorbed on a solid support.
- Samples may be obtained from different biological samples such as whole blood, serum, plasma, cerebral spinal fluid, and lymphocyte or cell culture supernatants.
- Solid support materials may include cellulose materials, such as paper and nitrocellulose, natural and synthetic polymeric materials, such as poiyacrylamide, polystyrene, and cotton, porous gels such as silica gel, agarose, dextran and gelatin, and inorganic materials such as deactivated alumina, magnesium sulfate and glass.
- Suitable solid support materials may be used in assays in a variety of well known physical configurations, including microtiter wells, test tubes, beads, strips, membranes, and microparticles.
- a preferred solid support for a non-immunodot assay is a polystyrene bead.
- a preferred solid support for an immunodot assay is nitrocellulose.
- Suitable methods and reagents for detecting an antibody-antigen complex in an assay of the present invention are commercially available or known in the relevant art. Representative methods may employ detection reagents such as enzymatic, radioisotopic, fluorescent, luminescent, or chemiluminescent reagents. These reagents may be used to prepare hapten-labelled antihapten detection systems according to known procedures, for example, a biotin-labelled antibiotin system may be used to detect an antibody-antigen complex.
- the present invention also encompasses assay kits including poiypeptides which contain at least one epitope of an HCV antigen bound to a solid support as well as needed sample preparation reagents, wash reagents, detection reagents and signal producing reagents.
- E.coli strains containing plasmids useful for constructs of the invention have been deposited at the American Type Culture Collection, Rockville, Maryland on August 10, 1990, under the accession Nos. ATCC 68380 (pHCV-23), ATCC 68381 (pHCV-29), ATCC 68382 (pHCV-31), ATCC 68383 (pHCV-34) and on November 6, 1990 for E.coli strains containing plasmids useful for constructs under the accession Nos.
- ATCC 68458 (pHCV-50), ATCC 68459 (pHCV-57), ATCC 68460 (pHCV-103), ATCC 68461 (pHCV-102), ATCC 68462 (pHCV-51), ATCC 68463 (pHCV-105), ATCC 68464 (pHCV-107), ATCC 68465 (pHCV-104), ATCC 68466 (pHCV-45), ATCC 68467 (pHCV-48),ATCC 68468 (pHCV-49), ATCC 68469 (pHCV-58) and ATCC 68470 (pHCV-101).
- E. coli strains containing plasmids useful for constructs of the invention have been deposited at the A.T.C.C. on
- FIGURE 1 illustrates the HCV genome.
- FIGURE 2 illustrates the use of recombinant poiypeptides to identify the presence of antibodies in a chimpanzee inoculated with HCV.
- FIGURE 3 illustrates the sensitivity and specificity increase in using the screening assay using pHCV-34 and pHCV-31 antigens.
- FIGURE 4 illustrates the construction of plasmid pHCV-34.
- FIGURE 5 illustrates fusion protein pHCV-34.
- FIGURE 6 illustrates the expression of pHCV-34 proteins in E.coli
- FIGURE 7 illustrates the construction of plasmid pHCV-23.
- FIGURE 8 illustrates the construction of plasmid pHCV-29.
- FIGURE 9 illustrates the construction of plasmid pHCV-31.
- FIGURE 10 illustrates the fusion protein pHCV-31.
- FIGURE 11 illustrates the expression of pHCV-29 in E.coli.
- FIGURE 12 illustrates the expression of pHCV-23 in E.coli.
- FIGURE 13 illustrates the expression of pHCV-31 in E.coli.
- FIGURE 14 illustrates the increased sensitivity using the screening assay utilizing the pHCV-34.
- FIGURE 15 illustrates the increased specificity with the screening assay utilizing pHCV-34 and pHCV-31.
- FIGURE 16 illustrates the results in hemodialysis patients using the screening and confirmatory assays.
- FIGURE 17 illustrates earlier detection of HCV in a hemodialysis patient using the screening assay.
- FIGURE 18 illustrates the results of the screening assay utilizing pHCV-34 and pHCV-31 on samples from individuals with acute NANBH.
- FIGURE 19 illustrates the results of the confirmatory assay of the same population group as in Figure 18.
- FIGURE 20 illustrates the results of the screening and confirmatory assays on individuals infected with chronic NANBH.
- FIGURE 21 illustrates preferred buffers, pH conditions, and spotting concentrations for the HCV immunodot assay.
- FIGURE 22 illustrates the results of the HCV immunodot assay.
- FIGURE 23 illustrates the fusion protein pHCV-45.
- FIGURE 24 illustrates the expression of pHCV-45 in E.coli.
- FIGURE 25 illustrates the fusion protein pHCV-48.
- FIGURE 26 illustrates the expression of pHCV-48 in E.coli.
- FIGURE 27 illustrates the fusion protein pHCV-51.
- FIGURE 28 illustrates the expression of pHCV-51 in E.coli.
- FIGURE 29 illustrates the fusion protein pHCV-50.
- FIGURE 30 illustrates the expression of pHCV-50 in E.coli.
- FIGURE 31 illustrates the fusion protein pHCV-49.
- FIGURE 32 illustrates the expression of pHCV-49 in E.coli.
- FIGURE 33 illustrates an immunoblot of pHCV-23, pHCV-45, pHCV-48, pHCV-51 , pHCV-50 and pHCV-49.
- FIGURE 34 illustrates the fusion proteins pHCV-24, pHCV-57, pHCV-58.
- FIGURE 35 illustrates the expression of pHCV-24, pHCV-57, and pHCV-58 in E.coli.
- FIGURE 36 illustrates the fusion protein pHCV-105.
- FIGURE 37 illustrates the expression of pHCV-105 in E.coli.
- FIGURE 38 illustrates the fusion protein pHCV-103.
- FIGURE 39 illustrates the fusion protein pHCV-101.
- FIGURE 40 illustrates the fusion protein pHCV-102.
- FIGURE 41 illustrates the expression of pHCV-102 in E.coli.
- FIGURE 42 illustrates the fusion protein pHCV-107.
- FIGURE 43 illustrates the fusion protein pHCV-104.
- FIGURE 44 illustrates the NS1 region of the HCV genome, and in particular, the locations of pHCV-77, pHCV-65 and pHCV-78.
- FIGURE 45 illustrates the NS1 region of the HCV genome, and in particular, the location of pHCV-80.
- FIGURE 46 illustrates the NS1 region of the HCV genome, and in particlar, the location of pHCV-92.
- FIGURE 47A illustrates the expression of pHCV-77 in E. coli: and FIGURE 47B illustrates an immunblot of pHCV-77 in E. coli.
- FIGURE 48A illustrates the expression of pHCV-65 in E. coli and FIGURE 48B illustrates an immunoblot of pHCV-65 in E. coli.
- FIGURE 49A illustrates the expression of pHCV-80 in E. coli and FIGURE
- 49B illustrates an immunoblot of pHCV-80 in E. coli.
- the present invention is directed to an assay to detect an antibody to an HCV antigen in a sample.
- Human serum or plasma is preferably diluted in a sample diluent and incubated with a polystyrene bead coated with a recombinant polypeptide that represents a distinct antigenic region of the HCV genome. If antibodies are present in the sample they will form a complex with the antigenic polypeptide and become affixed to the polystyrene bead. After the complex has formed, unbound materials and reagents are removed by washing the bead and the bead-antigen- antibody complex is reacted with a solution containing horseradish peroxidase labeled goat antibodies directed against human antibodies.
- This peroxidase enzyme then binds to the antigen-antibody complex already fixed to the bead.
- the horseradish peroxidase is contacted with o-phenylenediamine and hydrogen peroxide which results in a yellow-orange color.
- the intensity of the color is proportional to the amount of antibody which initially binds to the antigen fixed to the bead.
- the preferred recombinant poiypeptides having HCV antigenic epitopes were selected from portions of the HCV genome which encoded poiypeptides which possessed amino acid sequences similar to other known immunologically reactive agents and which were identified as having some immunological reactivity.
- the immunological reactivity of a polypeptide was initially identified by reacting the cellular extract of E.coli clones which had been transformed with cDNA fragments of the HCV genome with HCV infected serum. Poiypeptides expressed by clone containing the incorporated cDNA were immunologically reactive with serum known to contain antibody to HCV antigens.)
- An analysis of a given amino acid sequence only provides rough guides to predicting immunological reactivity. There is no invariably predictable way to ensure immunological activity short of preparing a given amino acid sequence and testing the suspected sequence in an assay.
- pHCV-34 and pHCV-31 expressed by the plasmids pHCV-34 and pHCV-31, respectively.
- the assay utilizing the recombinant pHCV-34 and pHCV-31 proteins detected plasma antibody three weeks prior to detection of antibody by the assay using c100-3.
- This test is sufficiently sensitive to detect seroconversion during the acute phase of this disease, as defined as an elevation in ALT levels, in most animals. Equally important is the high degree of specificity of the test as no pre-inoculation specimens were reactive.
- the poiypeptides useful in the practice of this invention are produced using recombinant technologies.
- the DNA sequences which encode the desired poiypeptides are preferably assembled from fragments of the total desired sequence. Synthetic DNA fragments of the HCV genome can be synthesized based on their corresponding amino acid sequences. Once the amino acid sequence is chosen, this is then reverse translated to determine the complementary DNA sequence using codons optimized to facilitate expression in the chosen system.
- the fragments are generally prepared using well known automated processes and apparatus. After the complete sequence has been prepared the desired sequence is incorporated into an expression vector which is transformed into a host cell. The DNA sequence is then expressed by the host cell to give the desired polypeptide which is harvested from the host cell or from the medium in which the host cell is cultured.
- PCR polymerase chain reaction
- Vector systems which can be used include plant, bacterial, yeast, insect, and mammalian expression systems. It is preferred that the codons are optimized for expression in the system used.
- a preferred expression system utilizes a carrier gene for a fusion system where the recombinant HCV proteins are expressed as a fusion protein of an E.coli enzyme, CKS (CTP:CMP-3-deoxy-mann o -octulosonate cytidylyl transferase or CMP-KDO synthetase).
- CKS CTP:CMP-3-deoxy-mann o -octulosonate cytidylyl transferase or CMP-KDO synthetase.
- lambda PL vector system whose features include a strong lambda pL promoter, a strong three-frame translation terminator rrnBtl, and translation starting at an ATG codon.
- the amino acid sequences encoding for the recombinant HCV antigens of interest were reverse translated using codons optimized to facilitate high level expression in E.coli.
- Individual oligonucleotides were synthesized by the method of oligonucleotide directed double-stranded break repair disclosed in U.S. Patent Application Serial No. 883,242, filed July 8, 1986 by Mandecki (EPO 87109357.1) which enjoys common ownership and is incorporated herein by reference.
- the individual oligonucleotides may be synthesized on the Applied Biosystem 380A DNA synthesizer using methods and reagents recommended by the manufacturer.
- the DNA sequences of the individual oligonucleotides were confirmed using the Sanger dideoxy chain termination method (Sanger et al., J. Mole. Biol., 162:729 (1982)). These individual gene fragments were then annealed and ligated together and cloned as EcoRI-BamHI subfragments in the CKS fusion vector pJO200. After subsequent DNA sequence confirmation by the Sanger dideoxy chain termination method, the subfragments were digested with appropriate restriction enzymes, gel purified, ligated and cloned again as an EcoRI-BamHI fragment in the CKS fusion vector pJO2OO.
- the resulting clones were mapped to identify a hybrid gene consisting of the EcoRI-BamHI HCV fragment inserted at the 3' end of the CKS (CMP-KDO synthetase) gene.
- the resultant fusion proteins under control of the la c promoter, consist of 239 amino acids of the CKS protein fused to the various regions of HCV.
- Examples 1 and 2 describe the synthesis and cloning of CKS-Core and CKS-33-BCD, respectively.
- Example 3 describes a screening assay.
- Example 4 describes a confirmatory assay.
- Example 5 describes a competition assay.
- Example 6 describes an immunodot assay.
- Example 7 describes the synthesis and cloning of HCV CKS-NS5E, CKS-NS5F, CKS-NS5G, CKS-NS5H and CKS-NS5I.
- Example 8 describes the preparation of HCV CKS-C100 vectors.
- Example 9 describes the preparation of HCV PCR derived expression vectors.
- Example 10 describes the synthesis and characterization of pHCV-77 of NS1.
- Example 11 describes the synthesis and characterization of pHCV-65 of NS1.
- Example 12 describes the synthesis and characterization of pHCV-78 of NS1.
- Example 13 describes the synthesis and characterization of pHCV-80 of NS1.
- Example 14 describes the synthesis and characterization of pHCV-92 of NS1.
- Horseradish peroxidase (HRPO) labeled secondary antibodies were obtained from Kirkegaard & Perry Laboratories, Inc., Gaithersburg, Maryland. Seaplaque® agarose (low melting agarose) was purchased from FMC Bioproducts, Rockland, Maine.
- T50E10 contained 50mM Tris, pH 8.0, 10mM EDTA; 1X TG contained 100mM Tris, pH 7.5 and 10% glycerol; 2X SDS/PAGE loading buffer consisted of 15% glycerol, 5% SDS, 100mM Tris base, 1 M ⁇ -mercaptoethanol and 0.8%
- E,coli JM103 cells, pUC8, pUC18, pUC19 and M13 cloning vectors were purchased from Pharmacia LKB Biotechnology, Inc., Piscataway, New Jersey;
- Competent EpicureanTM coli stains XL1 -Blue and JM109 were purchased from
- RR1 cells were obtained from Coli Genetic Stock Center, Yale University, New Haven, Connecticut; and E.coli CAG456 cells from Dr. Carol Gross, University of Wisconsin, Madison, Wisconsin.
- Vector pRK248.clts was obtained from Dr. Donald R. Helinski, University of California, San Diego, California.
- the cloning vector pJO200 allows the fusion of recombinant proteins to the
- the plasmid consists of the plasmid pBR322 with a modified Jac promoter fused to a KdsB gene fragment (encoding the first 239 of the entire 248 amino acids of the E.coli CMP-KDO synthetase of CKS protein), and a synthetic linker fused to the end of the KdsB gene fragment.
- the cloning vector pJO200 is a modification of vector pTB210.
- the synthetic linker includes: multiple restriction sites for insertion of genes; translational stop signals, and the trpA rho- independent transcriptional terminator.
- the pHCV-34 plasmid and the CKS plasmid pTB210 were transformed into E.coli K-12 strain xL-1 (recAI, endAI, gyrA96, thi-1 , hsdRI7, supE44, relAI, lac/F', proAB, laclqZDMl 5, TN10) cells made competent by the calcium chloride method.
- E.coli K-12 strain xL-1 recAI, endAI, gyrA96, thi-1 , hsdRI7, supE44, relAI, lac/F', proAB, laclqZDMl 5, TN10
- pHCV-34/XL-1 culture was grown overnight at 37°C in growth media consisting of yeast extract, trytone, phosphate salts, glucose, and ampicillin. When the culture reached an OD600 of 1.0, IPTG was added to a final concentration of 1 mM to induce expression. Samples (1.5 ml) were removed at 1 hour intervals, and cells were pelleted and resuspended to an OD600 of 1.0 in 2X SDS/PAGE loading buffer. Aliquots (15ul) of the prepared samples were separated on duplicate 12.5% SDS/PAGE gels.
- One gel was fixed in a solution of 50% methanol and 10% acetic acid for 20 minutes at room temperature, and then stained with 0.25% Coomassie blue dye in a solution of 50% methanol and 10% acetic acid for 30 minutes. Destaining was carried out using a solution of 10% methanol and 7% acetic acid for 3-4 hours, or until a clear background was obtained.
- Figure 6 presents the expression of pHCV-34 proteins in E.coli.
- Molecular weight standards were run in Lane M.
- Lane 1 contains the plasmid pJ0200-the CKS vector without the HCV sequence.
- the arrows on the left indicate the mobilities of the molecular weight markers from top to bottom: 110,000; 84,000; 47,000; 33,000; 24,000; and 16,000 daltons.
- the arrows on the right indicate the mobilities of the recombinant HCV proteins.
- Lane 2 contains the E.coli lysate containing pHCV-34 expressing CKS-Core (amino acids 1 to 150) prior to induction; and Lane 3 after 3 hours of induction.
- the results show that the recombinant protein pHCV-34 has an apparent mobility corresponding to a molecular size of 48,000 daltons. This compares acceptably with the predicted molecular mass of 43,750 daltons.
- Proteins from the second 12.5% SDS/PAGE gel were electrophoretically transferred to nitrocellulose for immunoblotting.
- the nitrocellulose sheet containing the transferred proteins was incubated with Blocking Solution for one hour and incubated overnight at 4°C with HCV patients' sera diluted in TBS containing E.coli K-12 strain XL-I lysate.
- the nitrocellulose sheet was washed three times in TBS, then incubated with HRPO-labeled goat anti-human IgG, diluted in TBS containing 10% fetal calf sera.
- the nitrocellulose was washed three times with TBS and the color was developed in TBS containing 2 mg/ml 4-chloro-1- napthol, 0.02% hydrogen peroxide and 17% methanol.
- Clone HCV-34 demonstrated a strong immu no reactive band at 48,000 daltons with the HCV patients' sera.
- the major protein in the Coomassie stained protein gel was immunoreactive.
- HCV CKS-33c-BCD Expression Vector The construction of this recombinant clone expressing the HCV CKS-33-BCD antigen was carried out in three steps described below. First, a clone expressing the HCV CKS-BCD antigen was constructed, designated pHCV-23. Second, a clone expressing the HCV CKS-33 antigen was constructed, designated pHCV-29. Lastly, the HCV BCD region was excised from pHCV-23 and inserted into pHCV-29 to construct a clone expressing the HCV CKS-33-BCD antigen, designated pHCV-31 (SEQ.ID.NO. 8 and 9).
- pHCV-23 To construct the plasmid pHCV-23, thirteen individual oligonucleotides representing amino acids 1676-1931 of the HCV genome were ligated together and cloned as three separate EcoRI-BamHI subfragments into the CKS fusion vector pJO200. After subsequent DNA sequence confirmation, the three subfragments, designated B, C, and D respectively, were digested with the appropriate restriction enzymes, gel purified, ligated together, and cloned as a 781 base pair EcoRI-BamHI fragment in the CKS fusion vector pJO200, as illustrated in Figure 7. The resulting plasmid, designated pHCV-23, expresses the HCV CKS-BCD antigen under control of the jac promoter.
- the HCV CKS-BCD antigen consists of 239 amino acids of CKS, seven amino acids contributed by linker DNA sequences, 256 amino acids from the HCV NS4 region (amino acids 1676-1931 , and 10 additional amino acids contributed by linker DNA sequences.
- the resulting plasmid expresses the CKS-33 antigen under control of the jac promoter.
- the HCV CKS-33 antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 266 amino acids from the HCV NS3 region (amino acids 1192- 1 457) .
- pHCV-31 To construct the plasmid pHCV-31 , the 781 base pair EcoRI-BamHI fragment from pHCV-23 representing the HCV-BCD region was linker-adapted to produce a Cla1-BamHl fragment which was then gel purified and ligated into pHCV- 29 at the Cla1-BamHl sites as illustrated in Figure 9.
- the resulting plasmid, designated pHCV-31 expresses the pHCV-31 antigen under control of the lac
- the complete DNA sequence of pHCV-31 and the entire amino acid sequence of the HCV CKS-33-BCD recombinant antigen produced is presented in SEQ.ID.NO. 8 and 9.
- the HCV CKS-33-BCD antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, 266 amino acids of the HCV NS3 region (amino acids 1192-1457), 2 amino acids contributed by linker DNA sequences, 256 amino acids of the HCV NS4 region (amino acids 1676-1931), and 10 additional amino acids contributed by linker DNA sequences.
- Figure 12 presents a schematic representation of the pHCV-31 antigen.
- the pHCV-31 plasmid was transformed into E.coli K-12 strain XL-I in a manner similar to the pHCV-34 and CKS-pTB210 plasmids of Example 1.
- pHCV CKS-33-BCD Characterization of pHCV CKS-33-BCD was carried out in a manner similar to pHCV CKS-Core of Example 1.
- pHCV-23, pHCV SDS/PAGE gels were run for E.coli lysates containing the plasmids pHCV-29 ( Figure 11), pHCV-23 ( Figure 12), and pHCV-31 ( Figure 13) expressing the recombinant fusion proteins CKS- 33c, CKS-BCD, and CKS-33-BCD, respectively.
- molecular weight standards were run in Lane M, with the arrows on the left indicating mobilities of the molecular weight markers the from top to bottom: 110,000;
- Lane 1 contained the E.coli lysate containing pHCV-29 expressing HCV CKS-33c (amino acids 1192 to 1457) prior to induction and lane 2 after 4 hours induction. These results show that the recombinant pHCV-29 fusion protein has an apparent mobility corresponding to a molecular size of 60,000 daltons. This compares acceptably to the predicted molecular mass of 54,911.
- Lane 1 contained the E.coli lysate containing pJO200- the CKS vector without the HCV sequence.
- Lane 2 contained pHCV-20 expressing the
- HCV CKS-B (amino acids 1676 to 1790).
- Lane 3 contained the fusion protein pHCV-23 (amino acids 1676-1931).
- Lane 1 contained the E.coli lysate containing pJO200 the CKS vector without the HCV sequences.
- Lane 2 contained pHCV-31 expressing the CKS- 33C-BCD fusion protein (amino acids 1192 to 1447 and 1676 to 1931) prior to induction and lane 3 after 2 hours induction.
- pHCV-31 (CKS-33c-BCD) fusion protein has an apparent mobility corresponding to a molecular size of 90,000 daltons. This compares acceptably to the predicted molecular mass of 82,995 daltons.
- An immunoblot was also run on one of the SDS/PAGE gels derived from the PHCV-31/X1-1 culture. Human serum from an HCV exposed individual reacted strongly with the major pHCV-31 band at 90,000 daltons. Normal human serum did not react with any component of the pHCV-31 (CKS-33-BCD) preparations.
- the procedure uses two E.coli expressed recombinant proteins, CKS-Core (pHCV-34) and CKS-33-BCD (pHCV- 31), representing three distinct regions of the HCV genome. These recombinant poiypeptides were prepared following procedures described above. In the screening assay, both recombinant antigens are coated onto the same polystyrene bead. In a modification of the screening assay the polystyrene bead may also be coated with the SOD-fusion polypeptide c100-3.
- the polystyrene beads are first washed with distilled water and propanol and then incubated with a solution containing recombinant pHCV-31 diluted to 0.5 to 2.0 ug/ml and pHCV-34 diluted to 0.1 to 0.5 ug/ml in 0.1 M NaH2PO 4 ⁇ H 2 O with
- the beads are incubated in the antigen solution for 2 hours (plus or minus 10 minutes) at 38-42°C, washed in PBS and soaked in 0.1% (w/v) Triton X-100 in PBS for 60 minutes at 38-42°C. The beads are then washed two times in phosphate buffered saline (PBS), overcoated with a solution of 5.0% (w/v) bovine serum albumin (BSA) in PBS for 60 minutes at 38-42°C and washed one time in PBS. Finally, the beads are overcoated with 5% (w/v) sucrose in PBS, and dried under nitrogen or air.
- PBS phosphate buffered saline
- BSA bovine serum albumin
- the polystyrene beads coated with pHCV-31 and pHCV-34 are used in an antibody capture format. Ten microliters of sample are added to the wells of the reaction tray along with 400 ul of a sample diluent and the recombinant coated bead.
- the sample diluent consists of 10% (v/v) bovine serum and 20% (v/v) goat serum in 20 mM Tris phosphate buffer containing 0.15% (v/v) Triton X-100, 1%(w/v) BSA, 1% E.coli lysate and 500 ug/ml or less CKS lysate.
- yeast extracts typically about 200 ug/ml. The addition of yeast extracts to the sample diluent is used to prevent false positive results.
- the final material is sterile filtered and filled in plastic bottles, and preserved with 0.1% sodium azide.
- the beads After one hour of incubation at 40°C, the beads are washed and 200 ul of conjugate is added to the wells of the reaction tray.
- the preferred conjugate is goat anti-human IgG horseradish peroxidase conjugate.
- Concentrated conjugate is titered to determine a working concentration.
- a twenty-fold concentrate of the working conjugate solution is then prepared by diluting the concentrate in diluent.
- the 20X concentrate is sterile filtered and stored in plastic bottles.
- the conjugate diluent includes 10% (v/v) bovine serum, 10% (v/v) goat serum and 0.15% Triton-X100 in 20 mM Tris buffer, pH 7.5 with 0.01% gentamicin sulfate, 0.01% thimerosal and red dye.
- the conjugate is sterile filtered and filled in plastic bottles.
- Anti-HCV positive control is prepared from plasma units positive for antibodies to HCV.
- the pool of units used includes plasma with antibodies reactive to pHCV-31 and pHCV-34.
- the units are recalcified and heat inactivated at 59-61°C for 12 hours with constant stirring.
- the pool is aliquoted and stored at -20°C or at 2-8°C.
- the stock solution is diluted with negative control containing 0.1% sodium azide as a preservative.
- the final material is sterile filtered and filled in plastic bottles.
- Anti-HCV negative control is prepared from recalcified human plasma, negative for antibodies to pHCV-31 and pHCV-34 proteins of HCV.
- the plasma is also negative for antibodies to human immunodeficiency virus (HIV) and negative for hepatitis B surface antigen (HBsAg).
- HCV human immunodeficiency virus
- HBsAg hepatitis B surface antigen
- the units are pooled, and 0.1% sodium azide is added as a preservative.
- the final material is sterile filtered and filled in plastic bottles.
- the cutoff for the assay should be at least 5-7 standard deviations above the absorbance value of the normal population mean.
- S/CO sample to cutoff
- Cutoff value 0.25 PCx + NCx.
- Testing may be performed by two methods which differ primarily in the degree of automation and the mechanism for reading the resulting color development in the assay.
- One method is referred to as the manual or QuantumTM method because Quantum or Quantumatic is used to read absorbance at 492 nm. It is also called the manual method because sample pipetting, washing and reagent additions are generally done manually by the technician, using appropriately calibrated pipettes, dispensers and wash instruments.
- the second method is referred to as the PPC method and utilizes the automated Abbott Commander® system.
- This system employs a pipetting device referred to as the Sample Management Center (SMC) and a wash/dispense/read device referred to as the Parallel Processing Center (PPC) disclosed in E.P.O. Publication No. 91114072.1.
- SMC Sample Management Center
- PPC Parallel Processing Center
- the optical reader used in the PPC has dual wavelength capabilities that can measure differential absorbencies (peak band and side band) from the sample wells. These readings are converted into results by the processor's Control Center
- Table I summarizes the results of a study which followed the course of HCV infection in seven chimpanzees using a screening assay which utilized the c100-3 polypeptide, and the screening assay which utilized pHCV-31 and pHCV-34. Both assays gave negative results before inoculation and both assays detected the presence of antibodies after the animal had been infected with HCV. However, in the comparison of the two assays, the assay utilizing pHCV- 31 and pHCV-34 detected seroconversion to HCV antigens at an earlier or equivalent bleed date in six of the seven chimpanzees. Data from these chimpanzee studies clearly demonstrate that overall detection of HCV antibodies is greatly increased with the assay utilizing the pHCV-31 and pHCV-34 proteins. This test is
- Non-A. Non-B Panel II ( ⁇ . Alter. NIH)
- probable infectious were three samples taken from the same post transfusion hepatitis patient.
- the first two acute phase samples were negative in both assays, but the third sample was reactive in both assay.
- the disease control samples and pedigreed negative controls were uniformly negative.
- Specimen 39 was initially reactive in the screening test utilizing pHCV-34 and pHCV-31 , but upon retesting was negative and could not be confirmed by the confirmatory assays.
- both screening tests identified 6 of 6 chronic NANBH carriers and 1 of 4 acute NANBH samples. Paired specimens from an implicated donor were non-reactive in the screening test utilizing c100-3 but were reactive in the screening test with pHCV-31 and pHCV-34. Thus, the screening test utilizing the recombinant antigens pHCV-31 and pHCV-34 appears to be more sensitive than the screening assay utilizing c100-3. None of the disease control specimens or pedigreed negative control specimens were reactive in either screening assay.
- a reference panel for antibody to Hepatitis C was received from the Center for Biologies Evaluation and Research (CBER).
- This 10 member panel consists of eight reactive samples diluted in normal human sera negative for antibody to HCV and two sera that contain no detectable antibody to HCV.
- This panel was run on the Ortho first generation HCV EIA assay, the screening assay utilizing d 00-3 and the screening assay utilizing pHCV-31 and pHCV-34. The assay results are presented in Figure 15.
- the screening assay utilizing pHCV-31 and pHCV-34 detected all six of the HCV positive or borderline sample dilutions.
- the two non-reactive sample dilutions (709 and 710) appear to be diluted well beyond endpoint of antibody detectabiiity for both screening assays.
- a marked increase was observed in the sample to cutoff values for three of the members on the screening assay utilizing pHCV-31 and pHCV-34 compared to the screening assay utilizing c100-3 or the Ortho first generation test. All repeatably reactive specimens were confirmed.
- the confirmatory assay provides a means for unequivocally identifying the presence of an antibody that is immunologically reactive with an HCV antigen.
- the confirmatory assay includes synthetic peptides or recombinant antigens
- Recombinant proteins used in the confirmatory assay should have a heterologous source of antigen to that used in the primary screening assay (i.e. should not be an E.coli-derived recombinant antigen nor a recombinant antigen composed in part, of CKS sequences). Specimens repeatedly reactive in the primary screening assay are retested in the confirmatory assay. Aliquots containing identical amounts of specimen are contacted with a synthetic peptide or recombinant antigen individually coated onto a polystyrene bead.
- Sero reactivity for epitopes within the c100-3 region of the HCV genome are confirmed by use of the synthetic peptides sp67 and sp65.
- the synthetic peptide sp117 can also be used to confirm seroreactivity with the c100-3 region.
- the assay protocols were similar to those described in Example 3 above.
- the peptides are each individually coated onto polystyrene beads and used in an antibody capture format similar to that described for the screening assay.
- Ten microliters of specimen are added to the wells of a reaction tray along with 400 ul of a specimen diluent and a peptide coated bead.
- the beads After one hour of incubation at 40°C, the beads are washed and 200 ul of conjugate (identical to that described in Example 3) is added to the wells of the reaction tray.
- the beads After one hour of incubation at 40°C, the beads are washed, exposed to the OPD substrate for 30 minutes at room temperature and the reaction terminated by the addition of 1 N H 2 SO 4 .
- the absorbance is read at 492 nm.
- the cutoff value for the peptide assay is 4 times the mean of the negative control absorbance value.
- a group of 233 specimens representing 23 hemodialysis patients all with clinically diagnosed NANBH were supplied by Gary Gitnick, M.D. at the University of California, Los Angeles Center for the Health Sciences. These samples which were tested in by the screening assay utilizing d 00-3 were subsequently tested in the screening assay which uses pHCV-31 and pHCV-34. A total of 7/23 patients (30.44%) were reactive in the c100-3 screening assay, with a total of 36 repeat reactive specimens. Ten of 23 patients (43.48%) were reactive by the screening assay utilizing pHCV-31 and pHCV-34, with a total of 70 repeatable reactives among the available specimens (Figure 16). Two specimens were unavailable for testing.
- a population of specimens was identified from individuals diagnosed as having acute or chronic NANBH. Specimens from individuals with acute cases of NANBH were received from Gary Gitnick, M.D. at the University of California, Los
- hepatitis was based on the presence of a cytolytic syndrome (ALT levels greater than 2X the upper normal limit) on at least 2 serum samples for a duration of less than 6 months with or without other biological abnormalities and clinical symptoms. All specimens were also negative for IgM antibodies to Hepatitis A Virus (HAV) and were negative for Hepatitis B surface Ag when tested with commercially available tests. Specimens from cases of chronic NANBH were obtained from two clinical sites. Individuals were diagnosed as having chronic NANBH based on the following criteria:
- Specimens with biopsy results were further categorized as either chronic active NANBH, chronic persistent NANBH, or chronic NANBH with cirrhosis.
- the c100-3 screening assay detected 2 of 10 specimens (20.00%) as repeatedly reactive, both of which were confirmed.
- the screening assay utilizing pHCV-34 and pHCV-31 detected both of these specimens plus and additional 2 specimens ( Figure 18). These 2 specimens were confirmed by sp75 (see Figure 1 9) .
- the c100-3 assay detected 4 of 32 specimens (12.50%) as repeatedly reactive, all of which was confirmed.
- the screening assay utilizing pHCV-34 and pHCV-31 detected 3 out of these 4 specimens (75%) as reactive.
- the one sample that was missed had an S/CO of 0.95 by the latter screening test.
- This sample was confirmed by the sp67 peptide ( Figure 18).
- the screening assay utilizing pHCV-34 and pHCV-31 detected 11 specimens not reactive in the c100-3 screening assay. Of the 9 specimens available for confirmation, 8 were confirmed by sp75 and 1 could not be confirmed but had an S/CO of 0.90 in the sp65
- the recombinant poiypeptides containing antigenic HCV epitopes are useful for competition assays.
- a recombinant polypeptide representing epitopes within the c100-3 region such as CKS-BCD (pHCV-23) is solubilized and mixed with a sample diluent to a final concentration of 0.5-50 ug/ml.
- Ten microliters of specimen or diluted specimen is added to a reaction well followed by 400 ul of the sample diluent containing the recombinant polypeptide and if desired, the mixture may be preincubated for about fifteen minutes to two hours.
- a bead coated with c100-3 antigen is then added to the reaction well and incubated for one hour at 40°C. After washing, 200 ul of a peroxidase labeled goat anti-human IgG in conjugate diluent is added and incubated for one hour at 40°C. After washing, OPD substrate is added and incubated at room temperature for thirty minutes. The reaction is terminated by the addition of 1 N sulfuric acid and the absorbance read at 492 nm.
- Samples containing antibodies to the c1 00-3 antigen generate a reduced signal caused by the competitive binding of the peptides to these antibodies in solution.
- the percentage of competitive binding may be calculated by comparing the absorbance value of the sample in the presence of a recombinant polypeptide to the absorbance value of the sample assayed in the absence of a recombinant polypeptide at the same dilution.
- EXAMPLE 6. IMMUNODOT ASSAY
- the immunodot assay system uses a panel of purified recombinant poiypeptides placed in an array on a nitrocellulose solid support.
- the prepared solid support is contacted with a sample and captures specific antibodies to HCV antigens.
- the captured antibodies are detected by a conjugate-specific reaction.
- the conjugate specific reaction is quantified using a reflectance optics assembly within an instrument which has been described in U.S. Patent Applications Serial No. 07/227,408 filed August 2, 1988.
- the related U.S. Patent Applications Serial Nos. 07/227,272, 07/227,586 and 07/227,590 further describe specific methods and apparatus useful to perform an immunodot assay.
- the assay has also been described in U.S. Application Serial No.
- a nitrocellulose-base test cartridge is treated with multiple antigenic poiypeptides. Each polypeptide is contained within a specific reaction zone on the test cartridge. After all the antigenic poiypeptides have been placed on the nitrocellulose, excess binding sites on the nitrocellulose are blocked. The test cartridge is then contacted with a sample such that each antigenic polypeptide in each reaction zone will react if the sample contains the appropriate antibody. After reaction, the test cartridge is washed and any antigen-antibody reactions are identified using suitable well known reagents.
- the recombinant poiypeptides pHCV-23, pHCV-29, pHCV-34, and c100-3 were diluted in the preferred buffers, pH conditions, and spotting concentrations as summarized in Figure 21 and applied to a preassembled nitrocellulose test cartridge. After drying the cartridge overnight at room temperature 37°C, the non-specific binding capacity of the nitro-cellulose phase was blocked.
- the blocking solution contained 1% porcine gelatin, 1% casein enzymatic hydrolysate, 5% Tween-20, 0.1% sodium azide, 0.5 M sodium chloride and 20 mM Tris, pH 7.5.
- sample A00642 was from a convalescent non-A, non-B hepatitis patient, diluted in negative human plasma from 1 :100 to 1 :12800.
- the other sample, 423 was from a paid plasma donor which tested positive in an assay using a recombinant c100-3 polypeptide, diluted in negative human plasma from 1 :40 to 1 :2560.
- sample A00642 was greatest with pHCV-29, and decreased for the remaining antigens pHCV-23, c100-3, and pHCV-34.
- Sample 423 most strongly reacted with the recombinant proteiss expressing pHCV-29 and pHCV-34, and to a lesser extent with pHCV-23 and c100- 3.
- HCV-45 Eight individual oligonucleotides representing amino acids 1932-2191 of the HCV genome were ligated together and cloned as a 793 base pair EcoRI-BamHI fragment into the CKS fusion vector pJ0200.
- the resulting plasmid designated pHCV-45 (SEQ.ID.NO 8), expresses the HCV CKS-NS5E antigen under control of the ]ac promoter.
- the HCV CKS-NS5E antigen consists of 239 amino acids of CKS, nine amino acids contributed by linker DNA sequences, and 260 amino acids from the HCV NS4/NS5 region (amino acids 1932-2191).
- Figure 23 presents a schematic representation of the recombinant antigen expressed by pHCV-45.
- SEQ.ID.NO. 10 and 11 presents the DNA and amino acid sequence of the HCV CKS-NS5E recombinant antigen produced by pHCV-45.
- Figure 24 presents the expression of pHCV-45 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-45
- HCV-48 expresses the HCV CKS-NS5F antigen under control of the lac promoter.
- the HCV CKS-NS5F antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 294 amino acids from the HCV NS5 region (amino acids 2188-2481).
- Figure 25 presents a schematic representation of the recombinant antigen expressed by pHCV-48. SEQ.ID.NO.
- FIG. 12 and 13 presents the DNA and amino acid sequence of the HCV CKS-NS5F recombinant antigen produced by pHCV-48.
- Figure 26 presents the expression of pHCV-48 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-48 expressing the HCV CKS-NS5F antigen (amino acids 2188-2481) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
- These results show that the pHCV-48 fusion protein has an apparent mobility corresponding to a molecular size of 65,000 daltons. This compares acceptably to the predicted molecular mass of 58,985 daltons.
- HCV-51 Seven individual oligonucleotides representing amino acids 2480-2729 of the HCV genome were ligated together and cloned as a 769 base pair EcoRI-BamHI fragment into the CKS fusion vector pJ0200.
- the resulting plasmid designated pHCV-51 (SEQ.ID.NO. 10), expresses the HCV CKS-NS5G antigen under control of the lac promoter.
- the HCV CKS-NS5G antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 250 amino acids from the HCV NS5 region (amino acids 2480-2729).
- Figure 27 presents a schematic representation of the recombinant antigen expressed by pHCV-51.
- SEQ.NO.ID NO.14 and 15 presents the DNA and amino acid sequence of the HCV CKS-NS5G recombinant antigen produced by pHCV-51.
- Figure 28 presents the expression of pHCV-51 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-51 expressing the HCV CKS-NS5G antigen (amino acids 2480-2729) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
- pHCV-50 expresses the HCV CKS-NS5H antigen under control of the lac promoter.
- the HCV CKS-NS5H antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 140 amino acids from the HCV NS5 region (amino acids 2728-2867).
- Figure 29 presents a schematic representation of the recombinant antigen expressed by pHCV-50. SEQ.ID.NO.
- 16 and 17 presents the DNA and amino acid sequence of the HCV CKS-NS5H recombinant antigen produced by pHCV-50.
- Figure 30 presents the expression of pHCV-50 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-50
- HCV-49 Six individual oligonucleotides representing amino acids 2866-3011 of the HCV genome were ligated together and cloned as a 460 base pair EcoRI-BamHI fragment into the CKS fusion vector pJ0200.
- the resulting plasmid designated pHCV-49 (SEQ.NO.ID.NO. 12), expresses the HCV CKS-NS5I antigen under control of the lac promoter.
- the HCV CKS-NS5I antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 146 amino acids from the HCV NS5 region (amino acids 2866-3011).
- Figure 31 presents a schematic representation of the recombinant antigen expressed by pHCV-49.
- SEQ.ID.NO. 18 and 19 presents the DNA and amino acid sequence of the HCV CKS-NS5I recombinant antigen produced by pHCV-49.
- Figure 32 presents the expression of pHCV-49 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-49 expressing HCV CKS-NS5I antigen (amino acids 2866-3011) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
- These results show that the pHCV-49 fusion protein has an apparent mobility corresponding to a molecular size of 42,000 daltons. This compares acceptably to the predicted molecular mass of 43,497 daltons.
- F Immunoblot of HCV CKS-NS5 Antigens
- Induced E.coli lysates containing pHCV-23, pHCV-45, pHCV-48, pHCV-51, pHCV-50, or pHCV-49 were individually run on preparative SDS/PAGE gels to separate the various HCV CKS-NS5 or HCV CKS-BCD recombinant antigens assay from the majority of other E.coli proteins.
- Gel slices containing the separated individual HCV CKS-NS5 or HCV CKS-BCD recombinant antigens were then electropheretically transferred to nitrocellulose, and the nitrocellulose sheet cut into strips.
- Figure 40 presents the results of a Western Blot analysis of various serum or plasma samples using these nitrocellulose strips.
- HCV CKS-NS5F pHCV-51
- HCV-50 HCV CKS-NS5H
- pHCV-49 HCV CKS-NS5I
- Panel A contained five normal human plasma
- panel B contained five normal human sera
- panel C contained twenty human sera positive in the Abbott HCV EIA test
- panel D contained two mouse sera directed against CKS
- panel E contained two normal mouse sera.
- Both the HCV CKS-NS5E antigen expressed by pHCV-45 and the HCV CKS-NS5F antigen expressed by pHCV-48 were immunoreactive when screened with human serum samples containing HCV antibodies.
- the HCV CKS-c100 antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, 363 amino acids from the HCV NS4 region (amino acids 1569-1931) and 10 additional amino acids contributed by linker DNA sequences.
- the HCV CKS-c100 antigen was expressed at very low levels by pHCV-24.
- pHCV-58 SEQ.ID.NO. 22 and 23
- HCV-58 contains a 21 amino acid deletion (HCV amino acids 1600-1620) and was constructed by deleting a 63 base pair NlalV-Haelll restriction fragment.
- Figure 34 presents a schematic representation of the recombinant antigens expressed by pHCV-24, pHCV-57, and pHCV-58.
- SEQ.ID. NO. 13 presents the DNA and amino acid sequence of the HCV-C100D1 recombinant antigen produced by pHCV-57.
- SEQ.ID.NO. 14 presents the DNA and amino acid sequence of the HCV- C100D2 recombinant antigen produced by pHCV-58.
- Figure 35 presents the expression of pHCV-24, pHCV-57, and pHCV-58 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-24 expressing the HCV CKS-c100 antigen (amino acids 1569-1931) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
- Lane 4 contained the E.coli lysate containing pHCV-57 expressing the HCV-CKS-C100D1 antigen (amino acids 1569-1574 and 1598-1931) prior to induction and lanes 5 and 6 after 2 and 4 hours induction, respectively.
- Lane 7 contained the E.coli lysate containing pHCV-58 expressing the HCV CKS-C100D2 antigen (amino acids 1569-1599 and 1621 -1931) prior to induction, and lanes 8 and 9 after 2 and 4 hours induction, respectively.
- HCV-105 expresses the HCV CKS-NS3 antigen under control of the ]ac promoter.
- the HCV CKS-NS3 antigen consists of 239 amino acids of CKS, 12 amino acids contributed by linker DNA sequences, 157 amino acids from the HCV NS3 region (amino acids 1473-1629), and 9 additional amino acids contributed by linker DNA sequences.
- Figure 36 presents a schematic representation of the pHCV-105 antigen.
- SEQ.ID.NO. 24 and 25 presents the DNA and amino acid sequence of the HCV CKS-NS3 recombinant antigen produced by pHCV-105.
- Figure 37 presents the expression of pHCV-105 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-105 expressing the HCV CKS-NS3 antigen (amino acids 1472-1629) prior to induction and lanes 2 and 3 after 2 and 4 hours induction, respectively.
- These results show that the pHCV-105 fusion protein has an apparent mobility corresponding to a molecular mass of 43,000 daltons. This compares acceptably to the predicted molecular mass of 46,454 daltons.
- a 489 base pair DNA fragment from the putative envelope region of HCV was generated by PCR.
- This fragment represents the HCV amino acids 1 14-276 and was cloned into the CKS expression vector pJ0202 using EcoRI-BamHI restriction sites.
- the resulting clone designated pHCV-103 (SEQ.ID.NO. 26 and 27), expresses the HCV CKS-5'ENV antigen under control of the lac promoter.
- the HCV CKS-5 ⁇ NV antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 163 amino acids from the HCV envelope region (amin ⁇ acids 1 14-276), and 16 additional amino acids contributed by linker DNA sequences.
- FIG 38 presents a schematic representation of the pHCV-103 antigen.
- SEQ.ID.NO. 26 and 27 presents the DNA and amino acid sequence of the HCV CKS-5'ENV recombinant antigen produced by pHCV-103.
- Figure 37 presents the expression of pHCV-103 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-103 expressing the HCV CKS- 5 ⁇ NV antigen (amino acids 1 14-276) prior to induction and lanes 5 and 6 after 2 and 4 hours induction, respectively.
- These results show that the pHCV-103 fusion protein has an apparent mobility corresponding to a molecular mass of 47,000 daltons. This compares acceptably to the predicted molecular mass of 46,091 daltons.
- HCV CKS-3 ⁇ NV antigen expresses the HCV CKS-3'ENV antigen under control of the lac promoter.
- the HCV CKS-3 ⁇ NV antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 207 amino acids from the HCV envelope region (amino acids 263-469), and 15 additional amino acids contributed by linker DNA sequences.
- Figure 39 presents a schematic representation of the pHCV-101 antigen.
- SEQ.ID.NO. 28 and 29 presents the DNA and amino acid sequence of the HCV CKS-3 ⁇ NV recombinant antigen produced by pHCV-101.
- FIG 37 presents the expression of pHCV-101 proteins in E.coli Lane 7 contained the E.coli lysate containing pHCV-101 expressing the HCV CKS-3'E NV antigen (amino acids 263-469) prior to induction and lanes 8 and 9 after 2 and 4 hours induction, respectively. These resulting show that the pHCV-101 fusion protein has an apparent mobility corresponding to a molecular mass of 47,000 daltons. This compares acceptably to the predicted molecular mass of 51 ,181 daltons.
- a 636 base pair DNA fragment from the putative NS2 region of HCV was generated by PCR. This fragment represents the HCV amino acids 994-1205 and was cloned into the CKS expression vector pJ0201 using EcoRI restriction sites. The resulting clone, designated pHCV-102, expresses the HCV CKS-NS2 antigen under control of the lac promoter.
- the HCV CKS-NS2 antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 212 amino acids from the HCV NS2 region (amino acids 994- 1205), and 16 additional amino acids contributed by linker DNA sequences.
- Figure 40 presents a schematic representation of the pHCV-102 antigen.
- SEQ.ID.NO. 30 and 31 presents the DNA and amino acid sequence of the HCV CKS-NS2 recombinant antigen produced by pHCV-102.
- Figure 41 presents the expression of pHCV-102 proteins in E.coli.
- Lane 1 contained the E.coli lysate containing pHCV-102 expressing the HCV CKS-NS2 antigen (amino acids 994-1205) prior to induction and lanes 2 and 3 after 2 and 4 hours induction, respectively.
- These results show that the pHCV-102 fusion protein has an apparent mobility corresponding to a molecular mass of 53,000 daltons. This compares acceptably to the predicted molecular mass of 51,213 daltons.
- HCV-107 expresses the HCV CKS-NS1 antigen under control of the Jac promoter.
- the HCV CKS-NS1 antigen consists of 239 amino acids of CKS, 10 amino acids contributed by linker DNA sequences, and 218 amino acids from the HCV NS1 region (amino acids 617-834).
- Figure 42 presents a schematic representation of the pHCV-107 antigen.
- SEQ.ID.NO. 32 and 33 presents the DNA and amino acid sequence of the HCV CKS-NS1 recombinant antigen produced by pHCV-107.
- HCV-104 expresses the HCV CKS-ENV antigen under control of the lac promoter.
- the HCV CKS-ENV antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 356 amino acids from the HCV envelope region (amino acids 114- 469), and 15 additional amino acids contributed by linker DNA sequences.
- Figure 43 presents a schematic representation of the pHCV-104 antigen.
- SEQ.ID.NO. 34 and 35 presents the DNA and amino acid sequence of the HCV CKS-ENV recombinant antigen produced by pHCV-104.
- the amino acid sequence of this antigen is designated as pHCV-77 (SEQ. ID. NO. 1).
- the resultant fusion protein HCV CKS-NS1S1 consists of 239 amino acids of CKS, seven amino acids contributed by linked DNA sequences, and 215 amino acids from the NS1 region of the HCV genome.
- pHCV-77 was transformed into E.coli K-12 strain XL-1 (recA1 , endA1 , gyrA96, thi-1 , hsdRl 7, SupE44, relA1 , Iac/f1 , p10AB, lacl1ADM15, TN10) cells.
- Expression analysis and characterization of the recombinant protein was done using polyacrylamide gel electrophoresis as described in Example 1.
- the apparent molecular weight of the pHCV-77 antigen was the same as the expected molecular weight of 50,228 as visualized on a coumassie stained gel.
- FIGURE 47A presents the expression of pHCV-77 in E. coli.
- FIGURE 47B presents an immunoblot of the pHCV-77 antigen expressed in E. coli.
- Lane 1 contained the E. coli lysate containing pHCV-77 expressing the HCV CKS-NS1S1 antigen prior to induction and Lanes 2 and 3 are 2 and 4 hours post-induction, respectfully.
- EXAMPLE 11 HCV CKS-NS1S2
- the resultant fusion protein HCV CKS-NS1S2 consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 167 amino acids from the NS1 region of the HCV genome.
- pHCV-65 was transformed into E.coli K-12 strain XL-1 (recA1 , endA1 , gyrA96, thi-1 , hsdR17, SupE44, relAI , lac/f 1 , p10AB, laclqAMD15, TN10) cells.
- Expression analysis and characterization of the recombinant protein was done using polyacrylamide gel electrophoresis as described in Example 1.
- the apparent molecular weight of the pHCV-65 antigen was the same as the expected molecular weight of 46,223 as visualized on a coumassie stained gel.
- FIGURE 48A presents the expression of pHCV-65 in E. coli.
- FIGURE 48B presents an immunoblot of the pHCV-65 antigen expressed in E. coli.
- Lane 1 contained the E. coli lysate containing pHCV-65 expressing the HCV CKS-NS1S2 antigen prior to induction and Lanes 2 and 3 are 2 and 4 hours post-induction, respectively.
- EXAMPLE 12. CKS-NS1S3
- the resultant fusion protein HCV CKS-NS1S3 consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 131 amino acids from the NS1 region of the HCV genome.
- pHCV-78 was transformed into E.coli K-12 strain XL-1 (recA1 , endA1 , gyrA96, thi-1 , hsdR17, SupE44, relAI , lac/f 1 , p10AB, laclqADM15, TN10) cells.
- Expression analysis and characterization of the recombinant protein was done using polyacrylamide gel electrophoresis as described in Example 1. Analysis of the coumassie stained gel indicated very low levels of expression of the protein with an expected molecular weight of 42,1141. Western blot analysis also failed to show any immunoreactivity and we are continuing to identify human sera that is specific to this region of NS1.
- the resultant HCV gene represents amino acids 365-731 of the HCV genome. This resulted in a 1101 base pair EcoRI/BamHI fragment of HCV cloned into the CKS fusion vector pJO200. The complete amino acid sequence of this antigen is designated as pHCV-80 (SEQ. ID. NO. 4).
- the resultant fusion protein HCV CKS NS1S1-NS1S2 consists of 239 amino acids of CKS, seven amino acids contributed by linker DNA sequences, and 367 amino acids from the NS1 region of the HCV genome.
- HCV-NS1S1-NS1S2 pHCV-80 was transformed into E.coli K-12 strain XL-1 (recA1, endA1, gyrA96, thi-1 , hsdR17, SupE44, relAI , lac/f 1 , p10AB, laclqADM15, TN10) cells.
- FIGURE 49A presents the expression of pHCV-80 in E. coli.
- FIGURE 49B presents an immunoblot of pHCV- 80 antigen expressed in E. coli.
- Lane 1 contained the E. coli lysate containing pHCV- 80 expressing the HCV CKS-NS1S1-NS1S2 antigen prior to induction and Lanes 2 and 3 are 2 and 4 hours post-induction, respectively.
- pHCV-92 SEQ. ID. NO. 5
- NS1 full length NS1
- the resultant fusion protein HCV CKS-full length NS1 consists of 239 amino acids of CKS, seven amino acids contributed by linker DNA sequences, and 483 amino acids from the NS1 region of the HCV genome.
- pHCV-92 was transformed into E.coli K-12 strain XL-1 (recA1 , endA1 , gyrA96, thi-1, hsdR17, SupE44, relAI , lac/f 1 , plOAB, laclqADM15, TN10) cells.
- Expression analysis and characterization of the recombinant protein was done using polyacrylameide gel electrophoresis as described in Example 1. The expression levels as seen by counassie stained gel were virtually undectable and the Western blot indicated no immunoreactivity. We are still in the process of identifying sera that will recognize this region of HCV NS1.
- the present invention thus provides unique recombinant antigens
- the NS1 protein is considered to be a rron-structural membrane glycoprotei ⁇ and to be able to elicit a protective immune response of the host against lethal viral infection.
- recombinant antigens either alone or in combination, can be used in the assay formats provided herein and exemplified in the Examples. It also is contemplated that these recombinant antigens can be used to develop specific inhibitors of viral replication and used for therapeutic purposes, such as for vaccines. Other applications and modifications of the use of these antigens and the specific embodiments of this inventions as set forth herein, will be apparent to those skilled in the art. Accordingly, the invention is intended to be limited only in accordance with the appended claims.
- NAME POREMBSKI, PRISCILLA E.
- MOLECULE TYPE DNA (genomic)
- AAAGC GGA TA CGG CGTT GTG GGCTTTGTATGACAGCCAGG GAAACCCAATGCGTTAATG 1677
- MOLECULE TYPE DNA (genomic)
- GGT CTG CTG CAG ACC
- GCT TCT CGT CAG
- GCT GAA GTT
- ATC GCT CCG
- GCT 1896 Gly Leu Leu Gln Thr Ala Ser Arg Gln Ala Glu Val lle Ala Pro Ala
- GCT CTG GTT GCT TTC AAA ATC ATG TCT GGT GAA GTT CCG TCT ACC GAA 2280 Ala Leu Val Ala Phe Lys lle Met Ser Gly Glu Val Pro Ser Thr Glu
- CAGGGAAACC CAATGCCGTT AATGG CAAGAAGCTTAGCCCGCCTAATGAGCGGGCTTTTT 2832
- GTCCGCATC TCCAGCAGCC GCACGCGGCG CATCTCGGGC AGCGTTGGGT CCTGGCCACG 3312 GGTGCGCATG ATCGTGCTCC TGTCG TTGAG GACCCGGCTA GGCTGGCGGG GTTGCCTTAC 3372
- GAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCV GAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCV.GTTACCTTCGGAAAAAGAGTTG 4272 GTAGCTCTTGATCCGGCAAA CAAACC ACCGCTGGTAGCGGTGGT T T T T T T GTTTGCAAGC 4332 AGCAGATT ACGCAGAAAA AAAGGATCTCAAGAAGATCC TTT GATCTTT TCTACGGGGT 4392 CTGACGCTCAGTGGAACGAA AACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAA 4452
- CTCCAGATTT ATCAG CAATAAACC AGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTG 4752
- MOLECULE TYPE DNA (genomic)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP5504658A JPH06510191A (ja) | 1991-08-21 | 1992-08-21 | Ns1に対する組換え抗原を利用したc型肝炎アッセイ |
EP92918853A EP0600009A4 (fr) | 1991-08-21 | 1992-08-21 | Depistage de l'hepatite c a l'aide d'antigenes recombines diriges contre la region ns1. |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US74856191A | 1991-08-21 | 1991-08-21 | |
US748,561 | 1991-08-21 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1993004088A1 true WO1993004088A1 (fr) | 1993-03-04 |
Family
ID=25009968
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1992/007188 WO1993004088A1 (fr) | 1991-08-21 | 1992-08-21 | Depistage de l'hepatite c a l'aide d'antigenes recombines diriges contre la region ns1 |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP0600009A4 (fr) |
JP (1) | JPH06510191A (fr) |
AU (1) | AU2513592A (fr) |
CA (1) | CA2115926A1 (fr) |
TW (1) | TW213924B (fr) |
WO (1) | WO1993004088A1 (fr) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995020664A2 (fr) * | 1994-01-28 | 1995-08-03 | Abbott Laboratories | Systemes d'expression mammaliens pour des genes d'enveloppe du virus de l'hepatite c |
EP0979867A2 (fr) * | 1993-11-04 | 2000-02-16 | Innogenetics N.V. | Epitopes de lymphocytes T humains immunodominants du virus de l'hépatite C |
EP1211315A1 (fr) * | 1994-07-29 | 2002-06-05 | Innogenetics N.V. | Vecteurs récombinants pour la production de protéines d'enveloppe de HCV |
US7157226B1 (en) * | 1993-04-27 | 2007-01-02 | Innogenetics S.A. | Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents |
US7196183B2 (en) | 2001-08-31 | 2007-03-27 | Innogenetics N.V. | Hepatitis C virus genotype, and its use as prophylactic, therapeutic and diagnostic agent |
EP2062913A1 (fr) | 1998-05-28 | 2009-05-27 | Abbott Laboratories | Cocktails d'antigènes, P35, et utilisations associées |
US8124747B2 (en) | 2003-08-29 | 2012-02-28 | Innogenetics | HCV clade and prototype sequences thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0318216A1 (fr) * | 1987-11-18 | 1989-05-31 | Chiron Corporation | Diagnostics et vaccins de NANBV |
EP0331961A2 (fr) * | 1988-03-11 | 1989-09-13 | Abbott Laboratories | Procédé pour la production de protéines en utilisant de protéines fusionnées du type CKS |
EP0388232A1 (fr) * | 1989-03-17 | 1990-09-19 | Chiron Corporation | Diagnostics et vaccins de NANBV |
US5106726A (en) * | 1990-02-16 | 1992-04-21 | United Biomedical, Inc. | Synthetic peptides specific for the detection of antibodies to HCV |
-
1992
- 1992-08-21 CA CA 2115926 patent/CA2115926A1/fr not_active Abandoned
- 1992-08-21 AU AU25135/92A patent/AU2513592A/en not_active Abandoned
- 1992-08-21 EP EP92918853A patent/EP0600009A4/fr not_active Withdrawn
- 1992-08-21 WO PCT/US1992/007188 patent/WO1993004088A1/fr not_active Application Discontinuation
- 1992-08-21 JP JP5504658A patent/JPH06510191A/ja active Pending
- 1992-09-03 TW TW81106995A patent/TW213924B/zh active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0318216A1 (fr) * | 1987-11-18 | 1989-05-31 | Chiron Corporation | Diagnostics et vaccins de NANBV |
EP0331961A2 (fr) * | 1988-03-11 | 1989-09-13 | Abbott Laboratories | Procédé pour la production de protéines en utilisant de protéines fusionnées du type CKS |
EP0388232A1 (fr) * | 1989-03-17 | 1990-09-19 | Chiron Corporation | Diagnostics et vaccins de NANBV |
US5106726A (en) * | 1990-02-16 | 1992-04-21 | United Biomedical, Inc. | Synthetic peptides specific for the detection of antibodies to HCV |
Non-Patent Citations (7)
Title |
---|
BioTechniques, Volume 8, No. 5, issued May 1990, T.J. BOLLING et al., "An Escherichia Coli Expression Vector for High-Level Production of Heterologous Proteins in Fusion with CMP-KDO Synthetase", pp. 488-492, see entire document. * |
Journal of General Virology, Volume 72, issued November 1991, H. OKAMOTO et al., pp. 2697-2704, see entire document. * |
Journal of General Virology, Volume 72, issued October 1991, D. KREMSDORF et al., "Partial Nucleotide Sequence Analysis of a French Hepatitis C Virus: Implications for HCV Genetic Variability in the E2/NS1 Protein", pp. 2557-2561, see entire document. * |
Journal of Virology, Volume 65, No. 3, issued March 1991, A. TAKAMIZAWA et al., "Structure and Organization of the Hepatitis C Virus Genome Isolated from Human Carriers", pp. 1105-1113, see entire document. * |
Proceedings of the National Academy of Sciences, Volume 87, issued December 1990, N. KATO et al., "Molecular Cloning of the Human Hepatitis C Virus Genome from Japanese Patients with Non-A, Non-B, Hepatitis", pp. 9524-9528, see entire document. * |
Proceedings of the National Academy of Sciences, Volume 88, issued March 1991, Q.-L. CHOO et al., "Genetic Organization and Diversity of the Hepatitis C Virus", pp. 2451-2455, see entire document. * |
See also references of EP0600009A4 * |
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7157226B1 (en) * | 1993-04-27 | 2007-01-02 | Innogenetics S.A. | Sequences of hepatitis C virus genotypes and their use as therapeutic and diagnostic agents |
EP0979867A2 (fr) * | 1993-11-04 | 2000-02-16 | Innogenetics N.V. | Epitopes de lymphocytes T humains immunodominants du virus de l'hépatite C |
EP0979867A3 (fr) * | 1993-11-04 | 2007-06-13 | Innogenetics N.V. | Epitopes de lymphocytes T humains immunodominants du virus de l'hépatite C |
WO1995020664A2 (fr) * | 1994-01-28 | 1995-08-03 | Abbott Laboratories | Systemes d'expression mammaliens pour des genes d'enveloppe du virus de l'hepatite c |
WO1995020664A3 (fr) * | 1994-01-28 | 1995-12-28 | Abbott Lab | Systemes d'expression mammaliens pour des genes d'enveloppe du virus de l'hepatite c |
US5610009A (en) * | 1994-01-28 | 1997-03-11 | Abbott Laboratories | Mammalian expression systems for hepatitis C virus envelope genes |
EP1211315A1 (fr) * | 1994-07-29 | 2002-06-05 | Innogenetics N.V. | Vecteurs récombinants pour la production de protéines d'enveloppe de HCV |
EP2062913A1 (fr) | 1998-05-28 | 2009-05-27 | Abbott Laboratories | Cocktails d'antigènes, P35, et utilisations associées |
US7196183B2 (en) | 2001-08-31 | 2007-03-27 | Innogenetics N.V. | Hepatitis C virus genotype, and its use as prophylactic, therapeutic and diagnostic agent |
US8124747B2 (en) | 2003-08-29 | 2012-02-28 | Innogenetics | HCV clade and prototype sequences thereof |
Also Published As
Publication number | Publication date |
---|---|
TW213924B (fr) | 1993-10-01 |
EP0600009A1 (fr) | 1994-06-08 |
EP0600009A4 (fr) | 1995-03-01 |
AU2513592A (en) | 1993-03-16 |
JPH06510191A (ja) | 1994-11-17 |
CA2115926A1 (fr) | 1993-03-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Selby et al. | Complex processing and protein: protein interactions in the E2: NS2 region of HCV | |
US5372928A (en) | Hepatitis C virus isolates | |
Falgout et al. | Deletion analysis of dengue virus type 4 nonstructural protein NS2B: identification of a domain required for NS2B-NS3 protease activity | |
CN100365017C (zh) | 肺炎衣原体抗原多肽 | |
Bartenschlager et al. | Nonstructural protein 3 of the hepatitis C virus encodes a serine-type proteinase required for cleavage at the NS3/4 and NS4/5 junctions | |
US6593083B1 (en) | Hepatitis C assay utilizing recombinant antigens | |
Lanford et al. | Analysis of hepatitis C virus capsid, E1, and E2/NS1 proteins expressed in insect cells | |
EP0472207B1 (fr) | Essai d'hépatite C utilisant des antigènes recombinants | |
JPH06107687A (ja) | 抗ウイルス剤 | |
Pilot‐Matias et al. | Identification of antigenic regions in the GB hepatitis viruses GBV‐A, GBV‐B, and GBV‐C | |
EP0846164B1 (fr) | Procede pour tester l'activite proteolytique de polypeptides ayant une activite de protease hcv ns3 et peptides substrats a utiliser dans cette methode. | |
EP1227323B1 (fr) | Antigène du virus de l'hépatite non-A, non B et procédé diagnostique | |
WO1993004088A1 (fr) | Depistage de l'hepatite c a l'aide d'antigenes recombines diriges contre la region ns1 | |
Pereboeva et al. | Hepatitis C epitopes from phage‐displayed cDNA libraries and improved diagnosis with a chimeric antigen | |
US5800982A (en) | Antigenic peptides for growing hepatitis C virus, kit comprising the same and methods for its grouping using the same | |
EP0600000A1 (fr) | Analyse de detection de l'hepatite c utilisant des antigenes de recombinaison venant de la region ns5 | |
CA2070952A1 (fr) | Gene du virus de l'hepatite c ou fragment dudit gene, polypeptide code par le gene | |
CA2116026C (fr) | Test de depistage de l'hepatite c a l'aide d'antigenes recombinants de la region c-100 | |
Gwack et al. | NTPase activity of hepatitis C virus NS3 protein expressed in insect cells | |
JPH06507552A (ja) | 肝炎疾患の診断において有用なdna配列及びコードされたポリペプチド | |
Seki et al. | Effective production of the hepatitis C virus core antigen having high purity in Escherichia coli | |
Seong et al. | Characterization of the structrual proteins of hepatitis C virus expressed by an adenovirus recombinant | |
Khanna et al. | Hepatitis C virus core protein: synthesis, affinity purification and immunoreactivity with infected human sera | |
Seong et al. | Overexpression and simple purification of a truncated, immunologically reactive GST-HCV core (1–123) fusion protein | |
US6030771A (en) | Mosaic protein and restriction endonuclease assisted ligation method for making the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA JP KR |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1992918853 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2115926 Country of ref document: CA |
|
WWP | Wipo information: published in national office |
Ref document number: 1992918853 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1992918853 Country of ref document: EP |