WO1990012098A2 - Methods and nucleic acid sequences for the expression of the cellulose synthase operon - Google Patents

Methods and nucleic acid sequences for the expression of the cellulose synthase operon Download PDF

Info

Publication number
WO1990012098A2
WO1990012098A2 PCT/US1990/001811 US9001811W WO9012098A2 WO 1990012098 A2 WO1990012098 A2 WO 1990012098A2 US 9001811 W US9001811 W US 9001811W WO 9012098 A2 WO9012098 A2 WO 9012098A2
Authority
WO
WIPO (PCT)
Prior art keywords
cellulose synthase
polynucleotide
cellulose
acetobacter
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1990/001811
Other languages
English (en)
French (fr)
Other versions
WO1990012098A3 (en
Inventor
Arie Ben-Bassat
Roger D. Calhoon
Anna Lisa Fear
David H. Gelfand
James H. Meade
Rony Tal
Hing Wong
Moshe Bensiman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Cetus Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cetus Corp filed Critical Cetus Corp
Priority to JP2-506168A priority Critical patent/JPH0773500B2/ja
Priority to DK90906539T priority patent/DK0471687T3/da
Priority to DE69031803T priority patent/DE69031803T2/de
Priority to EP90906539A priority patent/EP0471687B1/en
Publication of WO1990012098A2 publication Critical patent/WO1990012098A2/en
Publication of WO1990012098A3 publication Critical patent/WO1990012098A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • C12N9/1051Hexosyltransferases (2.4.1)
    • C12N9/1059Cellulose synthases (2.4.1.12; 2.4.1.29)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • C12N15/72Expression systems using regulatory sequences derived from the lac-operon
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/02Acetobacter

Definitions

  • the invention relates to the field of recombinant DNA techniques for the production of proteins. More specifically, this invention relates to the cloning of the bacterial cellulose synthase operon, the expression of this operon and methods of using this operon for the production of cellulose in recombinant microorganisms.
  • Cellulose is relied upon as the raw material for a number of useful products including paper products and wound dressings.
  • Cellulose may be obtained from plants and various microorganisms in culture, for example from the cellulose producing bacteria of the genus Acetobacter ⁇ Acetobacter is characteristically a Gram-negative, rod-shaped bacterium 0.6-0.8 u by 1.0-4 um. It is strictly aerobic; metabolism is respiratory, never fermentative. It is further distinguished by the ability to produce multiple poly ⁇ (l-4)-glucan chains, chemically identical to cellulose. Multiple cellulose chains or microfibrils are synthesized at the bacterial surface at sites on the cell wall. The production of cellulose by Acetobacter has been the subject of intense study since at least the 1930"s.
  • Acetobacter xylinum has been widely studied to attempt to elucidate the mechanism of cellulose synthesis in intact cells [Schramm and Hestrin,(1954) J. Gen. Microbiol. 11:123-129].
  • the enzymatic pathway for cellulose synthesis in Acetobacter xylinum has been investigated and essentially four enzymatic steps have been characterized in cell-free extracts of A. xylinum which appear to comprise the complete pathway from glucose to cellulose. These are the phosphorylation of glucose by glucokinase [Benziman, et al. , (1972) J. Bacteriol.
  • synthase activity may be rate limiting as cells in culture reach the stationary growth phase.
  • One improvement in cellulose production would be to remove a rate-limiting step in cellulose synthesis, thereby preventing the observed decline in cellulose specific productivity in culture.
  • the present invention provides an operon associated with the biosynthesis of cellulose, polynucleotides encoding one or more closely linked genes that code for proteins of bacterial cellulose synthase, expression vectors suitable for production of cellulose synthase, recombinant host cells transformed with these vectors, methods for producing bacterial cellulose synthase, and methods to increase the production of cellulose in a recombinant microorganism.
  • the invention provides an isolated native, cloned recombinant or synthetic polynucleotide encoding the bacterial cellulose synthase operon characterized by the polycistronic - 5 -
  • the cellulose synthase operon is approximately 9217 basepairs (bp) in length and comprises four genes, designated herein as "A”, "B", “C”, and "D”.
  • the invention further provides a process for expressing cellulose synthase in a host cell comprising transforming the host cell with a recombinant DNA expression vector comprising one or more of the genes associated with the bacterial cellulose synthase operon, which gene(s) is operably linked to a control sequence for expression of bacterial cellulose synthase, and culturing the transformed host cell under conditions suitable for expression of cellulose synthase.
  • the expression vector constructions of the present invention can either replicate independently or may be designed so as to introduce a heterologous promoter into the Acetobacter chromosome, thereby replacing the native cellulose synthase operon promoter.
  • Yet another aspect of the invention provides a method for increasing cellulose production in a recombinant microorganism, which method comprises transforming a suitable microorganism with a vector comprising at least one gene derived from the cellulose synthase operon, and culturing the transformed microorganism under conditions suitable for production of cellulose.
  • the chromosomal cellulose synthase promoter can be replaced with a heterologous promoter to overexpress the cellulose synthase operon at the chromosomal level.
  • a further aspect of the invention provides the individual proteins encoded by the cellulose synthase operon.
  • the isolated recombinant cellulose synthase B protein is capable of synthesizing ⁇ (l-4)-glucan polymers from uridine 5'-diphosphoglucose, whereas the - 6 -
  • protein encoded by gene A is capable of complementing cellulose negative Acetobacter cells defective in both cellulose synthase and diguanylate cyclase activities.
  • the protein encoded by either gene C or D is capable of synthesizing ⁇ (l-4)-glucan polymers from uridine 5'-diphosphoglucose and secreting the product from the cells in vivo when the respective protein is combined in appropriate proportions with the other three proteins of the cellulose synthase operon.
  • novel recombinant DNA vectors for the expression of heterologous genes in Acetobacter which vectors comprise a functional Acetobacter origin of replication-containing fragment of plasmid p824, and one or more DNA segments that convey resistance to at least one antibiotic when transformed into a sensitive host cell that is susceptible to transformation, cell division and culture.
  • These vectors may also be developed into shuttle vectors for use in cloning DNA in bacterial host cells, such as E. coli.
  • Figure 1 is the nucleic acid sequence and deduced amino acid sequence of the cellulose synthase operon.
  • the cellulose synthase operon is approximately 9217 bp in length and consists of four genes, a 2261 nucleotide sequence designated A (nucleotides 328-2589), a 2405 nucleotide sequence designated B (nucleotides 2594-4999), a 3956 nucleotide sequence designated C (nucleotides 5005 to 8961) and a 467 nucleotide sequence designated D (nucleotides 8964 to 9431.
  • the nucleotide sequences of each gene provided herein may include signal sequences.
  • the mature protein encoded by its respective gene may have undergone processing and if so, the corresponding gene sequence will be shorter than that provided above.
  • the alanine codon which corresponds to the first amino acid of the purified cellulose synthase B protein is flanked by two upward arrows, tt.
  • the site of transcription initiation is designated by a downward arrow, , positioned over the A at nucleotide 235.
  • the underlined nucleotide sequence following gene D designates the transcription terminator region comprising an inverted repeat sequence characteristic of stem-and-loop structures.
  • oligonucleotide MK170 is indicated above nucleotides 2190 to 2210, and that of MK172 is indicated above nucleotides 4564 to 4583.
  • Figure 2 depicts the construction of cosmid vector pKT230cos5.
  • FIG 3 is an illustration of the construction of TRT18-1 which contains the full-length cellulose synthase B gene.
  • Figure 4 is a restriction map of plasmid pUC18-824.
  • Figure 5 is a restriction map of the 8.3 kb Smal fragment and the 7.2 kb BamHI fragment from cosmid T5A1.
  • Figure 6 is a restriction and functional map of plasmid pUC18-824 FS6; pUC18-824 FSl is homologous to pUC18-824 FS6 except the orientation of the Smal restriction fragment carrying the cellulose synthase gene is reversed.
  • Figure 7 is a restriction and functional map of plasmid pUC19-824.
  • Figure 8 schematically illustrates the construc ⁇ tion of plasmid pABCD.
  • Figure 9 is a flow chart describing the construction of expression vectors containing - 8 -
  • heterologous promoters to transcribe the genes of the cellulose synthase operon.
  • cellulose synthase refers to one or more polypeptides associated in the in vivo biochemical conversion of uridine 5'-diphosphoglucose to bacterial cellulose and secretion outside of the cell.
  • a single transcriptional unit containing four genes associated with the synthesis of cellulose synthase is encoded by the nucleic acid sequence provided in Figure 1.
  • cellulose synthase gene is defined as a nucleic acid sequence encoding a polypeptide product associated with, the cellulose synthase operon. The term is not limited to any Acetobacter bacterial strain or species.
  • Cellulose synthase operon refers to a stretch of DNA sequence which codes for a group of protein products associated with cellulose synthesis and secretion outside of the cell.
  • the operon may include transcriptional elements such as a promoter region and a transcription terminator region which regulate the expression of the genes encoding the proteins.
  • Cellulose synthase activity is defined by the ability to synthesize cellulose [ ⁇ (l-4)-glucan] from UDP-glc. This activity is measured in vitro by incorporation of UDP-( 1 C) glucose to cellulose (base insoluble) and is measured as nmole (nanomole) of glucose incorporated to cellulose per min. - 9 -
  • Cellulose synthase specific activity is defined as nmole glucose incorporated to cellulose/ min/mg protein. Cellulose synthase specific activity in
  • Acetobacter cells is normally ranged from 0.2 to 4.0 nmole glc/min/mg cell protein.
  • Acetobacter refers to a genus of microorganisms, and in particular, to members of that genus which produce cellulose.
  • Suitable microorganism refers to a microorganism which is capable of producing cellulose when transformed with one or more of the genes associated with the cellulose synthase operon. Suitable microorganisms include those host cells which are capable of cellulose production in the absence of transformation, or those host cells which are deficient in one or more of the genes whose activity may be replaced by at least one gene of the cellulose synthase operon.
  • coding sequence "operably linked" to control sequences refers to a configuration wherein the coding sequences can be expressed under the control of these sequences.
  • control may be direct, that is, a single gene associated with a single promoter, or indirect, as in the case where a polycistronic transcript is expressed from a single promoter.
  • Control sequence refers to a DNA sequence or sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • the control sequences which are suitable for procaryotes, for example, include a promoter, optionally an operator sequence, a ribosome binding site, a transcription terminator, and possibly other as - 10 -
  • Eucaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Cells or “recombinant host cells” or “host cells” are often used interchangeably, and all such designation include progeny.
  • “transformants” or “transformed cells” includes the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. .Mutant progeny which have the same functionality as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
  • a polynucleotide "derived from” a designated sequence for example, the DNA from the cellulose synthase B gene, refers to a polynucleotide sequence which is comprised of a sequence of at least 6-20 nucleotides, more preferably at least 15 to 20 nucleotides corresponding, i.e., identical to or complementary to, a region of the designated nucleotide sequence.
  • the correspondence to the nucleic acid sequence will be approximately 70% or greater, will preferably be at least 80%, and even more preferably will be at least 90%.
  • the correspondence or non-correspondence of the derived sequence to other sequences can be determined by hybridization under the appropriate stringency conditions, using standard DNA hybridization technologies in liquid phases or on solid supports.
  • Hybridization techniques for determining the complementarity of nucleic acid sequences are known in the art (see, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second - 11 -
  • mismatches of duplex polynucleotides formed by hybridization can be determined by known techniques, including digestion with a nuclease such as SI, that specifically digests single-stranded sequences in duplex polynucleotides.
  • the derived polynucleotide is not necessarily physically derived from the nucleotide sequence shown, but may be generated in any manner, including for example, chemical synthesis, DNA replication or reverse transcription, which methods are based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived.
  • a polypeptide "derived from” a designated sequence refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a protein thereof wherein the portion consists of at least 5-10 amino acids, and more preferably at least 10-15 amino acids, which is immunologically identifiable with a polypeptide encoded in the sequence, or exhibits similar biological activity as that of the reference protein in the in vitro or In vivo assays described herein.
  • substantially correspondence refers to a sequence usually differing by fewer than 10 amino acids, more usually differing by fewer than 5 amino acids.
  • the recombinant protein displays substantially the same biological properties as the naturally occurring protein.
  • the biological properties include immunological properties, where antibodies raised to the authentic protein cross-react with the recombinant protein.
  • the term "recombinant polypeptide” as used herein to characterize a polypeptide useful for the production of cellulose synthase intends a polypeptide encoded by genomic, cDNA, semisynthetic, or synthetic nucleic acid sequences which, by virtue of their origin or manipulation: (1) are not associated with all or a portion of the polynucleotide with which they are associated in nature or in the form of a library; and/or (2) are linked to a polynucleotide other than that to which it is linked in nature.
  • “Expression system” refers to DNA sequences containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed with these sequences are capable of producing the encoded proteins.
  • the expression system may be included on a vector; however, the relevant DNA may also be integrated into the host chromosome.
  • “Sensitive host cell” refers to a host cell that cannot grow in the presence of a given antibiotic without a DNA segment containing a gene that confers resistance thereto.
  • vector refers to a polynucleotide suitable for transferring nucleic acid sequences into a host cell.
  • the term may include plas- mids, mini-chromosomes, phage, naked DNA and the like.
  • the polynucleotide encoding the bacterial cellulose synthase operon was obtained from an
  • Acetobacter DNA library as set forth in the examples, and genetic complementation was used to identify the genes.
  • the procedures for obtaining the nucleotide sequence encoding the bacterial cellulose synthase operon employ a number of individual steps that required adaptation for Acetobacter DNA, and include (1) preparation and characterization of cellulose negative (Cel ) mutant Acetobacter strains; (2) construction of appropriate vectors for cloning;
  • Confirmation of the cloned sequence may be performed by comparing the N-terminal amino acid sequence of the recombinantly produced bacterial cellulose synthase with that purified from a native Acetobacter source.
  • the amino acid sequence deduced from the cloned nucleotide sequence may be compared with the primary sequence of a protein obtained from a native Acetobacter source and purified. Attempts to clone the gene encoding cellulose synthase were initially directed at the identification of the B gene. While the cellulose synthase B gene has been cloned and sequenced, the interpretation of the 5' end of this gene was complicated for a variety of reasons.
  • the transcriptional and translational signals in Acetobacter are not characterized and control signals similar or analogous to those known for E. coli control signals were not present in the upstream region of the codon for alanine (the N-terminal residue of the purified native protein).
  • the proximity of an open reading frame upstream of this gene suggested that this gene was part of a polycistronic mess-age. Therefore, additional studies to sequence the open reading frames both upstream and downstream of this gene were performed as described herein. These studies revealed the identity of four closely linked genes bounded at the 5' end by a single promoter and at the 3' end by a transcription terminator region.
  • Genes A, C and D may code for regulatory, structural, membrane bound or processing proteins required in cellulose synthesis in vivo.
  • the availability of coding sequences for their respective gene product permits the synthesis of large amounts of each protein for studies to further elucidate the mechanism of cellulose synthesis.
  • the polynucleotide encoding the cellulose synthase operon may be cloned into an appropriate vector, transformed into a suitable microorganism host and cultured under conditions which permit the expression of cellulose synthase.
  • each gene may be independently cloned and expressed to produce the desired gene product.
  • Transcription of the polynucleotide sequences encoding the cellulose synthase operon gene products may be performed using the endogenous Acetobacter promoter or, alternatively, may be driven by heterologous bacterial promoters, including those derived from E. coli or B. subtilis.
  • heterologous bacterial promoters including those derived from E. coli or B. subtilis.
  • Many of the heterologous promoters described herein, such as the lac, trp and- tac are regulated promoters and are therefore useful in the method of the invention to control the expression of the bacterial cellulose synthase operon.
  • promoters such as the PL promoters, which are regulated by temperature sensitive repressors, i.e., nonfunctional beyond 37 ⁇ C would not be operable in many Acetobacter strains since these strains are normally cultured at 35°C or lower and would not grow beyond this temperature range.
  • Regulation of the heterologous promoters may utilize either positive or negative control elements.
  • a gene encoding a repressor which recognizes an operator associated with a heterologous promoter e.g., the lad repressor
  • the level of tryptophan present in growth media can provide for regulation of the trp promoter.
  • Yet another means to control expression of the cellulose synthase operon may employ a heterologous transcription terminator to stabilize the mRNA transcript.
  • the transcriptional terminator isolated from the crystal protein of B. thuringienesis has been shown to increase the expression level of many proteins in E. coli -and in B. subtilis by stabilizing their mRNAs.
  • this terminator may be used to increase the mRNA level from the cellulose synthase operon in Acetobacter. It is expected that the increased mRNA levels will enhance cellulose synthesis in the recombinant Acetobacter strains.
  • the resulting constructions may be inserted into a suitable, cellulose-producing microorganism and either replicated independently using an appropriate expression vector or, if plasmid instability is thought to be a problem, the promoter-gene construct may be integrated directly into the chromosome of the host microorganism.
  • the cellulose-producing host microorganism may be either a cellulose synthase negative strain or a cellulose synthase positive strain.
  • one or more of the genes of the cellulose synthase operon will restore the cellulose producing ability of the host microorganism. It is expected in the latter example that the introduction of the recombinant cellulose synthase operon will increase both the cellulose synthase activity and cellulose production of the recombinant strain.
  • Chromosomal promoter replacement avoids any potential problems which may be due to plasmid instability. It also removes the need for an antibiotic to maintain plasmid selection. Lastly, chromosomal promoter replacement removes the control of the operon from Acetobacter, allowing for a stronger, constitutive promoter or providing for control using a regulated promoter.
  • the nucleotide sequence encoding the genes of the bacterial cellulose synthase operon of the invention may be expressed in a variety of procaryotic systems, including E. coli, Strepto yces, Acetobacter, Aqrobacteria, Rhizobium, Pseudomonas, Alcaligenes, Zymomonas, Zooqloea, blue-green algae, and Sarcina ventricculi, with E. coli and Acetobacter being preferred.
  • vectors suitable for the expression of cellulose synthase are known in the art and may include hybrid shuttle vectors for the development of host-vector systems for acetic acid bacteria, such as Acetobacter. Fukaya, et al., (1985) Aqric. Biol. Chem. 49:2083-2090, describe several shuttle vectors of relatively small size, with selectable antibiotic gene markers, and capable of replicating in E. coli and Acetobacter ⁇ Fukaya, et al., (1989) App. Env. Microbiol. 55:171-176, describe a shuttle vector for E. coli and Acetobacter species, pmv24, which allows translation of a cloned sequence as a fusion protein with ⁇ -galactosidase. - 18 -
  • the present invention also provides an endogenous Acetobacter vector for use in the cloning and expression of the cellulose synthase genes.
  • This vector called p824, is small, and lacks the large mobilization region present on the pKT230cos5 conjugation vector described herein.
  • the small size of p824 makes it easier to manipulate as a cloning vector. Analysis of the insert DNA in this vector should also be greatly facilitated due to its small size.
  • the p824 vector can be used to directly clone genes from one Acetobacter host to another, thereby eliminating the host restriction barrier and associated rearrangements/deletions that occur during conjugation of pKT230cos5 cosmids from E. coli to Acetobacter.
  • the endogenous plasmid may be used for direct Acetobacter-Acetobacter transfer and may also be used to develop shuttle vectors.
  • the present invention also provides both cloning and expression vectors (for E. coli and Acetobacter species), using appropriate control sequences which allow direct transcription and translation of a desired sequence using, for example, the E. coli lac promoter and its translational initiation signal. Transformation of Acetobacter with these vectors results in transformation efficiencies useful for various types of cloning and expression experiments.
  • Purification of the recombinant cellulose synthase is accomplished using procedures similar to those used to recover the native material. Generally the cultured cells are disrupted using mechanical or enzymatic means, for example using a French Press, sonication or treatment with lysozyme and EDTA, and then collected by centrifugation to recover the pellet containing the cellulose synthase activity.
  • the pellet is resuspended and centrifuged to remove soluble protein and the collected pellet is solubilized with detergent, for example, with digitonin or Triton X-100 with 20% glycerol.
  • detergent for example, with digitonin or Triton X-100 with 20% glycerol.
  • the enzyme is entrapped using cellulose, its own insoluble product, to separate the enzyme from other detergent-solubilized proteins.
  • the entrapped enzyme may than be recovered from the cellulose by digestion of the cellulose with pure cellulase.
  • Procaryotes most frequently are represented by various strains of E. coli. However, other microbial strains may also be used, such as bacilli, for example, Bacillus subtilis, various species of Acetobacter, Pseudomonas and Streptomyces. In such procaryotic systems, vectors which contain replication sites and control sequences derived from a species compatible with the host are used. For example, E. coli may be transformed using derivatives of a vector such as pKT230, available from the American Type Culture Collection (ATCC), Rockville, MD (ATCC. No.
  • Plasmid pKT230 has a broad host range origin of replication, an E. coli origin of replication, tra genes necessary for conjugation, and a streptomycin resistance marker. Plasmid pBR322 contains genes for ampicillin and tetracycline resistance, and thus provides additional markers which can be either retained or destroyed in constructing the desired vector.
  • procaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang, et al., (1977) Nature 198:1056), the tryptophan (trp) promoter system (Goeddel, et al., (1980) Nucleic Acids. Res. ' 8:4057), the hybrid tac promoter (De Boer, et al., (1983) Proc. Natl. Acad. Sci.
  • promoters as the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang, et al., (1977) Nature 198:1056), the tryptophan (trp) promoter system (Goeddel, et al., (1980) Nucleic Acids. Res
  • U.S. Patent No. 4,711,845, issued 8 December 1987 describes this portable control sequence which comprises the first DNA sequence that is the P promoter operably linked to a second DNA sequence corresponding to the NRBS upstream of a third DNA sequence having at least one restriction site that permits cleavage within six base pairs 3' to the N RBS sequence.
  • U.S. Patent No. 4,666,848, issued 19 May 1987 discloses additional vectors with enhanced expression capabilities useful to express bacterial cellulose synthase.
  • Conjugation is a technique useful for transferring foreign DNA into a targeted host cell.
  • the cosmid vectors constructed in the present invention are not easily transferred from E. coli for replication in a different bacterial host such as Acetobacter ⁇
  • a helper plasmid such as pRK2013 (Figurski and Helinski, (1979) Proc. Natl. Acad. Sci. USA 76:1648-1652) may be used to assist in transferring the cosmid vector containing the desired DNA insert from the donor cells into the recipient cells.
  • donor, mobilizing and recipient cells are mixed and mated on plates. Cells which acquire the donor are selected for by growth on plates containing antibiotic to which the transformed recipient cells are resistant. Miller, supra, also discloses a conjugation procedure where nutritional markers are used to select recipient cells.
  • Another conjugation procedure suitable for mass screening is the "multiple spot conjugation method" set forth in detail in Example V, infra. B. Transformations
  • transformation is done using standard chemical techniques appropriate to such cells or may employ electroporation.
  • the calcium treatment employing calcium chloride as described by, for example, Cohen, S.N., (1972) Proc. Natl. Acad. Sci. USA 69:2110, is used for procaryotes or other cells which contain substantial cell wall barriers.
  • the optimal field force for the Acetobacter strains used in the present invention varies between 9 and 9.5 KV.
  • the level of transformation obtained (approximately 10 7 transformants/ug) is about 10 -fold higher than that obtained by chemical treatment (Fukaya, et al., (1985) Acrri.' Biol. Chem. 49:2091-2097) .
  • a DNA library is prepared from Acetobacter by isolating nucleic acid from Acetobacter cells and degrading the RNA in the sample.
  • the recovered DNA is partially digested with an appropriate restriction enzyme such as Sau3A and the DNA is subsequently size fractionated, for example, using a sucrose gradient.
  • a fraction containing a selected size range of molecules is ligated into a cosmid vector, and then conventionally packaged into lambda phage particles.
  • the phage particles are then used to infect a suitable host, such as E. coli.
  • a random number of isolates may be selected to isolate the cosmid DNA to determine the sizes*of the inserted DNA and thereafter, a number of clones sufficient to be representative of the genome are picked, grown and screened.
  • Plasmids containing the desired coding and control sequences employ standard ligation and restriction enzyme techniques which are well understood in the art. Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired. Site-specific DNA cleavage is performed by treating the DNA with the suitable restriction endonuclease(s) under conditions which are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g., New England Biolabs, Product Catalog (New England Biolabs, Beverly, MA). In general, about 1 ug of DNA is cleaved by one unit of enzyme, in about 20 ul of buffer solution.
  • restriction enzyme is typically used to insure complete digestion of the DNA substrate; however, it may be desirable to carry out partial digestions in which some but not all of the sites of a given restriction enzyme in the DNA are cleaved. Such partial digestions are accomplished by varying the concentration of restriction enzyme or length of time the restriction digestion is carried out. Incubation times of about one hour to two hours at about 37°C are workable, although variations can be tolerated. After each incubation, protein is removed by extraction with phenol/chloroform, and may be followed by ether extraction, and the nucleic acid recovered from aqueous fractions by precipitation with ethanol.
  • size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods in Enzymoloqy (1980) 65:499-560; Lawn, et al., (1981) Nuc. Acids Res. 9:6113-6114 and Goeddel, et al., (1980) Nuc. Acids Res. 8:405). Restriction cleaved fragments may be blunt ended by treating with the large fragment of E.
  • coli DNA polymerase I (Klenow) in the presence of the four deoxyribonucleoside triphosphates (dNTPs) using incubation times of about 15 to 25 min at 20° to 25°C in 50 mM Tris pH 7.6, 50 mM NaCl, 6 mM MgCl, 6 mM dTT, about 1 U/ul Klenow and 100 uM dNTPs.
  • the Klenow fragment "fills in” opposite 5' sticky ends but the 3'—>5' exonuclease activity of the enzyme chews back protruding 3' single strands in the absence of a template region.
  • selective repair can be performed by supplying only one, or selected, dNTPs within the limitations dictated by the nature of the sticky ends. After treatment with Klenow, the mixture is • extracted with phenol/chloroform and ethanol precipitated. Treatment under appropriate conditions with SI nuclease or Bal-31 results in hydrolysis of any single-stranded portion.
  • Synthetic oligonucleotides may be prepared by the triester method of Matteucci, et al., (1981) J. Am. Chem. Soc. 103:3185-3191 or by using automated synthesis methods. Kinasing of single strands prior to annealing or for labeling is achieved using an excess, e.g., approximately 10 units of polynucleotide kinase to 1 nmole substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl2» 5 mM dithiothreitol, and 1-2 mM ATP. If kinasing is for labeling of probe, the ATP will contain high specific activity gamma- 32 P.
  • Ligations are performed in 15-30 ul volumes under the following standard conditions and temperatures: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl, 10 mM DTT, 33 ug/ml BSA, 10 mM-50 mM NaCl, and either 40 uM ATP, 0.01- 0.02 (Weiss) units T4 DNA ligase at 0°C (for "sticky end” ligation) or 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14 ⁇ C (for "blunt end” ligation).
  • Intermolecular "sticky end” ligations are usually performed at 33-100 ug/ml total DNA concentrations (5-100 nM total end concentration).- Intermolecular blunt end ligations (usually employing a 10-30 fold molar excess of inserts) are performed at 1 uM total ends concentration.
  • vector construction employing "vector fragments”
  • the vector fragment is commonly treated with bacterial alkaline phosphatase (BAP) in order to remove the 5' phosphate and prevent religation of the vector.
  • BAP digestions are conducted at pH 8 in approximately 150 mM Tris, in the presence of Na + and Mg +2 using about 1 unit of BAP per ug of vector at 60°C for about one -hour.
  • the preparation is extracted with phenol/chloroform and ethanol precipitated.
  • religation can be prevented in vectors which have been double digested by additional restriction enzyme digestion of the unwanted fragments.
  • site-specific primer directed mutagenesis is used for portions of vectors derived from cDNA or genomic DNA which require sequence modifications. This technique is now standard in the art, and is - 27 -
  • the synthetic oligonucleotide is used as a primer to direct synthesis of a strand complementary to the phage DNA, and the resulting double-stranded DNA is transformed into a phage-supporting host bacterium. Cultures of the transformed bacteria are plated in top agar, permitting plaque formation from single cells which harbor the phage.
  • 50% of the new plaques will contain the phage having, as a single strand, the mutated form; 50% will have the original sequence.
  • the plaques are transferred to nitrocellulose filters and the "lifts" hybridized with kinased synthetic primer at a temperature which permits hybridization of an exact match, but at which the mismatches with the original strand are sufficient to prevent hybridization. Plaques which hybridize with the probe are then picked and cultured, and the DNA is recovered. Details of site-specific mutation procedures are described below in specific examples.
  • chloramphenicol (Cm) amplification (Clewell, (1972) J. Bacteriol. 110:667).
  • the isolated DNA is analyzed by restriction and/or sequenced by the dideoxy method of Sanger, et al., (1977) Proc. Natl. Acad. Sci. USA 74:5463 as further described by Messing, et al., (1981) Nuc. Acids Res. 9:309, or by the method of Maxam, et al., (1980) Methods in Enzymoloqy 65:499.
  • R20-2 medium has the following composition:
  • Minimal medium R70 (also referred to as Acetobacter Minimal Medium or "AMM”), has the following composition: - 29 -
  • R70-2 medium was a modified form of R70.
  • R70-2 had the following composition:
  • the pellicles formed by the Acetobacter cells in culture were asceptically removed with forceps, blended for approximately 15 seconds and filtered through 4 layers of sterile cheesecloth. The cells were washed two times with 0.9% NaCl by centrifugation for 10 min at 7500 rpm, at 4°C. The cells were resuspended in 20 ml 0.9% NaCl and filtered once more through 4 layers of cheesecloth to remove any remaining clumps.
  • Mutagenic conditions were selected to give a cell kill of 95% to 99.9%.
  • the cultures were incubated at 30°C.
  • the mutagen was ethyl methansulfonate (EMS, Sigma, St. Louis, MO).
  • EMS ethyl methansulfonate
  • the EMS concentrations ranged from 1% to 2% (v/v) and the incubation times ranged from 60 min to 210 min.
  • Acetobacter strains 1306-3 and 1306-11 ATCC Nos. 53264 and 53263, respectively.
  • Two procedures were used to isolate the Cel" Acetobacter strains, 1) mutagenesis without expression, and 2) mutagenesis with expression.
  • Acetobacter strain 1306-21 was treated with EMS and then directly plated on R20-2 medium to determine percent survival.
  • the plates from the EMS mutagenesis of 1306-21 were examined for potential Cel" colonies as follows.
  • the mutagenized culture was plated and after seven (7) days presumptive Cel" colonies were picked.
  • Cel" mutants may be identified on plates as flat and shiny colonies whereas wild type colonies have a rough, dry appearance.
  • In agitated culture Cel + strains form pellets while Cel " cultures produce a suspension of single cells.
  • the frequency of Cel" colonies was determined to be in the range of from 0.05% to 2.0%.
  • a similar technique was used to isolate Cel" strains from Acetobacter strains 1306-3 and 1306-11 and similar mutation frequencies were observed.
  • the cellulose synthase assay used to detect in vitro cellulose synthase activity of Cel" Acetobacter mutant strains was a modification of the procedure described by Aloni, et al., (1982) Proc. Natl. Acad. Sci. USA 79:6448-6452, which measures production of alkali insoluble polymers (cellulose) from uridine 5'-diphospho-( 14 C)-glucose (UDPG) . .
  • This assay was adapted for the screening of Acetobacter Cel" mutants. After incubation (10 min. at 30°C) , unreacted UDPG in each reaction mixture was separated from the cellulose by heating with NaOH (95°C for 1 hr) and filtering. The radioactively-labeled ( 14 C) cellulose retained on the filter was then quantitated by scintillation counting.
  • the amount of total protein used in the assay depends upon the state of purification of the cellulose synthase. Two or three different sample dilutions were assayed to obtain at least one result in the linear range of the assay ( ⁇ 20% of total UDPG consumed).
  • the 0.2 ml assay mixture contained, as final concentrations, 0.2 mM I 1 C) UDPG (7.5 cpm/pmole), 50 mM Tris, pH 7.5, 10 mM MgCl . 1 mM EDTA, 2 mM CaCl 2 , and the sample to be assayed. Cyclic diguanosine monophosphate (c-di-GMP) was added to 5 uM to some of the assay tubes (c-di-GMP activates the cellulose synthase) . Controls included a tube containing no added sample, and a tube containing the sample, denatured prior to the incubation by adding 4 ml of 0.5 M NaOH. - 33 -
  • the timed reactions were commenced by adding enzyme, vortexing the mixture, and placing the tubes into a 30°C water-bath. Succeeding tubes were started at timed intervals. After 10 min, each reaction was terminated by removing the tube from the water-bath, adding 4 ml of 0.5 M NaOH, and vortexing. When all the reactions were stopped, about 20 g cellulose was added to each tube to act as carrier for the ( 14 C) cellulose. The tubes were then heated in a water bath 95°C for one hour to digest the cells.
  • each assay tube was filtered through a Whatman GF/A filter to isolate the cellulose product (removing any unreacted 14 C UDPG), by passing the reaction mixture through the filter; rinsing the assay tube 3X with deionized water, passing the rinse water; washing the filter 2X with 20 ml deionized water; then with 20 ml 0.5 M HC1; followed by 20 ml deionized water and 20 ml methanol. Cellulose production was quantified by scintillation counting.
  • the total possible cpm of the assay was determined from the stock-solution aliquot, and the fraction of total UDPG consumed from each assay tube was calculated as follows:
  • nmole UDPG/min (fraction of total UDPG consumed) X (40,000 pmole) X (1/10 min)
  • Activity was expressed on the basis of nmole per minute per ml sample, or nmole per minute per mg protein.
  • the diguanylate cyclase assay was used to identify Acetobacter hosts lacking two or more specific activities, such as a deficiency in cellulose synthase activity and diguanylate cyclase activity.
  • the enzyme diguanylate cyclase catalyzes the production of c-di-GMP, ⁇ a cellulose synthase activator, from guanosine triphosphate (GTP).
  • the cells were grown, washed, and sonicated as described below for the screening assay. Diguanylate cyclase activity was measured using an assay similar to that reported in Ross, et al., (1987) Nature 325:279. Sonicated cells (1 mg/assay tube) were incubated for 10 min at 30°C in a 0.1 ml reaction mixture containing 0.2 mM [alpha 32 P]GTP, 50 mM Tris HC1, pH 7.5, 10 mM MgCl2, 1 mM EDTA, 5 ml CaCl2, 2 mM phosphocreatine, and 24 units/ml creatine phosphokinase.
  • the reaction was terminated with 10 ml (w/v) 100% trichloroacetic acid. After centrifugation to remove the precipitate, 10 ml of each reaction mixture was spotted on a thin layer chromatography (TLC) plate (Polygram Cel 300 PEI, Macherey-Nagel, Duren, W. Germany, U.S. distributor Sybron/Brinkman, Westbury, NY) .
  • TLC thin layer chromatography
  • the TLC plate was developed in 1.5 M KH2P0 , pH 3.65, for about 2 hr, autoradiographed, and the areas on the TLC plate - 35 -
  • Screening Assay To observe restoration of cellulose synthase activity, one needs to isolate a strain which is cellulose synthase negative and diguanylate cyclase positive.
  • the following screening assay is a modification of the cellulose synthase activity assay described above and may be used to determine mutations involving two different enzymes by comparing cellulose synthase activity in the presence or absence of GTP or c-di-GMP.
  • the assay measures cellulose production by suspended, sonicated cells. Mutant Acetobacter strains were classified by assaying sonicated cells under several different conditions. Three classes of Acetobacter mutations were identified. Class I (cellulose synthase negative) strains produced no cellulose under any assay conditions.
  • Class II (diguanylate cyclase negative) strains produced cellulose in the presence of c-di-GMP, but not in the presence of GTP.
  • Class III mutants produced cellulose following activation by either GTP or c-di-GMP.
  • -Mutants in Classes II and III contain cellulose synthase, and show activity in vitro, but produce little or no cellulose in vivo. The deficiency in the Class III mutants has not been defined biochemically.
  • the screening assay was conducted under the following conditions: 1) no nucleotide added; 2) 0.4 mM GTP added; and 3) 5 uM c-di-GMP added.
  • Acetobacter strains Six mutant Acetobacter strains were assayed in a single screening. Each time an Acetobacter strain having both cellulose synthase activity and diguanylate cyclase activity was included to monitor consistency between assays.
  • the selected Acetobacter strains were grown for approximately 24 hours at 30°C.
  • the growth medium contained R70-2, 1% Ambrex 1003 (TYE, Universal Foods, Milwaukee, WI), 4% fructose, 0.01% v/v Dow Corning Antifoam B, and 50 mM 3,3-di methylglutaric acid (DMG) , pH 5.0.
  • 25 ml of medium was inoculated in a 125 ml baffled shake flask with the cells from a frozen seed vial.
  • R70-2 + 0.5% TYE and 1% glucose agar plates were streaked to monitor for contamination. The plates were incubated at 30°C for about 3 days.
  • Each tube was sonicated in a cup sonicator (Branson Sonic Power Co., Model 350, Plainview, NY) for 1 min., 80% duty cycle, setting of 7.
  • the assay was performed as described above using 50 ul of sonicated cell suspension for each assay tube, substituting 50 mM EPPS, pH 9.0 for the 50 mM Tris, dropping the 1 mM EDTA, and adding 20 mM MgCl2 in place of 10 mM MgCl2»
  • Each assay condition was duplicated and the duplicates were averaged in the calculations.
  • This vector contains a streptomycin resistance gene (Sm), the cos fragment of phage lambda and cloning sites for insertion of foreign DNA.
  • Sm streptomycin resistance gene
  • a 1.85 kb DNA fragment containing the lambda cos site was excised from plasmid pVKlOO (Knauf and Nester, (1982) Plasmid 8:45-55) by digestion with the restriction enzyme Bglll and was cloned in the BamHI site in plasmid pUC19 (New England Biolabs Catalog) .
  • the new plasmid, pUC19cos2 was digested with the restriction enzymes HindiII and X al and the Hindlll-Xmal fragment containing the 1.85 kb cos-containing fragment was cloned into Xmal- and Hindlll-digested plasmid pKT230, thereby inactivating the kanamycin-resistance gene.
  • cosmid pKT230cos5 is not self-transmissible from E. coli to Acetobacter. Therefore, a helper plasmid, pRK2013, is necessary to mobilize the transfer of pKT230cos5 from the donor cells into the recipients cells of Acetobacter strain 1306-24.
  • E. coli strain MM294 transformed with pKT230cos5 was grown at 37°C in R2 medium (20.0 g Tryptone, 10.0 g yeast extract, 10.0 g NaCl, 1.0 L distilled H2O, pH 6.9 plus 2 g/1 glucose (R2-4) and optionally, 15 g/L Bacto agar) containing 100 ug/ml Sm to a Klett reading of 150 KU.
  • R2 medium 20.0 g Tryptone, 10.0 g yeast extract, 10.0 g NaCl, 1.0 L distilled H2O, pH 6.9 plus 2 g/1 glucose (R2-4) and optionally, 15 g/L Bacto agar
  • coli strain HB101 containing the mobilizing plasmid pRK2013 was grown at 37°C in R2-4 medium containing 50 ug/ml Km to a Klett reading of 150 KU.
  • the Acetobacter recipient cells 1306-24 were grown at 30°C in R20-2 medium to a Klett reading of 200 KU.
  • 1 ml of each donor, mobilizing and 2 ml recipient cells were mixed and filtered through a 0.2 micron Gelman disposable filter (Gelman, Ann Arbor, MI), washed twice with 10 ml of R2 medium without antibiotics. The filter was placed on agar plates containing R2-4 medium, The plates were incubated at 30°C for 3 hr to allow mating to take place.
  • Lambda phage will package DNA from 38 to 52 kb in length if cos sites are present at both ends. Since the vector pKT230cos5 was relatively small (13.5 kb), a large amount of Acetobacter DNA (28 to 37 kb) could be inserted and packaged in lambda phage particles. Presuming the genome size of Acetobacter is equivalent to E. coli, only 700 to 1000 clones are presumed necessary to have a complete gene bank. DNA banks were constructed from Acetobacter strain 1306-3 as follows. About 26 mg of nucleic acid were isolated from lawns of Acetobacter 1306-3 on R20-2 agar plates. This nucleic acid was treated with RNase A and RNase Tl to degrade the RNA in the sample.
  • a total of 560 ug of DNA was recovered. This DNA was partially digested with the restriction enzyme Sau3A at four different enzyme concentrations. The DNA was fractionated by size on a 10-40% sucrose gradient. The fraction containing the largest number of DNA molecules between 27-38 kb was selected (approximately 2 ug of DNA). Approximately 1 ug of this DNA was ligated into BamHI-cleaved and dephosphorylated pKT230cos5 DNA, and the ligation mixture was packaged into lambda phage particles. The phage particles were then used to infect E. coli strain K802 recA". Cosmid DNA, isolated from six random E. coli isolates, was used to determine the sizes of the inserted DNA fragments.
  • the six clones had DNA inserts ranging from 8 to 40 kb with an average size of 28 kb. Approximately 2000 clones were picked, individually grown in microtiter dishes, and stored for later screening. The bank was designated pKT230cos5:1306-3A2. - 40 -
  • a genetic complementation assay for restoration of cellulose synthase activity was used to isolate cosmid DNA capable of restoring cellulose synthase activity in the Cel" Acetobacter mutants.
  • Cosmids from the gene bank pKT230cos5:1306-3A2 were transferred to recipient mutant Acetobacter strain 1306-24 for screening using the mobilizing plasmid pRK2013 in a multiple spot conjugation method described below.
  • Acetobacter strain 1306-24 was grown in R20-2 medium at 30°C with shaking for approximately 28 hr to a Klett reading of 100-150 KU.
  • E. coli HBlOl/pRK2013 was grown in R2-4 medium and 50 ug/ml kanamycin (Km) at 37°C with shaking to a Klett reading of 100 to 150 KU.
  • Km ug/ml kanamycin
  • coli K802 recA (pKT230cos5:1306-3A2) cultures were inoculated from frozen microtiter trays with a flamed frog into microtiter dishes containing 100 ul R2-4 medium plus 50 ug/ml Sm and incubated at 37 ⁇ C without shaking for approximately 18 hr.
  • the E. coli HBlOl/pRK20l3 culture was centrifuged down, washed with an equal volume of 0.9% saline to remove the Km, centrifuged down again and concentrated by resuspending in one tenth the original volume of saline. A 10 ul volume of this concentrated E.
  • coli HBlOl/pRK2013 was added to each microtiter well containing 100 ul of 18 hr E. coli K802 recA" pKT230cos5:1306-3-A2 culture. 10 ul volumes of the mixed HB101/pRK2013 and K802 recA" pKT230cos5:1306-3-A2 - 41 -
  • each of the mating mixtures was scraped from the mating plates with a sterile toothpick and inoculated directly into 2 ml R70-2 containing 0.5% TYE, 3% glucose, 25 mM DMG, 20 ug/ml Cm and 50 ug/ml Sm in 13 x 100 mm tubes ("test tube selection screen").
  • the antibiotic Cm inhibits the growth of the E. coli donor * and helper parents.
  • the antibiotic Sm inhibits the growth of the Acetobacter strain 1306-24 which had not received a cosmid.
  • the tubes were incubated at 30°C and checked for formation of pellicles at day 7 and day 14. This procedure allowed visualization of any cellulose that the transconjugants produced.
  • Cosmids T19G9, T20A1 and T20B6 whose 1306-24 transconjugants produced a pellicle in the test tube selection screen described above were further tested in transfers done by the filter conjugation method with Acetobacter 1306-24 (receipient) , E. coli HB101pRK2013 (helper plasmid strain), and E. coli PKT23OCQS5:1306-3A2 T19G9, -T20A1, and -T2B6 (donor strains) according to the procedure in Example III.
  • Conjugation frequency for these conjugations was determined by plating serial dilutions of the mating mixtures dirctly after conjugation on R20-2 plates containing 20 ug/ml Cm and 40 ug/ml Sm.
  • Conjugation frequency was determined by plating serial dilutions of the mating mixtures dirctly after conjugation on R20-2 plates containing 20 ug/ml Cm and 40 ug/ml Sm.
  • the vector pKT230cos5 was transferred to 1306-24 in parallel with these conjugations, plated and inoculated into test - 43 -
  • Conjugation between the E. coli carrying pKT230cos5T19G9 and Acetobacter 1306-24 was performed on a filter. 100 ul of the conjugation mixture was inoculated for a test tube selection screen as described above. After seven days a pellicle formed in the test tube and was blended in a blender with 25 ml of 0.9% NaCl. The resulting suspension was streaked for single colonies on an R20-2 plate containing 20 ug/ml Cm and 40 ug/ml Sm. A Cel + colony was picked and designated * 1306-24 T19G9#106. The cosmid isolated from 1306-24 T19G9#106 was 16.6 kb in length.
  • coli strains K802 recA" carrying T19G9#106 were used as the cosmid donors in a conjugation with 1306-24 as the recipient, Acetobacter transconjugants showed a Cel + phenotype in 100% of the test tubes in the test selection screen. Therefore, the 16.6 kb cosmids were able to restore cellulose synthase activity in the Cel" mutant of 1306-24. Restriction analysis indicated that the T19G9#106 was a deletion product of T19G9.
  • a 1.8 kb BamHI-Smal fragment from cosmid T19G9 strongly hybridized with the oligo probe MK172 (its sequence spans from nucleotide 4564 to 4582 in Figure 1). If the molecular weight of the cellulose synthase was not greater than 120 kd, the 1.8 kb BamHI-Smal fragment should contain the 3'-end of the gene. To confirm this hypothesis, a plasmid carrying a full-length cellulose synthase gene was constructed in a three piece ligation as follows.
  • the cosmid vector pKT230cos5 was first digested with BamHI ' and the ends were repaired with the Klenow enzyme in the presence of all four deoxyribonucleotide triphosphates. The DNA was further digested with Hindlll. A 3.5 kb BamHI-Smal fragment from T19G9 containing the 3'-end of the cellulose synthase gene and the Hindlll-BamHI fragment from T19G9#106 carrying the 5'-end of the cellulose synthase gene were ligated into the Hindlll-BamHI repaired vector pKT230cos5 to construct TRT18-1. The construction for TRT18-1 is shown in Figure 3.
  • a 3 kb region of Acetobacter genomic DNA could restore a Cel + phenotype to Acetobacter strain 1306-24 (Example VI).
  • the present example describes the recovery of cellulose synthase activity in the transconjugant Acetobacter strain 1306-24.
  • the assay used was described as the screening assay in Example II.
  • Controls consisted of Acetobacter strain 1306-3 (Cel + ), and strain 1036-24 (Cel ⁇ ) each carrying the vector pKT230cos5.
  • the Cel + strain 1306-24 T19G9K106 (“the transconjugant") carried a 3 kb fragment of Acetobacter qenomic DNA in the vector pKT230cos5.
  • the cells were grown as described in Example II, with addition of 50 mg/1 Sm, and 20 mg/1 Cm. The cells were collected, separated from cellulose, washed, brought to concentration and sonicated as previously described.
  • strains 1306-24 pKT230cos5 and the transconjugant 1306-24 were not affected by the cell concentration of the assay.
  • the activity of 1306-3 pKT230cos5 was similar to the activity of strain 1306-21 (not shown) .
  • Strain 1306-24 demonstrated a low level of cellulose synthase activity upon activation by c-di-GMP. This was true for most Class I (cellulose synthase negative) Acetobacter mutants.
  • Class I cellulose synthase negative
  • the 3 kb insert increased the cellulose synthase activity of strain 1306-24 roughly ten-fold (0.4 to 4.1 nmole/min mg) at 5 mg cells/ml in the assay tube. This correlated with the appearance of the cellulose positive phenotype.
  • the transconjugant strain 1306-24 had the same - 46 -
  • the restriction map of the cloned celluMose synthase B gene of the invention was used to guide the subcloning strategy for the determination of the nucleotide sequence of the cellulose synthase gene carried on cosmid T19G9#106.
  • the cloned insert DNA carrying the cellulose synthase gene in cosmid T19G9#106 was physically mapped using restriction enzymes. This map information was then used for subcloning the Acetobacter DNA insert into M13 RF DNA for sequencing analysis as described by Messing in Methods in Enzymol. 101:20-78 (1983).
  • the nucleotide sequence of the restriction fragments was determined by the chain termination methods described in Innis, et al., (1988) Proc. Natl. Acad. Sci. USA 85:9436-9440, using Tag DNA polymerase (Cetus Corp. Emeryville, CA) .
  • a Bglll linker sequence was introduced at the EcoRV site at nucleotide position 3113 and at the StuI site at nucleotide position 3954.
  • the EcoRV insertion should create a termination codon TGA, as well as a frameshift mutation.
  • the Bglll linker that was introduced at a StuI site at position 4564 should create a frameshift mutation.
  • the third mutation was introduced at the BamHI site at nucleotide position 1899 and was created by filling-in the BamHI site with Klenow. - 48 -
  • Acetobacter CMCC824 a proprietary strain of Cetus
  • CMCC824 a cellulose producing strain isolated from a vinegar culture (CMCC824) contains a 3.5 kb plasmid.
  • aqueous layer was carefully removed using a Pasteur pipette and placed in a polypropylene tube capable of holding 2-3X of the present volume.
  • 1/10 volume of 3M NaOAC and 2-3X volumes of absolute EtOH were added and mixed well before the tubes were placed at -20°C overnight.
  • the supernatant was collected by centrifugation (20,000 x g for 30 min at 0°C) and the pellet washed with 5-10 ml cold 70% EtOH, and then recentrifuged at 20,000 x g for 10 min to recover the pellet.
  • the pellet was dissolved in 50-100 ul TE (100 mM Tris, 1 mM EDTA).
  • the plasmid DNA was purified by ethidium bromide-CsCl density centrifugation.
  • the CsCl prepared DNA was digested with the following restriction enzymes: Hindlll, EcoRI, PstI, BamHI, Sad, PvuII. Of the enzymes tested, only Sacl was able to linearize this plasmid.
  • S_acI-digested plasmid was ligated to Sacl-digested plasmid pUCl ⁇ (New England Biolabs) for cloning in E. coli.
  • This shuttle vector was designated pUC18-824.
  • the plasmid was digested with a variety of restriction endonucleases. , A restriction map of pUC18-824 is shown in Figure 4.
  • Example XI Electrotransformation To demonstrate that the shuttle vector pUCl8-824 can be transferred to Acetobacter strains, pUCl8-824 plasmid. DNA was prepared from an E. coli host strain DG98, carrying pUC18-824 according to Clewell, et al., (1972) J. Bacteriol. 110:667. Acetobactor strains 1306-21 and 1306-24 were washed as described in Dower, et al., (1988) supra. An electroporation device - 51 -
  • the cellulose synthase B gene can be isolated from plasmid TRT18-1, the construction of which is taught at Example VI, or alternatively, since the nucleotide sequence of this gene is provided herein, the full-length gene may be directly synthesized by chemical means or may be obtained from the constructed gene bank using a primer.
  • the primer oligonucleotide MK170 (TGCCCTGGCCAGATGTCAGCA) was used to probe the 1760 individual cultures from the constructed gene bank, and six clones were isolated for further characterization. Three cosmids isolated from three of these clones were designated as T5A1, TIC2 and T5D2.
  • the 8.3 kb Smal fragment carrying the cellulose synthase B gene and about 3 kb upstream sequence was cloned into the Smal site' of pUC18-824.
  • the resultant plasmids carrying the opposite orientations of the 8.3 kb Smal restriction fragment were designated as pUC18-824 FS-1 and pUC18-r824 FS-6, respectively.
  • a restriction map of FS-6 is provided in Figure 6.
  • In vitro assays confirm the ability of the plasmids pUC18-824 FS-1 and pUC18-824 FS-6 to restore cellulose synthase activity to the cellulose synthase negative mutant strain 1306-24.
  • the in vitro cellulose synthase assay of the transformants and control strains was carried out as described in Example VII. As shown in Table 3, the transformants, 1306-24 pUC18-825 FS-1 and 1306-24 pUC18-824 FS-6 showed cellulose synthase specific activities higher than that of the original Cel + parent strain, 1306-3 (1.3X and 1.8X, respectively) .
  • Plasmid pUCl9 (New England Biolabs) was digested with the restriction enzyme Sad.
  • the linearized plasmid was ligated with Sacl-restricted Acetobacter plasmid 824.
  • the resultant plasmid was designated pUC19-824.
  • the cellulose synthase gene from the 8.3 kb Smal fragment was cloned as a Hindlll-Smal fragment (i.e., 4.9 kb) into the Hindi!I-Smal sites in the linker region of the pUC19 plasmid (see Figure 8) so that its transcriptional direction was identical to the lac promoter.
  • This construction placed the gene under the control of the lac promoter in Acetobacter. Since the lac promoter is a constitutive promoter, expression of cellulose synthase in the absence of the lad gene product would be unregulated in Acetobacter.
  • the plasmid was designated pALl.
  • Plasmid pALl was used to transform Acetobacter strain 1306-24 and was shown to complement the cellulose synthase-deficient phenotype, resulting in a Cel + phenotype on plates.
  • the 7.2 kb BamHI restriction fragment, shown in Figure 5, from the Acetobacter chromosome was identified as carrying an additional 4.6 kb nucleotide sequence upstream of the cellulose synthase B gene. To investigate whether this region contains a gene involved in the biosynthesis of cellulose, the nucleotide sequence upstream of the cellulose synthase B gene was determined as follows.
  • the 7.2 kb BamHI restriction fragment was cloned into the BamHI site of pBR322.
  • a 2.3 kb SacII fragment, a 0.9 kb Bglll fragment and a 3.2 kb BamHI-Bqlll fragment of the 7.2 kb BamHI fragment from the pBR322 recombinant plasmid were subcloned into the SacII or BamHI sites of the Bluescript (Stratagene) KS vector, respectively.
  • These three subclones and the pBR322 recombinant plasmid, carrying the entire BamHI fragment were then purified by CsCl density gradient and used as templates in the dideoxy chain termination method for nucleotide sequence analysis.
  • the dideoxy chain termination methods were performed as previously described except that Sequenase was used to substitute for the Klenow fragment in the extension reaction.
  • the nucleotide sequence of the cellulose synthase operon is shown in Figure 1. Assuming that the ATG codon at nucleotide 2594 is the initiation codon for the cellulose synthase B gene, the nucleotide sequence of the coding region of the cellulose synthase B gene spans from nucleotide 2594 to 4999. Since the mature protein starts with the alanine codon at nucleotide 2666 (see Example XIV), the cellulose synthase appears to have a 24 amino acid leader sequence. The deduced amino acid sequence of this leader peptide is functionally similar to leader peptides carried by secreted and membrane proteins from a variety of bacteria. Therefore, the cellulose synthase protein encoded by the cellulose synthase B gene may be a membrane protein. - 56 -
  • RNA isolation Acetobacter 1306-21 was grown in R70-2 medium containing 20 ug/ml Cm and 0.1% (v/v) cellulase (Genencor) at 30°C with shaking to late log phase (O.D.600 nm - 0.7). The cells were then harvested by centrifugation at 6000 rpm for 10 min at 4°C and resuspended into 2.5 ml of NaOAc, pH 6.0 buffer containing 1 mM EDTA and 1% SDS. An equal volume of phenol/chloroform solution were added to the cell suspension and the mixture was sonicated for 15 sec.
  • RNA was precipitated with isopropanol and NaOAc at -70°C overnight.
  • the RNA was harvested by centrifugation, washed with 100% ethanol and dried before it was resuspended into 120 ul of DEPC-treated distilled water.
  • DNasel Sigma was added to 10 ug/ml and the mixture was incubated at room temperature for 20 min. The digested mixture was extracted twice with an equal volume phenol/chloroform.
  • RNA was precipitated with an equal volume of isopropanol.
  • the purified RNA was washed with 80% ethanol, dried and resuspended into 40 ul of DEPC-treated distilled water.
  • Primer extension The oligodeoxy- ribonucleotide GE13 (5'-TGCGGCGATAAGTGCACA-3' ) was labeled with gamma- 32 P ATP and T4 polynucleotide kinase. The unincorporated nucleotide was removed by ethanol precipitation.
  • the labeled oligodeoxyribonuc- leotide was resuspended into 100 ul of 0.3M NaOAc solution.
  • the specific activity of the primer was approximately 4 x 10 6 cpm/pmole.
  • Labeled primer (0.02 and 0.2 pmoles) was used for primer extension analysis.
  • the labeled primer was mixed with 50 ug RNA.
  • the mixed nucleic acids were coprecipitated with ethanol and then resuspended in 30 ul of hybrization buffer containing 50 mM HEPES, pH 7.5, 1 mM EDTA and 300 mM NaCl.
  • the hybrization reaction was carried out at 30°C for 10 min.
  • the mixture was treated with AMV reverse transcriptase.
  • the reaction was carried out at 42°C for 90 min, then terminated by adding 1 ul of 0.5 M EDTA and 1 ul of RNase (1 mg/ml) . After 30 min incubation at 37°C, the mixture was extracted with phenol/chloroform. The cDNA was precipitated, dried and resuspended in 3 ul 10 mM Tris-HCl, pH 8.0, containing 1 mM EDTA. 4 ul of formamide was added to the cDNA suspension and the mixture was boiled for 3 min before it was loaded on a DNA sequencing gel.
  • the transcriptional initiation site of the operon is marked by a downward arrow positioned over nucleotide 235 in Figure 1.
  • the substituted 5.5 kb fragment contained the entire C gene and an additional 3' sequence.
  • the 5.5 kb fragment carried on TRT11-4 was originally isolated from T19G9 and cloned as a 5.5 kb BamHI fragment into the BamHI site of pUC18 to construct TRT11-4.
  • TRT11-4 DNA Fifteen micrograms of TRT11-4 DNA was digested to completion with the restriction endonuclease BamHI at 37°C for one hr. The digested DNA was run on a 0.8% GTG agarose gel. The 5.5 kb BamHI fragment was cut from the gel, electroeluted and precipitated with ethanol and resuspended in a small volume of H2O.
  • Eleven micrograms of pFS-6 were digested to completion with BamHI at 37°C for 1 hr, releasing 1.8 kb of DNA from the 12.6 kb vector fragment containing the 5' portion of the cellulose synthase operon.
  • the digest was run on a 0.8% agarose gel and the 12.6 kb fragment containing the pUC18:824 vector sequence, the cellulose synthase promoter, the A gene, and the 5' portion of the B gene was cut from the gel and electroeluted.
  • the purified DNA was treated with calf alkaline • phosphatase and then ligated to the 5.5 kb BamHI fragment isolated from TRT11-4.
  • the ligation was carried out under standard conditions with a 10:1 molar ratio of 5.5 kb insert to 12.6 kb vector DNA.
  • the ligation mixture was used to transform E. coli DGlOl competent cells.
  • the transformation mixture was plated on R2-4 plates with 50 ug/ml ampicillin and incubated at 37°C overnight. Thirty-six ampicillin resistant transformants were picked from these plates and cultured in R2 media containing 50 ug/ml ampicillin at 37 ⁇ C with shaking for approximately 6 hr.
  • Alkaline lysis miniscreen DNA was - 59 -
  • the chain termination method was used to sequence the cellulose synthase operon. Double-stranded DNA carrying the operon was used as the DNA template.
  • the nucleotide sequence of the region from pABCD is shown in Figure 1.
  • the cellulose synthase operon is 9217 bp in length and consists of four genes. Genes A, B, C and D are 2,262 bp, 2,406 bp, 3,957 bp and 468 bp in length, respectively.
  • the molecular weights determined by and suggested roles of the gene products are as follows:
  • Flasks were harvested after one, two, and five days. Duplicate flasks were harvested at each time point for cell mass and cellulose measurements. In addition, cultures from the five day flasks were checked for plasmid retention, by observing antibiotic resistance on plates (patch test) . Thirty colonies were tested for each strain. To measure cellulose production and cell concentration, the flask contents of each sample were transferred to a 100 ml beaker. The suspension was then macerated for one minute with a large Tekmar probe at 50% full power. After that the suspension was centrifuged at 5,000 rpm for 10 minutes. The supernatant was discarded and the pellet was resuspended in 15 ml saline solution and incubated for 15 minutes with occasional stirring. The sample was again centrifuged and the above wash step repeated.
  • the pellet from the second wash step was resuspended in 15 ml of 0.1 N of NaOH and incubated at 60°C with mild agitation for 60 minutes. The suspension was centrifuged and the NaOH supernatant was used to analyze cell concentration while the pellet was used to analyze cellulose concentration.
  • the pellet was resuspended in 15 ml deionized water and left at room temperature for 15 minutes with occasional stirring. Then the sample was centrifuged and the above wash procedure was repeated for a total of three times. After the last centrifugation step, the cellulose precipitate was dried at 60°C overnight in a vacuum over and then weighed.
  • the supernatant was neutralized with HC1 (approximately 0.05 ml HC1 to 0.5 ml sample) and the protein concentration was assayed by the Lowry method. Cell concentration ⁇ ** - * protein concentration x 1.54.
  • the recombinant strain 1306-21 pABCD was also tested in a Chemap fermentor for cell growth and cellulose production. Contrary to that observed in the flasks, the performance of this strain was similar to that of the parent strain. It is believed that instability of the recombinant strain may be responsible for the absence of enhanced cellulose production. Overexpression of the chromosomal cellulose synthase operon genes would eliminate the instability of the recombinant strain.
  • Example XV The conditions were similar to that described in Example XV except that glucose was replaced with fructose.
  • Table 5 At day 2 the activities of the control strains 1306-3 and 1306-3 pUC18-824 retained 30% and 40% of the day 1 activity, with declining activity over time.
  • isolates #302 and #303 showed a decline to 45% and 50% of the day 1 activity, also with declining activity over time.
  • these latter strains both showed about 2x higher activity than did 1306-3 at day 1, while the activities were about 3x higher at day 2.
  • streptomycin resistance gene interrupted the cellulose synthase B gene near its 5' end.
  • Chromosomal Promoter Replacement Acetobactor appears to have a very efficient recombination system which may cause instability
  • the operon can be overexpressed at the chromosomal level using heterologous control elements to drive transcription of the chromosomal cellulose synthase operon.
  • heterologous control elements to drive transcription of the chromosomal cellulose synthase operon.
  • the supernatant from this clone was used to infect JM103.
  • a 15 ml culture of the JM103 MPll:Pcs was grown for six hr, spun down, and single-stranded phage DNA was isolated from the supernatant.
  • oligonucleotide LFOl 5'-GAATATATAACGGAGCTCCCGGGATCC ACCTGTTTTACC-3'
  • the transformation mixture was plated with JM103 lawn cells on R2-4 plates with 3 ml R-17 (10.0 g N-Z amine, type A, 5.0 g NaCl, 0.04 g X-gal in 2.0 ml DMF), 10 mM MgCl2, 0.7% top agarose. Phage plaques were lifted from these plates onto nitrocellulose filters and the plates stored at 4°C. The filters were baked at 80°C for two hr and hybridized with the 32 _ ⁇ a ]- , e ⁇ e( 3 oligonucleotide probe LF02.
  • LF02 contains a subset of the sequence of the oligonucleotide LFOl used for mutagenesis, the three restriction site sequences with only 2 bp of cellulose synthase promoter sequence on either side.
  • the sequence of LF02 is 5'-GGGAGCTCCCGGGATCCAC-3' .
  • Hybridization was carried out at 58 ⁇ C.
  • the filters were washed at 58°C with sequential 5 min washes of 5x SSC, 2x SSC, and 2x SSC containing 0.1% SDS.
  • Kodak X-OMAT AR film was exposed to the filters for 60 hr. After 60 hr, dark spots appeared on the developed film which corresponded to the lifted plaques still present on the plates.
  • MPll:Pcs:LF01 corresponded to the map provided in Figure 9.
  • the introduced restriction sites in MP11:Pcs:LFOl are for substitution of heterologous promoters.
  • the flanking regions serve as the sites for homologous recombination between the plasmid and the Acetobacter chromosome in gene replacement.
  • the phage supernatant from culture MP11:Pcs:LFOl was plaque purified, checked again for the appropriate restriction pattern, then used for infection and preparation of double-stranded cesium chloride gradient purified DNA.
  • This fragment was ligated to HindiII-digested pACY184 (New England Biolabs) with an insert-to-vector ratio of 10:1 at an ATP concentration of 2 mM at 16°C overnight.
  • the ligation mixture was transformed into MM294 competent cells and plated on R2-4 plates containing Cm at 20 ug/ml. The plates were incubated at 37°C overnight and over 15,000 Cm R colonies appeared.
  • pACYC184:Pcs DNA Forty ug of pACYC184:Pcs DNA was partially digested with 4 units of BamHI and gel purified. The approximately 6.7 kb fragment, containing linearized plasmid molecules cut at one of the two BamHI sites, was isolated and then digested to completion with SstI. The fragments were gel purified and the 6.7 kb BamHI-SstI fragment, was cut from the gel, electroeluted into O.lx TEA, extracted with phenol/chloroform, precipitated with sodium acetate in ethanol, and resuspended in Tris-EDTA buffer.
  • Oligonucleotides were synthesized to form the tac and lac UV5 promoters. Each oligonucleotide contains the sequence for one strand of the promoter, with one strand of an EcoRI half site at one end and one strand of a Hindlll half site at the other. The synthesized oligonucleotides were suspended in H2O to a concentration of 100 pmoles/ul. Two hundred pmoles of each oligonucleotide were treated with 9 units of polynucleotide kinase in a 20 ul reaction containing 1 mM ATP at 37°C for 30 min.
  • the oligonucleotides were mixed together in pairs then heated for 15 min to 68°C to unpair any secondary structure. The oligonucleotides were then allowed to anneal together by cooling to 37°C and incubating for 30 min. After 30 min the annealed oligonucleotides were included in ligation reactions with the pALF20 EcoRI/Hindlll fragment isolated as described below.
  • plasmid pALF20 Twenty ug of the plasmid pALF20 were digested with 100 units of EcoRI and 100 units of Hindlll at 37°C for 1.5 hr. The reaction was run on a 0.8% GTG agarose gel and the approximately 4.4 kb fragment, corresponding to linearized DNA, was cut from the gel. The fragment was electroeluted into O.lx TEA buffer in a dialysis bag at 100 volts for 1.5 hr. The DNA and buffer were removed from the bag, extracted with phenol and chloroform, then precipitated with sodium acetate in ethanol. The DNA was dried in a speed vac and resuspended in H2O. - 72 -
  • Each pair of annealed oligonucleotides was ligated to the HindiII/EcoRI-digested pALF20 DNA in a reaction containing 0.1 mM ATP with an insert to vector ratio of 3:1 at 16 ⁇ C for 3.5 hr.
  • the vector EcoRI/HindlII-digested pALF20 was ligated to itself under the same conditions.
  • An aliquot of each ligation mixture was taken before adding the ligase and after ligation for 3.5 hr. These aliquots were run on a 0.8% agarose gel and showed significant increase in molecular weight after 3.5 hr at 16 ⁇ C, indicating successful ligation.
  • pLac21 Contained the lacUV5 sequence with no errors.
  • pTac25 Contained the tac promoter sequence with a 1 bp mismatch from G to A at the -47 position of the promoter.
  • Plasmids pTac25 and pLac21 were selected to continue construction. Ten ug of each plasmid were - 73 -
  • the results of this experiment demonstrate that one can replace the Acetobacter chromosomal promoter of the cellulose synthase operon with an E. coli promotor and still obtain in vitro cellulose synthase activity and cellulose production.
  • the in vitro cellulose synthase specific activity of the tac-promoter construct was similar to that of the wild-type cells throughout the fermentation, both in the activity of day-old cultures, and in the decline in activity in the two and five day-old cultures, while the activity of the lac-promoter construct was lower than that of the wild-type strain. Its activity also declined between the first and second days.
  • Cell growth and cellulose production of the tac-promoter construct were experimentally identical to that of the control.
  • the lac-promoter construct was markedly lower in cellulose production, but not in cell growth, as compared to the control. This data suggests - 75 -
  • promoters of varying strength may give rise to different enzyme activities and cellulose to cell ratios.
  • the purpose of this experiment was to construct a 1306-21 derivative strain for exploration of the function of the cellulose synthase operon D gene.
  • the strain constructed herein can produce a polypeptide from gene D, which lacks 16.5% of the C-terminus of the wild-type protein.
  • a second construction wherein the complete gene D is removed was also constructed. These strains were tested for their phenotype with respect to cellulose production.
  • the approximately 4 kb EcoRV/BamHI fragment was cut from the gel, electroeluted into a small volume of 0.1X TEA at 100 volts for 1 hr, phenol and chloroform extracted, precipitated with sodium acetate in ethanol and resuspended in 10 ul Tris-EDTA buffer.
  • Fifty ug of pBR322:5.5 T19G9 DNA were digested to completion with Smal, checked for complete linearization, and then digested with BamHI.
  • Cm R transformants were obtained and one or more clones were picked for preparation of alkaline lysis mini-screened DNA.
  • Clone pACYCl84:3.7 was shown to carry a 3.7 kb Smal-BamHl insert containing the 3' end of gene C and all of gene D, including the stem and loop terminator structure at the end of the operon.
  • Cesium chloride ethidium bromide gradient purified DNA was isolated for pACYC184:3.7.
  • the filled-in DNA was run on a 1% GTG agarose gel, the 1.5 kb Amp 1 * fragment cut from the gel, electroeluted into 0.1X TEA, phenol/chloroform extracted, precipitated and resuspended in 5 ul Tris-EDTA buffer.
  • the 5 ug equivalents of pBR322 Amp R fragment DNA were ligated to 1 ug equivalent of the pACYC184:3.7 EcoRV-digested DNA at an insert to vector ratio of approximately 9:1 under standard ligation conditions.
  • the ligation mixture was used to transform MM294 competent cells under standard conditions. The transformation was plated on R2-4 Amp 50 plates and incubated at 37° overnight. Amp R colonies were obtained and cultured. Cells were harvested from each culture and alkaline lysis mini-prep DNA was isolated from the cultures. One of the cultures, designated pDI-2, was chosen for transformation of 1306-21.
  • pDI2 contained the Amp resistant fragment from pBR322 inserted in the EcoRV site of pACYC184:3.7, interrupting gene D.
  • Cesium chloride ethidium bromide gradient pDl-2 DNA was prepared. 10 ug of this DNA were digested to completion with Xbal. The digest was washed with 2 ml H2O by spinning at 5,000 rpm in a Centricon 30 (Amicon) . The DNA was then dried in a speed vac and resuspended in 4 ul H2O. Forty ul of electrocompetent 1306-21 cells were added to the digested DNA and the cells electroporated under standard conditions. One ml of R20-2 was added to the - 78 -
  • Example XVIII Purification of Cellulose Synthase Strain 1306-27 was grown on a 400 ml 4% fructose, 1% yeast extract, 0.5% Bactopeptone, 0.3% NaH2P0 4 medium, at pH 5.0 in 1000 ml baffled flasks, for 24 hr. Growth media was removed from the cells by washing twice with buffer (50 mM K2HP0 4 , pH 6.0). About 14 g of dry cells were prepared.
  • P-PEG was centrifuged (12,000 x g, 10 min) and the pellet was suspended in 0.1 M Tris, pH 8.3, 20% sucrose to 10 mg cells dry weight/ml. A 1% volume of 8 mg/ml trypsin (Sigma) was added and the preparation incubated with gentle shaking for 1 hr at 4°C. A 1% volume of 2 mg/ml trypsin inhibitor was added and the preparation was incubated for 15 min on ice. After centrifugation (100,000 x g, for 30 min) the pellet (TT-P-PEG) was stored frozen at -80°C.
  • a 10% solution of digitonin (Serva, Westbury, NY) in TME buffer was prepared by heating for 5-10 min in a boiling bath and the preparation was then cooled to 4°C.
  • the TT-P-PEG pellet was suspended to 1/10 the original volume in TME buffer containing 2% digitonin.
  • the suspension was sonified at 4°C for 2 min using a MSE Model 140 sonifier. Sonification was carried out on 30 ml portions in 30 sec sonic pulses with intermittent cooling. The suspension was shaken and mixed gently for 90 min and then centrifuged at 200,000 x g for 60 min. The supernatant contained approximately ' 50% of original cellulose synthase activity. When frozen and stored as above, activity was retained for several months.
  • the solubilized enzyme was concentrated 5-7 fold using Amicon cones (Filter lOOK) to an activity of
  • the tubes were incubated for 15 min at 30°C, then placed on ice for 2.5 hr, and finally centrifuged in a TST-28 Contron rotor for 30 minat 20,000 rpm. (The centrifuge was set to decelerate to 350 rpm in 3-4 min.) The supernatants were carefully decanted. The pellets were combined and suspended in 15 ml TME with a manual homogenizer and recentrifuged. The final pellet was suspended in 5 ml TME. Before SDS-PAGE, the entrapped enzyme was washed once by centrifugation. The entrapped enzyme was stable for several weeks when frozen and stored as above. The activity yield of entrapped enzyme was about 45%.
  • the proteins were separated from the SDS-PAGE gel slices by electroelution, using a method modified from Hunkapiller, et al. (Methods in Enzymology, 1983, 91:227-247). The method was adapted to result in a lower final SDS concentration.
  • the modifications were: 1) substitution of elution buffer (0.1% SDS in 0.05 M NH HC03) for the soaking buffer (2% SDS in 0.05 M NH 4 HC03); and 2) when replacing the elution buffer (0.1% SDS in 0.05 M NH HC03) in the apparatus with dialysis buffer (0.02% SDS in 0.01 M NH 4 HC0 3 ) , most of the buffer in the sample " cell was also replaced, carefully avoiding disturbing the sample.
  • the first 18 amino acids of the 90-95 kd protein and the first 16 amino acids of the 65-68 kd protein purified from Acetobacter strain 1306-27 were sequenced by automated Edman degradation on an Applied Biosystems model 470A Protein Sequencer, using the reagents and protocol supplied by the manufacturer.
  • the 18 amino acids of the 90-95 kd protein match an amino acid sequence predictedfrom the DNA sequence of cellulose synthase obtained as described above. The match begins with the alanine residue indicated in Figure 1.
  • the amino-terminus obtained after purification may not be the actual in vivo N-terminus, but may reflect proteolysis at the lysine preceding this alanine.
  • the deduced sequence of the cloned gene codes for a protein of 83 kd. Some additional peaks for the early amino acids near the N-terminus were present, possibly due to contamination. The quality of the sequence obtained for the 65-68 kd protein was not as high as that obtained for the 90-95 kd protein, but a good match may be made between the 65-68 kd protein N-terminal sequence and the amino acids (designated by the brackets) from the sequence predicted in Figure 1. Thus, the 65-68 kd protein appears to be a proteolytic fragment of the 90-95 kd protein.
  • CMCC Master Culture Collection

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
PCT/US1990/001811 1989-04-12 1990-04-04 Methods and nucleic acid sequences for the expression of the cellulose synthase operon Ceased WO1990012098A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2-506168A JPH0773500B2 (ja) 1989-04-12 1990-04-04 セルロースシンターゼオペロンの表現のための方法及び核酸配列
DK90906539T DK0471687T3 (da) 1989-04-12 1990-04-04 Fremgangsmåder og nucleinsyresekvenser til ekspression af cellulosesynthase-operonen
DE69031803T DE69031803T2 (de) 1989-04-12 1990-04-04 Verfahren und nukleinsäuresequenzen zur expression des zellulose-synthase-operons
EP90906539A EP0471687B1 (en) 1989-04-12 1990-04-04 Methods and nucleic acid sequences for the expression of the cellulose synthase operon

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US33719489A 1989-04-12 1989-04-12
US337,194 1989-04-12
US49623690A 1990-03-23 1990-03-23
US496,236 1990-03-23

Publications (2)

Publication Number Publication Date
WO1990012098A2 true WO1990012098A2 (en) 1990-10-18
WO1990012098A3 WO1990012098A3 (en) 1991-05-30

Family

ID=26990589

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/001811 Ceased WO1990012098A2 (en) 1989-04-12 1990-04-04 Methods and nucleic acid sequences for the expression of the cellulose synthase operon

Country Status (11)

Country Link
EP (1) EP0471687B1 (https=)
JP (1) JPH0773500B2 (https=)
AT (1) ATE161049T1 (https=)
AU (1) AU5437390A (https=)
CA (1) CA2014264C (https=)
DE (1) DE69031803T2 (https=)
DK (1) DK0471687T3 (https=)
ES (1) ES2111536T3 (https=)
IL (1) IL94053A (https=)
NZ (1) NZ233312A (https=)
WO (1) WO1990012098A2 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991013988A1 (en) * 1990-03-15 1991-09-19 The Board Of Regents, The University Of Texas System RECOMBINANT β-1,4 GLUCAN SYNTHASE PROTEINS
US5114849A (en) * 1990-10-26 1992-05-19 Weyerhaeuser Company Protectants for microbial fermentation
WO1992018631A1 (en) * 1991-04-22 1992-10-29 Cetus Oncology Corporation Methods and nucleic acid sequences for the expression of the cellulose synthase operon
WO1993011244A1 (en) * 1991-11-29 1993-06-10 Weyerhaeuser Company Cyclic di-guanylate metabolic enzymes
US5382656A (en) * 1992-10-06 1995-01-17 Weyerhaeuser Company Cellulose synthase associated proteins
WO1998000549A1 (en) * 1996-06-27 1998-01-08 The Australian National University MANIPULATION OF CELLULOSE AND/OR β-1,4-GLUCAN
WO2001000819A1 (en) * 1999-06-25 2001-01-04 Chauhan, Sarita Targeted gene replacements in enteric bacteria using linear dna
US6316251B1 (en) 1997-03-04 2001-11-13 Bio-Polymer Research Co., Ltd. Gene, group of genes, and novel β-gluclosidase

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6462257B1 (en) 1999-06-01 2002-10-08 Institute Of Paper Science And Technology, Inc. Vicilin-like seed storage protein gene promoter and methods of using the same
CN101708341B (zh) * 2009-12-11 2012-07-18 东华大学 载银细菌纤维素水凝胶抗菌敷料制备方法及其制品
JPWO2014104310A1 (ja) * 2012-12-28 2017-01-19 国立大学法人京都大学 セルロース製造用発現ベクター、形質転換体およびセルロースの製造方法
CN105463625B (zh) * 2014-08-29 2021-01-19 清华大学 一种由细菌细胞制得的细菌纤维材料及其应用

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Chemical Abstracts, Vol. 105, 1986, Columbus, Ohio, US; M.P. Thelen et al.: "Gel. Electrophoretic separation, detection, and characterization of plant and bacterial UDP-glucose glucosyltransferaes", page 295, abstract 148560q, & Plant Physiol. 1986, 81(3), 913-18. *
Proc. Natl. Acd. Sci. USA, Vol. 84, October 1987, T. E. Bureau et al.: "In vitro synthesis of cellulose II from a cytoplasmic membrane fraction of Acetobacter xylinum", pages 6985-6989. *
See also references of EP0471687A1 *
The Journal of Biological Chemistry, Vol. 258, No. 7, 10 April 1983, Y. Aloni et al.: "Solubilization of the UDP-glucose: 1,4-beta-D-glucan 4-beta-D-glucosyltransferease (cellulose synthase) from Acetobacter xylinum", pages 4419-4423. *
The Journal of Biological Chemistry, Vol. 265, 25 March 1990, The American Society for Biochemistry and Molecular Biology, Inc., F. Chyr Lin et.: "Identification of the uridine 5'-diphosphoglucose (UDP-Glc) binding subunit of cellulose synthase in Acetobacter xylinum using the photoaffinity probe 5-azido-UDP-Glc", pages 4782-4784. *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991013988A1 (en) * 1990-03-15 1991-09-19 The Board Of Regents, The University Of Texas System RECOMBINANT β-1,4 GLUCAN SYNTHASE PROTEINS
US6541238B1 (en) 1990-03-15 2003-04-01 Board Of Regents, The University Of Texas Systems Recombinant cellulose synthase
US5114849A (en) * 1990-10-26 1992-05-19 Weyerhaeuser Company Protectants for microbial fermentation
WO1992018631A1 (en) * 1991-04-22 1992-10-29 Cetus Oncology Corporation Methods and nucleic acid sequences for the expression of the cellulose synthase operon
WO1993011244A1 (en) * 1991-11-29 1993-06-10 Weyerhaeuser Company Cyclic di-guanylate metabolic enzymes
US5759828A (en) * 1991-11-29 1998-06-02 Weyerhaeuser Cyclic di-guanylate metabolic enzymes
US5382656A (en) * 1992-10-06 1995-01-17 Weyerhaeuser Company Cellulose synthase associated proteins
WO1998000549A1 (en) * 1996-06-27 1998-01-08 The Australian National University MANIPULATION OF CELLULOSE AND/OR β-1,4-GLUCAN
US6495740B1 (en) 1996-06-27 2002-12-17 The Austrailian National University Manipulation of cellulose and/or β-1,4-Glucan
US7154026B2 (en) 1996-06-27 2006-12-26 The Australian National University Manipulation of cellulose and/or β-1,4,-glucan
US6316251B1 (en) 1997-03-04 2001-11-13 Bio-Polymer Research Co., Ltd. Gene, group of genes, and novel β-gluclosidase
WO2001000819A1 (en) * 1999-06-25 2001-01-04 Chauhan, Sarita Targeted gene replacements in enteric bacteria using linear dna

Also Published As

Publication number Publication date
JPH0773500B2 (ja) 1995-08-09
EP0471687A1 (en) 1992-02-26
IL94053A0 (en) 1991-01-31
NZ233312A (en) 1992-03-26
WO1990012098A3 (en) 1991-05-30
DK0471687T3 (da) 1998-08-24
CA2014264C (en) 1999-05-11
ATE161049T1 (de) 1997-12-15
EP0471687B1 (en) 1997-12-10
CA2014264A1 (en) 1990-10-12
DE69031803T2 (de) 1998-07-09
ES2111536T3 (es) 1998-03-16
JPH0773500B1 (https=) 1995-08-09
IL94053A (en) 2001-04-30
AU5437390A (en) 1990-11-05
DE69031803D1 (de) 1998-01-22

Similar Documents

Publication Publication Date Title
US5268274A (en) Methods and nucleic acid sequences for the expression of the cellulose synthase operon
KR930007579B1 (ko) 선택된 유전자를 박테리아의 염색체상에 통합시키는 방법 및 그 방법에 따라 얻어진 박테리아
Koronakis et al. The secreted hemolysins of Proteus mirabilis, Proteus vulgaris, and Morganella morganii are genetically related to each other and to the alpha-hemolysin of Escherichia coli
Matsuyama et al. Promoter exchange between ompF and ompC, genes for osmoregulated major outer membrane proteins of Escherichia coli K-12
Babcock et al. Cloning of DNA involved in sporulation of Streptomyces griseus
JPH028714B2 (https=)
CA2014264C (en) Methods and nucleic acid sequences for the expression of the cellulose synthase operon
JPH03103193A (ja) ホスフィノトリシン耐性遺伝子の使用
WO1993011244A1 (en) Cyclic di-guanylate metabolic enzymes
JPH05292977A (ja) バシラス・サチリス染色体dna領域
CN111117942A (zh) 一种产林可霉素的基因工程菌及其构建方法和应用
CA1338138C (en) Recombinant-dna mediated production of xanthan gum
CA2093152C (en) Integrative gene-expression in food-grade microorganisms
JPH04503456A (ja) セルロースシンターゼオペロンの表現のための方法及び核酸配列
US5559015A (en) Recombinant-DNA mediated production of xanthan gum
US6057146A (en) Microorganisms for the stabilization of plasmids
EP0233019B1 (en) Recombinant dna plasmid for xanthan gum synthesis
EP0316677A2 (en) Method for cloning in lactic acid bacteria
JPS62155081A (ja) 新規微生物およびそれを用いる醗酵法によるビオチンの製造法
US5242809A (en) Gal operon of streptomyces
CA2331924A1 (en) Propionibacterium vector
EP0235112B1 (en) The gal operon of streptomyces
Juarez et al. Study of regulation and transport of hemolysin by using fusion of the beta-galactosidase gene (lacZ) to hemolysin genes
US5858745A (en) Bacillus thuringiensis transformation method
JPH0753592A (ja) エレファマイシン耐性変異体

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU FI JP NO

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

AK Designated states

Kind code of ref document: A3

Designated state(s): AU FI JP NO

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1990906539

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1990906539

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1990906539

Country of ref document: EP