WO1992000376A1 - Facteur de croissance de mastocytes - Google Patents

Facteur de croissance de mastocytes Download PDF

Info

Publication number
WO1992000376A1
WO1992000376A1 PCT/US1991/004274 US9104274W WO9200376A1 WO 1992000376 A1 WO1992000376 A1 WO 1992000376A1 US 9104274 W US9104274 W US 9104274W WO 9200376 A1 WO9200376 A1 WO 9200376A1
Authority
WO
WIPO (PCT)
Prior art keywords
mgf
ser
val
asp
lys
Prior art date
Application number
PCT/US1991/004274
Other languages
English (en)
Inventor
Douglas E. Williams
Stewart Lyman
Original Assignee
Immunex Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Immunex Corporation filed Critical Immunex Corporation
Publication of WO1992000376A1 publication Critical patent/WO1992000376A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to mammalian Mast Cell Growth Factor polypeptides ("MGF"), nucleotide sequences encoding MGF and certain derivatives, analogs and allelic variants thereof, processes for production of MGF polypeptides by recombinant DNA technology or by purification from culture media of cell lines which constitutively produce MGF, and pharmaceutical compositions comprising MGF and an additional growth factor. More specifically, the invention provides isolated mammalian nucleotide sequences encoding MGF and derivatives thereof that regulate early events in stem cell proliferation.
  • the present invention discloses murine and human nucleotide sequences encoding murine and human MGF, and also nucleotide sequences capable of hybridizing to disclosed and/or deposited nucleotide sequences and encoding MGF and derivatives or analogs thereof having MGF biological activity.
  • a "true" pluripotent hematopoietic stem cell is a cell capable of extensive proliferation, self-renewal, and the ability to mediate long-term reconstitution of all hematopoietic lineages.
  • PHSC are extremely rare cells in the hematopoietic system, which are not actively cycling under normal circumstances.
  • attempts to purify PHSC have centered on the purification of spleen colony-forming cells (CFU-S) (Spangrude et al., Science 242:58 (1988)).
  • CFU-S spleen colony-forming cells
  • pre-CFU-S a cell more primitive than a CFU-S which then gives rise to daughter CFU-S cells. Such a cell has been referred to as a "pre-CFU-S.”
  • Other cells have certain stem cell-like features, including high proliferative potential colony-forming cells (HPP-CFC), a mixed colony- forming cell (CFU-GEMM), a blast cell CFC, and long-term culture initiating cells. These later cell types fail to fulfill all of the criteria for a "true" stem cell, but point to the complexity and heterogenous functional capability of primitive hematopoietic cells.
  • HPP-CFC high proliferative potential colony-forming cells
  • CFU-GEMM mixed colony- forming cell
  • blast cell CFC blast cell CFC
  • long-term culture initiating cells long-term culture initiating cells.
  • Progenitor cells are the immediate progeny of stem cells, but differ in two respects. First, progenitor cells have a restricted capacity for self-renewal, and secondly, progenitor cells are committed irreversibly to a single lineage of hematopoietic differentiation (or two, in the case of many granulocyte-macrophage progenitor cells). Progenitor cells are the cells responsible for forming the majority of observable cell colonies in experimental cultures of hematopoietic cells. Examples of progenitor cells include, granulocyte-macrophage progenitors, eosinophil progenitors, megakaryocyte progenitors, multipotential progenitors and erythroid progenitors.
  • Hematopoiesis in vivo is regulated both by feedback signals generated from peripheral tissues, i.e., long-range regulation, and by interaction between stromal cells in the bone marrow and target hematopoietic stem or progenitor cells. Regulation is likely due to the transfer of regulatory molecules from cell to cell.
  • Stromal cell lines produce a variety of known hematopoietic factors, such as interleukin-7 (LL-7), granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte CSF (G-CSF), macrophage CSF (M-CSF), interleukin-1 (LL- l ⁇ and IL-l ⁇ ), interleukin-6 (LL-6) and leukemia inhibitory factor (LLF).
  • LL-7 interleukin-7
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • G-CSF granulocyte CSF
  • M-CSF macrophage CSF
  • interleukin-1
  • hematopoietic regulatory factors there is a continuing need in the art to identify hematopoietic regulatory factors and the cellular receptors that bind to each regulatory factor.
  • One such receptor is a tyrosine kinase receptor encoded by the c-kit proto-oncogene (Yarden et al. EMBO J 6:3341 1987). This receptor is structurally related to the receptor for M-CSF, (Qui et al. EMBO J. 7:1003 1988) which is encoded by the c-fms proto-oncogene (Sherr et al. Cell 41:665 1985). Prior to the present invention, the ligand for the c-kit receptor had not yet been identified or characterized in the art.
  • mice with mutations at the Steel or W locus display a similar phenotype characterized by a reduction of pluripotent hematopoietic stem cells (PHSC), anemia, a deficiency of mast cells, and defects in gametogenesis and pigmentation (Russell Adv. Genet.20:357 1979).
  • the hematopoietic defect in W mice is intrinsic to the PHSC, whereas that of the Steel mouse is the result of a microenvironmental aberration.
  • Recent studies have shown that the W locus on murine chromosome 5 encodes the c-kit proto-oncogene (Chabot et al. Nature 335:89 1988; Geissler et al. Cell 55: 185 1988).
  • SI Steel
  • Several alleles are lethal when homozygous due to failure of erythropoiesis. The lethal period begins at the thirteenth day of gestation after hematopoiesis has commenced in the normal fetal liver. Heterozygote animals are generally viable but differ in severity on three different affected lineages.
  • SI /SI premigratory neural crest cells precursors of melanocytes
  • they give rise to pigmented melanocytes that populate and pigment skin hair follicles
  • the converse experiment results in unpigmented hairs.
  • hematopc ' -nic stem cells from anemic Sl/Sl d animals can repopulate stroma and rescue a lethally-i iated syngeneic host.
  • +/+ stem cells fail to rescue a SllSl d anemia.
  • mice, W or dominant white spotting mutations parallel those of the SI series.
  • the W mutation in mice affects the same three (primordial germ cells, hematopoietic stem cells and neural-crest derived melanocytes) stem cell lineages, erythroid cells and mast cells. Due to severe anemia the W mutation is generally lethal in the homozygous condition. Grafting experiments, much like those carried out for SI mutations, suggest that the site of action for the W gene is within the affected cells themselves rather than within the extracellular environment. Neural crest cells from W/W embryos grafted alongside +/+ skin are unable to give rise to melanocytes, whereas +/+ neural crest cells form melanocytes that populate and pigment W/W skin hair follicle.
  • MGF mammalian equivalents and homologies of the gene product of the mouse Steel locus, herein designated MGF.
  • MGF mammalian equivalents and homologies of the gene product of the mouse Steel locus.
  • Such potential hematopoietic stromal cell factors are likely to be useful regulatory molecules for controlling the early growth and differentiation of stem cells.
  • the ligand is likely to be useful for treating aplastic anemia when an individual already has erythropoietin (EPO) available.
  • EPO erythropoietin
  • MGF is likely to be further useful to treat bone marrow suppression or ineffective hematopoiesis.
  • MGF should be useful when used in combination with other factors having colony stimulating biological activity, such as GM-CSF, G-CSF, IL-3, CSF-1, IL-6 and IL-1.
  • mMGF murine MGF
  • hMGF human MGF
  • Mature hMGF polypeptide begins at a Glu residue 1.
  • the mature extracellular region of hMGF is 156 amino acids in length as shown in Figure 3, terminating at the Asp residue at amino acid 157.
  • the alternative form is provided by clone hMGF-2.4 and has 185 amino acids in its full length mature extracellular region.
  • the present invention further comprises other mammalian MGF polypeptides having MGF biological activity and encoded by nucleotide sequences which hybridize, under conditions of moderate stringency, to a probe defined by clone 10 (deposited with the ATCC on September 11, 1990 under accession number 68396) and shown in Figure 2, or by mMGF- 94 (shown in Figure 1), or which hybridize to human clone MGF-2D ( Figure 3) or hMGF-2.4 ( Figure 4) under conditions of high stringency or to various human sequence probes described herein.
  • the present invention comprises hMGF nucleotide sequences and polypeptides, wherein said nucleotide sequences hybridize, under high stringency conditions, to a probe defined by clone MGF-2D (whose sequence is shown in Figure 3) or to the nucleotide sequence encoding the extracellular portion of the human sequence and shown in Figure 3.
  • MGF Proliferative responses to mMGF correlated with expression of c-kit mRNA.
  • purified, radiolabeled mammalian MGF can be cross-linked to responder cells and subsequently immunoprecipitated with an antisera recognizing the carboxy-terminus of the c-kit gene product Therefore, MGF is the ligand for the protein receptor expression product of c- kit.
  • binding to the polypeptide receptor encoded by the c-kit proto-oncogene is a measure of MGF biological activity.
  • the c-kit sequences (mouse and human) have been published (see Background section) and expressed in various cell types as disclosed herein in the Examples.
  • MGF has a transmembrane region, an extracellular region and an intracellular region.
  • Human MGF has a 27 amino acid transmembrane region beginning with a Ser residue at amino acid 158 ( Figure 3, clone MGF-2D) or amino acid 186 ( Figure 4, clone MGF-2.4).
  • a transmembrane region typically comprises hydrophobic amino acid residues flanked by charged amino acids.
  • the intracellular region of hMGF begins with a Lys residue at amino acid 185 ( Figure 3, clone MGF-2D) or at amino acid 213 ( Figure 4, clone MGF-2.4) and is 36 amino acids in length.
  • hMGF-2.4 amino acid 149 of hMGF-2D is a Gly whereas corresponding amino acid (just after the spliced exon sequence) 177 of hMGF-2.4 is an Arg.
  • This amino acid difference is a result of the spliced exon sequence being inserted within a codon.
  • Figures 1, 2, 3 and 4 illustrate nucleotide and amino acid sequences of wild type mMGF ( Figures 1 and 2) and hMGF ( Figures 3 and 4).
  • Clone hMGF-2D comprises the full coding region of wild type hMGF without the additional 28 amino acid alternative exon region.
  • Clone hMGF-2.4 comprises the full hMGF coding region with the alternative exon sequence.
  • the polypeptide expressed by the extracellular region of clone hMGF-2.4 is called ⁇ 28 MGF.
  • Mammalian or human hematopoiesis are influenced by administration of MGF.
  • optimal hematopoiesis is achieved by combination therapy with MGF and other cytokines, including but not limited to GM-CSF, IL-3, a fusion protein comprising both GM-CSF and IL-3, EPO, IL-l ⁇ , IL-l ⁇ , G-CSF, LIF, LL-6, and IL-7.
  • MGF has the ability to augment the action of other cytokines for megakaryocytopoiesis, an activity shared by LL-3 and LL-6, and provides maximal hematopoietic progenitor proliferative stimulus when employed in combination with GM-CSF, IL-3 or GM-CSF/IL-3 fusion proteins.
  • MGF was found to influence early lymphoid development, early myeloid development, and promote proliferation and sustain hematopoiesis of early stem cells or progenitor cells of the more primitive types.
  • Figure 1 shows a cDNA sequence and corresponding amino acid sequence for clone mMGF-94 'Sequence ID No. 1) without the 16 amino acid spliced sequence.
  • Figure 2 shows the nucleotide sequence and corresponding amino acid sequence for murine MGF clone mMGF-10 (Sequence ID No.2) with the alternative mRNA exon sequence that adds 16 amino acids to the extracellular region of the polypeptide.
  • Figure 3 illustrates the wild type hMGF cDNA and amino acid sequence as derived from clone hMGF-2D (Sequence ID No. 3) without the 28 amino acid alternative exon region. This sequence encodes a polypeptide that is also called ⁇ 28 hMGF.
  • Figure 4 illustrates the wild type hMGF cDNA and amino acid sequence as derived from clone hMGF-2.4 (Sequence ID No.4).
  • the transmembrane region begins with a Ser Ser sequence following an Asp residue and ends with a Leu Tyr Tip sequence just prior to a Lys Lys sequence that begins (N- terminus) the intracellular region. A portion of the 5' non-coding region is also shown.
  • the mature hMGF polypeptide begins with a Glu residue in the extracellular region.
  • Figure 5 shows a dose-response comparison of BFU-E and CFU-GEMM activities of different concentrations of MGF.
  • Figure 6a shows the number of cells recovered from purified stem cell fractions after three days in culture with medium alone, mMGF alone, IL-3 alone or IL-3 plus mMGF for early (dull) and late (bright) stem cells.
  • Figure 6b shows the recovery of CFU-S from dull and bright populations of primitive stem cells after 3 days of culture with medium alone, mMGF alone, IL-3 alone or IL-3 plus mMGF.
  • MGFs have an extracellular region that contains the c-kit binding region, a hydrophobic transmembrane region delineated by charged amino acids on either side and an intracellular region.
  • the present invention further comprises a soluble human MGF polypeptides comprising amino acid sequences corresponding to the extracellular domain or at least a region of the extracellular domain encompassing all four Lys residues.
  • MGF is a ligand for the gene product of the c-kit proto-oncogene.
  • c-kit encodes a tyrosine kinase receptor on bone marrow stem cells and other tissues including, for example, primordial germ cells (PGC), melanocytes and developing (embryonic) neural crest cells arising from the neural tube.
  • PPC primordial germ cells
  • MGF activity comprises signaling proliferation and/or differentiation of precursor bone marrow stem cells and a variety of other germ-type cells for developing central and peripheral nervous system, gametogenesis and pigmentation.
  • MGF is preferably secreted by bone marrow stromal .cells in either precursor or mature forms, or both. There is also a natural soluble form of MGF comprising the extracellular region or a fragment thereof.
  • MGF myelogenous growth factor-dependent mast cell line
  • a biological assay for mammalian MGF can use, for example, a growth factor-dependent mast cell line to look for cell proliferation.
  • Any IL-3 dependent cell line expressing c-kit can be used to provide responder cells for a proliferation assay receptor or binding assay for a mammalian MGF.
  • fresh mast cells isolated from bone narrow of normal mice express c-kit and can similarly be used for receptor binding assays or for proliferation assays for mammalian MGF.
  • fresh mast cells isolated from marrow samples taken from humans or from mammals can be used to assay for mammalian MGF.
  • a MGF-dependent cell line can be derived from fresh Thy-1 + marrow cells of NFS/N mice.
  • the NFS/N1 cell line is a mast cell that lacks Thy-1+, ThB, and B220. This cell line responds to purified murine IL-3 and recombinant murine B -4, but not to natural or recombinant murine GM-CSF, recombinant human G-CSF or murine CSF-1.
  • An IL-3- dependent cell line was obtained from IL-3 responsive cells from an NFS/N mouse strain passaged in a high concentration of WEHI-3 conditioned media ("WEHI-3-CM”) containing IL-3 after enrichment of Thy-1 + cells by a fluorescence-activated cell sorter.
  • WEHI-3-CM WEHI-3 conditioned media
  • cell line cloning can be accomplished, for example, by limiting dilution and by isolation of individual colonies growing in methylcellulose in response to a combination of WEHI-3-CM and stromal cell-CM.
  • WEHI-3-CM are collected from supematants of the WEHI-3 murine leukemia cell line (ATCC TIB68) growing in RPMI- 1640 medium supplemented with 2% fetal calf serum. The supernatant is dialyzed against distilled water and concentrated five-fold prior to use.
  • the NFS/N1-MC6 or MC6 cell line provides biological activity assays for murine MGF by proliferating in response to murine MGF as measured by colony formation or by uptake of tritiated thymidine.
  • human MGF can be assayed for MGF biological activity by anyone of a number of cell lines that require human IL-3 for growth and express the product of the c-kit gene product. Examples of such cells include TF1 cells (Kitamura et al., /. Cell. Physiol. 140:323, 1989) and Mo7e cells (Avanzi et al., Br. J. Haematol. 69:359, 1988).
  • factor-dependent cells e.g., MC6 cells, TF1 cells, or mast cells
  • a suitable medium such as RPMI 1640 supplemented with 10% fetal calf serum.
  • Supematants from cells secreting putative growth factor are added to the wells and the cells are incubated overnight at 37 ⁇ C in a 5% CO2 atmosphere.
  • the cells are next pulsed with 1 ⁇ Ci of tritiated thymidine and incubated for an additional eight hours.
  • the wells are harvested onto glass fiber .filter discs for counting by liquid scintillation. Presence of a growth factor is determined by increased tritium in the cells as an indication of cellular division.
  • MGF refers to a family of mammalian polypeptides which are capable of stimulating IL-3 dependent mast cell lines and hematopoietic progenitor cells, and serve as a ligand for the gene product of the c-kit proto-oncogene.
  • MGF includes analogs or subunits of native mammalian polypeptides with substantially identical or substantially similar amino acid polypeptide sequences which bind to the protein expressed by the c-kit proto- oncogene and which induce proliferation of mast cells, for example, the IL-3 dependent murine mast cell line MC6 or human cell line TF1.
  • MGF may consist solely of its extracellular region or a fragment thereof including all four Cys residues of the extracellular domain and may lack a transmembrane region and intracellular domain.
  • the extracellular region of MGF or fragment thereof is a soluble polypeptide.
  • Both human and murine native sequence MGF have been found in two variations, differing by an extra coding region in the extracellular domain of the polypeptide.
  • One human variant (clone MGF 2.4) has an extra 28 amino acids beginning at amino acids 148 in the extracellular domain of the polypeptide.
  • One murine variant (clone mMGF-10) has an extra 16 amino acids beginning with amino acid 148 in its extracellular domain.
  • clone hMGF2-D lacks a 28 amino acid sequence in the extracellular domain.
  • the extracellular domain of this polypeptide is called ⁇ 28 hMGF.
  • Human MGF polypeptides have a full length 185 amino acid extracellular domain. This polypeptide has five glycosylation sites and four Cys residues. The first Cys residue at position 3 of the mature human polypeptide sequence binds to the third Cys residue at position 89 of the human MGF polypeptide sequence. Similarly, the second Cys residue at position 43 binds to the fourth Cys residue at position 138. ⁇ 28 hMGF retains all four Cys residues, but eliminates the fifth glycosylation site. When several amino acids are removed from the C- terminus of hMGF extracellular domain, up to the fourth Cys residue at position 138, biological activity is retained.
  • Murine and human MGF are 87% homologous at the DNA level and 90% homologous at the protein level. However, despite 90% homology at the protein level, there are enough differences in protein structure for human MGF to be 2-3 logs less active in a murine cell (MC6) assay and murine MGF to be 2-4 fold less active in a human (TF1 cell) proliferation assay.
  • MC6 murine cell
  • TF1 cell human proliferation assay
  • a murine-human- murine MGF chimeric protein having murine sequence from the 5' end to the Ssp I site, human sequence from the Ssp I site to the EcoRl site and murine sequence from the Ec ⁇ RI site to the 3' end of the extracellular domain.
  • This chimera was active in a human assay but inactive in a murine assay.
  • the 50 amino acid region was not sufficient (alone) to confer total biological activity but needs to be configured in the context of additional protein.
  • glycosylation sites can be altered to facilitate expression in yeast or mammalian cell systems.
  • the region surrounding the third Cys at position 89 is important for receptor binding.
  • the Val residue at residue 90 can be altered to any other amino acid without affecting biological activity.
  • the adjoining Lys residue at position 91 confers human species specificity to hMGF and requires a Glu residue at this position for murine species specificity.
  • Human MGF analogs can vary in length from about 135 amino acids to about 185 amino acids constituting the extracellular domain of the hMGF polypeptide.
  • Biologically active hMGF analog polypeptides comprise four Cys residues, but can vary at other positions according to the following sequence:
  • Glu Glu Phe Phe Arg lie Phe Asn Arg Ser lie Asp Ala Phe Lys Asp Phe Val Val Ala Ser Glu Thr Ser Asp Cys X n X n X n X n X n X n X n X n X n X n X n
  • n 0 or 1
  • X is any naturally occurring amino acid
  • Ri is any amino acid except Glu
  • R2 is any amino acid except Val
  • Q is Lys or Arg to provide human activity, or is Glu to provide murine activity.
  • Human MGF is encoded, for example, by a nucleotide sequence comprising the sequence from nucleotide 112 to nucleotide 516 in Figure 3, or a DNA sequence that hybridizes to a probe defined by the foregoing sequence under conditions of high stringency.
  • Moderate stringency hybridization conditions refer to conditions described in, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2 Ed. Vol. 1 pages 1.101-1.104 (Cold Spring Harbor Laboratory Press 1989).
  • Exemplary conditions of moderate stringency are a prewashing with
  • the primary amino acid structure of mammalian MGF may be modified by forming covalent or aggregative conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like, or by creating amino acid sequence mutants.
  • Such polypeptides are called derivatives.
  • Covalent derivatives of mammalian MGF are prepared, for example, by linking particular functional groups to mammalian MGF amino acid side chains or at the N-terminus or C-terminus of a mammalian MGF polypeptide.
  • the fusion polypeptide may comprise a signal (or leader) polypeptide sequence at the N-terminal region of a mammalian MGF polypeptide which co-translationally or post-translationally directs transfer of a mammalian polypeptide from its site of synthesis to a site inside or outside of the cell membrane or wall (e.g., the yeast ⁇ -f actor leader).
  • Mammalian MGF polypeptide fusions can also comprise fusion to other biologically active proteins or immunoglobulins.
  • the present invention further includes mammalian MGF polypeptides having altered glycosylation.
  • Mammalian MGF expressed in yeast or mammalian expression systems e.g., COS-7 cells
  • Expression of mammalian MGF polypeptides in bacterial expression systems, such as E. coli provides non-glycosylated molecules.
  • N-glycosylation sites in eukaryotic polypeptides are characterized by an amino acid triplet Asn- ⁇ - ⁇ where ⁇ is any amino acid except Pro and ⁇ is Ser or Thr. In this sequence, carbohydrate residues are covalently attached at the Asn side chain.
  • Human MGF clone MGF-2D contains four glycosylation sites in the extracellular region of the polypeptide and hMGF-2.4 further contains a fifth glycosylation site in the 28 amino acid alternative exon located in the extracellular region.
  • the glycosylation sites in hMGF-2D begin with the Asn residue at positions 65, 72, 93 and 120.
  • the fifth glycosylation site of human MGF is at position 170.
  • the ⁇ 28 hMGF polypeptide does not contain a fifth glycosylation site.
  • yeast expression of human MGF hyperglycosylates only the fifth glycosylation site.
  • Mammalian MGF polypeptides are encoded by multi-exon genes.
  • the present invention includes DNAs and polypeptides corresponding to alternative mRNAs which can be attributed to different mRNA splicing events following transcription, and which share regions of identity or similarity with the cDNAs disclosed herein.
  • Bioequivalent analogs of mammalian MGF polypeptides or MGF muteins may be constructed, for example, by making various substitutions of amino acid residues or sequences, or by deleting terminal or internal residues or sequences not needed for biological activity. Generally, substitutions are made conservatively by substituting an amino acid having physiochemical characteristics resembling those of the replaced residue. Further substitutions may be made outside of the "core" sequence (for human MGF, the core sequence lies between the first the fourth Cys residues) needed for mammalian MGF binding and biological activity. However, the amino acid residue at position 91 is essential for receptor binding and helps to confer species specificity. Subunits of a mammalian MGF polypeptide may be constructed by deleting terminal or internal residues or sequences.
  • nucleotide sequence and corresponding amino acid sequence of mMGF are illustrated in Figures 1 and 2. These murine sequences were obtained from mMGF- 10 and mMGF-94, constructed from +/+ cDNA, that was Sal 1 linkere4 into a Sail site of vector HAVEo. These isolates were cloned as described in Example 2 herein.
  • oligonucleotide probe was created from the nucleotide sequence of isolate 10 used to screen a human cDNA library under moderate stringency conditions. Similar cross species hybridization techniques may be applied to clone new mammalian MGF nucleotide sequences when a particular mammalian sequence (e.g., murine) is known and cDNA or genomic DNA libraries made from cells that would produce MGF polypeptides are available for the desired species. Expression of MGF Polypeptides
  • MGF and especially human MGF and analogs thereof can be expressed in a variety of prokaryotic and eukaryotic host systems.
  • prokaryotic host systems include E. coli bacteria and Staphyllococcus aureus.
  • eukaryotic host systems include mammalian cells (COS), Chinese hampster ovary (CHO) and yeast cells such as S. cerevisiae.
  • pIXY-120 which comprises an ADH2 promoter sequence and the ⁇ -factor secretion leader.
  • the ADH2 promoter has been described in Russell et al., /. Biol. Chem.258:26 , 1982, and Beier et al., Nature 300:724, 1982.
  • the ⁇ -factor leader sequence is often inserted between the promoter sequence and the structural gene sequence.
  • the use of an ⁇ -factor leader sequence to improve expression of a particular structure gene has been described in, for example, Kurjan et al., Cell 30:933, 1982, and Bitter et al., Proc. Natl. Acad. Sci. USA 81:5330, 1984.
  • the pLXY 120 vector further comprises an Asp 718 restriction site at the 5' end and a Bam HI restriction site at the 3' end to facilitate insertion of a structural gene.
  • the pIXY 120 expression vector is cut with Xho I and an insert comprising a MGF cDNA is ligated into the pLXY 120 vector with Sal I restriction enzyme.
  • Recombinant expression vectors include suitable transcriptional or translational regulatory or structural nucleotide sequences which may be derived from mammalian, micTobial, viral or insect genes.
  • regulatory sequences include transcriptional promoters or enhancers, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and appropriate sequences which control transcription and translation initiation and termination.
  • Suitable host cells for expression of mammalian MGF or derivatives thereof include prokaryotes, yeast or higher eukaryotic cells under the control of appropriate promoters.
  • Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli.
  • Suitable prokaryotic hosts cells for transformation include, for example, E. coli, Bacillus subtilis, Salmonella typhimuri m, and various other species within the genera Pseudomonas, Streptomyces, and Staphylococcus.
  • Higher eukaryotic cells include established cell lines of mammalian origin as described below. Cell-free translation systems could also be employed to produce mammalian MGF or derivatives thereof using RNAs derived from the DNA constructs disclosed herein.
  • Promoter sequences are commonly used for recombinant prokaryotic host cell expression vectors. Common promoter sequences include ⁇ -lactamase (penicillinase), lactose promoter system (Chang et al., Nature 275:615, 1978; and Goeddel et al., Nature 281:544, 1979), tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res. 5:4057, 1980; and EP-A- 36,776) and tac promoter (Maniatis, Molecular Clonin ⁇ Laboratory Manual, Cold Spring Harbor Laboratory, p. 412, 1982).
  • ⁇ -lactamase penicillinase
  • lactose promoter system Chang et al., Nature 275:615, 1978; and Goeddel et al., Nature 281:544, 1979
  • tryptophan (trp) promoter system Goeddel et al., Nucl
  • a particularly use rokaryotic host cell expression system employs a phage ⁇ PL promoter and a cI8i / t a thermolabile repressor sequence.
  • Plasmid vectors available from the American Type Culture Collection which incorporate derivatives of the ⁇ P promoter include plasmid pHUB2 (resident in E. coli strain JMB9 (ATCC 37092)) and pPLc28 (resident in E. coli RR1 (ATCC 53082)).
  • Yeast transformation protocols are known to those of skill in the art.
  • One such protocol is described by Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929, 1978.
  • the Hinnen et al. protocol selects for Trp + transformants in a selective medium, wherein the selective medium consists of 0.67% yeast nitrogen base, 0.5% casamino acids, 2% glucose, 10 ⁇ g/ml adenine and 20 ⁇ g/ml uracil.
  • Yeast host cells transformed by vectors containing ADH2 promoter sequence were grown for inducing expression in a "rich" medium.
  • a rich medium is one consisting of 1% yeast extract, 2% peptone, and 1% glucose supplemented with 80 ⁇ g/ml adenine and 80 ⁇ g ml uracil. Derepression of the ADH2 promoter occurs when glucose is exhausted from the medium.
  • Mammalian or insect host cell culture systems could also be employed to express recombinant mammalian MGF polypeptide or derivatives thereof.
  • suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells (ATCC CRL 1651) (Gluzman et al., Cell 23:175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary (CHO) cells, HeLa cells, and BHK (ATCC CRL 10) cell lines.
  • Suitable mammalian expression vectors include nontranscribed elements such as an origin of replication, a promoter sequence, an enhancer linked to the structural gene, other 5 1 or 3' flanking nontranscribed sequences, such as ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
  • Transcriptional and translational control sequences in mammalian host cell expression vectors may be provided by viral sources.
  • mammalian cell promoter sequences and enhancer sequences are derived from Polyoma, Adenovirus 2, Simian Virus 40 (S V40), and human cytomegalovirus.
  • DNA sequences derived from the SV40 viral genome, for example, S V40 origin, early and late promoter, enhancer, splice, and polyadenylation sites may be used to provide the other genetic elements required for expression of a structural gene sequence in a mammalian host cell.
  • Viral early and late promoters are particularly useful because both are easily obtained from a viral genome as a fragment which may also contain a viral origin of replication (Fiers et al., Nature 273:113, 1978). Smaller or larger SV40 fragments may also be used, provided the approximately 250 bp sequence extending from the Hind III site toward the Bgl I site located in the SV40 viral origin of replication site is included. Purification of Recombinant Mammalian MGF
  • MGF polypeptides may be prepared by culturing transformed host cells under culture conditions necessary to express MGF or derivatives thereof. The resulting expressed polypeptides may then be purified from culture media or cell extracts. MGF or a derivative thereof is concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a purification matrix such as a gel filtration medium. Alternatively, an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) groups.
  • the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
  • a cation exchange step can be employed.
  • Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred (e.g., S-Sepharose® columns).
  • one or more reverse-phase high performance liquid chromatography (RP- HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify MGF.
  • RP- HPLC reverse-phase high performance liquid chromatography
  • Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous recombinant protein.
  • some or all of the steps used in the purification procedure described above for murine MGF can also be employed.
  • Recombinant protein produced in bacterial culture is usually isolated by initial disruption of the host cells, centrifugation, extraction from cell pellets if an insoluble polypeptide, or from the supernatant if a soluble polypeptide, followed by one or more concentration, salting-out, ion exchange or size exclusion chromatography steps. Finally, RP- HPLC can be employed for final purification steps. Microbial cells can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
  • Transformed yeast host cells are preferably employed to express MGF as a secreted polypeptide.
  • One construct, pLXY 551 encodes an amino acid sequence comprising the first 148 amino acids of human MGF.
  • pIXY 551 was made by mutagenizing pIXY-481 (full length human MGF extracellular domain) to remove 37 amino acids from the C-terminus. PCR reaction conditions allow one to begin with full length (185 amino acids) sequence of the extracellular domain of human MGF and make shorter fragments.
  • pIXY 551 comprises an ADH2 promoter sequence, an ⁇ -factor leader sequence, a FLAG sequence, followed by the coding region for the first 148 amino acids of human MGF extracellular domains.
  • pIXY 552 comprises the N-terminal 133 amino acids of human MGF extracellular domain
  • pIXY 553 comprises the first 119 amino acids of human MGF N- terminal
  • pD Y 554 comprises the first 104 amino acids of human MGF extracellular domain.
  • yeast Sacharomyces cerevisiae
  • Yeast were grown to an optimal optical density and supematants were collected for analysis of protein and human MGF activity in a TF1 cell proliferation assay.
  • pLXY 551 and pLXY 490 ⁇ 28 hMGF
  • pLXY 551 and pLXY 490 exhibited the highest mean specific activity of 8326 and 6938 units/ ⁇ g, respectively.
  • full-length 185 amino acid MGF produced 4520 units/ ⁇ g
  • another version comprising the first 164 amino acids of the extracellular domain produced 4978 units/ ⁇ g.
  • pLXY 553 comprising the first 133 amino acids of the N-terminal sequence had 1143 units/ ⁇ g of activity while pLXY 553 (119 N-terminal amino acids) and pLXY 554 (104 N-terminal amino acids) did not produce any proliferation activity in the TF1 cell assay when compared to background.
  • Yeast broth from transformed yeast making recombinant human MGF was titrated to pH 3 with a citrate buffer and HC1.
  • the buffered broth is diluted with water and loaded onto a cation exchange column, such as S-Sepharose® (Pharmacia) that has been equilibrated in the citrate buffer.
  • the column is washed with citrate buffer, and MGF is eluted with 50 mM ⁇ -alanine pH 4.0 and a solution of 50 mM sodium acetate pH 5.0.
  • the next step is a reverse phase high performance liquid chromatography (RP- HPLC) with a bonded alkyl column (preferably a C4 column).
  • RP- HPLC reverse phase high performance liquid chromatography
  • the column is washed with 0.1% TFA (trifluoroacetic acid) until the pH drops to 2.0.
  • TFA trifluoroacetic acid
  • MGF is eluted with a linear gradient of 0-100% acetonitrile in 0.1% TFA. MGF elutes at approximately 50% acetonitrile.
  • Fractions containing MGF from the reverse phase column were pooled and buffered with 25 mM citrate pH 3.0. MGF was applied to a cation exchange column such as S- Sepharose®, and equilibrated with 25 mM citrate pH 3.0. The column was washed with citrate buffer and eluted with an elution buffer containing 0.5 M NaCl in 50 mM Tris pH 8.0. This step concentrates MGF in the elution buffer.
  • the present invention provides methods of using therapeutic compositions comprising an effective amount of MGF in a suitable diluent or carrier.
  • MGF purified MGF or a biologically active derivative thereof is administered to a patient, preferably a human, for treatment in a manner appropriate to the indication.
  • MGF compositions administered to suppress a form of anemia can be given by bolus injection, continuous infusion, sustained release from implants, or other suitable technique.
  • a MGF therapeutic agent will be administered in the form of a pharmaceutical composition comprising purified polypeptide in conjunction with physiologically acceptable carriers, excipients or diluents. Such carriers will be nontoxic to patients at the dosages and concentrations employed.
  • compositions entails combining a mammalian MGF polypeptide or derivative thereof with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrans, chelating agents such as EDTA, glutathione and other stabilizers and excipients.
  • antioxidants such as ascorbic acid
  • proteins proteins
  • amino acids amino acids
  • carbohydrates including glucose, sucrose or dextrans
  • chelating agents such as EDTA
  • glutathione glutathione and other stabilizers and excipients.
  • Neutral buffered saline or saline mixed with conspecific serum albumin are exemplary appropriate diluents.
  • cytokines The cellular events that lead to blood cell production are controlled by multiple cytokines. Many of these cytokines are produced by marrow stromal cells or by cells that traffic through the marrow compartment. Hematopoietic stem cell development occurs primarily at specific sites within the marrow. Of the hematopoietic stem cells, the human CFU- Bl and HPP-CFC are believed to be the cells responsible for initiating long term hematopoiesis in vitro. Each of these cells possesses similar phenotypic properties and a number of biological behavior patterns associated with human stem cells. A variety of in vitro assays have been utilized to determine cytokine requirements of these primitive progenitor cells.
  • MGF extracellular domain
  • MGF can augment the proliferation of both myeloid and lymphoid hematopoietic progenitor cells.
  • MGF exhibits potent synergistic activity in conjunction with other colony-stimulating factors that can result in increased colony number and size.
  • MGF can synergistically interact with later acting hematopoietic growth factors such as Interleukin-1 (LL-1), Interleukin-3 (LL-3), granulocyte- macrophage colony-stimulating factor (GM-CSF), Interleukin-7 (LL-7), and a fusion protein (pLXY-321) that comprises active sites of both GM-CSF and IL-3.
  • LL-1 Interleukin-1
  • LL-3 Interleukin-3
  • GM-CSF granulocyte- macrophage colony-stimulating factor
  • LL-7 Interleukin-7
  • pLXY-321 fusion protein
  • pLXY-321 is a GM-CSF/IL-3 fusion protein havingLeu 23 Asp 27 Glu 34 hGM-CSF/Gly4SerGly5Ser/Pro 8 Asp 15 Asp 70 hLL-3, and is described in U.S. Patent Aplication 07/567,983 filed October 14, 1990, the disclosure of which is incorporated by reference herein.
  • a bone marrow subpopulation of CD34+ DR- CD15- is a model for a group of primitive hematopoietic progenitor cells.
  • MGF is added to this model of hematopoietic progenitor cells, a modest granulocyte-macrophage colony-stimulating activity but no erythropoietic burst or mixed colony formation activity was evident.
  • MGF has promoted erythropoietic bursts (macroscopic) and mixed colony formation in the presence of EPO.
  • MGF was capable of synergizing with other cytokines, such as LL-3, in promoting hematopoietic cell proliferation.
  • cytokines such as LL-3
  • the combination of MGF and the fusion protein pIXY-321 produced a significant increase in the number of CFU-GM and HPP- CFC when compared to the colonies formed with just pD Y-321 alone.
  • Table 1 below presents data from a comparison of CFU-GM, BFU-E, CFU-GEMM, HPP-CFC, and BFU- MK colony activities stimulated by various cytokines in a population of CD34+ DR- CD 15- human progenitor cells.
  • CFU-GM, BFU-E, CFU-GEMM, and HPP-CFC were assayed with about 10 3 CD34+ DR- CD15" marrow cells in methyl cellulose containing one unit of human recombinant erythropoietin and enumerated at 21 days, or 28 days for HPP-CFC.
  • Concentrations of cytokine included 2 ⁇ g/ml for IL-3 (specific activity 3.5 x 10 8 CFU/MG protein), 1 ng ml for GM-CSF (specific activity 2.8 x 10 8 CFU/MG protein), 10 ng/ml for pIXY-321 (specific activity 1-2 x 10 9 CFU/MG protein), 50 ng/ml for murine MGF (specific activity 10 6 CFU/MG protein). These data were performed in duplicate to obtain the standard deviations indicated. The study was repeated, and similar data were obtained.
  • MGF alone was capable of sustaining long term myelopoiesis but had a limited affect on megakaryocytopoiesis and erythropoiesis.
  • pD Y-321 or IL-3 was added with MGF, a profound synergistic effect in promoting progenitor cell expansion of all three hematopoietic lineages was found. The most pronounced effect was seen with the combination of MGF and pLXY-321, which led to a 50-1000 fold increase in progenitor numbers over a 10 week period.
  • MGF was capable of synergizing with IL-3 in promoting megakaryocyte progenitor cell expansion, but was incapable of substantially augmenting maximal proliferative stimulus supplied by pIXY-321 or a combination of GM-CSF and LL-3.
  • hematopoiesis was sustained for six to ten weeks in the presence of either IL- 3, GM-CSF, pIXY-321, IL-3 plus GM-CSF, or MGF.
  • the combination of IL-3 and GM- CSF was additive, but less than the effect of pLXY-321.
  • MGF plus LL-3 or MGF plus pLXY-321 provided a dramatic synergy, resulting in a 10 3 - l -fold increase in cell numbers over an original 5 x 10 3 cellular inoculum.
  • MGF in combination with a later-acting cytokine such as LL-3 or a fusion protein of LL-3 and GM-CSF promotes cellular proliferation and the presence of MGF in that cytokine combination favors the persistence of a more primitive hematopoietic cell type.
  • Human megakaryocytopoiesis is regulated by a group of cytokines, including GM- CSF, IL-l ⁇ , LL-3, LL-6, and MGF. Megakaryocytopoiesis can be measured by CFU-MK and BFU-MK. Each in vitro measurement determines a level of progenitor cell development leading to platelet formation.
  • MGF affects multiple stages of megakaryocyte development and synergistically augments colony stimulating activity of various cytokines, including pIXY-321, GM-CSF, IL-3 and LL-6.
  • MGF in combination with LL-3 potentiates the ability of LL-3 to promote colony formation at each level of progenitor cell development (BFU-MK and CFU- MK).
  • GM-CSF, LL-3, pIXY-321, IL-l ⁇ , and IL-3 were roughly equivalent when measuring BFU-MK in vitro, and were not further enhanced by the addition of MGF.
  • MGF synergistically enhanced the ability of pLXY-321, GM-CSF, LL-3 and LL-6 to promote megakaryocyte colony formation in vitro.
  • Maximal human megakaryocytopoiesis was achieved with the triple combination of IL-3, GM- CSF and MGF, or the combination of MGF plus a GM-CSF/IL-3 fusion protein such as pLXY-321.
  • MGF also stimulates erythroid proliferation in the presence of erythropoietin (EPO).
  • EPO erythropoietin
  • MGF can increase fetal hemoglobin synthesis in sickle cell anemia.
  • the stimulation effect of MGF was decreased by concurrent addition of Interf eron- ⁇ .
  • MGF can also be effective for stimulating lymphoid precursor cells, and influencing early lymphoid development. MGF stimulated thvmidine incorporation in day 13 fetal thymus cells.
  • Fetal thymus cells are a source of lympho: recursor cells.
  • both Interleukin-2 (LL-2) and IL-7 can stimulate significant tritiated thymidine incorporation in day 13 fetal thymus cells.
  • the effects of the combination of MGF and IL-2 were additive, while the effects of MGF plus IL-7 were greater-than-additive.
  • day 13 fetal thymus cell expansion after 9 days of incubation with cytokine were three-fold higher than background for MGF, three-fold higher than background for LL-7, and 103-fold higher than background for the combination of MGF and LL-7.
  • Fetal thymus cells that were expanded by the combination of MGF and LL-7 were CD3" CD4" CD8- cells.
  • the combination of MGF plus LL-7 stimulated pre B cell colonies two to four-fold above that seen with IL-7 alone.
  • MGF may have further function in organization of the neural tube and brain. More importantly, MGF mediates proliferation and differentiation of fetal neural tube cells to promote development of fetal brain and brain in newborns. Moreover, MGF effects melanocyte function to regulate differentiation and proliferation of melanocytic functions.
  • This example describes purification of murine MGF to homogeneity for amino acid sequencing.
  • 45 liters of conditioned medium was obtained from normal WCB6F1 +/+ cells grown in RPMI 1640 supplemented with 10% fetal calf serum.
  • the conditioned medium was first acidified to pH 2.75 by adding concentrated HCl and buffered with Na citrate, pH 3.25, to a final concentration of 5 mM Na citrate.
  • the acidified conditioned medium was applied to an S-Sepharose® Fast Flow (Pharmacia) column equilibrated with 0.1 M NaCl 5 mM Na citrate, pH 3.25.
  • the protein pool was diluted with 2M ammonium sulfate 20 mM Tris HCl, pH 7.5, and centrifuged to remove precipitated proteins.
  • the pooled protein was then applied to a Phenyl Sepharose® CL-4B (Pharmacia) column equilibrated with 2 M ammonium sulfate 20 mM Tris HCl, pH 7.5. Bound proteins were eluted using a reverse gradient of 2 M - 0.5 M ammonium sulfate in 20 mM Tris HCl, pH 7.5.
  • Fractions were collected, dialyzed against PBS (using a 6000-8000 dalton cut-off membrane), and assayed for MGF biological activity using the MC6 cell assay described herein. Fractions containing MGF were pooled for further purification procedures.
  • the Blue A pool was acidified by addition of trifluorocetic acid (TFA) while vortexing to a final TFA concentration of about 0.1% (v/v) and filtered through a .022 ⁇ cellulose acetate filter.
  • the acidified protein pool was pumped directly onto a Radial-Pak Vydac® C-4 column (15 ⁇ particle size) pre-equilibrated with 0.1% TFA in water at a flow rate of about 0.8 ml/min. Bound proteins were eluted using a 1%/min linear gradient of acetonitrile (0.1%, v/v TFA). One minute fractions were collected, neutralized with a Tris buffer, and bioassayed for MGF biological activity.
  • TFA trifluorocetic acid
  • Active fractions were pooled, and the protein pool was concentrated by rotary evaporation to about 10% of its original volume.
  • the concentrated protein pool was applied to an Aquapore® Butyl C-4 column (7 ⁇ particle size) pre-equilibrated with 0.1% TFA in water, at a flow rate of about 0.2 ml/min. Protein bound to the colurr n was eluted with a .05%/min linear gradient of acetonitrile (0.1 %, v/v TFA). Fractions were collected, neutralized, and bioassayed for MGF activity.
  • Protein fractions exhibiting MGF activity were collected from 2 runs of the purification protocol described above and concentrated to dryness by rotary evaporation. The protein was resuspended in gel sample buffer and heated to 110 ⁇ C for five minutes. The protein was then separated using a 10% Laemli gel and transferred onto a PVDF membrane (Pro Blot, Applied Biosystems) using constant current, 60V setting, for 1.0 hour. Three protein bands were visualized by staining the PVDF membrane for five minutes with 0.1% Coomassie Blue in 10% acetic acid, 50% methanol.
  • the membrane was destained in the acetic acid/methanol solution without Coomassie blue stain, washed extensively with HPLC water, and dried. Protein bands were excised with a razor and placed onto a pre-cycled filter for a model 477 protein sequencer (Applied Biosystems, Foster City, CA), for N-terminal amino acid sequencing.
  • RNA Polyadenylated RNA was prepared from +/+ cells (described in Boswell et al. Blood 70:161 'a. 1987) and cDNAs were prepared using standard techniques. The +/+ cell line produces murine MGF. cDNA ends were adapted with Sal 1 adapters (Haymerle et al. Nucleic Acid Res. 74:8615-24 1986):
  • the DNA fragment was prepared using polymerase chain reaction (PCR) amplification of murine MGF sequences from +/+ and LDA11 cell line cDNA as follows.
  • the sequence of the N-terminal 28 amino acids of purified murine MGF was used to design synthetic oligonucleotide primers for PCR amplification of murine MGF-cDNA clones from a murine library described below.
  • the first five amino acids of the N-terminus (Lys Glu lie Cys Gly) were used to design one primer, 5'-
  • CGCCCGGGAA(G/A)GA(G/A)AT(A/C T)TG(T/C)GG-3' a degenerate mixture coding for all possible codon usages of the first five amino acid residues, omitting the third position of Gly and containing an additional eight bases coding for a Smal recognition site and a 5' CG clamp.
  • the amino acid sequences of the mouse mature N-terminus 23-28 (Pro Asn Asp Tyr Met Lie) were used to design a second primer, a degenerate mixture coding for a complement of all possible codon usages of amino acids 23-28, omitting position 3 of He and containing an Asp 718 recognition site and a 5' CGC clamp: 5 , -CGCGGTACCATCAT(G/A)TA(G/A)TC(G/A)TT(G/A/C/T)GG-3'.
  • RNA from mouse secretor cell lines +/+ and LDA11 stimulated under a variety of conditions (LDA11, 45% McCoy's medium, 45% HL-1 medium, 10% PBS, 6 hrs; LDA11, HL-1 medium, 28 hrs; LDA11, HL-1 medium, 5.5 hrs; +/+, Opti-MEM medium 9 hrs), was used as separate templates for first strand cDNA synthesis.
  • a portion of first strand cDNA reactions was added to commercially available PCR reaction mixes containing the oligonucleotide primers. This mixture was subjected to 30 cycles of PCR amplification.
  • samples were purified and subjected to agarose gel electrophoresis. This yielded a 100 base pair DNA fragment that was excised from gel lanes from four separate reactions involving +/+ cells and LDA11 cells.
  • the 100 base pair DNA fragment was purified using an Elutip-D® column (Schleicher & Schuell, Keene, NH), cloned into pBluescript® SK (Stratagene, La Jolla, CA) and used for dideoxy DNA sequencing.
  • Isolate 4 contained sequence information for the coding region minus the last four amino acids of the C terminus.
  • Isolate 10 contained the entire coding region for the mouse polypeptide and is illustrated in Figure 2.
  • Isolate 94 has a 16 amino acid deletion in the extracellular domain compared to isolates 4 and 10.
  • MGF is the ligand for c-kit
  • murine MGF purified as described in Example 1 was bound to cells expressing c-kit.
  • the resulting c-kitfMGF complexes were covalently cross-linked and immunoprecipitated using antibody specific for c- kit. Radioactivity was recovered in the immunoprecipitated fracjdon.
  • Radiolabeled purified mouse MGF was added to MC6 (responder cell line expressing c-kit as described herein) and 32D cells (non-responder cell line that does not express c-kit) with and without excess unlabeled MGF.
  • MGF was cross-linked to its specific cell surface receptor by the cross-linking agent BS3.
  • Cell lysates were immunoprecipitated with the specific antisera described above, which recognize the C-terminal portion of c-kit, then separated on an SDS-PAGE gel and subjected to autoradiography.
  • Cross-linked receptor- ligand complexes were specifically immunoprecipitated by anti-c-kit antisera only from MC6 cell lysates incubated in the absence of cold-competitor and had an approximate molecular weight of 175-180 kDa as determined by an autoradiogram of cross-linked receptor (c-kit) ligand (in MGF) complexes (See Figure 6). Preimmune sera did not immunoprecipitate this complex and binding in the presence of excess unlabeled MGF provided ro cross-linked complexes detectable in autoradiography. No evidence of MGF binding to 32D cells was seen.
  • the suggested molecular weight of the ligand is from about 30 kDa to about 35 kDa.
  • a probe was prepared from a cDNA insert of MGF isolate 10 (an approximately 2 kb Sail fragment) by random prime labeling with ⁇ -32p-dCTP to a specific activity of greater than
  • the probe was hybridized to human RNAs on.Northem blots in buffer (50% formamide, 0.8 M NaCl, 0.02 M PIPES pH 6.4, 2 mM EDTA, 0.5% sodium dodecyl sulfate (SDS), 100 ⁇ g/ml salmon sperm DNA and 5 x 10 ⁇ dpm/ml of labelled DNA) at approximately 42 * C for greater than 20 hours. Hybridization was followed by extensive washing in 1 X SSC (15 mM trisodium citrate, 165 mM NaCl), 0.1% SDS at approximately 55'C.
  • 1 X SSC 15 mM trisodium citrate, 165 mM NaCl
  • MGF- 10 probe in cross hybridization in a buffer containing 40% formamide with hybridization conditions as described in this example at approximately 37°C followed by extensive washes in 1 x SSC, 0.1% SDS at approximately 55"C to screen a PBL library.
  • MGF-positive human clones from this library.
  • cDNAs contain only a portion of the 3' MGF coding region, based on a comparison with mMGF.
  • Full length hMGF coding cDNAs were isolated by polymerase chainreaction (PCR) amplification of hMGF cDNAs from HeLa mRNA using oligonucleotide primers designed to specifically amplify hMGF coding cDNAs.
  • the partial cDNA sequence derived from the PBL library clone was used to design a 3' non-coding region oligonucleotide primer (5'-AATGTTACCAGCCAATGTACG-3') which is complementary to sequences located 30 bp downstream of the end of translation in the hMGF cDNAs (nucleotides 878-898 of hMGF-2.4, Figure 3).
  • the 5' non-coding oligonucleotide primer (5'- GGGCTGGATCGCAGCGC-3') was derived from the mMGF 5' non-coding region (nucleotides 122-138 of MGF-10, Figure 1).
  • oligonucleotides were used to amplify hMGF cDNAs from HeLa in a reaction buffer containing 50 mM KC1, 10 mM Tris pH 8.3, 0.01% gelatin,1.5 mM MgCl2200 ⁇ M dNTPs, 1 ⁇ M each oligonucleotide primer, 2.5 units Taq polymerase, and approximately 20 ng first strand HeLa cDNA. Reactions were performed on an Ericomp TwinBlock ® temperature cycler (Ericomp, San Diego, CA) for 35 cycles of 94 * C for 30 seconds, 45 * C for 45 seconds and 72 °C for 60 seconds, followed by an additional 5 minutes of extension at 72 °C.
  • Ericomp TwinBlock ® temperature cycler Ericomp, San Diego, CA
  • Isolate hMGF-2.4 corresponds to the most abundant cDNA from the PCR amplification.
  • Isolate hMGF-2D corresponds the the next most abundant cDNA.
  • DNA probes can also be prepared by nick translation of mouse MGF cDNA by polymerase chain reaction (PCR) amplification using MGF-specific primers and radiolabeled d NTPs, and by preparation of radiolabeled cDNA using synthetic MGF RNA as a template.
  • the DNA probes can be hybridized in hybridization solutions containing 50% or less formamide at temperatures ranging from 37°C to 50°C, followed by washes at 50°C or above in 2 X SSC or less.
  • This example illustrates the expression of full length murine MGF in COS cells (derived from African Green Monkey kidney cells).
  • Isolate 10 and isolate 4 were transfected into COS cells using standard techniques, such as those described in Cosman et al. Nature 372:768 (1984).
  • the transfected COS cells were seeded into 96 well plates.
  • Responder cells e.g., MC6 cells
  • Tritiated thymidine was added to the wells at a concentration of 0.5 ⁇ Ci/well.
  • COS cells transfected with HA VEo empty vector were incubated in parallel as a control.
  • a positive control (not shown) consisted of COS cells transfected with HA VEo engineered to express a murine IL-4 cDNA.
  • the MC6 responder cell line also proliferates in the presence of LL-4.
  • Proliferative activity significantly increased (p ⁇ 0.001) in the presence of MGF when compared to empty vector controls.
  • clone 4 induced proliferative activity in MC6 cells of about 28,000 cpm compared to about 13,000 for an empty vector control.
  • Both clones 10 and 4 provided mMGF polypeptides with about 13,000 cpm compared to about 4,000 for empty vector control.
  • COS-7 cells were transfected with either the vector containing the truncated cDNA, with vector containing a murine interieukin-4 cDNA (pDC402/mIL-4), or with vector lacking an insert.
  • the transfected COS cells were metabolically labeled with 35s-methionine and 35s-cysteine.
  • Supematants were analyzed by SDS-PAGE for size determination of the secreted polypeptide and found a 33 kDa protein (Extracellular region plus glycosylation). Supematants were also tested for MGF biological activity using the MC6 proliferation assay described herein. The secreted extracellular portion of murine MGF was found to possess MGF biological activity.
  • AATGTTTACCTTTGGATAAAAGAGACTACAAGGACGACGATGACAAGAAGGAGAT CTGCGGGAATCCTGTG-3' encoded an alpha factor leader and an antigenic octapeptide (FLAG ® ), Hopp et al. Bio/Technology 6:1204 (1988) fused in-frame with the mature N- terminus of MGF.
  • FLAG ® antigenic octapeptide
  • ATATGGATCCCTAGTC ⁇ TCAGGGGCCT ⁇ GCGGC ⁇ TT-3' created a termination codon following Asp-185 ( Figure 2), just upstream from the transmembrane region.
  • This DNA fragment was PCR-generated and ligated into a yeast expression vector that directs secretion of the recombinant product into yeast medium (Price et al. Gene 55:287 (1987). There was one alteration in the sequence of the PCR-generated DNA, which converted asparagine 169 to serine, eliminating one of the four potential sites for N-linked glycosylation.
  • the resulting murine MGF fusion protein was purified from yeast broth by affinity chromatography using procedures described in Hopp et al., supra.
  • Biological activity of recombinant yeast-made MGF and purified murine MGF was compared in the MC6 proliferation assay. Both recombinant MGF and purified murine MGF stimulated proliferation of MC6 cells in a dose-response fashion. There was some reduction of thymidine incorporation seen at the highest concentration of recombinant MGF, but this may have been due to the presence on non-specific inhibitors of cellular proliferation in the yeast broth. When the yeast broth was purified, the maximum thymidine incorporation by MC6 cells was identical to that observed with natural murine MGF. These data were repeated with murine MGF-responsive cell lines H7 and FDC-P2-1D instead of MC6 cells. Again, the pattern of responsiveness to the recombinant yeast-derived fusion protein was identical to that derived from the purified murine natural MGF polypeptide.
  • This example describes yeast expression of human full length extracellular domain MGF and ⁇ 28 hMGF, which lacks a 28 amino acid sequence in the extracellular domain.
  • pLXY-528 and pLXY-490 Two yeast expression constructs, pLXY-528 and pLXY-490. Both constructs were made by inserting a human MGF cDNA into a pLXY-120 vector comprising a ADH2 promoter sequence, an ⁇ -factor leader sequence, and a FLAG® octapeptide sequence for purification.
  • pLXY-528 encoded a FLAG ® full length human MGF extracellular domain
  • pIXY- 490 encoded a FLAG® ⁇ 28 human MGF extracellular domain.
  • Yeast Sacharomyces cerevisiae
  • host strains XV2181 and YNN281 were transformed with pLXY-528 or pLXY- 490.
  • Material made from pIXY-528 showed a high degree of hyperglycosylation and a lower level of protein expression than the material made from pIXY-490.
  • a controlled experiment was conducted utilizing host strain XV2181 and an ELISA assay for total MGF expression in yeast supematants. The yeast were grown to the same optical density and supematants were purified.
  • pD Y-528 produced approximately 50 mg/liter of human MGF whereas pIXY-490, grown under identical conditions with the same expression vector in the same yeast host strain, produced five times more protein, or about 250 mg/1. Further examination of the material produced by pLXY-490 shows virtually no hyperglycosylation judging by two bands visible on a FLAG Western blot. The material produced by pIXY-528 was hyperglycosylated with at least five bands visible on a FLAG Western blot.
  • Full length human MGF has five potential N-linked glycosylation sites, whereas ⁇ 28 human MGF has four. Further, multiple serine residues have been removed from the ⁇ 28 version. It is believed that the series of serine residues function as O-linked glycosylation sites. Removal of the fifth N-linked glycosylation site and serine-rich domain in the ⁇ 28 version of human MGF, surprisingly, resulted in reduced glycosylation, greater MGF biological activity, and approximately five times greater amounts of protein expression when grown under identical conditions.
  • MGF is the ligand for c-kit.
  • the experiment described in Example 3 was repeated, except, the c-kit clone was transfected into COS cells (along with an empty vector control) and the transfected COS cells were used instead of MC6 responder cells.
  • the procedures described in Example 3 were followed.
  • CFU-GM granulocyte-macrophage colony- and cluster- forming cells
  • bone marrow cells were suspended in 0.5 ml of 0.3% agar (Difco, Detroit MI) or 0.4% agarose (FMC, Rockland, ME) culture medium containing McCoy's 5A medium supplemented with essential and nonessential amino acids, glutamine, serine, asparagine, and sodium pyruvate (Gibco) with 20% fetal bovine serum.
  • Quadruplicate cultures were incubated for seven days in a fully humidified atmosphere of 5% CO2 in air. Colonies (> 50 cells) and clusters (3-49 cells) were counted with an inverted microscope at 32 X.
  • erythroid burst-forming units BFU-E
  • CFU-GEMM multipotential colony- forming cells
  • BFU-E and CFU-GEMM were scored using an inverted stage microscope at 80 X on the basis of hemoglobinization of erythroid elements, producing a characteristic red color, and the absence or presence of myeloid elements for the former and latter, respectively.
  • MGF stimulates erythroid and primitive mixed colony formation.
  • CFU-GM activity of MGF and GM-CSF compared CFU-GM activity of MGF and GM-CSF versus no cytokine control.
  • MGF had significant CFU-GM stimulatory activity (more than GM-CSF) with a stimulation index over background above 50.
  • BFU-E and CFU-GEMM activities of MGF increase with increasing doses of MGF. This is in contrast to EPO (erythropoietin) whose BFU-E activity remains constant across the dose range.
  • EXAMPLE 9 MGF PLUS IL-3 SYNERGISTICALLY STIMULATES PRIMITIVE STEM
  • Sorted hematopoietic stem cells can be further sorted for metabolic activity.
  • a mitochondrial stain rhodamine 123 stains mitochondria and allows sorting of "bright" cells that are metabolically active and "dull" cells that are not metabolically active.
  • the sorting procedure leading to bright and dull cells is a modification of the procedure described in Visser et al. Blood Cells 14:369 (1988). Briefly, a low density ( ⁇ 1.055 g/c ⁇ r.3) bone marrow cell fraction from untreated animals (e.g., mice) is isolated by spinning the cells over a discontinuous density gradient of metrizamide. During centrifugation, the cells are stained with WGA/Tx Red.
  • the WGA/Tx Red stained low density cells are next stained with 15-1.4.1/FITC.
  • Stem cells are selected on a cell sorter by detecting for Tx Red + cells, setting a FLS window on the WGA + cells to exclude the smallest and largest cells and cell aggregates, selecting cells having the lowest SSC when looking at the SSC intensity distribution of the cells in the TxR/FLS window, and selecting for negative cells when looking at the 15-1.4.1 (HTC) fluorescence distribution of cells in the Tx Red/FLS/SSC window.
  • HTC 15-1.4.1
  • the cells are again sorted in the same FLS and SSC windows as before on the basis of their Rhl23 distribution into Rhl23 dull and Rhl23 bright fractions.
  • Dull cells have marrow repopulating activity and brights do not.
  • Bright cells contain most of the in vitro colony forming cells.
  • GROWTH FACTOR DULL BRIGHT Medium control 668 (139) 380 (87) mMGF (33 U/ml) 2569 (874) 5166 (748) mLL-3 (100 ng/ml) 9371 (770) 34472 (13226) IL-3 + MGF 35132 (3098) 91112 (33475)
  • mice are lethally irradiated to wipe out bone marrow cells. Cells (i.e., dulls or brights) are injected into each irradiated mouse. After 14 days, the mice are sacrificed and the spleens are examined and counted for macroscopic colonies on the surface of the spleen.
  • Each colony is derived from a single primitive hematopoietic colony-forming cell (CFU-S).
  • CFU-S hematopoietic colony-forming cell
  • the injected primitive cells were either control (freshly isolated), or treated for three or seven days with mMGF, mIL-3, or the combination of mMGF and mLL-3.
  • the concentrations of mMGF (50 U/ml) and mIL-3 (250 ng/ml) were plateau amounts in colony assays and proliferation assays.
  • a Unit (U) of murine MGF is the amount of mMGF that stimulates half maximal tritiated thymidine incorporation by the MC6 cell line.
  • the combination of MGF and BL-3 provides a synergistic effect to cause activation and proliferation of the most primitive population of stem cells.
  • MGF and LL-3 preferably conspecific MGF and IL-3, is useful for treating anemias and other forms of bone marrow failure that require activation and proliferation of the most primitive stem cell populations. This combination will be most effective for treating aplastic anemia, bone marrow transplantation, and reduced hematopoietic counts caused by any reason.
  • MGF has demonstrated proliferative activity in a population of the most primitive stem cells, it will be effective in combination with another one or combination of hematopoietic factors have have proliferative activity for more developed cells in the hematopoietic system, these other hematopoietic factors include, for example, GM-CSF, G-CSF, IL-3, EPO, LL-l ⁇ , LL-l ⁇ , LL- 7, LLF, IL-6 and combinations thereof.
  • Preparations of hMGF are used to generate monoclonal antibodies against hMGF using conventional techniques.
  • sources of hMGF for use as an immunogen include, for example, purified recombinant MGF, human MGF, or transfected COS cells expressing high amounts of MGF as described in Example 5 herein.
  • An example of a convention technique to generate monoclonal antibodies is described in United States Patent 4,411,993. Monoclonal antibodies generated by these techniques are likely to be useful in establishing convenient assays for MGF, or for blocking the effects of MGF in vitro or in vivo.
  • mice are immunized with an MGF immunogen emulsified in complete Freund's adjuvant and injected subcutaneously into Balb/c mice at amounts ranging from 10-100 ⁇ g. Ten to twelve days later the immunized animals are boosted with additional immunogen emulsified in incomplete Freund's adjuvant. The animals are periodically boosted on a weekly or biweekly immunization schedule. Serum samples are taken periodically for assay of antibody titer, such as by dot-blot or ELIS A (enzyme-linked immunosorbent assay). Serum samples may be obtained by retro-orbital bleeding or by tail-tip excision.
  • the positive animals a injected intravenously with MGF in saline. Three or four days after the saline injection, the animals are sacrificed and spleens harvested to splenocytes.
  • Splenocytes are fused to a murine myeloma cell line, such as NS1 to generate hybridoma cell lines.
  • the hybridoma cell lines are plated in multiple microtiter plates in a HAT (hypoxanthine, aminopterin and thymidine) selective medium to inhibit proliferation of non- fused cells, myeloma hybrids and spleen cell hybrids.
  • HAT hypoxanthine, aminopterin and thymidine
  • An ELISA techniques can be used to screen for positive hybridoma clones by assaying for reactivity with MGF. Such techniques are described, for example, in Engvall et al. Immunochemistry 8:871 1971 and in United States Patent 4,703,004.
  • Anti-MGF monoclonal antibodies are made, for example, in mouse ascites by injecting positive hybridoma clones into peritoneal cavities of syngeneic Balb/c mice. The ascites fluid is purified by standard techniques, such as ammonium sulfate precipitation followed by gel exclusion chromatography, or by affinity chromatography by binding the monoclonal antibody to Protein A (Staphylococcus aureus).
  • a cDNA encoding mMGF is prepared and inserted into C127 cells (ATCC No. CRL 1616) as described in Dower et al. J. Immunol. 142:4314-20 1989. Briefly, this procedure adds the entire bovine papilloma virus genome linearized at a Bam HI site to pDC201 containing mMGF cDNA to form a plasmid BX8.
  • BX8 is transfected into C127 cells along with plasmid PSV2 Neo at a ratio of 10: 1 (BX8 to PSV2 Neo). Transformed cells expressing mMGF are selected.
  • Approximately 10 ⁇ selected transformed C127 cells are used to immunize each Lewis rat. Immunization is by intraperitoneal injection three times at three week intervals. Antibody titer is determined by an appropriate assay. Once an appropriate antibody titer is achieved, the rat is boosted by approximately 2 x 10 ⁇ selected transformed C127 cells and sacrificed three days later. Spleen cells are harvested from the rat and fused with mouse myeloma cells (NS-1, ATCC No. TLB 18) at a 4:1 ratio with 50% polyethylene glycol (PEG MW 1500, EM Reagents, Stuttgard, Germany) using standard fusion procedures. Spleen cells are harvested from the rat and fused with mouse myeloma cells (NS-1, ATCC No. TIB 18) at a 4:1 ratio with 50% polyethylene glycol (PEG MW 1500, EM Reagents, Stuttgard, Germany) using standard fusion procedures. The fused cells are called hybridoma cells.
  • Hybridoma cells are seeded into well plates at a density of 2 x 10 ⁇ cells per well in a volume of 200 ⁇ l media. Hybridoma cells are screened for monoclonal antibody production to MGF by an assay procedure, such as an ELISA assay.
  • VACCINIA BEARING MGF cDNA containing the entire coding region of MGF or the extracellular region of MGF is prepared as described herein.
  • the cDNA is inserted into the Smal site of vaccinia virus (W) plasmid expression vector pSCl 1 (available by license from the U.S. Dept of Commerce, National Technical Information Service, 5285 Port Royal Rd, Springfield, VA 22161) utilizing a known methods, such as one described in Chakrabaiti et al. Mol. Cell Biol. 5:3403-09 1985.
  • W vaccinia virus
  • pSCl 1 available by license from the U.S. Dept of Commerce, National Technical Information Service, 5285 Port Royal Rd, Springfield, VA 22161
  • Transformed W are visualized by blue plaques.
  • VV from blue plaques are selected and used to infect a host cell, such as CV-1 (ATCC CCL 70) or HeLa (ATCC CCL 2).
  • Infected cells are tested for expression of MGF.
  • Recombinant VV from a positive plaque was purified using conventional techniques, such as those described in Chakrabaiti, et al. supra and Elango et al. Proc. Natl. Acad. Sci. USA 83:1906-10 1986.
  • Lewis rats are immunized by intradermal injection with approximately 10 ⁇ plaque forming units (pfu) of recombinant MGF VV. After two weeks, immunized rats are boosted with approximately 10 ⁇ primary rat fibroblasts infected with recombinant MGF W (greater than 5 pfu per cell). After another two weeks, the rats are boosted with approximately 2 x 10 ⁇ Ci27 cells that express MGF. Three days later the rats are sacrificed and its spleen cells recovered. The spleen cells are fused with P3X63-Ag8.653 mouse myeloma cells as described in Examples 10 and 11. Positive hybridoma clones are selected by an assay, such as an ELISA assay.
  • an assay such as an ELISA assay.
  • An ELISA assay for screening cells for MGF secretion is conducted by seeding cells into a well plate at a concentration of 4 x 10 ⁇ cells per well in a 200 ⁇ l/well volume. This involves preparing a suspension of 2 x 10 ⁇ cells/ml in media. Hybridoma supematants and diluted antisera controls are added to each cell for a 30 minute incubation at room temperature in the wells. Following incubation, the wells are washed and approximately 50 ⁇ l/well of antispecies-specific antisera (e.g., Goat anti-rat Peroxidase Bio Rad) are added (diluted 1:1000 in 5% fetal calf serum/PBS). The next incubation step is for approximately 30 minutes at room temperature.
  • antispecies-specific antisera e.g., Goat anti-rat Peroxidase Bio Rad
  • substrate solution for example 0-Phenylenediamine 1 mg/ml Zymed, hydrogen peroxide in citrate buffer or TMB substrate, Kirkegaard and Perry
  • substrate solution for example 0-Phenylenediamine 1 mg/ml Zymed, hydrogen peroxide in citrate buffer or TMB substrate, Kirkegaard and Perry
  • Positive wells are identified by development of color as determined by absorbance in excess of control wells.
  • the relative epitopes of isolated monoclonal antibodies to MGF are determined by a cross-blocking assay.
  • the assay determines is a particular monoclonal antibody inhibits binding of MGF to other specific antibodies. This assay is conducted by binding approximately 2 ml of specific antibody or hybridoma supernatant preincubated with radiolabeled (iodine) MGF (2000 cpm/ml) to a nitrocellulose sheet (Schleicher & Schuell Keene NH). The sheet is dried and then blocked for one hour in 3% BSA (bovine serum albumin) in PSA (phosphate buffered saline). The sheet is thoroughly washed with PBS and exposed to film. A diminished signal indicates inhibition of one antibody's binding by another.
  • BSA bovine serum albumin
  • PSA phosphate buffered saline
  • a sheet of nitrocellulose membrane (Schleicher & Schuell Keene NH) is marked into squares and approximately 25 ng of MGF is placed onto the membrane within each square. After the MGF is dried, the sheet is blocked with 3% BSA in PBS for one hour. After washing and drying the sheet, specific antibody in the form of hybridoma supernatant or antibody is placed onto the membrane for 30 minutes. Next, the membrane is washed and excess antibody removed by incubating with PBS. The membrane is next incubated with diluted labeled antisera which is species specific for the particular antibody.
  • the labeled antisera is a 1:2000 of goat anti-mouse antibody conjugated with, for example, a horse radish peroxidase.
  • the membrane is washed and color as an indicator is developed with a substrate for the label, such as 4-chloro-l-napthol with an oxidizing agent such as hydrogen peroxide. Positive tests show color and indicate the presence of an antibody specific for MGF coated onto the membrane. This assay is useful for screening of multiple hybridoma colonies. Radioimmunoprecipitation
  • This assay determines the presence of an immunoprecipitating antibody.
  • the assay is conducted by adding 50 ⁇ l of PBSTA (PBS containing 50 mg/ml BSA and 10 ⁇ l/ml Triton XlOO, 2 ⁇ l of rabbit anti-species specific antibody (i.e., rabbit anti-mouse IgG, IgM and IgA, specific antibody (such as 50 ⁇ l of hybridoma supernatant, or 2 ⁇ l serum, or 2 ⁇ l ascites fluid from a mouse innoculated with a hybridoma), 50 ⁇ l of 20% Protein A Sepharose solution (Sigma), and 25 ⁇ l of radioiodinated MGF (about 2000 cpm/ ⁇ l).
  • PBSTA PBS containing 50 mg/ml BSA and 10 ⁇ l/ml Triton XlOO
  • rabbit anti-species specific antibody i.e., rabbit anti-mouse IgG, IgM and IgA, specific antibody (

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

On décrit un polypeptide de facteur de croissance de mastocytes (MGF) de mammifère, des dérivés de ce polypeptide, des séquences d'ADN, des molécules d'ADN de recombinaison et des cellules hôtes transformées qui produisent des polypeptides de MGF. En particulier, cette invention présente des polypeptides de MGF de mammifère isolés et des dérivés qui régulent des changements précoces ayant lieu lors de la prolifération des cellules de souche. De plus, les polypeptides de MGF et leurs dérivés se lient à un produit d'expression de protéine d'un proto-oncogène de Kit-c et/ou stimulent la prolifération de mastocytes.
PCT/US1991/004274 1990-06-25 1991-06-14 Facteur de croissance de mastocytes WO1992000376A1 (fr)

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US54326490A 1990-06-25 1990-06-25
US543,264 1990-06-25
US56584090A 1990-08-10 1990-08-10
US565,840 1990-08-10
US57415290A 1990-08-28 1990-08-28
US574,152 1990-08-28
US58607390A 1990-09-21 1990-09-21
US586,073 1990-09-21
US71371591A 1991-06-12 1991-06-12
US713,715 1991-06-12

Publications (1)

Publication Number Publication Date
WO1992000376A1 true WO1992000376A1 (fr) 1992-01-09

Family

ID=27541870

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/004274 WO1992000376A1 (fr) 1990-06-25 1991-06-14 Facteur de croissance de mastocytes

Country Status (7)

Country Link
EP (1) EP0536317A1 (fr)
AU (1) AU8196891A (fr)
IE (1) IE912135A1 (fr)
IL (1) IL98549A0 (fr)
NZ (1) NZ238659A (fr)
WO (1) WO1992000376A1 (fr)
ZA (1) ZA914783B (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4224050A1 (de) * 1991-07-31 1993-02-04 Hoffmann La Roche Loesliche kit-liganden
EP0546054A1 (fr) * 1990-08-27 1993-06-16 Sloan-Kettering Institute For Cancer Research LIGAND POUR LE RECEPTEUR DE c-KIT ET SES PROCEDES D'UTILISATION
WO1993021936A1 (fr) * 1992-04-23 1993-11-11 Sloan-Kettering Institute For Cancer Research LIGAND POUR LE RECEPTEUR DE c-KIT ET PROCEDES D'UTILISATION
WO1995017206A1 (fr) * 1993-12-22 1995-06-29 Amgen Inc. Formulations lyophylisees du facteur des cellules souches
US5525708A (en) * 1994-03-28 1996-06-11 Cytomed, Inc. Covalent dimer of kit ligand
WO1997005251A2 (fr) * 1995-08-02 1997-02-13 Q-One Biotech Limited Cytokine slf feline
WO1997038101A1 (fr) * 1996-04-05 1997-10-16 Amgen Inc. Compositions d'analogues de scf et procedes associes
US5767074A (en) * 1990-08-27 1998-06-16 Sloan-Kettering Institute For Cancer Research Compositions of soluble C-kit ligand and hematopoietic factors
US6001803A (en) * 1992-04-23 1999-12-14 Sloan-Kettering Institute For Cancer Research Composition of c-kit ligand, GM-CSF, and TNF-α and method of use
US6399057B1 (en) * 1997-03-05 2002-06-04 Gho'st Holding B. V. Method for the propagation of hair
WO2004071523A1 (fr) * 2003-02-14 2004-08-26 Istituto Superiore Di Sanita Facteur des cellules souches dans la prevention de la depletion de cellules sanguines induite par la chimiotherapie
WO2006055260A2 (fr) 2004-11-05 2006-05-26 Northwestern University Utilisation de scf et de scf dans le traitement de l'ischemie cerebrale et des troubles neurologiques
JP2009544290A (ja) * 2006-07-24 2009-12-17 ザ・ユニバーシティ・オブ・クイーンズランド 細胞集団を産生する方法
CN116836227A (zh) * 2023-05-24 2023-10-03 艾一生命科技(广东)有限公司 一种合成多肽在维持干细胞干性中的应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110218176A1 (en) 2006-11-01 2011-09-08 Barbara Brooke Jennings-Spring Compounds, methods, and treatments for abnormal signaling pathways for prenatal and postnatal development

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0423980A1 (fr) * 1989-10-16 1991-04-24 Amgen Inc. Facteur de stimulation des cellules souches

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0423980A1 (fr) * 1989-10-16 1991-04-24 Amgen Inc. Facteur de stimulation des cellules souches

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CELL, Vol. 63, 5 October 1990, Cambridge, NA, US, ANDERSON D.M. et al., "Molecular Cloning of Mast Cell Growth Factor, a Hematopoietin That is Active in Both Membrane Bound and Soluble forms", pages 235-243. *
CELL, Vol. 63, 5 October 1990, Cambridge, NA, US, HUANG, E. et al., "The Hematopoietic Growth Factor KL is Encoded by the SI Locus and is the Ligand of the C-kit Receptor, the Gene Product of the W Locus", pages 225-233. *
CELL, Vol. 63, 5 October 1990, Cambridge, NA, US, MARTIN F.H. et al., "Primary Structure and Functional Expression of Rat and Human Stem Cell Factor DNAs", pages 203-211. *
CELL, Vol. 63, 5 October 1990, Cambridge, NA, US, ZSEBO K.M. et al., "Identification, Purification and Biological Characterization of Hematopoietic Stem Cell Factor from Buffalo Rat Liver-Conditioned Medium", pages 195-201. *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0546054A1 (fr) * 1990-08-27 1993-06-16 Sloan-Kettering Institute For Cancer Research LIGAND POUR LE RECEPTEUR DE c-KIT ET SES PROCEDES D'UTILISATION
US5767074A (en) * 1990-08-27 1998-06-16 Sloan-Kettering Institute For Cancer Research Compositions of soluble C-kit ligand and hematopoietic factors
EP0546054A4 (fr) * 1990-08-27 1994-04-27 Sloan Kettering Institute For Cancer Research
US6403559B1 (en) 1990-08-27 2002-06-11 Sloan-Kettering Institute For Cancer Research C-kit ligand-based method for expanding peripheral blood cell levels
DE4224050A1 (de) * 1991-07-31 1993-02-04 Hoffmann La Roche Loesliche kit-liganden
FR2679910A1 (fr) * 1991-07-31 1993-02-05 Hoffmann La Roche Ligands de kit solubles.
EP1127577A3 (fr) * 1992-04-23 2002-11-27 Sloan-Kettering Institute For Cancer Research Ligand pour le récepteur de c-kit et procédés d'utilisation
WO1993021936A1 (fr) * 1992-04-23 1993-11-11 Sloan-Kettering Institute For Cancer Research LIGAND POUR LE RECEPTEUR DE c-KIT ET PROCEDES D'UTILISATION
KR100313064B1 (ko) * 1992-04-23 2002-04-06 C-키트수용체의리간드및그의사용방법
US6001803A (en) * 1992-04-23 1999-12-14 Sloan-Kettering Institute For Cancer Research Composition of c-kit ligand, GM-CSF, and TNF-α and method of use
US6159461A (en) * 1992-04-23 2000-12-12 Sloan-Kettering Institute For Cancer Research Use of c-kit ligand with TNF-α and hematopoietic factors for the expansion or differentiation of hematopoietic cells
EP1127577A2 (fr) * 1992-04-23 2001-08-29 Sloan-Kettering Institute For Cancer Research Ligand pour le récepteur de c-kit et procédés d'utilisation
US6288030B1 (en) 1993-12-22 2001-09-11 Amgen Inc. Stem cell factor formulations and methods
WO1995017206A1 (fr) * 1993-12-22 1995-06-29 Amgen Inc. Formulations lyophylisees du facteur des cellules souches
US5965522A (en) * 1993-12-22 1999-10-12 Amgen Inc. Stem cell factor formulations and methods
US5525708A (en) * 1994-03-28 1996-06-11 Cytomed, Inc. Covalent dimer of kit ligand
WO1997005251A2 (fr) * 1995-08-02 1997-02-13 Q-One Biotech Limited Cytokine slf feline
WO1997005251A3 (fr) * 1995-08-02 1997-04-17 Q One Biotech Ltd Cytokine slf feline
US5885962A (en) * 1996-04-05 1999-03-23 Amgen Inc. Stem cell factor analog compositions and method
WO1997038101A1 (fr) * 1996-04-05 1997-10-16 Amgen Inc. Compositions d'analogues de scf et procedes associes
US6399057B1 (en) * 1997-03-05 2002-06-04 Gho'st Holding B. V. Method for the propagation of hair
WO2004071523A1 (fr) * 2003-02-14 2004-08-26 Istituto Superiore Di Sanita Facteur des cellules souches dans la prevention de la depletion de cellules sanguines induite par la chimiotherapie
US7994125B2 (en) 2003-02-14 2011-08-09 Istituto Superiore Di Sanita Stem cell factor for preventing chemotherapy-induced depletion of blood cells
WO2006055260A2 (fr) 2004-11-05 2006-05-26 Northwestern University Utilisation de scf et de scf dans le traitement de l'ischemie cerebrale et des troubles neurologiques
US8524655B2 (en) 2004-11-05 2013-09-03 Northwestern University Use of SCF and G-CSF in the treatment of cerebral ischemia and neurological disorders
JP2009544290A (ja) * 2006-07-24 2009-12-17 ザ・ユニバーシティ・オブ・クイーンズランド 細胞集団を産生する方法
CN116836227A (zh) * 2023-05-24 2023-10-03 艾一生命科技(广东)有限公司 一种合成多肽在维持干细胞干性中的应用
CN116836227B (zh) * 2023-05-24 2023-12-08 艾一生命科技(广东)有限公司 一种合成多肽在维持干细胞干性中的应用

Also Published As

Publication number Publication date
NZ238659A (en) 1992-09-25
EP0536317A1 (fr) 1993-04-14
IL98549A0 (en) 1992-07-15
AU8196891A (en) 1992-01-23
ZA914783B (en) 1992-03-25
IE912135A1 (en) 1992-01-01

Similar Documents

Publication Publication Date Title
Williams et al. Identification of a ligand for the c-kit proto-oncogene
Fukunaga et al. Growth and differentiation signals mediated by different regions in the cytoplasmic domain of granulocyte colony-stimulating factor receptor
CA2288218C (fr) Nouvel inhibiteur de differentiation
US5935565A (en) Method for increasing the level of stem cells in peripheral blood
AU716889B2 (en) Differentiation-suppressive polypeptide
AU657913B2 (en) Tissue-derived tumor growth inhibitors, methods of preparation and uses thereof
CA2295936C (fr) Proteine chimere du recepteur d'interleukine-6 soluble/ligand, analogues de celle-ci et applications
EP2107109B1 (fr) Facteur D recombinant de croissance de cellules vasculaires endotheliales
US5856110A (en) Method of using HRG2-α to stimulate P185HeR2
US20040147726A1 (en) Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
WO1992000376A1 (fr) Facteur de croissance de mastocytes
RU2180850C2 (ru) Фармацевтическая композиция, содержащая c-kit-лиганд и гемопоэтический фактор, способ повышения уровней стволовых клеток в периферической крови, антагонист c-kit-лиганда, антисмысловая молекула нуклеиновой кислоты, способ увеличения уровней клеток периферической крови ex-vivo
JPH11276168A (ja) ベクタ―
US5767074A (en) Compositions of soluble C-kit ligand and hematopoietic factors
US7537932B1 (en) Antibodies that bind purified mammalian FLT3 ligands
US6001803A (en) Composition of c-kit ligand, GM-CSF, and TNF-α and method of use
US20020137168A1 (en) Developmental tyrosine kinases and their ligands
AU751498B2 (en) flt3 ligand chimeric proteins
Bouscary et al. c-mpl Expression in hematologic disorders
JP3689111B2 (ja) インターロイキン１５
CZ346799A3 (cs) Chimérické proteiny jako flt3 ligandy
MXPA97004173A (en) Designated citoquina lce
JPH09234079A (ja) 単球の成熟分化因子
SK281486B6 (sk) Dna sekvencia, polypeptid majúci hematopoetickú biologickú vlastnosť, jeho použitie a farmaceutická kompozícia

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI JP KR NO

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1991913543

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1991913543

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1991913543

Country of ref document: EP