WO1992001786A1 - Cassettes de ribozymes portables, sequences d'adn les contenant, ribozymes codes par ces sequences d'adn, et compositions contenant ces ribozymes - Google Patents
Cassettes de ribozymes portables, sequences d'adn les contenant, ribozymes codes par ces sequences d'adn, et compositions contenant ces ribozymes Download PDFInfo
- Publication number
- WO1992001786A1 WO1992001786A1 PCT/EP1991/001403 EP9101403W WO9201786A1 WO 1992001786 A1 WO1992001786 A1 WO 1992001786A1 EP 9101403 W EP9101403 W EP 9101403W WO 9201786 A1 WO9201786 A1 WO 9201786A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ribozyme
- dna
- rna
- sequence
- nucleotides
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/121—Hammerhead
Definitions
- the present invention relates to portable ribozyme cassettes (which may also be designated as "insertable ribozyme cassettes") of general applicability which can be inserted into given restriction enzyme cleavage sites and can thus be used for the simplified construction of ribozymes.
- the invention also relates to DNA sequences containing said portable ribozyme cassettes, recombinant vectors containing such DNA sequences and to host organisms which are transformed by the recombinant vectors of the present invention.
- the invention relates to the ribozymes encoded by said DNA sequences.
- the invention also relates to compositions containing the ribozymes or DNA sequences of the present invention. Other embodiments will become apparent from the following description.
- RNA enzymes Enzymes which are composed of an RNA chain only, are called “RNA enzymes” or “ribozymes”. Such catalytic RNAs have been observed in different biological systems.
- the first ribozyme discovered is the nuclear rRNA from Tetrahymena thermophila which contains an intervening sequence (IVS) of 413 nucleotides, and is capable of undergoing self-cleaving in the absence of proteins.
- the IVS catalyzes different transesterification reactions, which result in the excision of the IVS from the precursor RNA and the ligation of the two exons.
- This IVS RNA enzyme has been described in detail, e.g. Kruger at al., Cell 31 (1982); 147-157, Cech, Cell 34 (1983), 713-713; Zaug et al., Science 224 (1984), 574-578; Cech, Cell 44 (1986), 207-210; Cech and Bass, Annu. Rev.
- Cech and coworkers have also described the modification of the IVS ribozyme to use it for the cleavage of large RNA molecules in a sequence- specific manner.
- the modified IVS recognizes small sequence motifs, like CUCU and related sequences like CCCU and cleaves them in a sequence-spe cific manner comparable to DNA restriction enzymes.
- the ribozymes of the present invention are derived from another class of naturally occurring RNAs which undergo site-specific autolytic cleavage generating two cleavage products having a 5'-hydroxyl group and a 2',3'- cyclic phosphodiester, at their termini, respectively.
- the majority of these self-cleaving RNAs originates from satellite RNAs of plant viruses.
- a self-catalyzed cleavage reaction has been demonstrated in vitro for the avocado sunblotch viroid (ASBV) (Hutchins et al., Nucleic Acids Res. 14 (1986), 3627-3640, the satellite RNAs of tobacco ring spot virus (sTobRV) (Prody et al., Science 231 (1986), 1577-1580; Buzayan et al., Proc.Natl.Acad.Sci.
- ASBV avocado sunblotch viroid
- sTobRV satellite RNAs of tobacco ring spot virus
- sLTSV lucerne transient streak virus
- RNAs can assume a so-called "hammerhead” structure (Forster and Symons, Cell 50, (1987), 9-16) which determines the site of cleavage.
- hammerhead structure Formster and Symons, Cell 50, (1987), 9-16
- cleavage can occur in trans, i.e. that one molecule can catalyze the cleavage of the other (Uhlenbeck, Nature 328 ( 1987) , 596-600).
- RNA which can be cleaved is considered the substrate (target) RNA, and the RNA which catalyzes the cleavage is called an RNA enzyme or "ribozyme".
- any trinucleotide sequence NUH can be a target sequence (N can be A, C, G or U, H can be A,C or G).
- N can be A, C, G or U
- H can be A,C or G.
- motifs AUA, AUU, CUU, UUA, UUU represent target sequences .
- EP-A2 321 201 describes the ribozymes of the "hammerhead"-type and its usage to create RNA endonucleases which are, in contrast to the IVS ribozyme described in WO 88/04300, highly specific for a certain target RNA.
- a specific ribozyme RNA can be designed that consists of two functional regions: the actual catalytic domain, and the regions which are complementary to the target RNA, so that the ribozyme can bind to its substrate in a sequence-specific manner, and in that way that the catalytic domain of the ribozyme is placed opposite of the cleavage motif of the target RNA.
- EP-A2 321 201 describes the procedure to create a ribozyme.
- a DNA oligonucleotide is synthesized according to a specific cleavage motif and the sequence context next to it within the target RNA. After cloning of this DNA oligonucleotide downstream of an appropriate promoter, this synthetic DNA can be used for the in vitro and in vivo synthesis of the target-specific ribozyme RNA. Transcription generates an RNA molecule which contains the catalytic ribozyme domain, flanked by sequences that are complementary to the target RNA and usually also vector-derived sequences which are not complementary to the target RNA.
- cleavage occurs 3'-terminal to the motif of the substrate RNA, e.g. GUC. Since the base-pairing complementary regions between the substrate RNA and the ribozyme RNA which do not participate in the catalytic reaction, enable the sequence-specific binding of the ribozyme to its target, their length influences the specificity and efficiency of the ribozyme reaction.
- the ribozymes of the hammerhead-type which are so far known from the approve prior art suffer from the disadvantage that for each and every use they have to be synthesized de novo.
- the technical problem underlying the present invention is to provide a means permitting the ease and precise construction of DNA sequences of sufficient length which encode ribozymes that cleave a desired target RNA.
- the present invention relates to portable ribozyme cassettes displaying the following features :
- DNA sequence encoding that part of a ribozyme which does not form base pairs with the target RNA refers to DNA sequences encoding the loop of ribozymes which may also be called the "active domain” or "catalytic domain” of the ribozyme.
- DNA sequence (a) are the loops created when the ribozymes given in Figs. 1, 4, 7 and 13, pair with their target RNA (substrate RNA).
- Examples of a sequence (a) are also indicated in Figs. 2 and 3.
- a particular DNA strand it is understood that the DNA strand that "encodes" the RNA is of the same polarity as the corresponding RNA.
- the sense strand of a cDNA sequence encodes the target RNA
- the antisense strand together with the sequence (a) encodes the ribozyme RNA that is directed against the target RNA.
- sequences (b) do not represent a continuous sequence but consist of a part flanking sequence (a) at its 5'- end and another part at its 3'-end, respectively. Sequences (b) can also consist just of a part flanking the 5 '-end of sequence (a) or just at the 3'-end, respectively.
- An example, of such DNA sequences (b) is given in Fig. 1, and 2.
- the portable ribozyme cassettes can be easily synthesized because - as is evident from the general formula presented hereinbelow - they only contain a few nucleotides.
- the production of the portable ribozyme cassettes of the present invention preferably involves cloning steps because these portable ribozyme cassettes contain additional longer sequences, such as marker sequences.
- the portable ribozyme cassettes of the present invention simplify the generation of target-specific ribozyme RNAs.
- they are inserted into the DNA encoding the target RNA, e.g. into a cDNA.
- the cDNA encoding the target RNA is converted into a ribozyme construct, respectively, so that transcription can generate the desired catalytic antisense ribozyme RNA.
- more than 20 preferred restriction enzyme cleavage sites can be used for the insertion of the portable ribozyme cassettes of the present invention.
- a particular advantage of the ribozyme cassettes of the present invention is that it is not necessary to design a ribozyme RNA ac cording to the sequence of the target. In fact, it is not even necessary to know the nucleotide sequence of the target.
- a particular portable ribozyme cassette of the present invention e.g. a Sall-specific cassette can be used in an universal way for the insertion into any SalI site in any target.
- the eventually resulting RNAs combine the characteristics of ribozymes and antisense RNAs and are therefore also called “catalytic antisense RNAs" or "antisense-ribozymes” or “antizymes”.
- a striking advantage of the portable ribozyme cassettes of the present invention thus is their general applicability.
- the present invention relates to a portable ribozyme cassette, wherein said DNA sequences (a) and (b) are represented by the following general formula:
- nucleotides K and L represent the first and second nucleotide (5' -3') of the target motif of the target RNA
- nucleotides M 1 and N 1 are the first nucleotides flanking the target motif of the target RNA at the
- nucleotides M 2 and N 2 are the second nucleotides flanking the target motif of the target RNA at the 5'- and 3'- side, respectively, and the nucleotides N 3 and N 4 are located in the third and fourth position at the
- the nucleotides M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N 4 independently, are A,G,C or T or not present in the cassette, under the proviso that the presence of M 2 requires the presence of M 1 ,
- M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N. is 0 to 4 , preferably 1 to 4;
- W, X or Y is A, G, C or T;
- x is at least 6, wherein each X independently is A, G, C or T and wherein
- X is selected so that the complementary nucleotides X' form at least one additional base pair next to the base pair formed by the nucleotides C and G 2 (which flank the sequence (X')) in the secondary structure which is formed when the ribozyme pairs to its target sequence;
- y is 0 or 1
- nucleotide C 1 when the nucleotide C 1 is C, the nucleotide G 1 is G, when the nucleotide C 1 is T, the nucleotide G is A, when nucleotide C is C or T, the nucleotides C 2 and G 2 are either C and G or T and A, respectively;
- nucleotides marked with " ' " are complementary nucleotides
- nucleotides M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N 4 correspond to nucleotides from the protruding ends obtained after cleavage of a restriction enzyme cleavage site within the DNA encoding the target RNA with the corresponding restriction enzyme, said restriction enzyme cleavage site containing in said protruding ends an additional nucleotide Z which is A.G.C or T.
- the interaction between the target RNA and the ribozyme of the present invention can schematically be illustrated as follows: 5' N N N N N N N N M 2 M 1 K L Z N 1 N 2 N 3 N 4 N N N N N N N 3 ' * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
- nucleotides N and N' are derived from the DNA encoding the target RNA
- the nucleotides K L Z represent the cleavage motif of the target RNA
- sequence 3' A A G C 1 (X') (x) G 2 Y' (y) A G W'A G T C 5' represents the sequence (a), that is the DNA sequence encoding that part of a ribozyme which does not form base pairs with the target RNA;
- (x) is at least 6, wherein these X' residues form a loop structure with at least one additional base pair, preferably at least three base pairs, neighboring the C 1 * G 2 pair of the ribozyme within sequence (a);
- the ribozyme cassette is inserted into a SalI site, wherein K is G, L is U, Z is C, N 1 is G, N 2 is A and No is C, i.e. the nucleotides K, L, Z, N 1 , N 2 and N3 represent a SalI cleavage site contained in the DNA encoding the target RNA, wherein the nucleotides L, Z, N, and N 2 are located within the protruding ends created by SalI digestion.
- the nucleotides L', N' 1 and N' 2 represent the nucleotides of the ribozyme cassette of the present invention which form base pairs with the target RNA on the RNA level.
- RNA level T is U.
- the latter part consisting of nucleotides L' , N' 1 and N' 2 is also generally referred to as the sequence (b) of the present invention.
- sequence (b) of the present invention is also generally referred to as the sequence (b) of the present invention.
- the loop depicted in Figure 1 which is generally referred to as DNA sequence (a) in the present invention
- the flanking nucleotides N' including the nucleotides M' 2 , M' 1 , K' , and N' 3 , N' 4 , which fulfill in this particular sequence the same function as the nucleotides N'
- said DNA sequence forms the ribozyme ("antizyme") of the present invention.
- the ribozyme of the present invention is depicted in 3'-5'-orientation in the claims, figures and illustrations of the present invention. Therefore, it will be evident to a person skilled in the art that a DNA sequence encoding the ribozyme or ribozyme cassette of the present invention has to be expressed in 5'-3'-orientation, i.e. in the opposite orientation as given in said figures and illustrations, in order to obtain the desired ribozyme as the expression product which has the desired endoribonuclease activity.
- the superiority of the portable ribozyme cassettes of the present invention is evident from Figures 2 and 3.
- the portable ribozyme cassette is inserted into a given cleavage site of the DNA sequence encoding the target RNA (substrate) RNA, in this preferred embodiment a SalI site.
- the precise sequence specificity of the ribozyme (“antizyme”) encoded by the resulting DM sequence is automatically obtained without any difficult and time consuming steps or further manipulations. This is because the DNA sequence flanking the inserted ribozyme cassette is fully homologous to the DNA sequence encoding the target RNA.
- the length of the base pairing regions which influence the specificity and efficiency of the endoribonuclease activity of the ribozyme - because they are relevant for the correct and efficient binding of the resulting ribozyme to the target RNA - is only limited by the length of the DNA sequence into the restriction enzyme cleavage site of which the portable ribozyme cassette of the present invention has been incorporated.
- the present invention allows the construction of ribozymes, the base pairing region of which may have up to the same length as the substrate RNA if this is desired.
- this general formula either represents the non-integrated ribozyme cassette of the present invention ("portable ribozyme cassette") or the integrated ribozyme cassette together with the total flanking sequences derived from the restriction enzyme cleavage site of the DNA sequence encoding the target RNA.
- nucleotides M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N 4 define the nucleotides from the protruding ends obtained after cleavage of said restriction enzyme cleavage site with the corresponding restriction enzyme
- the above general formula represents the portable ribozyme cassette.
- this portable ribozyme cassette lacks any of the above nucleotides M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N 4 , these have to be provided by the 5 '-terminus of the DNA sequence encoding the target RNA in order to obtain a functional ribozyme.
- nucleotide L is T.
- nucleotides M 1 , K, L, N 1 , N 2 , No and N 4 have any of the following meanings:
- Y or W is selected such that it forms a restriction enzyme cleavage site together with the neighboring nucleotides.
- restriction enzyme cleavage site within the portable ribozyme cassette of the present invention provides a means for screening for target DNA sequences in which the portable ribozyme cassette of the present invention has been incorporated. Furthermore, such a restriction enzyme cleavage site provides a means for the determination of the orientation in which the portable ribozyme cassette of the present invention has been incorporated into the target DNA sequence. Furthermore, such a restriction enzyme cleavage site provides a means for the excision of excess cassettes in case more than one cassette has been inserted into the DNA encoding the target RNA.
- X is selected in the above general formula such that it forms a restriction enzyme cleavage site either alone or together with the neighboring nucleotides.
- This restriction enzyme cleavage site also provides a means for screening and determination of the orientation of the portable ribozyme cassette of the present invention.
- this restriction enzyme cleavage site provides a means for the insertion of a marker sequence or any other desired sequence into the portable ribozyme cassette of the present invention.
- the portable ribozyme cassette also contains a marker sequence which is incorporated into the restriction enzyme cleavage site located at nucleotide X.
- marker sequence contained in said restriction enzyme cleavage site of the portable ribozyme cassette of the present invention allows a rapid selection of ribozyme constructs which contain the portable ribozyme cassette of the present invention. Therefore, particularly preferred marker sequences of the present invention represent a selectable marker gene, such as an antibiotic resistance gene or a gene such as the ⁇ -galactosidase gene, allowing the identification of desired recombinant DNA sequences by providing a color reaction.
- the portable ribozyme cassettes of the present invention can be removed by simply cleaving the constructed recombinant DNA sequences with the restriction enzyme recognizing the restriction enzyme cleavage site at position X and re-ligating the cleavage product, i.e. the DNA sequences flanking the originally contained marker sequence.
- the portable ribozyme cassettes of the present invention are cloned in a recombinant vector, so that said portable ribozyme cassette of the present invention is flanked by restriction enzyme cleavage sites.
- these cleavage sites are derived from a class-IIS restriction enzyme that cleaves in a defined distance away from its actual recognition sequence that is located outside the sequence of the portable ribozyme cassette. This insertion of the portable ribozyme cassette of the present invention allows an excision and thus a simple transfer of the same into another target DNA sequence.
- the ribozyme cassette of the present invention which itself contains a restriction enzyme recognition sequence and which is cloned on a vector so that it can be precisely excised, may contain another DNA, e.g. a marker gene can be inserted. This enables the generation of a ribozyme cassette containing a marker gene.
- the present invention relates to a DNA sequence encoding a ribozyme (antizyme), said DNA sequence containing a portable ribozyme cassette of the present invention in an orientation allowing the production of a ribozyme displaying endonuclease activity upon expression in a host cell, or when used as template in a polymerase chain reaction, and containing additional sequences flanking said ribozyme cassette which have a length sufficient to provide a target-specific endoribonuclease activity of the encoded ribozyme.
- DNA sequences of the present invention can be used for the production of highly selective ribozymes (antisense ribozymes, antizymes) in the systems described below. They can be easily obtained by inserting the portable ribozyme cassette of the present invention into a restriction enzyme cleavage site of a DNA sequence encoding an RNA which is an anti- sense RNA in comparison to the target RNA. Therefore, as already mentioned, the ribozymes of the present invention are also called antisense ribozymes or "antizymes”.
- flanking sequences flanking the portable ribozyme cassette after insertion of it into a desired DNA sequence encode an antisense RNA in relation to the target RNA.
- flanking sequences can be either a part of the antisense RNA or a full-length antisense RNA.
- a part of the antisense RNA having a length which is sufficient for highly selective binding of the ribozyme RNA to the target RNA can be used to express a target-specific ribozyme acting as endoribonuclease, e.g. in a given cell.
- said DNA sequences of the present invention which is contained in the recombinant vector is under the control of a suitable promoter.
- These recombinant vectors of the present invention are expression vectors which are suitable for the expression of the ribozymes of the present invention in a desired host cell.
- procaryotic promoters are the bacteriophage lambda PL and PR promoters , the bacteriophage SP6 , T3 and T7 promoters (which are preferred for the in vitro synthesis of the ribozymes of the present invention), the lacZ, tac, trc and the trp promoters.
- eu- caryotic promoters in animal systems are the glucocorticoid-inducible promoter present in the mouse mammary tumor virus long terminal repeat (MMTV LTR) , the SV40 early and late promoters and for plant systems the nopaline synthase promoter, the cauliflower mosaic virus (CaMV) 35S promoter, and promoters derived from gemini viruses.
- the additional DNA sequences, which encode an antisense RNA, and which flank the portable ribozyme cassette after insertion contain at their 5'- and/or their 3'- ends sequence domains that are self-complementary and that form after transcription into RNA highly stable stem-loop structures, which confer protection against exonucleases.
- sequences which after transcription into RNA form the stable stem-loop structure are derived from a double-stranded DNA cassette that can be inserted by blunt-end ligation and that has the following sequence:
- the present invention relates to recombinant vectors containing a portable ribozyme cassette of the present invention or the above mentioned DNA sequences of the present invention.
- the present invention also relates to host organisms containing these recombinant expression vectors such as bacteria, e.g. E.coli or Bacillus subtilis, lower eucaryots, such as yeast or fungi.
- bacteria e.g. E.coli or Bacillus subtilis
- lower eucaryots such as yeast or fungi.
- the present invention relates to a method for the production of a ribozyme of the present invention, said method comprising cultivating a host of the present invention under suitable conditions, and isolating the ribozyme of the present invention from the culture.
- the present invention also relates to the ribozymes encoded by the DNA sequences of the present invention. Furthermore, the present invention relates to viral, bacterial, plant and animal genomes, containing a portable ribozyme cassette of the present invention or any other of the DNA sequences of the present invention referred to above. Additionally, the present invention relates to the corresponding viruses, bacteria, fungi, plants or animals containing such genomes. For instance, such viruses can be used as vectors for introducing DNA sequences encoding the ribozymes of the present invention into a desired host. Retroviruses and vaccinia viruses are preferred vector viruses.
- the transcription of the DNA sequences encoding the ribozymes of the present invention gives rise to ribozymes which act to inactivate a desired target RNA (substrate RNA).
- ribozymes which act to inactivate a desired target RNA (substrate RNA).
- substrate RNA target RNA
- either the DNA sequences encoding the ribozymes of the present invention or the ribozymes themselves have extensive therapeutic and biological applications. For example, they can be used for the suppression of certain unwanted genes or the treatment of viral infections in man, animals and plants by inactivating a target RNA, produced in the life cycle of the virus.
- the ribozymes of the present invention can be used for the treatment of infections with retroviruses such as the human immunodeficiency virus (HIV) and positive-sense RNA viruses, such as infections with togaviruses, coronaviruses, picornaviruses, caliviviruses and also for infections with negative-sense RNA viruses such as paramyxoviruses (e.g. Sendai virus), rhabdoviruses, the influence viruses, the bunyaviruses, or arenaviruses.
- retroviruses such as the human immunodeficiency virus (HIV) and positive-sense RNA viruses, such as infections with togaviruses, coronaviruses, picornaviruses, caliviviruses and also for infections with negative-sense RNA viruses such as paramyxoviruses (e.g. Sendai virus), rhabdoviruses, the influence viruses, the bunyaviruses, or arenaviruses.
- the viral mRNAs of DNA viruses can be targeted by ribozymes of the present invention, so that they can be used for treatment of viral infections with pox-, irido-, herpes- (e.g herpex simplex virus (HSV)), adeno, papova- (e.g. hepatitis B virus (HBV) and/or reoviruses.
- the ribozymes and the corresponding encoding DNA sequences of the present invention can also be used for the inactivation of target RNAs in procaryotic cells, such as bacteria, or eucaryotic cells such as protozoa and yeast, in plants and animals, such as parasitic animals, e.g. plasmodium faliparum, and humans.
- the ribozymes of the present invention or the corresponding encoding DNA sequences may be administered to a patient in need thereof.
- the present invention also relates to a composition containing a ribozyme or a corresponding encoding DNA sequence of the present invention.
- the present invention furthermore relates to a method of eliminating a target RNA in a plant, an animal or a human patient, which comprises treating said plant animal or human patient with a DNA sequence encoding the ribozyme of the present invention or with a ribozyme of the present invention, optionally in association with a pharmaceutically, veterinarially or agriculturally acceptable carrier and/or excipient.
- the ribozymes or the corresponding encoding DNA sequences of the present invention may be delivered by parenteral or other means of administration.
- the DNA sequence encoding the ribozyme of the present invention and containing a portable ribozyme cassette of the present invention is contained in a vehicle, such as a carrier virus, by which it is transported to a particular target tissue or cell into the genome of which it can be incorporated or in which it can be transiently expressed.
- a carrier virus which may be used here for example is a recombinant retrovirus or a recombinant vaccinia virus.
- compositions of the present invention may contain Ti-plasmid based vectors or vector systems or correspondingly transformed Agrobacteria, which are capable of directing the transfer of the DNA sequences of the present invention containing the portable ribozyme cassette into a desired target tissue or target cell of the plant to be treated.
- the compositions of the present invention may contain expression vectors which are suitable for direct gene transfer techniques into plant cells or tissues, such as electroporation or particle acceleration.
- the expression of the ribozyme in such a plant target tissue or target cell may be either transient or permanent.
- the present invention also relates to compositions for eliminating the disease-causing capability of an infectious agent.
- the present invention also relates to a method for the production of a DNA sequence encoding a ribozyme, wherein this DNA sequence contains a portable ribozyme cassette as described herein, said method comprising the steps of:
- RNA which is to be inactivated by a ribozyme, a restriction enzyme cleavage site of the following nucleotide sequence:
- M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N 4 have the same meaning as given before;
- Z is A, G , C or T;
- Z corresponds to the 3'-terminal nucleotide of the 5 '-terminal ribozyme cleavage product of the target RNA
- the nucleotide sequence K L Z corresponds to a nucleotide sequence of the target RNA which is cleavable by a ribozyme;
- the ribozyme cassette displaying the structure given in step (D), which is inserted in step (E) into the DNA sequence obtained in step (C), is excised from a cloning vector by cleavage of restriction enzyme cleavage sites flanking said portable ribozyme cassette.
- the present invention relates to a method for the production of a portable ribozyme cassette of the present invention comprising the steps of : (A) selecting in a DNA sequence encoding a desired target RNA,
- M 2 M 1 K L Z N 1 N 2 N 3 N 4 wherein M 2 , M 1 , K, L, N 1 , N 2 , N 3 , and N 4 , have the same meaning as before;
- Z is A, G, C or T
- Z corresponds to the 3 '-terminal nucleotide of the 5 '-terminal ribozyme cleavage product of the target RNA
- the nucleotide sequence K L Z corresponds to a nucleotide sequence of the target RNA which is cleavable by a ribozyme;
- nucleotides located at the 3'-side of Z in said protruding ends are located at the 3'-side of Z in said protruding ends.
- the technique to generate a DNA construct that encodes an antisense-ribozyme, comprises five steps: (i) the preparation of the DNA cassette, (ii) the preparation of the cDNA that codes for the target RNA (substrate RNA), (iii) the actual insertion of the DNA cassette into the cDNA, (iv) the analysis of the recombinant clones and (v) the confirmation of the catalytic activity of the resulting RNA in a ribozyme assay.
- the individual phases of the procedure are done as follows. A more detailed description of some conventional laboratory procedures are found in Sambrook et al., "Molecular Cloning", Cold Spring Harbor, second edition, 1989.
- a plasmid vector which is preferably the plasmid pT3T71ac (Boehringer Mannheim, FRG) .
- the resulting recombinant plasmid contains a DNA sequence, corresponding to the desired DNA cassette between two recognition sites of a class-IIS restriction enzyme, like EarI, that allows to specifically release a DNA fragment with defined ends so that after filling-in of its protruding ends the desired DNA cassette can be obtained.
- a class-IIS restriction enzyme like EarI
- the plasmid that carries the ribozyme DNA cassette is cleaved with XhoI.
- a DNA fragment that is flanked by XhoI sites and that contains the tetra- cycline resistance gene (tet gene) is inserted.
- This DNA fragment is obtained from a modified version of the plasmid pBR322 that had been generated by successive introduction of XhoI linkers into the EcoRI and Aval sites of plasmid pBR322, respectively, after cleaving with said restriction enzymes and subsequent filling-in with Klenow polymerase (the EcoRI site is thus restored).
- the orientation in which the tet gene had been inserted into the XhoI site is determined by digestion with EcoRI and HindIII, which cleave once within the tet gene and once in the plasmid pT3T71ac.
- the actual DNA cassette is generated by cleaving the recombinant plasmid (for example pAzSa11-tet) with EarI.
- About 5-10 ⁇ g of the plasmid are digested with about 20-30 units of the isoschizomer Ksp632l from Boehringer Mannheim in a volume of 100 ⁇ l.
- dNTPs are added to a final concentration of 500 ⁇ M
- 5 units of the large fragment of E.coli DNA polymerase I Klenow enzyme, N.E. Biolabs
- the reaction mixture is incubated for 5 minutes at 16oC.
- EDTA to a final concentration of 15 mM
- the DNA is loaded in several lanes on an agarose gel. After separation of the DNA fragments by electrophoresis, the gel is stained with ethidium bromide (1 ⁇ g/ml) and the fragment of about 1450 base pairs, corresponding to the desired DNA cassette, is excised. The DNA is electroeluted, phenolized and collected by isopropanol precipitation.
- the DNA cassette is then dissolved in a small volume (10-20 ⁇ l) of TE buffer (10 mM Tris/HCl, 1 mM EDTA pH 8.0). A small aliquot (1 ⁇ l) is again loaded on an agarose gel to estimate the concentration of the recovered DNA cassette.
- the residual solution of the DNA cassette is stored at -20oC and can be used for several incorporation experiments.
- the cDNA (or a fragment of it) that encodes the target RNA is cloned into a cloning vector that allows in vitro transcription of the inserted DNA in different directions from bacteriophage-encoded RNA polymerase promoters, such as T3, T7 or SP6 RNA polymerase. Many of these "gemini"-type vectors are commercially available.
- a preferred example is the transcription vector pT3T71ac (or modifications thereof, where one restriction site had been destroyed) from Boehringer, Mannheim, FRG.
- the plasmid contains a polylinker region between the promoters for T7 and T3 RNA polymerase. This enables the in vitro synthesis of RNA that corresponds to the substrate RNA or its complementary RNA (compare Fig.2).
- labeled RNA can be synthesized that can act as substrate for the ribozyme assay (see below).
- one ⁇ g of the recombinant plasmid is cleaved with said restriction enzyme.
- S1 buffer 225 mM NaCl, 30 mM potassium acetate pH 4.5, 200 ⁇ M ZnSO 4 and 5% glycerol
- nuclease S1 (Boehringer Mannheim) is diluted in S1 buffer to a concentration of 1 unit per ⁇ l and also incubated for at least 10 minutes on ice. Then, 2 ⁇ l, corresponding to two units of nuclease S1, are added to the cleaved plasmid. After 20 minutes on ice, 5 ⁇ l of S1 Stop buffer (300 mM Tris/HCl, 50 mM EDTA, pH 8.0) are added to the reaction mixture, which is in the following incubated for 10 minutes at 65oC for inactivation of the nuclease. The sample is subsequently phenolized and again precipitated with isopropanol. It is dissolved in a small volume of TE buffer (10 ⁇ l) and 1 ⁇ l is loaded on an agarose gel to estimate the concentration.
- S1 Stop buffer 300 mM Tris/HCl, 50 mM EDTA, pH 8.0
- labeled substrate RNA is prepared by in vitro transcription, using the transcription vector into which the cDNA fragment of interest had been cloned.
- the ribozyme constructs are cleaved with a restriction enzyme (which does not cleave within the tet gene, nor within the cDNA insert), so that they provide a template for run-off transcription.
- the ribozyme RNA is prepared by in vitro transcription (unlabeled) from the corresponding promoter under standard reaction conditions (according to the supplier of the enzymes (N.E. Biolabs or Boehringer Mannheim) in 20 ⁇ l for one hour at 37oC.
- RNA is then incubated with the labeled substrate RNA in 20 ⁇ l of 50 mM Tris/HCl pH 8.0, 20 mM MgCl 2 for 30 minutes at 60'C. After addition of sodium acetate (pH 5) to a final concentration of 0.2 M and 1 ⁇ g of tRNA (used as "carrier"), the samples are precipitated with ethanol and separated on a denaturating 5% polyacrylamide gel as described by Tsagris et al., EMBO J. , 6 (1987), 2173-2183, and visualized by autoradiography. Detection of cleavage products of expected size confirm the ribozyme nature of the tested RNAs .
- the corresponding DNA construct is cleaved with XhoI and religated in order to excise the tet gene.
- the ribozyme RNA can also be taken directly after transcription (without phenolizing and precipitation the ribozyme RNA) .
- 20 ⁇ l of labeled substrate RNA in 100 mM Tris/HCl pH 8.0 and 40 mM MgCl 2 are added to the unlabeled ribozyme RNA and the reaction mixture is incubated for 30 minutes at 60oC.
- 20 ⁇ l of 0.6 M sodium acetate, 150 ⁇ g/ ⁇ l tRNA is added, followed by 150 ⁇ l of ethanol.
- the samples are collected by centrifugation and separated on a denaturating polyacrylamide gel together with an aliquot of labeled but untreated substrate RNA.
- cleavage products of the substrate can be identified. Due to the lack of phenolization of the ribozyme RNA, the substrate RNA might undergo some unspecific degradation. The cleavage products can, however, be identified. Thus, the ribozyme activity of certain constructs can be verified.
- restriction enzyme cleavage sites (taken from the catalogue of New England Biolabs) which can be used in the above mentioned methods of the present invention are listed in the following Table I. c: The recognition sequences of the restriction enzymes, which is part of the DNA encoding the target RNA, are given,
- nucleotides N are A, C, G or T
- W are A or T
- Y are C or T
- R are A or G
- the sequence GGTCC represents only approximately 50 % of all possible Avail sites with the recognition sequence GGWCC. Only 50% of the Avail sites can be expected to be target motifs.
- the DNA cassette consists of the sequence (a) , as defined before, to which some nucleotides out of M ⁇ , K, L and N j , N2, N 3 , and N 4 , also defined before, are added 5 '-terminal and 3 '-terminal to sequence (a) , respectively.
- Xbal contains two target motifs:
- Af1II contains two target motifs:
- the DNA cassette is selected according to Table I as follows:
- the portable ribozyme cassette of the present invention with the catalytic domain which has to be inserted may for instance consist of the following core sequence (DNA sequence (a)), and the "replacement nucleotides" which are the DNA sequence (b) (here, 5'- end: L is T, and 3 '-end: N 1 is G and N 2 is A) which are specific for each restriction recognition sequence:
- At least a partial DNA construct encoding the target RNA must be available, preferably cloned in a plasmid or phage vector (sequence information is not necessary !), and
- the DNA construct must contain a restriction enzyme cleavage site as defined hereinabove in the general formula, e.g. a restriction enzyme cleavage site as given in Table I.
- target RNA substrate RNA
- GUCGAC SalI recognition sequence
- the part of the ribozyme molecule which is bulged out is the catalytic domain and residues which are assumed to participate in the cleavage reaction are boxed. The site of cleavage is indicated.
- sequence GUC is the target motif of the substrate RNA. Therefore, these nucleotides represent the nucleotides KLZ, wherein nucleotide Z (in this case C) is the only nucleotide of the substrate RNA that does not directly base pair with the ribozyme RNA and which is that residue, that corresponds to the 3'-terminal nucleotide of the 5'-terminal ribozyme cleavage product of the target RNA as indicated.
- the sequence 5' CUGAUGAGUCCGUGAGGACGAA 3' represents a sequence (a), i.e. that part of a ribozyme which does not form base pairs with the target RNA.
- the nucleotides UCGA of the target RNA are located within the protruding ends.
- the nucleotides U and GA of the substrate RNA and A and CU of the ribozyme RNA are part of the protruding ends of the SalI site and are also part of the base pairing region between substrate RNA and ribozyme. Therefore, they represent the sequence (b), i.e.
- the DNA sequences flanking the sequence (a) which are derived from the protruding ends of a restriction enzyme cleavage site of a DNA sequence encoding a target RNA, and which encode a part of that part of a ribozyme which forms base pairs with the target RNA.
- the cDNAs which allow transcription to yield the target RNA and the ribozyme RNA.
- the top shows the cDNA of a target RNA with a SalI site as indicated, and the lower part represents the corresponding ribozyme DNA construct.
- the target and the ribozyme RNA (which can be considered as an antisense RNA with a ribozyme domain) will be synthesized which can form the hammerhead structure as given in Fig.l.
- the sense strand of the cDNA encodes the target RNA and the antisense strand of the corresponding ribozyme construct encodes the ribozyme RNA.
- the sequence of the two DNAs differ only in the two parts which are boxed, wherein the lower box represents sequence (a).
- the base pairs T/A and GA/CT which neighbor the boxed C/G pair in the target RNA and the boxed sequence (a) in the antisense ribozyme construct, represent the sequence (b) derived from the protruding ends of the SalI cleavage site.
- the top illustrates a double-stranded cDNA containing a SalI site with the sense strand at the top.
- the four internal nucleotides TCGA are removed by digestion with SalI and subsequent trimming of the protruding ends.
- a synthetic Sall-specific double-stranded DNA cassette By insertion of a synthetic Sall-specific double-stranded DNA cassette, a sense- or antisense-directed ribozyme construct can be obtained, depending on the orientation of insertion.
- the hatched part of the synthetic DNA cassette corresponds to the lower strand of the boxed sequence of Fig.2 and represents a sequence (a) within the ribozyme sequence. In this case, the sequence (a) is modified to contain a StuI site (AGG'CCT) as given in Fig.4.
- nucleotides which are attached comprise sequence (b) and correspond to nucleotides L, N 1 and N 2 of the general formula. They are used to replace three of the four nucleotides which have been removed by SalI digestion and subsequent trimming.
- the nucleotide C in third position of the SalI site corresponds to nucleotide Z, and is not replaced by inserting the cassette.
- the hammerhead structure formed by a ribozyme RNA that contains a StuI recognition sequence and is directed against an RNA containing a SalI recognition sequence.
- the substrate RNA contains a SalI recognition sequence like in Fig.1.
- the catalytic domain is modified by three nucleotide exchanges.
- the newly introduced residues G,U,C (5'->3') are given in bigger letters and the original nucleotides are indicated in parenthesis.
- the nucleotide exchanges create a new StuI recognition sequence AGGCCU and opposite of it an additional HaeIII sequence GGCC.
- the two maps at the top show the plasmids pPV1 and pPV2 which each contain an EcoRI fragment of the cDNA of plum pox virus (PPV) ranging from nucleotide 3409-3831, with a SalI site at nucleotide 3631, which is detailed.
- the EcoRI fragment is inserted in different orientations in the two plasmids.
- the right legend indicates the polarity of the PPV RNA which can be synthesized with T3 and T7 RNA polymerase from these plasmids, respectively.
- the two maps in the middle are antizyme constructs derived from plasmid pPV1 and the two maps at the bottom represent derivatives of plasmid pPV2.
- the hatched parts of the DNA cassette in the four antizyme constructs represent the sequence (a) of the ribozyme sequence.
- the right legend indicates whether T3 or T7 RNA polymerase can synthesize a sense or an antisense-directed ribozyme construct.
- the plasmids pPV2 and pPV12 were used to synthesize radioactively labeled PPV (-) RNA serving as substrate (S) and antizyme RNA (Az) , respectively, by transcription with T7 RNA polymerase.
- the RNAs were incubated in 50 mM Tris/HCl, 20 mM MgCl 2 , pH 8.0 for 30 minutes at either 0oC or 60oC, alone or in mixture. After collection by ethanol precipitation, the RNAs were analyzed on an polyacrylamide gel (5% polyacrylamide, 0.125% bisacry- lamide) containing 8M urea.
- Lane 1 antizyme RNA (Az) from pPV12, incubated at 0oC, Lane 2 PPV substrate RNA (S) from plasmid ⁇ PV2, incubated at 0oC, Lanes 3 and 4 correspond to 1 and 2, but the incubation temperature is 60oC. Lane 5 contains both RNAs of lane 3 and 4 incubated together. Lane 6 is like in Lane 5, but the ribozyme RNA is not radioactively labeled (indicated by AZ in parenthesis).
- Lane 7 contains a truncated marker transcript (T) synthesized by T7 RNA polymerase from plasmid pPV2 which had been cleaved with SalI before, so that it corresponds to the expected 5'-terminal cleavage product.
- T truncated marker transcript
- the PPV target RNA is cleaved into two smaller RNAs by the antizyme RNA.
- the smaller of the two cleavage products co-migrates with the marker transcript in lane 7 and represents the 5'-half of the PPV target transcript.
- the hammerhead structure with a ribozyme RNA specific for a SalI recognition sequence, that contains an XhoI and a StuI recognition sequence.
- an additional base modification (U to C) is made, creating now an XhoI site (CUCGAG) that forms a hairpin loop of the catalytic domain.
- the sequence at the top represents a part of the plasmid pAzSa11.
- a 25 bp DNA cassette is formed which can be used to create ribozyme constructs as described in Fig.3.
- tetracycline resistance gene tet gene
- the plasmid pAzSa11-tet is obtained (lower part).
- EarI digestion followed by Klenow reaction results in a cassette as shown at the bottom, which can equally be used for insertion into a trimmed SalI site.
- tetracycline it can be selected for the insertion of the portable ribozyme cassette.
- antisense ribozymes contain a long region of sequences complementary (antisense) to the target RNA.
- Antizymes with one or two catalytic domains are given in the two upper maps.
- the map at the bottom represents an antizyme RNA, in which a foreign RNA, e.g. the mRNA of the tetracycline resistance gene, has been introduced. It should be stressed that in case of the tetracycline resistance gene, the inserted sequence is more than 50-fold bigger as compared to the actual catalytic domain.
- Plasmid pPV12-tet was created from plasmid pPV1 (Fig.5) by inserting the Sall-specific DNA cassette obtained from plasmid pAzSa11-tet (Fig.8) into the cleaved and trimmed SalI site of pPV1.
- the boxed part shows the relevant sequence of inserted cassette in detail.
- the resulting construct pPV12-tet is related to plasmid pPV12 (Figs. 5 and 6).
- a (-) directed antisense ribozyme can be obtained by transcription with T7 RNA polymerase. After excision of the tet gene with XhoI and subsequent re-ligation, the plasmid pPV12a was obtained.
- RNAs were synthesized by T7 transcription : from plasmid pPV2 the PPV (-) RNA substrate (S), from plasmid pPV12 the antizyme RNA (Az) and from plasmid pPV12-tet the antizyme RNA which contains the tetracycline resistance gene inserted into the XhoI recognition sequence (Az-t).
- the lanes 1-3 contain the RNAs of plasmids pPV12, pPV2 and pPV12-tet, incubated at 0*C.
- Lanes 4-6 contain the same RNAs incubated at 60oC.
- Lane 7 contains the mixture between the RNAs of lane 4 and 5. In lane 8 the RNAs of lane 4 and 6 are mixed. Lane 9 is identical to 8 but the antizyme RNA is not labeled.
- RNA derived from plasmid pPV12-tet is able to cleave the PPV (-) target RNA in the same manner as the antizyme RNA derived from plasmid pPV12.
- the plasmid pAzSa11 (Fig.8) was linearized with XhoI and the protruding ends were removed by digestion with nuclease S1.
- pAzSa13-tet corresponds (except the orientation of the tet gene) to plasmid pAzSa11-tet (Fig.8), and likewise a Sall-specific DNA ribozyme cassette including tet gene can be obtained from plasmid pAzSa13-tet in analogy to pAzSa11-tet.
- the tet gene can be removed by digestion with Af1II.
- the hammerhead structure with a ribozyme RNA specific for a SalI recognition sequence, that contains an Af1II and a StuI recognition sequence.
- the ribozyme sequence containing an Af1II site is derived from DNA cassettes such as from plasmid pAzSa13-tet (Fig.12). Compared to the sequence given in Fig.4, there is another G to A mutation, that creates an Af1II site within the catalytic domain.
- Map of plasmid pPV-BS1 and the resulting ribozyme construct pPV-BS11-tet The map at the top shows plasmid pPV-BS1 that contains a BstYI - SphI fragment of plum pox virus (PPV) corresponding to nucleotides 3461-4058, with a SalI site at nucleotide 3631, inserted into the vector pT3T71ac (Boehringer Mannheim) from which the EcoRI site had been deleted by cleaving and subsequent filling-in followed by re-ligation.
- PPV plum pox virus
- the construct pPV-BS11-tet was obtained that delivers after cleavage with PvuII and transcription with T3 RNA polymerase a (+) directed antisense ribozyme RNA.
- Labeled target RNA was obtained from plasmid pPV-BS1 that had been linearized with HindIII and transcribed with T7 RNA polymerase.
- Unlabeled RNA transcript obtained by transcription with T3 RNA polymerase from plasmid pPV-BS11-tet that had been cleaved with PvuII, was incubated with the labeled target RNA as described in Fig.6 and analyzed on a denaturating polyacrylamide gel: Lane 1, labeled RNA of pPV-BS1 not incubated; Lane 2 labeled RNA of pPV-BS1 incubated at 60oC for 30 minutes with the unlabeld RNA transcript of pPV-BS11-tet in 50 mM Tris/HCl pH 8.0, 20 mM MgCl 2 ; Lane 3 labeled RNA of pPV-BS1 incubated at 60oC for 30 minutes in 50 mM Tris/HCl pH 8.0
- GUC cleavage motif
- the objective is to create a DNA construct, which allows the transcription of such a SalI-directed ribozyme RNA.
- Fig.2 gives, in general form, the sequences of such a cDNA construct in comparison to the cDNA of the target.
- Fig.3 describes a strategy to convert the cDNA of the target into the desired ribozyme construct.
- oligonucleotides were synthesized with an automated DNA synthesizer (Applied Biosystems).
- the oligonucleotides comprising 25 nucleotides each had the following sequence :
- oligo ⁇ eoxynucleotides represent such a DNA cassette which is needed to create - according to the strategy outlined in Fig. 3 - a ribozyme RNA as depicted in Fig. 4, which is characterized by the presence of the StuI recognition site AGGCCT within the ribozyme sequence.
- the DNA cassette consisting of the two synthetic DNA oligonucleotides Rz- Sa11 and Rz-Sal2 was used to create an antizyme RNA against the (-) RNA of plum pox virus (PPV) which is a plant virus of the potyvirus group.
- PPV plum pox virus
- an EcoRI fragment containing 423 bases of the cDNA of (PPV) ranging from nucleotides 3409-3831 of the viral RNA genome (according to the sequence of Techeney at al., Nucleic Acids Res.
- plasmid pT3T7-Sa1 a modified version of the plasmid pT3T71ac (Boehringer Mannheim) from which the SalI site had been removed before, by cleaving with SalI, trimming the protruding ends with the aid of mung bean nuclease followed by re-ligation of the plasmid DNA.
- the EcoRI fragment was inserted in both possible orientations into this vector, so that the two plasmids pPVl and pPV2 as given in Fig. 5 (top), were obtained.
- the PPV cDNA insert contains a SalI site at nucleotide 3631, i.e.
- the SaxI site of each of the two plasmids was digested and trimmed by treatment with mung bean nuclease using the protocol as described by the supplier (N.E.Biolabs), which removes the protruding ends as outlined in Fig.3. Then, the above mentioned Sall-specific synthetic ribozyme DNA cassette, containing a StuI site, was inserted by blunt-end ligation.
- the restriction enzyme StuI was used to screen the transformants for the insertion of the DNA cassette. Those plasmids which could be linearized by StuI digestion, were digested with EcoRI and the resulting DNA fragments were separated on a 5% polyacrylamide gel. By comparison with the 423 base fragment of the plasmid pPV2, recombinant plasmids could be identified which contained one, two or three copies of the Sall-specific DNA cassette inserted into the trimmed SalI site.
- Those plasmids which contained more than one inserted cassette were digested with StuI and religated. Since neither the substrate cDNA nor the vector contains a StuI site, this procedure removes the cassette present in excess. However, only about 50% of the resulting plasmids can be expected to contain a correct monomeric DNA cassette, whereas in the other 50%, there are head-to-head or tail-to-tail connected parts of the DNA cassette which are useless for the generation of ribozyme RNA.
- a functional ribozyme assay was carried out.
- the plasmids pPV1 and pPV2 were linearized with HindIII, which cleaves that part of the polylinker next to the T3 promoter (see Fig. 5, top).
- the recombinant plasmids containing the monomeric Sall-specific DNA cassette inserted and those plasmids which were obtained by StuI digestion and re-ligation, in order to eliminate excess cassettes, were digested with HindIII or PvuII, respectively.
- the HindIII cut DNA was transcribed with T7 RNA polymerase and the PvuII cut DNA served as template for T3 RNA polymerase.
- the resulting RNA transcripts were tested for ribozyme activity.
- plasmids derived by inserting the SalI-specific ribozyme cassette into plasmid pPVl were screened in the following way:
- RNA transcript synthesized with T3 RNA polymerase which represents a potential sense-directed antizyme (comp. Fig.3)
- PPV (+) RNA derived from plasmid pPVl by transcription with T7 RNA polymerase for 30 minutes at 60*C in 20 mM MgCl 2 , 50 mM Tris pH 8.0, followed by ethanol precipitation and separation of the products on a denaturing 5% polyacrylamide gel (0,125 7. bisacrylamide), containing 8M urea.
- the RNA transcripts synthesized with T7 RNA polymerase from the same recombinant plasmids which represent a potential antisense-directed antizyme (comp. Fig.3), were incubated with PPV (-) RNA derived from plasmid pPV2 by transcription with T7 RNA polymerase.
- the recombinant clones pPV11 and pPV12 (Fig. 5, middle) were identified amongst the pPVl derived plasmids.
- the pPV2-derived plasmids pPV21 and pPV22 could be identified, by incubating transcripts synthesized by T3 RNA polymerase with the T7 RNA transcript of plasmid pPV2 which is a PPV (-) RNA and testing the T7 RNA transcripts with the T7 RNA transcript of plasmid pPV1 , respectively.
- an additional nucleotide exchange in the ribozyme cassette was made to create an XhoI recognition sequence which is located directly in the center of the hairpin loop of the hammerhead structure (Fig.7).
- the DNA oligonucleotide Az-Sa11 was synthesized which contained beside the sequence of the actual DNA cassette, two flanking EarI recognition sites as indicated in the top of Fig.8.
- the DNA oligonucleotide contained the such nucleotides at the 5'- and 3'-terminus, that it could be cloned into the plasmid pT3T71ac which had been cleaved with an enzyme that produced 5'-protruding ends (BamHI) and another enzyme that produced 3'-protruding ends (KpnI).
- the sequence of the DNA oligonucleotide Az-Sa11 was as follows (the restriction enzyme recognition sequences contained in this oligonucleotide are indicated): BamHI StuI EarI
- the oligonucleotide was annealed to these protruding BamHI- and KpnI- ends of the vector and the ligation was done in presence of Klenow polymerase and dNTP, so that the DNA strand complementary to Az-Sa11 was synthesized enzymatically during the ligation reaction.
- the plasmid pAzSa11 was created (Fig. 8, top) .
- EarI is a class-IIS restriction enzyme that has its cleavage site outside of its recognition sequence, and it cleaves a DNA sequence in the following manner:
- the desired Sall-specific ribozyme cassette can be obtained from plasmid pAzSa11, by digestion with EarI and subsequent filling-in the protruding ends with Klenow enzyme.
- an XhoI linker was introduced into the EcoRI site and also into the Aval site of the plasmid pBR322 (after cleaving and filling-in the protruding ends, respectively), so that the tetracycline resistance gene (tet gene) could be excised by XhoI cleavage.
- the plasmid pAz-Sa11-tet was digested with EarI, the protruding ends were filled-in by Klenow polymerase and the resulting DNA fragments were separated on an agarose gel, and the DNA fragment which was the desired Sall-specific ribozyme cassette was purified by electroelution via isotachophoresis. This fragment is about 1450 bp in size and was used for ligation into plasmid pPV1 , which had been cleaved with SalI and treated with mung bean nuclease in order to remove the protruding ends as described under Example 1.
- Ampicillin and tetracycline were used to select for transformants .
- the recombinant plasmids were analyzed for the presence of the StuI site, which is characteristic for the Sall-specific ribozyme cassette, and for the presence of the XhoI fragment containing the tetracycline resistance gene.
- restriction enzymes that cleave within the tetracycline resistance gene and also in the sequences derived from plasmid pPVl , e.g. HindIII or BamHI, is was possible to deduce the orientation in which the SalI-specific DNA cassette had been inserted.
- the plasmids pPV11-tet and pPV12-tet were identified, which are related to plasmids pPV11 and pPV12 (Fig. 5, middle), but contain, in addition, the tetracycline resistance gene within the ribozyme sequence.
- plasmid pPV12-tet (Fig.10) was tested whether it already could deliver a functional antizyme RNA such as the RNA given at the bottom of Fig. 9. Therefore, the plasmid was cleaved with XbaI and transcribed with T7 RNA polymerase and the resulting RNA was incubated with the target RNA derived from plasmid pPV2 by T7 transcription. Surprisingly, the insertion of the tetracycline resistance gene into the ribozyme cassette did not affect the catalytic activity of the ribozyme (Fig. 11).
- the experiment shows that the catalytic domain of the ribozyme which does not form base pairs with the target RNA (sequence (a)), which consists of 22 nucleotides in case of plasmid pPV12, can be divided into two sub-domains of 9 and 13 nucleotides, respectively, and separated by more than 1400 bases in pPV12-tet, without loss of catalytic activity.
- sequence (a) which consists of 22 nucleotides in case of plasmid pPV12
- plasmid pPV12a was obtained.
- This plasmid is very similar to plasmid pPV12. The only difference is that it contains an XhoI site according to Fig. 7, whereas plasmid pPV12 contains a ribozyme sequence according to Fig. 4.
- the tetracycline resistance gene can be removed by digestion with XhoI, but the antizyme RNA also works in the presence of it.
- sequence of the "core ribozyme” corresponds to sequence (a): pAzSa11, pAzSa11-tet
- Ribozymes were also created against the (+) and (-) RNA of Sendai virus by inserting DNA cassettes into two different BstBI sites, and both possible cassettes for the Xbal site (L gene of the virus) and a SalI site (P gene).
- catalytic antisense ribozymes could be obtained after the incorporation of the corresponding DNA cassettes.
- a potential complication of the technique to incorporate selectable DNA cassettes with a selectable marker gene arises when the cDNA itself contains an XhoI site. Then, a DNA cassette, such as the one derived from plasmid pAzSa11-tet, can still be incorporated into any site of interest. However, the excision of the tet gene, that is cloned into the XhoI site within the catalytic domain (compare Fig.7), requires to prepare partially digested DNA. The same complication arises when a second cassette is to be introduced into a cDNA construct that already contains a DNA cassette with a ribozyme domain including an XhoI site.
- a second series of recombinant plasmids was prepared that contained the tet gene within an Af1II site.
- the plasmid pAzSa11 (compare Fig.8, top) was digested with XhoI, and the resulting protruding ends were removed by trimming with nuclease S1 (Fig.l2A).
- a synthetic Af1II linker (CCTTAAGG) was consecutively introduced into the EcoRI and Aval sites of the plasmid pBR322 after filling-in the corresponding protruding ends, respectively.
- a second type of DNA cassettes could be obtained which can be introduced into cDNAs that contain an XhoI site or already an inserted ribozyme cassette with an XhoI site. After excision of the Af1II fragment containing the tet gene, a ribozyme as given in Fig.13 is obtained.
- a SalI-specific DNA cassette was prepared by digestion with Ksp632l (isoschizomer of EarI) and filling-in the resulting protruding ends.
- This Sall-specific DNA cassette was purified on an agarose gel and electroeluted.
- one ⁇ g of plasmid pPV-BSl (Fig.14), which contains a fragment of the cDNA of plum pox virus (PPV) was cleaved with SalI.
- the plasmid was dissolved in 20 ⁇ l of S1 buffer (225 mM NaCl, 30 mM potassium acetate pH 4.5, 200 ⁇ M ZnSO 4 and 5% glycerol) and treated with 2 units of nuclease S1 (Boehringer Mannheim) for 20 minutes on ice. Then 5 ⁇ l of S1 Stop buffer (300 mM Tris/HCl, 50 mM EDTA, pH 8.0) were added and the sample incubated for 10 minutes at 65 oC, followed by phenolization and precipitation with isopropanol. Compared to the construction of the ribozymes described in Examples 1 and 2, the above process represents a preferred embodiment with respect to reaction conditions for the trimming reaction.
- S1 buffer 225 mM NaCl, 30 mM potassium acetate pH 4.5, 200 ⁇ M ZnSO 4 and 5% glycerol
- S1 Stop buffer 300 mM Tris/HCl, 50 mM EDTA, pH
- plasmid pPV-BSl About 300 ng of the plasmid pPV-BSl, treated in that way, was ligated with about 100 ng of the above mentioned Sall-specific DNA cassette prepared from plasmid pAzSa13-tet in a volume of 5 ⁇ l of blunt end ligation buffer (50 mM Tris/HCl pH 7.5, 10 mM MgCl 2 , 5% PEG 8000, 1 mM DTT and 100 ⁇ M ATP containing 3 units of T4 DNA ligase (Minotech, Heraklion, Greece) for 16 hours at 12"C. After transformation in E.coli strain JM83 , and selection for ampicillin and tetracycline, the resulting clones were analyzed by restriction mapping.
- blunt end ligation buffer 50 mM Tris/HCl pH 7.5, 10 mM MgCl 2 , 5% PEG 8000, 1 mM DTT and 100 ⁇ M ATP containing
- Fig. 14 shows an autoradiograph, confirming the catalytic activity of the transcript obtained from pPV-BS11-tet.
- Fig. 15 shows an autoradiograph, confirming the catalytic activity of the transcript obtained from pPV-BS11-tet.
- Stem2 5 ' ACGGCCGCACGGGCCTCGCGTGGCCCGAGCGGCCGC which after phosphorylation with T4 polynucleotidkmase and subsequent annealing can form the following double-stranded DNA cassette:
- the DNA cassettes contains restriction sites for Aval, EagI,
- EagI EagI and for the restriction endonucleases NotI, SfiI that recognize a sequence of 8 bases: NotI
- the DNA cassette can be inserted by blunt-end ligation into the DNA con struct that encodes an antisense ribozyme at two sites, up- and downstream of the inserted DNA ribozyme cassette(s).
- the restriction sites allow to detect the insertion of the cassette and to test for the orientation of insertion and also the excision of excess cassettes. Preferred are the same orientations of insertion at the 5'-terminus and the 3'-terminus, respectively.
- the sequence of the DNA cassette was chosen to ensure that when the DNA containing the DNA cassette composed of Stem1 and Stem2 is used as a template for transcription, the resulting RNA will assume a stem loop structure as shown below:
- RNA stem is not completely double-stranded to avoid degradation by double-strand-specific endoribonucleases of the RNaseIII-type.
- the stem-loop structures at the 5' and 3'- ends of the antisense ribozyme RNA provide protection against exonucleases. Similar structures, that are highly stable in vivo, are found amongst bacterial IS elements; see Simons and Kleckner, Annu. Rev Genet. 22 (1988), 567-700.
- the RNA transcript can assume an alternative structure involving the 5'- and 3'-terminal regions derived form the cloned Stem cassette by forming a "folding back" structure (ping pong paddle).
- a "pseudo-circular" structure can be formed in which the 5'-end and the 3'-end of the antisense ribozyme basepair, without forming a completely double-stranded RNA segment. Also this structure confers protection against exonuclease attack:
- the plasmids pPV-BSl and pPV1 were deposited in E. coli JM83 at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany, under the requirements of the Budapest Treaty under the deposition numbers DSM 6624 and DSM 6625, respectively, on July 26, 1991.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Saccharide Compounds (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP3512748A JPH06502988A (ja) | 1990-07-26 | 1991-07-26 | ポータブルリボザイムカセット、それを含有するdna配列、これらdna配列によりコードされるリボザイム、およびこれらリボザイムを含有する組成物 |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP90114359.4 | 1990-07-26 | ||
EP90114359 | 1990-07-26 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1992001786A1 true WO1992001786A1 (fr) | 1992-02-06 |
Family
ID=8204262
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP1991/001403 WO1992001786A1 (fr) | 1990-07-26 | 1991-07-26 | Cassettes de ribozymes portables, sequences d'adn les contenant, ribozymes codes par ces sequences d'adn, et compositions contenant ces ribozymes |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP0558490A1 (fr) |
JP (1) | JPH06502988A (fr) |
AU (1) | AU8294291A (fr) |
CA (1) | CA2088154A1 (fr) |
WO (1) | WO1992001786A1 (fr) |
Cited By (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994019476A1 (fr) * | 1993-02-26 | 1994-09-01 | Gene Shears Pty. Ltd | Polyribozyme apte a conferer, aux plantes, une resistance aux virus et plantes resistantes produisant ce polyribozyme |
EP0642589A1 (fr) * | 1992-05-11 | 1995-03-15 | Ribozyme Pharmaceuticals, Inc. | Procede et reactif d'inhibition de la replication virale |
WO1995010609A1 (fr) * | 1993-10-15 | 1995-04-20 | Foundation For Research And Technology - Hellas (F.O.R.T.H.) | Ribozymes asymetriques en tete de marteau et sequences de nucleotides destinees a leur construction |
EP0652705A1 (fr) * | 1992-06-29 | 1995-05-17 | Gene Shears Pty Limited | Acides nucleiques et leurs procedes d'utilisation dans la lutte contre des agents pathogenes de nature virale |
US5741679A (en) * | 1992-12-04 | 1998-04-21 | Innovir Laboratories, Inc. | Regulatable nucleic acid therapeutic and methods of use thereof |
US5767263A (en) * | 1992-10-15 | 1998-06-16 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5804683A (en) * | 1992-05-14 | 1998-09-08 | Ribozyme Pharmaceuticals, Inc. | Deprotection of RNA with alkylamine |
US5834440A (en) * | 1994-03-07 | 1998-11-10 | Immusol Incorporated | Ribozyme therapy for the inhibition of restenosis |
US5869253A (en) * | 1992-05-14 | 1999-02-09 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting hepatitis C virus replication |
WO1999032618A1 (fr) * | 1997-12-19 | 1999-07-01 | Strata Biosciences Incorporated | Clonage non bacterien pour l'apport et l'expression d'acides nucleiques |
US5942395A (en) * | 1997-05-09 | 1999-08-24 | Universite De Montreal | Hybrid ribozymes and methods of use |
US6017756A (en) * | 1992-05-14 | 2000-01-25 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting hepatitis B virus replication |
US6258585B1 (en) | 1992-05-14 | 2001-07-10 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting influenza virus replication |
US6432704B1 (en) | 1992-05-14 | 2002-08-13 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting herpes simplex virus replication |
US6469158B1 (en) | 1992-05-14 | 2002-10-22 | Ribozyme Pharmaceuticals, Incorporated | Synthesis, deprotection, analysis and purification of RNA and ribozymes |
US6528639B2 (en) | 1992-10-15 | 2003-03-04 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US6803194B1 (en) | 1998-02-13 | 2004-10-12 | Hk Pharmaceuticals, Inc. | Use of ribozymes for functionating genes |
DE10337407A1 (de) * | 2003-08-13 | 2005-03-10 | Transmit Technologietransfer | Klonierungssystem |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU650032B2 (en) * | 1990-06-19 | 1994-06-09 | Gene Shears Pty. Limited | Endonucleases |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1989005852A1 (fr) * | 1987-12-15 | 1989-06-29 | Macphillamy Cummins & Gibson | Ribozymes |
EP0428881A1 (fr) * | 1989-10-25 | 1991-05-29 | Hoechst Schering AgrEvo GmbH | ARNs à activité endonucléase et antisens, leurs production et utilisation |
-
1991
- 1991-07-26 WO PCT/EP1991/001403 patent/WO1992001786A1/fr not_active Application Discontinuation
- 1991-07-26 EP EP91914041A patent/EP0558490A1/fr not_active Withdrawn
- 1991-07-26 CA CA002088154A patent/CA2088154A1/fr not_active Abandoned
- 1991-07-26 JP JP3512748A patent/JPH06502988A/ja active Pending
- 1991-07-26 AU AU82942/91A patent/AU8294291A/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1989005852A1 (fr) * | 1987-12-15 | 1989-06-29 | Macphillamy Cummins & Gibson | Ribozymes |
EP0428881A1 (fr) * | 1989-10-25 | 1991-05-29 | Hoechst Schering AgrEvo GmbH | ARNs à activité endonucléase et antisens, leurs production et utilisation |
Non-Patent Citations (2)
Title |
---|
Journal of Cellular Biochemistry; Supplement 15D, 2 February-1 March 1991, abstract no. CD215, M. Tabler et al.:" Catalytic antisense RNAS by incorporation of specific ribozyme cassettes into cDNA", page 21, see the whole abstract * |
Protein Engineering, vol. 3, no. 8, 1990, Oxford University Press, (GB), K. Taira et al.:" Construction of a novel artificial-ribozyme-releasing plasmid", pages 733-737, see the whole article, especially figure 2 * |
Cited By (26)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0642589A1 (fr) * | 1992-05-11 | 1995-03-15 | Ribozyme Pharmaceuticals, Inc. | Procede et reactif d'inhibition de la replication virale |
EP0642589A4 (fr) * | 1992-05-11 | 1997-05-21 | Ribozyme Pharm Inc | Procede et reactif d'inhibition de la replication virale. |
US5869253A (en) * | 1992-05-14 | 1999-02-09 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting hepatitis C virus replication |
US7041817B2 (en) | 1992-05-14 | 2006-05-09 | Sirna Therapeutics, Inc. | Synthesis, deprotection, analysis and purification of RNA and ribozymes |
US6017756A (en) * | 1992-05-14 | 2000-01-25 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting hepatitis B virus replication |
US6132966A (en) * | 1992-05-14 | 2000-10-17 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting hepatitis C virus replication |
US6469158B1 (en) | 1992-05-14 | 2002-10-22 | Ribozyme Pharmaceuticals, Incorporated | Synthesis, deprotection, analysis and purification of RNA and ribozymes |
US6258585B1 (en) | 1992-05-14 | 2001-07-10 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting influenza virus replication |
US5804683A (en) * | 1992-05-14 | 1998-09-08 | Ribozyme Pharmaceuticals, Inc. | Deprotection of RNA with alkylamine |
US6432704B1 (en) | 1992-05-14 | 2002-08-13 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting herpes simplex virus replication |
EP0652705A1 (fr) * | 1992-06-29 | 1995-05-17 | Gene Shears Pty Limited | Acides nucleiques et leurs procedes d'utilisation dans la lutte contre des agents pathogenes de nature virale |
EP0652705A4 (fr) * | 1992-06-29 | 1997-11-19 | Gene Shears Pty Ltd | Acides nucleiques et leurs procedes d'utilisation dans la lutte contre des agents pathogenes de nature virale. |
US6528639B2 (en) | 1992-10-15 | 2003-03-04 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5767263A (en) * | 1992-10-15 | 1998-06-16 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5891684A (en) * | 1992-10-15 | 1999-04-06 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5879938A (en) * | 1992-10-15 | 1999-03-09 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
US5741679A (en) * | 1992-12-04 | 1998-04-21 | Innovir Laboratories, Inc. | Regulatable nucleic acid therapeutic and methods of use thereof |
FR2701960A1 (fr) * | 1993-02-26 | 1994-09-02 | Gene Shears Pty Ltd | Polyribozyme apte à conférer, aux plantes, une résistance aux virus et plantes résistantes produisant ce polyribozyme. |
WO1994019476A1 (fr) * | 1993-02-26 | 1994-09-01 | Gene Shears Pty. Ltd | Polyribozyme apte a conferer, aux plantes, une resistance aux virus et plantes resistantes produisant ce polyribozyme |
WO1995010609A1 (fr) * | 1993-10-15 | 1995-04-20 | Foundation For Research And Technology - Hellas (F.O.R.T.H.) | Ribozymes asymetriques en tete de marteau et sequences de nucleotides destinees a leur construction |
WO1995010608A1 (fr) * | 1993-10-15 | 1995-04-20 | Foundation For Research And Technology - Hellas (Fo.R.T.H.) | Ribozymes asymetriques en tete de marteau et sequences de nucleotides destinees a leur construction |
US5834440A (en) * | 1994-03-07 | 1998-11-10 | Immusol Incorporated | Ribozyme therapy for the inhibition of restenosis |
US5942395A (en) * | 1997-05-09 | 1999-08-24 | Universite De Montreal | Hybrid ribozymes and methods of use |
WO1999032618A1 (fr) * | 1997-12-19 | 1999-07-01 | Strata Biosciences Incorporated | Clonage non bacterien pour l'apport et l'expression d'acides nucleiques |
US6803194B1 (en) | 1998-02-13 | 2004-10-12 | Hk Pharmaceuticals, Inc. | Use of ribozymes for functionating genes |
DE10337407A1 (de) * | 2003-08-13 | 2005-03-10 | Transmit Technologietransfer | Klonierungssystem |
Also Published As
Publication number | Publication date |
---|---|
EP0558490A1 (fr) | 1993-09-08 |
CA2088154A1 (fr) | 1992-01-27 |
JPH06502988A (ja) | 1994-04-07 |
AU8294291A (en) | 1992-02-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO1992001786A1 (fr) | Cassettes de ribozymes portables, sequences d'adn les contenant, ribozymes codes par ces sequences d'adn, et compositions contenant ces ribozymes | |
US5874414A (en) | Trans-splicing ribozymes | |
Lieber et al. | Selection of efficient cleavage sites in target RNAs by using a ribozyme expression library | |
AU651380B2 (en) | Selection of ribozymes that efficiently cleave target RNA | |
KR970010758B1 (ko) | 올리고리보뉴클레오티드 화합물 | |
US5366878A (en) | Method of site-specific alteration of RNA and production of encoded polypeptides | |
US5220007A (en) | Method of site-specific alteration of RNA and production of encoded polypeptides | |
Haseloff et al. | Sequences required for self-catalysed cleavage of the satellite RNA of tobacco ringspot virus | |
US5840874A (en) | Hammerhand ribozymes | |
US5869248A (en) | Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences | |
US5872241A (en) | Multiple component RNA catalysts and uses thereof | |
Baumstark et al. | Only one of four possible secondary structures of the central conserved region of potato spindle tuber viroid is a substrate for processing in a potato nuclear extract | |
WO2002046449A2 (fr) | Selection d'acides nucleiques catalytiques cibles sur des agents infectieux | |
US5405775A (en) | Retrons coding for hybrid DNA/RNA molecules | |
JPH1052264A (ja) | N‐ras発現阻害剤およびその方法 | |
Tabler et al. | Catalytic antisense RNAs produced by incorporating ribozyme cassettes into cDNA | |
Grimaldi et al. | Spacer promoters are orientation-dependent activators of pre-rRNA transcription in Drosophila melanogaster | |
US6130092A (en) | Ribozyme gene library and method for making | |
Hauswirth | Autonomous parvovirus DNA structure and replication | |
EP0785998B1 (fr) | Ribozymes asymetriques en tete de marteau et sequences de nucleotides destinees a leur construction | |
RU2144080C1 (ru) | Рибозим, способ инактивации рнк-мишени, способ получения рибозима | |
KR100710112B1 (ko) | 세포내에서의 단일 가닥 dna의 제조 | |
AU2004205192B2 (en) | Production of ssDNA in vivo | |
AU2002228756B2 (en) | Selection of catalytic nucleic acids targeted to infectious agents | |
WO1997043404A2 (fr) | Variants de ribozyme a activite catalytique amelioree dans des conditions pauvres en magnesium |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU BB BG BR CA CS FI HU JP KP KR LK MC MG MN MW NO PL RO SD SU US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE BF BJ CF CG CH CI CM DE DK ES FR GA GB GN GR IT LU ML MR NL SE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2088154 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1991914041 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1991914041 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1991914041 Country of ref document: EP |