WO1992005256A1 - Natural killer stimulatory factor - Google Patents

Natural killer stimulatory factor Download PDF

Info

Publication number
WO1992005256A1
WO1992005256A1 PCT/US1991/006332 US9106332W WO9205256A1 WO 1992005256 A1 WO1992005256 A1 WO 1992005256A1 US 9106332 W US9106332 W US 9106332W WO 9205256 A1 WO9205256 A1 WO 9205256A1
Authority
WO
WIPO (PCT)
Prior art keywords
nksf
subunit
sequence
cells
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1991/006332
Other languages
English (en)
French (fr)
Inventor
Giorgio Trinchieri
Bice Perussia
Michiko Kobayashi
Steven C. Clark
Gordon G. Wong
Rodney Hewick
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetics Institute LLC
Wistar Institute of Anatomy and Biology
Original Assignee
Genetics Institute LLC
Wistar Institute of Anatomy and Biology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetics Institute LLC, Wistar Institute of Anatomy and Biology filed Critical Genetics Institute LLC
Publication of WO1992005256A1 publication Critical patent/WO1992005256A1/en
Anticipated expiration legal-status Critical
Priority to US11/504,768 priority Critical patent/US20070104680A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5434IL-12
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00Chemistry: molecular biology and microbiology
    • Y10S435/803Physical recovery methods, e.g. chromatography, grinding

Definitions

  • the present invention relates to a novel cytokine that stimulates the function of natural killer cells and other cells of the immune system, and to processes for obtaining the factor in homogeneous form and producing it by recombinant genetic engineering techniques.
  • Natural killer (NK) cells are a subset of lymphocytes active in the immune system and representing an average 15% of mononuclear cells in human peripheral blood [G. Trinchieri and B. Perussia, Lab. Invest., 50:489 (1984)].
  • NK cells Among the surface markers used to identify human NK cells is a receptor binding with low affinity to the Fc fragment of IgG antibodies, such as Fc-gamma receptor III or CD16 antigen [B. Perussia et al, J. Immunol., 133; 180 (1984)].
  • NK cells have been
  • cytokines A growing family of regulatory proteins that deliver signals between cells of the immune system has been identified. These regulatory molecules are known as cytokines. Many of the cytokines have been found to control the growth, development and biological activities of cells of the hematopoietic and immune systems. These regulatory molecules include all of the colony- stimulating factors (GM-CSF, G-CSF, M-CSF, and multi CSF or interleukin-3), the interleukins (IL-1 through IL-11), the interferons (alpha, beta and gamma), the tumor necrosis factors (alpha and beta) and leukemia inhibitory factor (LIF).
  • GM-CSF colony- stimulating factors
  • G-CSF G-CSF
  • M-CSF multi CSF or interleukin-3
  • interleukins IL-1 through IL-11
  • interferons alpha, beta and gamma
  • tumor necrosis factors alpha and beta
  • LIF leukemia inhibitory factor
  • cytokines exhibit a wide range of biologic activities with target cells from bone marrow, peripheral blood, fetal liver, and other lymphoid or hematopoietic organs. See, e.g., G. Wong and S. Clark, Immunology Today, 9(5) :137 (1988).
  • the biochemical and biological identification and characterization of certain cytokines was hampered by the small quantities of the naturally occurring factors available from natural sources, e.g., blood and urine. Many of the cytokines have recently been molecularly cloned, heterologously expressed and purified to
  • cytokines are gamma interferon, human and murine GM-CSF, human G-CSF, human CSF-1 and human and murine IL-3.
  • hematopoietic and immune systems in vivo including GM- CSF, G-CSF, IL-3 and IL-2.
  • the present invention provides a novel human natural killer stimulatory factor, called NKSF, which is substantially free from other mammalian proteins.
  • Active NKSF has an apparent molecular weight of approximately 70-80 kD. Pure preparations of NKSF reveal the presence of two polypeptides, subunits of approximately 40 kD and 30kD, which, when associated, yield active NKSF. It is presently speculated that NKSF is a heterodimer formed by association of both the larger and smaller subunits through one or more disulfide bonds. This apparent heterodimeric structure can be generated by association of the two individual subunits.
  • NKSF The active, approximately 70-80 kD, NKSF is further characterized by containing all or a portion of the amino acid sequences of Table I and/or II below.
  • one or more of nine sequences of amino acids is present in the primary sequence of either the larger or smaller of the NKSF subunits. These nine amino acid fragments are listed and discussed in detail below.
  • the larger subunit polypeptide of NKSF is characterized by having an apparent molecular weight of 40kD.
  • This subunit is further characterized by having the same or substantially the same amino acid sequence as described in Table I, containing the N-terminal sequence:
  • NKSF displays biological activity in inducing the production of gamma interferon in vitro in human peripheral blood lymphocytes (PBLs).
  • PBLs peripheral blood lymphocytes
  • NKSF is characterized by a specific activity of greater than 1X10 7 dilution units per milligram in the gamma interferon induction assay, described in detail below.
  • NKSF demonstrates the following biological activities:
  • GM-CSF granulocyte- macrophage colony stimulating factor
  • NK Natural Killer
  • PHA PHA-activated T lymphocytes
  • Another aspect of the invention includes DNA sequences comprising cDNA sequences encoding the
  • Such sequences include a sequence of nucleotides encoding one or more of the subunits and peptide sequences described above.
  • Also provided by the present invention is a vector containing a DNA sequence encoding NKSF or a subunit of NKSF in operative association with an expression control sequence.
  • Host cells transformed with such vectors for use in producing recombinant NKSF or its recombinant subunits are also provided by the present invention.
  • NKSF protein As still a further aspect of the present invention, there is provided recombinant NKSF protein.
  • This protein is free from other mammalian proteinaceous materials and is characterized by the presence of a DNA sequence encoding one or more of the above-described subunits or peptide fragments containing one or more of the above-described physical, biochemical or biological activities or characteristics.
  • compositions containing a therapeutically effective amount of homogeneous or recombinant NKSF, or an effective amount of one or both of the subunits of NKSF, or of one or more of the peptide fragments thereof.
  • These pharmaceutical compositions may be employed in methods for treating cancer, viral infections, such as AIDS, bacterial infections, and other disease states responsive to the enhanced presence of gamma interferon or GM-CSF production.
  • this factor may be employed in the treatment of diseases in which
  • a further aspect of the invention is a method for treating cancer and/or other pathological states which may benefit from enhanced natural killer cell functions by administering to a patient a
  • NKSF or one or more of its subunits or peptide fragments may include administering simultaneously or sequentially with NKSF or one or more of its subunits or peptide fragments an effective amount of at least one other cytokine, hematopoietin, interleukin, growth factor, or antibody.
  • IL-2 IL-2
  • Still a further aspect of the present invention is a process for producing homogeneous NKSF, or a subunit thereof from a human cell line producing NKSF or a subunit thereof in admixture with other proteins and polypeptides.
  • This process of production provided by the present invention includes culturing selected cells capable of producing NKSF, its subunits, or peptide fragments thereof to obtain conditioned medium and purifying the conditioned medium through five primary purification steps.
  • the vectors and transformed cells of the invention are employed in another aspect, a novel process for producing recombinant human NKSF protein, a subunit thereof or peptide fragments thereof.
  • This claimed process may employ a number of known cells as host cells for expression of the polypeptide.
  • Presently preferred cell lines are mammalian cell lines and
  • the novel human natural killer cell stimulatory factor, NKSF, provided by the present invention is a homogeneous protein or proteinaceous composition
  • Natural killer stimulatory factor has an apparent molecular weight of approximately 70-80 kD as determined by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions. This 70-80 kD peptide is active in a gamma interferon induction assay.
  • the 70- 80 kD band yields two smaller subunits with apparent molecular weights of approximately 40 kD (larger subunit) and approximately 30-35 kD (smaller subunit).
  • the biological activity in the same gamma interferon induction assay is substantially lost compared to that of the native 70-80 kD species.
  • the amino terminal sequences identified above were originally determined from the 40 kD reduced species and the 30-35 kD reduced species believed to be the subunits of the NKSF heterodimer. It is presently believed that NKSF is a disulfide-bonded heterodimer of the larger and smaller subunits. However, it is also possible that one or both of these subunits, when present alone, may have biological activity.
  • NKSF is, at least in part, an anionic glycoprotein. Under isoelectric focusing, two species of the NKSF are observed having isoelectric points of 4.3 and 4.8. It is presently speculated that the two species differ in glycosylation patterns. NKSF is primarily characterized by biological activity in the gamma interferon induction assay
  • NKSF also has an enhancing effect on the mitogenic activity of various mitogens, such as lectins and phorbol diesters, on peripheral blood T lymphocytes and has a growth promoting effect on activated human tonsillar B cells. NKSF has also been observed to enhance NK cell functions to kill leukemia and tumor-derived cells in vitro using a
  • NKSF human peripheral blood lymphocytes or purified NK cells are incubated in the presence of NKSF for a period of 8 to 18 hours. Lymphocytes and NK cells are then assayed in a standard 51 Cr-release assay for their ability to lyse target cells such as leukemia cell lines, tumor-derived cell lines, or virus-infected fibroblasts.
  • NK cells dramatically increases the ability of NK cells to lyse such target cells at a level comparable to that obtained with interferon alpha and IL-2, well known activators of NK cell cytotoxic activity [See, e.g., G. Trinchieri et al, J. Exp. Med., 147:1314 (1978) and G. Trinchieri et al, J. EXP. Med., 160:1146 (1984)].
  • target cancer cells are coated with antibodies capable of binding to the Fc receptor on NK cells, e.g., IgG 2a , IgG 3 and the like.
  • NKSF e.g., IgG 2a , IgG 3 and the like.
  • the presence of NKSF appears to enhance the killing activity of the NK cells for the coated tumor cells in ADCC.
  • NKSF may also be characterized by B cell growth factor activity.
  • antibody directed against the IgM immunoglobulin on the surface of the B cell activates the B cell and causes it to become responsive to B cell growth factors.
  • NKSF was originally detected in the conditioned medium of the human cell line, RPMI 8866, a commercially available cell line [University of Pennsylvania Cell Center] which produces a mixture of lymphokines. This factor may also be produced by other Epstein Barr virus- transformed lymphoblastoid cell lines or from other human cell lines.
  • the RPMI 8866 cell line produces the factor spontaneously, but the level of production can be
  • phorbol esters such as phorbol dibutyrate.
  • the cells deprived of serum for 48 hours still produce NKSF along with other phorbol esters, such as phorbol dibutyrate.
  • lymphokines Procedures for culturing RPMI 8866 (see Example 1) or another cell source of NKSF are known to those of skill in the art.
  • the purification technique employed in obtaining NKSF from cells which naturally produce it uses the following steps. These steps include
  • the second purification step is a lentil lectin column which
  • NKSF is, at least in part, a
  • the eluate from the lentil lectin column is further purified through a hydroxylapatite column, followed by a heparin sepharose column and a fast protein liquid chromatography (FPLC) Mono-Q column.
  • FPLC fast protein liquid chromatography
  • the NKSF from RPMI 8866 eluted as a single peak in each of the three latter columns.
  • a remaining protein contaminant of about 37 kD is removed by gel filtration chromatography alone or reverse phase HPLC and gel filtration
  • the resulting purified homogeneous NKSF was assayed for biological activity in the gamma
  • Example 8 interferon induction assay of Example 8 and demonstrated a specific activity of greater than 1X10 7 dilution units per milligram.
  • the homogeneous NKSF may be obtained by applying the above purification procedures, which are described in detail in Example 2 to the conditioned medium of RPMI 8866 or other sources of human NKSF.
  • NKSF one or both of its subunits, or peptide fragments thereof may also be produced via recombinant techniques, e.g., by culturing under suitable conditions a host cell transfected with DNA sequences encoding the larger and/or smaller subunit in operative association with a regulatory control sequence capable of directing expression thereof.
  • NKSF The DNA sequences for cloned NKSF and its subunits were originally isolated by preparing tryptic digests of the homogeneous polypeptide. For example, the nine tryptic fragments originally found in NKSF are identified below: Fragment 1: Leu-Thr-Ile-Gln-Val
  • Fragment 2 Lys-Tyr-Glu-Asn-Tyr-Thr
  • Fragment 3 Ile-Trp-Glu-Leu-Lys
  • Fragment 4 Leu-Met-Asp-Pro-Lys
  • Fragment 5 Val-Met-Ser-Tyr-Leu-Asn-Ala
  • Fragment 6 Ala-Val-Ser-Asn-Met-Leu-Gln-Lys Fragment 7: Asn-Ala-Ser-Ile-Ser-Val
  • Fragment 9 Asp-Ile-Ile-Lys-Pro-Asp-Pro-Pro-Lys. Fragments 4, 5 and 6 have been identified as being located within the smaller or 30 kD subunit. These sequences correspond to the underlined amino acids #179- 184, 246-252, and 81-86, respectively, of the p35nksf14- 1-1 clone illustrated in Table II. Fragments 1-3 and 7-9 have been identified as being located within the larger, 40 kD, NKSF subunit. Amino acid sequences corresponding to Fragment 1 (amino acids #75-79); Fragment 2 (amino acids #219-224); Fragment 3 (amino acids #23-27);
  • Fragment 7 (amino acids #303-308); Fragment 8 (amino acids #127-130); and Fragment 9 (amino acids #231-239) are underlined in Table I. Additionally, the amino terminal sequences of the larger and smaller subunits of NKSF were identified as described below in Example 5 and are underlined in Table I (#23-45) and Table II (#57-70), respectively. Oligonucleotide probes were synthesized using the genetic code to predict all possible sequences that encode the amino acid sequences of these tryptic
  • NKSF digestion products of NKSF.
  • the same procedure may be followed by constructing probes from the above-identified amino terminal sequences of the two subunits of NKSF.
  • the NKSF subunit genes can be identified by using these probes to screen a human genomic library.
  • the mRNA from RPMI 8866 or another cell source of NKSF can be used to make a cDNA library which can be screened with the probes to identify the cDNAs encoding the polypeptides of the NKSF large and small subunits. Once the cDNAs were identified, they were introduced into an expression vector to make an expression system for NKSF, or one or both of its subunits.
  • DNA sequences encoding the polypeptides of the NKSF large and small subunit were obtained, which contain DNA sequences encoding the tryptic fragments or the amino terminal sequences identified above.
  • NKSF clone named pNK40-4, has the DNA and amino acid sequences presented in Table I below and codes for all or a portion of the larger NKSF subunit:
  • pNK-6 approximately nucleotide #888, was called pNK-6 and deposited with the ATCC on February 3, 1989 under ATCC No. 40545.
  • Another partial clone of the larger subunit, pNK162 was sequenced and contains the sequence from nucleotides #643 to 2362 of Table I. This clone is maintained at the labs of Genetics Institute, Inc.
  • p35nksf9-1-1) begins at nucleotide #133 (indicated by *) and ends at nucleotide #1335 (indicated by *) of Table II and the deposited sequence. Between those two
  • the smaller clone is identical to the sequence of Table II except for 5 nucleotide changes in the 3* non-coding region.
  • This shorter clone thus has a coding sequence beginning with Met (amino acid #35) in Table II.
  • Met amino acid #35
  • the additional sequence at the 5' end of p35nksf14-1-1 encodes an in-frame initiation codon (ATG) 34 residues 5' of the operative initiation codon in p35nksf9-1-1.
  • ATG in-frame initiation codon
  • Both of these clones encode all of the peptide sequences identified in the tryptic digest of purified NKSF, which were not found in the 40 kD subunit protein, as well as the amino terminal sequence of the purified 30 kD subunit.
  • Bluescript polylinker sequence when introduced into Cos cells in the expression vector pEMC3(1) along with a plasmid expressing the 40 kD subunit, yielded
  • NKSF biologically active NKSF.
  • This material was active in the same bioassays used to test natural NKSF as discussed below.
  • This sequence may be obtained from p35nksf14-1-1 by digestion with Pst I.
  • the cloned sequence of plasmid p35nksf9-1-1, containing the shorter 30-35 kD subunit sequence is being maintained at the laboratories of Genetics Institute, CambridgePark, MA and will be made available to the public upon grant of the patent.
  • a cDNA suitable for expression of the longer version of the 30-35 kD subunit may be obtained from the p35nksf14-1-1 deposited clone by digestion with Sail and Notl.
  • the longer 30-35 kD subunit contains an earlier Met (amino acid #1) codon, additional 5' coding and non- coding sequences as well as 3' non-coding sequence.
  • the sequence from Met (amino acid #35) to the N-terminus of the mature protein (encoded by both cDNAs) encodes a sequence which resembles a signal peptide and may direct the proper folding and/or secretion of the subunit. It is therefore possible that the longer 30-35 kD subunit sequence may be more efficiently expressed and secreted by the Cos cells than the shorter version. It may also fold differently, thereby conferring NKSF activity independent of the presence of the 40 kD subunit.
  • Table II indicates the placement of polylinker sequence in the deposited clone, as well as the first and last nucleotide of the larger and smaller versions of this subunit. Also indicated in the sequence are the 5' Pstl site for obtaining the sequence of the small subunit which has been expressed and underlined tryptic fragment sequences.
  • the present invention also encompasses these novel DNA sequences, free of association with DNA sequences encoding other primate proteins, and coding on expression for NKSF polypeptides, including those of its large and small subunits.
  • DFA sequences include those containing one or more of the above-identified DNA and peptide sequences and those sequences which hybridize under stringent hybridization conditions [see, T.
  • hybridization condition is in 50% formamide, 4XSSC at
  • DNA sequences which hybridize to the sequences for NKSF or its subunits under relaxed hybridization conditions and which code on expression for NKSF peptides having NKSF biological properties also encode novel NKSF polypeptides. Examples of such non-stringent
  • hybridization conditions are 4XSSC at 50°C or
  • NKSF significant homology, e.g., sites of glycosylation or disulfide linkages, with the sequences of NKSF and encodes a protein having one or more NKSF biological properties clearly encodes a NKSF polypeptide even if such a DNA sequence would not stringently hybridize to the NKSF sequences.
  • DNA sequences which code for NKSF polypeptides coded for by the sequence of NKSF are also encompassed by this invention.
  • Variations in the DNA sequence of NKSF which are caused by point mutations or by induced modifications to enhance the activity, half-life or production of the polypeptides encoded thereby are also encompassed in the invention.
  • NKSF polypeptides may also be produced by known conventional chemical synthesis. Methods for
  • NKSF polypeptide sequences by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with NKSF polypeptides may possess NKSF biological properties in common therewith. Thus, they may be employed as
  • NKSF polypeptides provided herein also include factors encoded by sequences similar to those of purified homogeneous and recombinant NKSF protein, or the subunit polypeptides, but into which modifications are naturally provided or deliberately engineered.
  • Modifications in the peptides or DNA sequences can be made by one skilled in the art using known techniques. Modifications of interest in the NKSF sequences may include the replacement, insertion or deletion of a selected amino acid residue in the coding sequences. Mutagenic techniques for such replacement, insertion or deletion are well known to one skilled in the art. [See, e.g., United States patent 4,518,584.]
  • glycosylation site The absence of glycosylation or only partial glycosylation results from amino acid
  • glycosylation recognition site or at any site of the molecule that is modified by addition of O-linked
  • recognition site comprises a tripeptide sequence which is specifically recognized by appropriate cellular
  • glycosylation enzymes These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid.
  • X is usually any amino acid.
  • a variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence.
  • One such modification may be the attachment of polyethylene glycol onto existing lysine residues or the insertion of a lysine residue into the sequence by conventional techniques to enable the
  • the present invention also provides a method for producing NKSF polypeptides.
  • the method of the present invention involves culturing a suitable cell or cell line, which has been transformed with a DNA sequence coding on expression for an NKSF polypeptide or subunit, under the control of known regulatory sequences.
  • DNA sequences for both subunits are identical to each other.
  • Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO) or 3T3 cells.
  • CHO Chinese hamster ovary cells
  • 3T3 cells The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production and purification are known in the art. See, e.g., Gething and Sambrook,
  • WO88/08035 Other suitable mammalian cell lines, are the monkey COS-1 cell line, and the CV-1 cell line,
  • bacterial cells e.g., HB101, MC1061 and strains used in the following examples
  • Various strains of B. subtilis, Pseudomonas, other bacilli and the like may also be employed in this method.
  • yeast cells Many strains of yeast cells known to those skilled in the art are also available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention.
  • the present invention also provides vectors for use in the method of expression of novel NKSF
  • NKSF polypeptides contain the novel NKSF DNA sequences which code for NKSF polypeptides of the
  • vectors incorporating modified sequences as described above are also embodiments of the present invention and useful in the production of NKSF
  • the vector employed in the method also contains selected regulatory sequences in operative association with the DNA coding sequences of the
  • NKSF purified to homogeneity from cell sources or produced recombinantly or synthetically, may be used in a pharmaceutical preparation or formulation to treat cancer or other disease states which respond to enhanced NK cell activity or increased in vivo production of gamma interferon or GM-CSF.
  • pathological states may result from disease, exposure to radiation or drugs, and include for example, leukopenia, bacterial and viral infections, anemia, B cell or T cell deficiencies
  • NKSF polypeptide compositions including immune cell or hematopoietic cell deficiency following a bone marrow transplantation.
  • Therapeutic treatment of cancer and other diseases with these NKSF polypeptide compositions may avoid undesirable side effects caused by treatment with presently available drugs.
  • the NKSF polypeptide compositions according to the present inventin may also be used in the treatment of Acquired Immunodeficiency Syndrome (AIDS) and other viral infections, particularly non-responsive viral infections, as well as bacterial infections. It may also be possible to employ one or both of the subunit polypeptides of NKSF or peptide fragments thereof in such pharmaceutical formulations.
  • AIDS Acquired Immunodeficiency Syndrome
  • polypeptides of the present invention may also be employed, alone or in combination with other cytokines, hematopoietins, interleukins, growth factors or antibodies in the treatment of cancer or other disease states.
  • cytokines hematopoietins
  • interleukins growth factors or antibodies
  • NKSF polypeptides have been shown to have a synergistic effect when administered in
  • composition can be systemically
  • composition may be administered intravenously. If desirable, the composition may be administered subcutaneously.
  • therapeutic composition for use in this invention is in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such a
  • pharmaceutically acceptable protein solution having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
  • the daily regimen should be in the range of 1-1000 micrograms of NKSF protein or subunit thereof or 50 to 5000 units (i.e., one unit per ml being the concentration of protein which leads to half maximal stimulation in the gamma interferon induction assay) of protein per kilogram of body weight.
  • compositions of the present invention may also include co-administration with other human factors.
  • hematopoietins for such use include the known factors IL- 1, IL-2 and IL-6 particularly. [See, e.g., PCT
  • candidates for participation in NKSF therapy may also include IL-4, G-CSF, CSF-1, GM-CSF, IL-3, IL-11 or erythropoietin.
  • Growth factors like B cell growth factor, B cell differentiation factor, or eosinophil differentiation factors may also prove useful in coadministration with NKSF.
  • NKSF or a subunit or fragment thereof with or prior to administration of an antibody capable of binding to the Fc receptor on NK cells may enhance ADCC therapy directed against tumors.
  • the dosage recited above would be adjusted to compensate for such additional components in the therapeutic
  • composition progress of the treated patient can be monitored by conventional methods.
  • the human B-lymphoblastoid cell line RPMI 8866 was maintained in RPMI 1640 medium containing 5% heat- inactivated fetal calf serum (FCS).
  • FCS heat- inactivated fetal calf serum
  • cells were washed and suspended (10 6 cells/ml) in serum free RPMI 1640 medium containing 10 -7 M phorbol-12-13-dibutyrate (PdBU) and cultured for 48 hours at 37°C, 5% CO 2 .
  • the cell free supernatants were harvested by filtration through a 0.2 ⁇ m filter [Durapore ® hydrophilic cartridge filter,
  • phenylmethylsulfonyl-fluoride were added to 0.02% and 0.1 mM, respectively.
  • the cell conditioned medium was then concentrated 50 fold under pressure using an ultra-filtration cartridge [Spiral-Wound, S1, Amicon, Danvers, MA].
  • NKSF protein from RPMI 8866 conditioned medium, as described in Example 1 above.
  • a. Anion Exchange Cartridge Chromatography Two liters of the crude concentrated conditioned medium was diluted with distilled water to a conductivity of 6m Os/cm and adjusted to pH 8 with 1 M Tris-HCl buffer (pH 8). The concentrate was then applied to five QAE Zetaprep 250 cartridges [Pharmacia] connected in parallel and previously equilibrated with 0.1 M Tris- HCl buffer (pH 8) at a flow rate of 150 ml/min. Unless otherwise cited, all the buffers used for purification contained 0.02% Tween-20 and 0.1 mM PMSF.
  • the cartridges were washed with 3 liters of 0.1 M Tris-HCl buffer (pH 6.8) followed by washing with 1.5 liters of 0.5 M NaCl in 0.1 M Tris-HCl buffer (pH 6.8) and 300 ml fractions were collected.
  • the NKSF activity was eluted with the 0.5 M NaCl-containing wash.
  • NKSF-containing fractions from two separate QAE Zetaprep elutions were pooled and applied directly to a column (2.5x15 cm) of lentil-lectin
  • Sepharose 4B [Pharmacia] which has been equilibrated with 20 mM Tris-HCl buffer (pH 7.2). After washing with five column volumes of equilibration buffer, the column was eluted with three column volumes of 20 mM Tris-HCl buffer (pH 7.2) containing 0.2 M ⁇ -methyl-D-mannopyranoside
  • NKSF activity which bound to the lentil-lectin Sepharose column was dialyzed against 1 mM potassium phosphate buffer (pH 6.8) containing 0.1 mM CaCl 2 and 0.15 M NaCl and applied to a Biogel HT [BioRad] column (2x5 cm) previously equilibrated with 1 mM potassium phosphate buffer (pH 6.8) containing 0.1 mM CaCl 2 .
  • the column was washed with five column volumes of equilibration buffer and eluted with 100 ml of a linear gradient from 1 mM to 400 mM potassium phosphate buffer (pH 6.8) containing 0.15 M NaCl. 4 ml fractions were collected and tested for NKSF activity. A single peak of activity emerged from the column between the approximately 200 mM and 300 mM potassium phosphate.
  • Eluted NKSF-containing fractions from the Biogel HT column were pooled and dialyzed against 20 mM sodium phosphate buffer (pH 7.2) and applied to a Heparin Sepharose [Pierce, Rockford, IL] column (1x10 cm). The column was washed with five column volumes of 20 mM sodium phosphate buffer (pH 7.2) and eluted with the same buffer containing 1 M NaCl. 3 ml fractions were
  • Sepharose column were dialyzed against 20 mM Tris-HCl buffer (pH 6.8) containing 1% ethylene glycol and 0.1 mM PMSF but no Tween-20 (buffer A) and concentrated to 2 ml using a stirred cell [Amicon] with a YM 10 membrane.
  • the sample was applied to a Mono Q (5/5) column [Pharmacia- FPLC apparatus] and eluted with a linear gradient from 0 M to 1 M NaCl in buffer A (pH 6.8). 0.5 ml fractions were collected and tested for NKSF activity.
  • the sample was applied to a Mono Q (5/5) column [Pharmacia- FPLC apparatus] and eluted with a linear gradient from 0 M to 1 M NaCl in buffer A (pH 6.8). 0.5 ml fractions were collected and tested for NKSF activity.
  • NKSF protein 70 kD was separated from the approximately 37 kD protein contaminant.
  • the pooled Mono-Q fractions may be subjected to reverse-phase HPLC (C8 column) prior to the step (f) described above, to separate the protein contaminant from the active 70 kD protein.
  • Example 3. Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis
  • SDS-PAGE was performed according to the method of Laemmli [Laemmli, U. K., Nature, 227;680-685 (1970)] on 10% acrylamide slab gels (0.75 mm thickness). After electrophoresis the gels were either stained by the silver-nitrate method using a silver staining reagents [BioRad] or cut into 2 mm slices and eluted in 0.5 ml RPMI medium for 4 hours at 24°C and assayed for NKSF activity.
  • Apparent molecular weight was determined with protein standards, phospholipase b (94 kD), bovine serum albumin (67 kD), ovalbumin (43 kD), carbonic anhydrase (30 kD), soybean trypsin inhibitor (20 kD) and
  • lactalbumin (14.4 kD).
  • the active fractions were rerun on a second non-reducing gel and the proteins were eluted from the regions corresponding to the 70 kD and 37 kD bands and tested for NKSF activity. The activity all correlated with the 70 kD species indicating that this protein is NKSF.
  • the 70 kD species was eluted from the gel, iodinated using chloramine T [Sigma, St. Louis, MO] and rerun on a second SDS gel after boiling for two minutes in the presence of the reducing agent, ⁇ -mercaptoethanol (10%). Under these conditions, the 70 kD species resolved into two distinct subunits of molecular weights 40kD and 30kD, indicating that the native NKSF may be a disulfide-bonded heterodimer of these subunit
  • NKSF may be a dimer formed by multiples of the larger or smaller subunits. The reduction of the native 70kD NKSF appeared to destroy all of its ability to induce peripheral blood lymphocyte production of gamma interferon.
  • the final pooled active fractions from the Mono Q column contained approximately 10 ⁇ g of protein, estimated from the intensities of silver staining by control proteins analyzed in parallel on the same gel. Approximately 6 ⁇ g of this corresponded to the 70 kD NKSF protein. The estimated specific activity of the 70 kD NKSF is 1x10 7 u/mg. The overall recovery of NKSF activity in the preparation was 2%.
  • NKSF Homogeneous NKSF is reduced as described in the SDS-PAGE example above and digested with trypsin.
  • non-reduced NKSF may be obtained from a reverse-phase HPLC column and digested with trypsin.
  • Fragment 2 Lys-Tyr-Glu-Asn-Tyr-Thr Fragment 3 - Ile-Trp-Glu-Leu-Lys
  • Fragment 6 Ala-Val-Ser-Asn-Met-Leu-Gln-Lys Fragment 7 - Asn-Ala-Ser-Ile-Ser-Val Fragment 8 - Thr-Phe-Leu-Arg
  • amino terminal sequence from the 30kD smaller subunit was as follows: Arg-Asn-Leu-Pro-Val-Ala- Thr-Pro-Asp-Pro-Gly-Met-Phe-Pro. Fragments 4, 5 and 6 proved to be derived from the amino acid sequence of the clone of the smaller subunit identified in Table II above.
  • Probes consisting of pools of oligonucleotides or unique oligonucleotides are designed according to the method of R. Lathe, J. Mol. Biol., 183 (1): 1-12 (1985). The oligonucleotide probes are synthesized on an
  • oligonucleotides must be synthesized that contains all possible nucleotide sequences encoding the amino acid sequence of the tryptic fragment. It may be possible in some cases to reduce the number of
  • oligonucleotides in the probe mixture based on codon usage because some codons are rarely used in eukaryotic genes, and because of the relative infrequency of the dinucleotide CpG in eukaryotic coding sequences [see J. J. Toole et al, Nature, 312:342-347 (1984)].
  • the regions of the amino acid sequences used for probe design are chosen by avoiding highly degenerate codons where
  • oligonucleotides are synthesized on an automated DNA synthesizer and the probes are then
  • a cDNA encoding the small subunit of NKSF was identified by screening a cDNA library (prepared in lambda Zap; Stratagene cloning systems, La Jolla, CA) made from polyadenylated RNA from PdBu induced 8866 cells (Univ. of Pennsylvania Cell Center) using established techniques (see Toole et al cited above). The screening was carried out using oligonucleotides with sequence predicted by those tryptic peptides not contained within the previously cloned cDNA coding for the 40kD protein as probes. Recombinants from this library are plated and duplicate nitrocellulose replicas made of the plates.
  • the oligonucleotides are kinased with 32 P gamma ATP and hybridized to the replicas.
  • two pools of oligonucleotides were synthesized based on the peptide Val-Met-Ser-Tyr- Leu-Asn-Ala.
  • the sequences in one pool of 17mers were derived from the peptide sequence Met-Ser-Tyr-Leu-Asn-Ala and those in the second from Val-Met-Ser-Tyr-Leu-Asn.
  • oligonucleotides were hybridized with the second pool. Hybridizations were performed at 48°C in a buffer
  • cDNA that had been previously prepared from 8866 polyadenylated RNA was cloned into ⁇ ZAP as described above.
  • Two hundred thousand recombinants from this library were plated, duplicate nitrocellulose filters were prepared and screened with a random primed 32 P labeled DNA fragment, the sequence of which is within pNK-6.
  • the probing was done using standard stringent hybridization and washing conditions.
  • Three duplicate positive plaques resulted from this screen. The plaques were replated and reprobed using the above probe and conditions to clonally isolate the plaques.
  • the three isolates were then probed with a 32 P end-labeled oligo dT probe (pd(T) 12-18, Pharmacia). This hybridization was done in 6XSSC, 5x Denhardt's solution, and carrier DNA plus labeled probe at room temperature.
  • pd(T) 12-18 32 P end-labeled oligo dT probe
  • 6XSSC 6XSSC
  • 5x Denhardt's solution 5x Denhardt's solution
  • carrier DNA plus labeled probe at room temperature.
  • One of the three isolates, pNK162 hybridized to the oligo dT probe and was sequenced.
  • NKSF clones pNK-6 and pNK162 were subcloned together in frame for transcription and
  • pNK40-4 (Table I) is believed to contain the full length cDNA for the 40 kD NKSF subunit.
  • Example 6 Expression of Recombinant Human NKSF
  • NKSF To produce NKSF, the DNAs encoding its subunits are transferred into appropriate expression vectors, of which numerous types are known in the art for mammalian, insect, yeast, fungal and bacterial expression, by standard molecular biology techniques.
  • appropriate expression vectors of which numerous types are known in the art for mammalian, insect, yeast, fungal and bacterial expression, by standard molecular biology techniques.
  • One such vector for mammalian cells is pXM [Y. C. Yang et al, Cell, 47: 3- 10 (1986)].
  • This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells [See, e.g., Kaufman, Proc. Natl. Acad. Sci. USA, 82:689-693 (1985)].
  • the pXM vector is linearized with the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells [See, e.g., Kaufman, Proc. Natl.
  • pEMC3(1) can be made by simple modification of the pEMC2B1 vector, described below.
  • pEMC3(1) differs from pEMC2B1 by three restriction sites, Smal, Sall, Xbal, in the polylinker region. To make pEMC3(1), these three restriction sites are inserted between the Pstl and EcoRI restriction sites of pEMC2B1 by conventional means.
  • pEMC2B1 may be derived from pMT2pc which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under Accession Number ATCC 40348. The DNA is linearized by digestion of the plasmid with Pstl. The DNA is then blunted using T 4 DNA
  • TTCCTCGA 3' is then ligated into the DNA, recreating the Pstl site at the 5' end and adding an EcoRI site and Xhol site before the ATG of the DHFR cDNA.
  • This plasmid is called pMT21.
  • pMT21 is cut with EcoRI and Xhol which cleaves the plasmid at two adjacent cloning sites.
  • An EMCV fragment of 508 base pairs was cut from pMT 2 ECAT 1 [S. K. Jong et al, J. Virol., 63: 1651-1660 (1989)] with the restriction enzymes EcoRI and Taq ⁇ l.
  • the sequences of the oligonucleotides were: 5' CGAGGTTAAAAAACGTCTAGGCCCCGAACCACGGGGACGTGGTTTTCCTTT GAAAAACACGATTGC 3' and its complementary strand.
  • This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, DHFR and ⁇ -lactamase markers and an EMC sequence, in
  • the two different cDNAs are expressed simultaneously in the same host or independently in different hosts. In the latter case, the subunits are purified separately and the final active NKSF is
  • the constructs containing the cDNAs for the 40 kD and 30 kD (smaller version) subunits were cloned separately into the
  • polyclonal rabbit antiserum (1:100 dilution) to the NKSF heavy chain, blocks the activity in the cotransfectant as well as RPMI 8861 conditioned medium.
  • the antiserum was produced by immunizing rabbits with NKSF heavy chain purified from conditioned media from COS cells transfected with the NKSF heavy chain cDNA (cloned in pEMC 3(1)).
  • transfection with pNK40-4 was inactive in the gamma interferon induction assay and in the cell cytotoxicity assay, which were performed as described below in Example 8.
  • the mammalian cell expression vectors described herein may be synthesized by techniques well known to those skilled in this art. The components of the
  • vectors e.g. replicons, selection genes, enhancers, promoters, and the like, may be obtained from natural sources or synthesized by known procedures. See, Kaufman et al, J. Mol. Biol., 159:511-521 (1982); and Kaufman, Proc. Natl. Acad. Sci., USA, 82.:689-693 (1985).
  • Exemplary mammalian host cells include particularly primate cell lines and rodent cell lines, including transformed cell lines. Normal diploid cells, cell strains derived from in vitro culture of primary tissue, as well as primary explants, are also suitable.
  • Candidate cells need not be genotypically deficient in the selection gene so long as the selection gene is dominantly acting.
  • CHO cells may be employed.
  • the vector DNA may include all or part of the bovine papilloma virus genome [Lusky et al, Cell. 36:391-401 (1984)] and be carried in cell lines such as C127 mouse cells as a stable episomal element.
  • suitable mammalian cell lines include but are not limited to, HeLa, COS-1 monkey cells, mouse L-929 cells, 3T3 lines derived from Swiss, Balb-c or NIH mice, BHK or HaK hamster cell lines.
  • the two cDNAs may be introduced into the cells using two different selectable genes or markers. As discussed below in Example 7, this can readily be achieved in CHO cells using the
  • DHFR dihydrofolate reductase
  • ADA adenosine deaminase
  • Any combination of two genes which can be independently selected in any mammalian cell line are useful for this purpose.
  • a CHO cell line is independently developed for expression of one subunit under ADA
  • multicistronic vectors encoding both subunits with a single selectable marker might yield cells in which both subunits can be
  • One skilled in the art can also construct other mammalian expression vectors comparable to the pEMC3(1) vector by, e.g., inserting the DNA sequences of the NKSF subunits from the respective plasmids with appropriate enzymes and employing well-known recombinant genetic engineering techniques and other known vectors, such as pXM, pJL3 and pJL4 [Gough et al., EMBO J., 4:645-653 (1985)] and pMT2 (starting with pMT2-VWF, ATCC #67122; see PCT application PCT/US87/00033).
  • the transformation into appropriate host cells of these vectors with both NKSF subunits can result in expression of the NKSF
  • sequences encoding the NKSF subunits by eliminating any mammalian regulatory sequences flanking the coding sequences and inserting bacterial regulatory sequences to create bacterial vectors for intracellular or extracellular expression of the NKSF subunits of the invention by bacterial cells.
  • the DNA encoding the NKSF polypeptides may be further modified to contain different codons to optimize bacterial expression as is known in the art.
  • sequences encoding the mature NKSF subunits are operatively linked in-frame to
  • nucleotide sequences encoding a secretory leader are nucleotide sequences encoding a secretory leader
  • NKSF polypeptide permitting bacterial expression, secretion and processing of the mature NKSF polypeptides, also by methods known in the art.
  • the simultaneous expression of both subunits of NKSF in E. coli using such secretion systems is expected to result in the secretion of the active heterodimer.
  • This approach has yielded active chimeric antibody fragments [See, e.g., Bitter et al, Science. 240: 1041-1043 (1988)].
  • the individual subunits are expressed in the mature form separately from the two different cDNAs in E. coli using vectors for
  • NKSF polypeptides in insect cells See, e.g., procedures described in published European patent application
  • NKSF subunits are derived from a single cDNA, this cDNA will be expressed in insect cells.
  • each subunit is separately inserted into an insect cell vector and the two resulting vectors cointroduced into insect cells to express biologically active NKSF.
  • yeast vectors are constructed employing yeast regulatory sequences to express either the individual NKSF subunits simultaneously, or, if the protein is derived from a single precursor, the cDNA encoding that precursor, in yeast cells to yield secreted extracellular active NKSF heterodimer.
  • the individual subunits may be expressed intracellularly in yeast, the individual polypeptides isolated and finally, refolded together to yield active NKSF.
  • One method for producing high levels of the NKSF protein of the invention from mammalian cells involves the construction of cells containing multiple copies of the two cDNAs encoding the individual NKSF subunits.
  • each corresponding cDNA must be expressed simultaneously in CHO cells.
  • Two different selectable markers e.g., DHFR and ADA, may be employed.
  • One of the cDNAs is expressed using the DHFR system
  • Plasmid pMT3SV2ADA also directs the expression of ADA in mammalian cells.
  • the first vector construct containing one subunit is transfected into DHFR-deficient CHO DUKX-BII cells.
  • the second vector construct containing the second subunit is transfected into a second CHO cell line. The transfected cells are selected for growth in increasing
  • polyethylene glycol using methods well established in the art to yield a single cell line, resistant to both dCF and MTX and expressing both subunits to yield
  • a first vector containing one subunit e.g., the first vector described above, is transfected into a selected CHO cell line and the
  • the second vector containing the other subunit is transfected into the cell line which already contains amplified first vector.
  • the cDNA expressing the other subunit e.g., the second vector described above, may be introduced under a second drug selection. The second vector is then
  • two vectors constructs may be designed, e.g., a pEMC3(1) construct containing one subunit and the DHFR gene and a second pEMC3(1) construct containing the second subunit and the DHFR gene.
  • the two pEMC3(1) constructs expressing both NKSF subunits may be mixed and the mixture transfected into CHO cells.
  • the cells are then amplified in MTX as described above to obtain a cell line producing both subunits.
  • two drug markers may be employed in this method and the combined selection of both drugs may be used and transformants tested for NKSF activity directly to obtain cell lines expressing the heterodimer.
  • the resulting cell lines can be further amplified by appropriate drug selection, resulting cell lines recloned and the level of expression assessed using the gamma interferon induction assay described herein.
  • NKSF neurotrophic factor
  • Example 2 a partially purified version of NKSF.
  • the recombinant version of the molecule is expected to exhibit NKSF biological properties in these same assays or other assays.
  • NKSF When fresh human peripheral blood mononuclear cells (PBMC) or phytohemagglutinin (PHA)-induced blasts are cultured with NKSF, significant amounts of gamma interferon are detected in the supernatant. Moreover, NKSF synergizes with IL-2, phorbol dibutyrate (PdBu), and PHA in inducing gamma interferon production.
  • IL-2 IL-2
  • PdBu phorbol dibutyrate
  • PHA phorbol dibutyrate
  • interferon mRNA Gamma interferon message was found in both purified T and NK populations. Preincubation with the protein synthesis inhibitor, cycloheximide (CHX), leads to a superinduction of gamma interferon mRNA following stimulation with NKSF. HLA-DR(+) accessory cells are required for gamma interferon production by T and NK cells. Induction of gamma interferon mRNA can be detected as early as 1 hour after treatment with NKSF of PHA blasts. The details of the assay are described below.
  • CHX protein synthesis inhibitor
  • HLA-DR(+) accessory cells are required for gamma interferon production by T and NK cells. Induction of gamma interferon mRNA can be detected as early as 1 hour after treatment with NKSF of PHA blasts. The details of the assay are described below.
  • gamma-IFN gamma interferon
  • NKSF Interferon Radioimmunoassay
  • NKSF induces T and NK cells to produce GM-CSF and tumor necrosis factor.
  • the assay of production of these cytokines is performed as above and the supernatant is assayed for the presence of the cytokines by specific biological assays or by
  • the induction of the cytokine genes is measured by evaluating the accumulation of mRNA transcripts of the three cytokines in the
  • lymphocytes treated with NKSF Lymphocytes are cultured for 4 to 18 hours with NKSF, RNA is extracted by
  • Extent of hybridization is determined by autoradiography and densitometry.
  • NKSF induces production of IFN-gamma and TNF from purified human NK cells.
  • NK cells are able to lyse various target cells by two mechanisms.
  • One mechanism is spontaneous lysis, in the absence of specific sensitization, of a variety of target cells, including leukemia- and solid tumor-derived cell lines, virus-infected cells, and, in some cases, normal cell lines.
  • the second mechanism is ADCC.
  • NKSF may enhance the ability of NK cells to lyse more efficiently target cells coated with IgG antibodies with an Fc portion able to bind to the NK cell Fc receptor
  • NKSF increases several-fold the cytotoxicity of NK cells when assayed against the following target cells: malignant
  • NK cell- mediated cytotoxicity by NKSF is not secondary to the production of IFN-gamma, tumor necrosis factor, or IL-2, produced by the PBL treated with NKSF.
  • the cytotoxic assay, the methods for NK cell purification, and for the quantitative evaluation of enhancement of NK cell- mediated enhancement by cytokines are described in detail in G. Trinchieri et al, J. Exp. Med., 147:1314 (1978); G. Trinchieri et al, J. Exp. Med., 160: 1147 (1984); and B. Perussia et al, Natural Immunity and Cell Growth
  • NKSF of the present invention enhanced NK cell killing of antibody coated tumor target cells in a dose dependent manner.
  • ADCC response of NK cells was enhanced by the addition of NKSF.
  • PBLs (0.5x10 6 /ml) are cultured in 200 ⁇ l of
  • RPMI 1640 medium supplemented with 10% heat inactivated human AB serum. After 3 and 6 days the PBLs are pulsed for 6 hours with 3 H-thymidine and DNA synthesis
  • NKSF Tricarb beta counter.
  • NKSF has minimal effect on PBL proliferation by itself, but is strongly co-mitogenic with phytohemagglutinin (PHA-M Welcome, 1:100) at day 6 of culture and with phorbol diesters (TPA or PDBu, 10 -8 or 10 -7 M, respectively) at both day 3 and day 6.
  • PHA-M phytohemagglutinin
  • TPA or PDBu phorbol diesters
  • Induction of GM-CSF expression in cultures of human PBLs was measured.
  • 100 ⁇ l of human PBLs suspended (10 7 cells/ml) in RPMI 1640 culture medium supplemented with 10% heat-inactivated FCS was added to 100 ⁇ l of sample to be tested in a microtiter plate [U-bottom, 96-well, Costar, Cambridge, MA] and incubated for 18 hours at 37°C, 5% CO 2 .
  • the detection limit of this assay was 50 pg/ml.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Diabetes (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US1991/006332 1988-11-10 1991-09-04 Natural killer stimulatory factor Ceased WO1992005256A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/504,768 US20070104680A1 (en) 1988-11-10 2006-08-16 Antibodies to natural killer stimulatory factor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US07/584,941 US5457038A (en) 1988-11-10 1990-09-18 Natural killer stimulatory factor
US584,941 1990-09-18

Publications (1)

Publication Number Publication Date
WO1992005256A1 true WO1992005256A1 (en) 1992-04-02

Family

ID=24339390

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/006332 Ceased WO1992005256A1 (en) 1988-11-10 1991-09-04 Natural killer stimulatory factor

Country Status (5)

Country Link
US (4) US5457038A (cg-RX-API-DMAC7.html)
EP (1) EP0549711A1 (cg-RX-API-DMAC7.html)
JP (3) JP4014590B2 (cg-RX-API-DMAC7.html)
AU (1) AU8723691A (cg-RX-API-DMAC7.html)
WO (1) WO1992005256A1 (cg-RX-API-DMAC7.html)

Cited By (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0640689A3 (en) * 1993-07-02 1995-06-28 Hoffmann La Roche P40 homodimer of interleukin-12.
WO1995024918A1 (en) * 1994-03-14 1995-09-21 Genetics Institute, Inc. Use of il-12 and il-12 antagonists in the treatment of autoimmune diseases
WO1996024369A1 (en) * 1995-02-06 1996-08-15 Genetics Institute, Inc. Formulations for il-12
EP0712931A3 (en) * 1994-11-15 1997-03-26 Hayashibara Biochem Lab Interferon-gamma inducing polypeptide monoclonal antibody, and composition for interferon-gamma linked diseases
EP0692536A3 (en) * 1994-07-14 1997-03-26 Hayashibara Biochem Lab Protein that induces interferon gamma production and monoclonal antibodies against it
EP0767178A1 (en) * 1995-09-26 1997-04-09 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Protein which induces interferon-gamma production by immunocompetent cell
EP0790308A1 (en) * 1989-12-22 1997-08-20 F. Hoffmann-La Roche Ag Cytotoxic lymphocyte maturation factor and monoclonal antibodies directed thereto
US5674483A (en) * 1995-01-31 1997-10-07 National Jewish Medical And Research Center Treatment for diseases involving inflammation
WO1998017689A3 (en) * 1996-10-18 1998-08-20 Genemedicine Inc Il-12 gene expression and delivery systems and uses
WO1998017814A3 (en) * 1996-10-18 1998-08-27 Genemedicine Inc Gene expression and delivery systems and uses
WO1998041229A1 (en) * 1997-03-19 1998-09-24 F. Hoffmann-La Roche Ag USE OF IL-12p40 AS IMMUNOSTIMULANT
US5853714A (en) * 1995-03-27 1998-12-29 Genetics Institute, Inc. Method for purification of IL-12
US5891680A (en) * 1995-02-08 1999-04-06 Whitehead Institute For Biomedical Research Bioactive fusion proteins comprising the p35 and p40 subunits of IL-12
EP0901370A4 (en) * 1996-05-07 1999-07-14 Cornell Res Foundation Inc STIMULATING IMMUNE RESPONSE BY LOW-DOSE IL-2
US5928636A (en) * 1996-05-13 1999-07-27 Hoffmann-La Roche Inc. Use of IL-12 and IFNα for the treatment of infectious diseases
WO2000050453A1 (en) * 1999-02-26 2000-08-31 The Johns Hopkins University A novel inhibitor of programmed cell death
WO2000055198A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. 50 human secreted proteins
WO2000055201A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. 49 human secreted proteins
WO2000055200A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. 50 human secreted proteins
WO2000058355A1 (en) * 1999-03-26 2000-10-05 Human Genome Sciences, Inc. 50 human secreted proteins
WO2000059938A1 (en) * 1999-04-01 2000-10-12 Genetics Institute, Inc. Angiopoietin-like proteins, crisp proteins and polynucleotides encoding same
WO2000061628A1 (en) * 1999-04-09 2000-10-19 Human Genome Sciences, Inc. 49 human secreted proteins
WO2001007476A1 (en) * 1999-07-21 2001-02-01 Human Genome Sciences, Inc. 26 human prostate and prostate cancer associated proteins
WO2000063230A3 (en) * 1999-03-26 2001-02-08 Human Genome Sciences Inc 49 human secreted proteins
WO2001012786A1 (en) * 1999-08-16 2001-02-22 Human Genome Sciences, Inc. Retinoid receptor interacting polynucleotides, polypeptides, and antibodies
WO2001018176A1 (en) * 1999-09-03 2001-03-15 Human Genome Sciences, Inc. Immunoglobulin superfamily polynucleotides, polypeptides, and antibodies
WO2001018049A1 (en) * 1999-09-09 2001-03-15 Human Genome Sciences, Inc. Steroid hormone receptor polynucleotides, polypeptides, and antibodies
WO2001021658A1 (en) * 1999-09-24 2001-03-29 Human Genome Sciences, Inc. 32 human secreted proteins
US6214584B1 (en) 1994-11-15 2001-04-10 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Human Interferon-γinducing factor
WO2001053343A1 (en) * 2000-01-18 2001-07-26 Human Genome Sciences, Inc. Human polynucleotides, polypeptides, and antibodies
WO2001055206A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001062789A1 (en) * 2000-02-24 2001-08-30 Human Genome Sciences, Inc. Human polynucleotides, polypeptides, and antibodies
WO2001070804A1 (en) * 2000-03-17 2001-09-27 Human Genome Sciences, Inc. 7 human ovarian and ovarian cancer associated proteins
WO2001075074A1 (en) * 2000-03-31 2001-10-11 Genetics Institute, Llc Novel proteins
WO2001074896A1 (en) * 2000-04-03 2001-10-11 Human Genome Sciences, Inc. Human polynucleotides, polypeptides, and antibodies
WO2001079454A1 (en) * 2000-04-13 2001-10-25 Smithkline Beecham Corporation Novel compounds
WO2001098342A1 (en) * 2000-06-22 2001-12-27 Smithkline Beecham Corporation Novel compounds
WO2002018435A1 (en) * 2000-08-28 2002-03-07 Human Genome Sciences, Inc. 18 human secreted proteins
US6399379B1 (en) 1992-09-29 2002-06-04 Isis Pharmaceuticals, Inc. Antisense modulation of interleukin 12 p35 subunit expression
US6448081B1 (en) 2001-05-07 2002-09-10 Isis Pharmaceuticals, Inc. Antisense modulation of interleukin 12 p40 subunit expression
US6706264B1 (en) 1994-03-14 2004-03-16 Genetics Institute, Llc Use of IL-12 antagonists in the treatment of conditions promoted by an increase in levels of IFN-y
US6902734B2 (en) 2000-08-07 2005-06-07 Centocor, Inc. Anti-IL-12 antibodies and compositions thereof
US7026456B1 (en) 1998-01-23 2006-04-11 Hoffman-La Roche, Inc. Antibodies against human IL-12
US7135458B1 (en) 1995-11-15 2006-11-14 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Interferon-γ inducing polypeptide, pharmaceutical composition thereof, monoclonal antibody thereto, and methods of use
US7247442B1 (en) 1998-05-12 2007-07-24 Human Genome Sciences, Inc. Antibodies to HHPEN62 polypeptide
US8080247B2 (en) 2000-08-07 2011-12-20 Janssen Biotech, Inc. Anti-IL-12 antibodies
US20190092853A1 (en) * 2017-09-25 2019-03-28 Janssen Biotech, Inc. Safe and Effective Method of Treating Lupus with Anti-IL12/IL23 Antibody
US10961307B2 (en) 2018-09-24 2021-03-30 Janssen Biotech, Inc. Methods of treating moderately to severely active ulcerative colitis by administering an anti-IL12/IL23 antibody
US11197913B2 (en) 2016-03-29 2021-12-14 Janssen Biotech, Inc. Method of treating psoriatic arthritis with increased interval dosing of anti-IL12/23 antibody
US11578124B2 (en) 2018-05-18 2023-02-14 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-IL12/IL23 antibody
WO2023070038A3 (en) * 2021-10-20 2023-09-28 Synthekine, Inc. Human il-12p40 variants and uses thereof
US11780911B2 (en) 2019-05-23 2023-10-10 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
US12103954B2 (en) 2021-10-20 2024-10-01 Synthekine, Inc. Heterodimeric Fc cytokines and uses thereof
US12258393B2 (en) 2020-05-21 2025-03-25 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha

Families Citing this family (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6150328A (en) 1986-07-01 2000-11-21 Genetics Institute, Inc. BMP products
US5457038A (en) * 1988-11-10 1995-10-10 Genetics Institute, Inc. Natural killer stimulatory factor
US5811523A (en) * 1988-11-10 1998-09-22 Trinchieri; Giorgio Antibodies to natural killer stimulatory factor
US5780597A (en) * 1989-12-22 1998-07-14 Hoffmann-La Roche Inc. Monoclonal antibodies to cytotoxic lymphocyte maturation factor
WO1993009229A1 (en) 1991-11-04 1993-05-13 Genetics Institute, Inc. Recombinant bone morphogenetic protein heterodimers, compositions and methods of use
US20080139474A1 (en) * 1991-11-04 2008-06-12 David Israel Recombinant bone morphogenetic protein heterodimers, compositions and methods of use
US6291206B1 (en) 1993-09-17 2001-09-18 Genetics Institute, Inc. BMP receptor proteins
AU689184B2 (en) * 1993-12-07 1998-03-26 Genetics Institute, Llc BMP-12, BMP-13 and tendon-inducing compositions thereof
US5571515A (en) * 1994-04-18 1996-11-05 The Wistar Institute Of Anatomy & Biology Compositions and methods for use of IL-12 as an adjuvant
US5635182A (en) * 1994-06-16 1997-06-03 Genetics Institute, Inc. Method of detecting ligand interactions
US6372208B1 (en) 1999-09-28 2002-04-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant virus
US6251957B1 (en) 1995-02-24 2001-06-26 Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant virus
US5872154A (en) * 1995-02-24 1999-02-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant adenovirus
AU729579B2 (en) * 1996-10-23 2001-02-01 Trustees Of The University Of Pennsylvania, The Immunotherapy and improved vaccines
US5994104A (en) * 1996-11-08 1999-11-30 Royal Free Hospital School Of Medicine Interleukin-12 fusion protein
JP2001521906A (ja) * 1997-11-03 2001-11-13 ザ・ウイスター・インステイテユート・オブ・アナトミー・アンド・バイオロジー 血管新生を阻害し、癌を処置するための方法及び組成物
ES2590912T3 (es) 1997-12-08 2016-11-24 Merck Patent Gmbh Proteínas de fusión heterodiméricas útiles para inmunoterapia dirigida y estimulación general del sistema inmunitario
EP1049484B1 (en) * 1998-01-23 2004-03-31 Genetics Institute, LLC Use of il-11 to enhance cell mediated immunity for treating various viral and parasitic infections and cancer
US20030105294A1 (en) * 1998-02-25 2003-06-05 Stephen Gillies Enhancing the circulating half life of antibody-based fusion proteins
US6375944B1 (en) 1998-09-25 2002-04-23 The Wistar Institute Of Anatomy And Biology Methods and compositions for enhancing the immunostimulatory effect of interleukin-12
US6727224B1 (en) * 1999-02-01 2004-04-27 Genetics Institute, Llc. Methods and compositions for healing and repair of articular cartilage
US6800460B1 (en) * 1999-03-11 2004-10-05 Schering Corporation Mammalian cytokine complexes
SK782002A3 (en) 1999-07-21 2003-08-05 Lexigen Pharm Corp FC fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US7067110B1 (en) 1999-07-21 2006-06-27 Emd Lexigen Research Center Corp. Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
MXPA02001417A (es) 1999-08-09 2002-08-12 Lexigen Pharm Corp Complejos multiples de citosina-anticuerpo.
DK1223990T3 (da) 1999-10-15 2004-11-29 Inst Genetics Llc Formuleringer af hyaluronsyre til tilförsel af osteogene proteiner
CA2391080A1 (en) 1999-11-12 2001-05-25 Merck Patent Gesellschaft Mit Beschraenkter Haftung Erythropoietin forms with improved properties
US7115712B1 (en) * 1999-12-02 2006-10-03 Maxygen, Inc. Cytokine polypeptides
HUP0204475A2 (en) * 2000-02-11 2003-04-28 Merck Patent Gmbh Enhancing the circulating half-life of antibody-based fusion proteins
KR20030064275A (ko) * 2000-06-29 2003-07-31 메르크 파텐트 게엠베하 면역싸이토카인 흡수 증강제와의 조합 치료에 의한항체-싸이토카인 융합 단백질 매개 면역 반응 증강
US20030082233A1 (en) * 2000-12-01 2003-05-01 Lyons Karen M. Method and composition for modulating bone growth
RU2003129528A (ru) 2001-03-07 2005-04-10 Мерк Патент ГмбХ (DE) Способ экспрессии белков, содержащих в качестве компонента гибридный изотип антитела
WO2002079415A2 (en) 2001-03-30 2002-10-10 Lexigen Pharmaceuticals Corp. Reducing the immunogenicity of fusion proteins
EP1383785B1 (en) 2001-05-03 2011-03-16 Merck Patent GmbH Recombinant tumor specific antibody and use thereof
US7226587B2 (en) * 2001-06-01 2007-06-05 Wyeth Compositions and methods for systemic administration of sequences encoding bone morphogenetic proteins
TWI267378B (en) * 2001-06-08 2006-12-01 Wyeth Corp Calcium phosphate delivery vehicles for osteoinductive proteins
DK1454138T3 (da) 2001-12-04 2012-02-13 Merck Patent Gmbh Immunocytokiner med moduleret selektivitet
WO2004055056A1 (en) * 2002-12-17 2004-07-01 Merck Patent Gmbh Humanized antibody (h14.18) of the mouse 14.18 antibody binding to gd2 and its fusion with il-2
US7939058B2 (en) 2003-07-03 2011-05-10 University Of Southern California Uses of IL-12 in hematopoiesis
JP5392981B2 (ja) * 2003-09-12 2014-01-22 ワイス・エルエルシー 骨形成蛋白の送達のための注入可能なリン酸カルシウム固体ロッドおよびペースト
EP1702069A2 (en) * 2004-01-05 2006-09-20 EMD Lexigen Research Center Corp. Interleukin-12 targeted to oncofoetal fibronectin
US20040260068A1 (en) * 2004-02-26 2004-12-23 Naoya Tsurushita Humanized chicken antibodies
TW200613554A (en) 2004-06-17 2006-05-01 Wyeth Corp Plasmid having three complete transcriptional units and immunogenic compositions for inducing an immune response to HIV
WO2006081379A1 (en) * 2005-01-26 2006-08-03 Wyeth Use of sfrps as markers of bmp activity
EP1863518A2 (en) * 2005-03-30 2007-12-12 Wyeth Methods for stimulating hair growth by administering bmps
PL1966238T3 (pl) 2005-12-30 2012-09-28 Merck Patent Gmbh Warianty interleukiny-12p40 o polepszonej stabilności
WO2008070647A1 (en) * 2006-12-07 2008-06-12 Wyeth Methods and compositions for assessing il-12 or the neutralization of il-12 in a sample
EP2248903A1 (en) 2009-04-29 2010-11-10 Universitat Autònoma De Barcelona Methods and reagents for efficient and targeted gene transfer to monocytes and macrophages
JO3244B1 (ar) 2009-10-26 2018-03-08 Amgen Inc بروتينات ربط مستضادات il – 23 البشرية
US9878012B2 (en) 2010-05-18 2018-01-30 Neumedicines, Inc. IL-12 formulations for enhancing hematopoiesis
WO2012174056A1 (en) 2011-06-13 2012-12-20 Neumedicines, Inc. Mitigation of cutaneous injury with il-12
CA2843014C (en) 2011-07-27 2020-01-21 Neumedicines, Inc. Use of il-12 to generate endogenous erythropoietin
JP2015505326A (ja) 2012-01-18 2015-02-19 ニューメディシンズ,インコーポレーテッド 放射線防護及び放射線誘発性毒性緩和のためのil−12
US20140350087A9 (en) 2012-03-22 2014-11-27 Halozyme, Inc. Oncovector Nucleic Acid Molecules and Methods of Use
EP2940128A1 (en) 2014-04-30 2015-11-04 Institut d'Investigació Biomèdica de Bellvitge (IDIBELL) Adenovirus comprising an albumin-binding moiety
WO2017062953A1 (en) 2015-10-10 2017-04-13 Intrexon Corporation Improved therapeutic control of proteolytically sensitive, destabilized forms of interleukin-12

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005147A1 (en) * 1988-11-10 1990-05-17 Genetics Institute, Inc. Natural killer stimulatory factor
EP0433827A2 (en) * 1989-12-22 1991-06-26 F. Hoffmann-La Roche Ag Cytotoxic lymphocyte maturation factor and monoclonal antibodies directed thereto

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4473555A (en) * 1983-10-17 1984-09-25 Syntex (U.S.A.) Inc. Nona- and dodecapeptides for augmenting natural killer cell activity
US4879111A (en) * 1986-04-17 1989-11-07 Cetus Corporation Treatment of infections with lymphokines
US5185431A (en) * 1988-08-31 1993-02-09 Eisai Co., Ltd. Recombinant natural killer cell activator
US5457038A (en) * 1988-11-10 1995-10-10 Genetics Institute, Inc. Natural killer stimulatory factor

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005147A1 (en) * 1988-11-10 1990-05-17 Genetics Institute, Inc. Natural killer stimulatory factor
EP0433827A2 (en) * 1989-12-22 1991-06-26 F. Hoffmann-La Roche Ag Cytotoxic lymphocyte maturation factor and monoclonal antibodies directed thereto

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF EXPERIMENTAL MEDICINE, vol. 170, no. 3, 01 September 1989, New York, NY (US); M. KOBAYASHI et al., pp. 827-845 *
Journal of Experimental Medicine, volume 170, no. 3, 1st September 1989, (New York, US) M. Kobayashi et al.: "Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes", pages 827-845, see the whole article, especially page 829; page 836 and page 847, lines 7-14 *
JOURNAL OF IMMUNOLOGY, vol. 146, no. 9, May 1991, Baltimore, MD (US); S.F. WOLF et al., pp. 3074-3081 *
Proceedings of the National Academy of Sciences, volume 87, 5 September 1990, Immunology (Washington, US) A.S. Stern et al.: "Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells", pages 6808-6812, see page 6811; page 6812, line 36 - end *
PROCEEDINGS OF THE NATL. ACADEMY OF SCIENCES USA, vol. 87, 05 September 1990, Immunology, Washington, DC (US); A.S. STERN et al., pp. 6808-6812 *
The Journal of Immunology, volume 146, no. 9, May 1991 (Baltimore, US) S.F. Wolf et al.: "Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells", pages 3074-3081, see the whole article *

Cited By (108)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0790309A1 (en) * 1989-12-22 1997-08-20 F. Hoffmann-La Roche Ag Cytotoxic lymphocyte maturation factor and monoclonal antibodies directed thereto
EP0790308A1 (en) * 1989-12-22 1997-08-20 F. Hoffmann-La Roche Ag Cytotoxic lymphocyte maturation factor and monoclonal antibodies directed thereto
US6399379B1 (en) 1992-09-29 2002-06-04 Isis Pharmaceuticals, Inc. Antisense modulation of interleukin 12 p35 subunit expression
US5650492A (en) * 1993-07-02 1997-07-22 Hoffmann-La Roche Inc. P-40 homodimer of interleukin-12
EP0640689A3 (en) * 1993-07-02 1995-06-28 Hoffmann La Roche P40 homodimer of interleukin-12.
US7534430B2 (en) 1994-03-14 2009-05-19 Genetics Institute, Llc Use of IL-12 and IL-12 antagonists in the treatment of autoimmune diseases
EP2311484A1 (en) * 1994-03-14 2011-04-20 Genetics Institute, LLC Use of IL-12 and IL-12 antagonists for the manufacture of a pharmaceutical composition for the treatment of autoimmune diseases
EP2201959A3 (en) * 1994-03-14 2011-03-16 Genetics Institute, LLC Use of IL-12 and IL-12 antagonists for the manufacture of a pharmaceutical composition for the treatment of autoimmune diseases
US7138115B2 (en) 1994-03-14 2006-11-21 Genetics Institute, Llc Use of IL-12 and IL-12 antagonists in the treatment of autoimmune diseases
US8012475B2 (en) 1994-03-14 2011-09-06 Genetics Institute, Llc Use of IL-12 and IL-12 antagonists in the treatment of autoimmune diseases
US6706264B1 (en) 1994-03-14 2004-03-16 Genetics Institute, Llc Use of IL-12 antagonists in the treatment of conditions promoted by an increase in levels of IFN-y
WO1995024918A1 (en) * 1994-03-14 1995-09-21 Genetics Institute, Inc. Use of il-12 and il-12 antagonists in the treatment of autoimmune diseases
EP1179348A3 (en) * 1994-03-14 2003-12-03 Genetics Institute, LLC Use of IL-12 and IL-12 antagonists in the treatment of autoimmune diseases
US5912324A (en) * 1994-07-14 1999-06-15 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Interferon-gamma (IFN-γ) inducing factor (IGIF, IL-18) purified from murine liver
US6277598B1 (en) 1994-07-14 2001-08-21 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo DNA molecule encoding interferon-gamma (IFN-λ) inducing factor (IGIF, IL-18) and DNA fragment thereof
US6274709B1 (en) 1994-07-14 2001-08-14 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Interferon-gamma (IFN-γ) inducing factor (IGIF, IL-18) and peptide fragment thereof
EP0692536A3 (en) * 1994-07-14 1997-03-26 Hayashibara Biochem Lab Protein that induces interferon gamma production and monoclonal antibodies against it
US5914253A (en) * 1994-07-14 1999-06-22 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Recombinant production of murine interferon--γ (IFN-γ) inducing factor (IGIF, IL-18)
US7758853B2 (en) 1994-07-14 2010-07-20 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo IFN-γ production inducing protein (IGIF, IL-18)
EP0962531A3 (en) * 1994-11-15 1999-12-15 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Interferon-gamma production inducing isolated polypeptide fragment and an isolated DNA fragment encoding said polypeptide
US6214584B1 (en) 1994-11-15 2001-04-10 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Human Interferon-γinducing factor
EP0712931A3 (en) * 1994-11-15 1997-03-26 Hayashibara Biochem Lab Interferon-gamma inducing polypeptide monoclonal antibody, and composition for interferon-gamma linked diseases
US5908620A (en) * 1995-01-31 1999-06-01 National Jewish Medical And Research Center Treatment for diseases involving inflammation
US5674483A (en) * 1995-01-31 1997-10-07 National Jewish Medical And Research Center Treatment for diseases involving inflammation
US5906815A (en) * 1995-01-31 1999-05-25 National Jewish Medical And Research Center Treatment for diseases involving inflammation
WO1996024369A1 (en) * 1995-02-06 1996-08-15 Genetics Institute, Inc. Formulations for il-12
AU695129B2 (en) * 1995-02-06 1998-08-06 Genetics Institute, Llc Formulations for IL-12
US5891680A (en) * 1995-02-08 1999-04-06 Whitehead Institute For Biomedical Research Bioactive fusion proteins comprising the p35 and p40 subunits of IL-12
US5853714A (en) * 1995-03-27 1998-12-29 Genetics Institute, Inc. Method for purification of IL-12
US6441138B2 (en) 1995-09-26 2002-08-27 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Protein which induces interferon-γ production by immunocompetent cell
EP0767178A1 (en) * 1995-09-26 1997-04-09 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Protein which induces interferon-gamma production by immunocompetent cell
US6403079B1 (en) 1995-09-26 2002-06-11 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Process for producing a pharmaceutical composition containing a protein which induces interferon-γ production by an immunocompetent cell
US6242255B1 (en) 1995-09-26 2001-06-05 Kabushiki Kaisha Hayashibara Seibutsu Kegaku Kenkyujo Protein which induces interferon-gamma production by immunocompetent cell
US7135458B1 (en) 1995-11-15 2006-11-14 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Interferon-γ inducing polypeptide, pharmaceutical composition thereof, monoclonal antibody thereto, and methods of use
US6509313B1 (en) 1996-02-28 2003-01-21 Cornell Research Foundation, Inc. Stimulation of immune response with low doses of cytokines
EP0901370A4 (en) * 1996-05-07 1999-07-14 Cornell Res Foundation Inc STIMULATING IMMUNE RESPONSE BY LOW-DOSE IL-2
US5928636A (en) * 1996-05-13 1999-07-27 Hoffmann-La Roche Inc. Use of IL-12 and IFNα for the treatment of infectious diseases
WO1998017814A3 (en) * 1996-10-18 1998-08-27 Genemedicine Inc Gene expression and delivery systems and uses
WO1998017689A3 (en) * 1996-10-18 1998-08-20 Genemedicine Inc Il-12 gene expression and delivery systems and uses
WO1998041229A1 (en) * 1997-03-19 1998-09-24 F. Hoffmann-La Roche Ag USE OF IL-12p40 AS IMMUNOSTIMULANT
US8716449B2 (en) 1998-01-23 2014-05-06 Hoffman-Laroche, Inc. Antibodies against human IL-12
US7026456B1 (en) 1998-01-23 2006-04-11 Hoffman-La Roche, Inc. Antibodies against human IL-12
US9657097B2 (en) 1998-01-23 2017-05-23 Hoffman-Laroche, Inc. Methods of treating autoimmune diseases by administering monoclonal antibodies against human IL-12
US7247442B1 (en) 1998-05-12 2007-07-24 Human Genome Sciences, Inc. Antibodies to HHPEN62 polypeptide
WO2000050453A1 (en) * 1999-02-26 2000-08-31 The Johns Hopkins University A novel inhibitor of programmed cell death
WO2000055200A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. 50 human secreted proteins
WO2000055201A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. 49 human secreted proteins
WO2000055198A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. 50 human secreted proteins
WO2000058355A1 (en) * 1999-03-26 2000-10-05 Human Genome Sciences, Inc. 50 human secreted proteins
WO2000063230A3 (en) * 1999-03-26 2001-02-08 Human Genome Sciences Inc 49 human secreted proteins
WO2000059938A1 (en) * 1999-04-01 2000-10-12 Genetics Institute, Inc. Angiopoietin-like proteins, crisp proteins and polynucleotides encoding same
WO2000061628A1 (en) * 1999-04-09 2000-10-19 Human Genome Sciences, Inc. 49 human secreted proteins
WO2001007476A1 (en) * 1999-07-21 2001-02-01 Human Genome Sciences, Inc. 26 human prostate and prostate cancer associated proteins
WO2001012786A1 (en) * 1999-08-16 2001-02-22 Human Genome Sciences, Inc. Retinoid receptor interacting polynucleotides, polypeptides, and antibodies
WO2001018176A1 (en) * 1999-09-03 2001-03-15 Human Genome Sciences, Inc. Immunoglobulin superfamily polynucleotides, polypeptides, and antibodies
WO2001018049A1 (en) * 1999-09-09 2001-03-15 Human Genome Sciences, Inc. Steroid hormone receptor polynucleotides, polypeptides, and antibodies
WO2001021658A1 (en) * 1999-09-24 2001-03-29 Human Genome Sciences, Inc. 32 human secreted proteins
WO2001053343A1 (en) * 2000-01-18 2001-07-26 Human Genome Sciences, Inc. Human polynucleotides, polypeptides, and antibodies
WO2001055309A3 (en) * 2000-01-31 2002-07-18 Human Genome Sciences Inc Nucleic acids, proteins, and antibodies
WO2001055307A3 (en) * 2000-01-31 2002-01-10 Human Genome Sciences Inc Nucleic acids, proteins, and antibodies
WO2001055328A3 (en) * 2000-01-31 2002-07-04 Human Genome Sciences Inc Nucleic acids, proteins, and antibodies
WO2001055202A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055350A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055205A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055207A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055201A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055208A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055204A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055203A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001055206A1 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
WO2001062789A1 (en) * 2000-02-24 2001-08-30 Human Genome Sciences, Inc. Human polynucleotides, polypeptides, and antibodies
WO2001070804A1 (en) * 2000-03-17 2001-09-27 Human Genome Sciences, Inc. 7 human ovarian and ovarian cancer associated proteins
WO2001075074A1 (en) * 2000-03-31 2001-10-11 Genetics Institute, Llc Novel proteins
WO2001074896A1 (en) * 2000-04-03 2001-10-11 Human Genome Sciences, Inc. Human polynucleotides, polypeptides, and antibodies
WO2001079454A1 (en) * 2000-04-13 2001-10-25 Smithkline Beecham Corporation Novel compounds
WO2001098342A1 (en) * 2000-06-22 2001-12-27 Smithkline Beecham Corporation Novel compounds
US7560247B2 (en) 2000-08-07 2009-07-14 Centocor Ortho Biotech Inc. Nucleic acids encoding anti-IL-12 antibodies, and methods of production
US9605067B2 (en) 2000-08-07 2017-03-28 Janssen Biotech, Inc. Nucleic acids encoding anti-IL-12 antibody
US7887807B2 (en) 2000-08-07 2011-02-15 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies and compositions
US7166285B2 (en) 2000-08-07 2007-01-23 Centocor, Inc. Anti-IL-12 antibodies and compositions
US7063964B2 (en) 2000-08-07 2006-06-20 Jill Giles-Komar Nucleic acids encoding IL-12 antibody
US6902734B2 (en) 2000-08-07 2005-06-07 Centocor, Inc. Anti-IL-12 antibodies and compositions thereof
US8080247B2 (en) 2000-08-07 2011-12-20 Janssen Biotech, Inc. Anti-IL-12 antibodies
US8084233B2 (en) 2000-08-07 2011-12-27 Janssen Biotech, Inc. Nucleic acids encoding anti-IL-12 antibody
US8329170B2 (en) 2000-08-07 2012-12-11 Janssen Biotech, Inc. Method for treating psoriasis by administering an anti-IL-12 antibody
US8329171B2 (en) 2000-08-07 2012-12-11 Janssen Biotech, Inc. Method for treating psoriatic arthritis by administering an anti-IL-12 antibody
US8703141B2 (en) 2000-08-07 2014-04-22 Janssen Biotech, Inc. Method for treating Crohn's disease by administering an anti-IL-12 antibody
US11078267B2 (en) 2000-08-07 2021-08-03 Janssen Biotech, Inc. Method for treating lupus by administering an anti-IL-12 antibody
US8894990B2 (en) 2000-08-07 2014-11-25 Janssen Biotech, Inc. Method for treating psoriatic arthritis by administering an anti-IL-12 antibody
US9409984B2 (en) 2000-08-07 2016-08-09 Janssen Biotech, Inc. Method for treating psoriasis by administering an anti-IL-12 antibody
US9428579B2 (en) 2000-08-07 2016-08-30 Janssen Biotech, Inc. Method of treating Crohn's disease by administering an anti-IL-12 antibody
US7279157B2 (en) 2000-08-07 2007-10-09 Centocor, Inc. Method for treating psoriasis by administering an anti-il-12 antibody
US10519231B2 (en) 2000-08-07 2019-12-31 Janssen Biotech, Inc. Method for treating lupus by administering an anti-IL-12 antibody
US9676848B2 (en) 2000-08-07 2017-06-13 Janssen Biotech, Inc. Anti-IL-12 antibodies and compositions
US9862766B2 (en) 2000-08-07 2018-01-09 Janssen Biotech, Inc. Method of treating lupus by administering an anti-IL-12 antibody
US10259867B2 (en) 2000-08-07 2019-04-16 Janssen Biotech, Inc. Method for treating lupus by administering an anti-IL-12 antibody
WO2002018435A1 (en) * 2000-08-28 2002-03-07 Human Genome Sciences, Inc. 18 human secreted proteins
US6448081B1 (en) 2001-05-07 2002-09-10 Isis Pharmaceuticals, Inc. Antisense modulation of interleukin 12 p40 subunit expression
US11197913B2 (en) 2016-03-29 2021-12-14 Janssen Biotech, Inc. Method of treating psoriatic arthritis with increased interval dosing of anti-IL12/23 antibody
US20190092853A1 (en) * 2017-09-25 2019-03-28 Janssen Biotech, Inc. Safe and Effective Method of Treating Lupus with Anti-IL12/IL23 Antibody
US12091452B2 (en) 2017-09-25 2024-09-17 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-IL12/IL23 antibody
US11578124B2 (en) 2018-05-18 2023-02-14 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-IL12/IL23 antibody
US10961307B2 (en) 2018-09-24 2021-03-30 Janssen Biotech, Inc. Methods of treating moderately to severely active ulcerative colitis by administering an anti-IL12/IL23 antibody
US11780911B2 (en) 2019-05-23 2023-10-10 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
US12258393B2 (en) 2020-05-21 2025-03-25 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
WO2023070038A3 (en) * 2021-10-20 2023-09-28 Synthekine, Inc. Human il-12p40 variants and uses thereof
US12103954B2 (en) 2021-10-20 2024-10-01 Synthekine, Inc. Heterodimeric Fc cytokines and uses thereof
US12522639B2 (en) 2021-10-20 2026-01-13 Synthekine, Inc. Heterodimeric FC cytokines and uses thereof

Also Published As

Publication number Publication date
US5569454A (en) 1996-10-29
JP4423313B2 (ja) 2010-03-03
US5648072A (en) 1997-07-15
US5457038A (en) 1995-10-10
JP2007306929A (ja) 2007-11-29
US5648467A (en) 1997-07-15
EP0549711A1 (en) 1993-07-07
JPH06501009A (ja) 1994-01-27
JP2009178164A (ja) 2009-08-13
AU8723691A (en) 1992-04-15
JP3652365B2 (ja) 2005-05-25
JP2005046158A (ja) 2005-02-24
JP4014590B2 (ja) 2007-11-28

Similar Documents

Publication Publication Date Title
US5648467A (en) Natural killer cell stimulatory factor
EP0441900B1 (en) Natural killer stimulatory factor
US5811523A (en) Antibodies to natural killer stimulatory factor
EP0473724B1 (en) A human cytokine, interleukin-9
US4959455A (en) Primate hematopoietic growth factors IL-3 and pharmaceutical compositions
CA1341489C (en) Family of primate hematopoietic growth factors
US5371193A (en) Mammalian cytokine, IL-11
US5414071A (en) Human cytokine IL-9
JP3652365B6 (ja) ナチュラルキラー刺激因子
IE871727L (en) Novel family of primate il3-like hematopoietic growth¹factors.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1991918119

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1991918119

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

ENP Entry into the national phase

Ref country code: US

Ref document number: 1997 956240

Date of ref document: 19971022

Kind code of ref document: A

Format of ref document f/p: F

WWW Wipo information: withdrawn in national office

Ref document number: 1991918119

Country of ref document: EP