WO1988010303A1 - Preparation of novel protein sweeteners - Google Patents

Preparation of novel protein sweeteners Download PDF

Info

Publication number
WO1988010303A1
WO1988010303A1 PCT/KR1988/000010 KR8800010W WO8810303A1 WO 1988010303 A1 WO1988010303 A1 WO 1988010303A1 KR 8800010 W KR8800010 W KR 8800010W WO 8810303 A1 WO8810303 A1 WO 8810303A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna sequence
sequence
monellin
terminus
transcriptional
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR1988/000010
Other languages
English (en)
French (fr)
Inventor
Joong Myung Cho
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LG Biomedical Institute
LG Corp
Original Assignee
Lucky Ltd
Lucky Biotech Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lucky Ltd, Lucky Biotech Corp filed Critical Lucky Ltd
Priority to BR888807102A priority Critical patent/BR8807102A/pt
Priority to KR1019890700263A priority patent/KR910008642B1/ko
Priority to AU19397/88A priority patent/AU619193B2/en
Priority to PCT/KR1988/000010 priority patent/WO1988010303A1/en
Priority to IN460/CAL/88A priority patent/IN168525B/en
Publication of WO1988010303A1 publication Critical patent/WO1988010303A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C07K14/43Sweetening agents, e.g. thaumatin, monellin

Definitions

  • Novel proteinacious sweeteners are provided produced by recombinant techniques.
  • Monellin is an intensely sweet material present in the sap of "Serendipity Berries", the fruit of the West African plant, Dioscoreophyllum comminisii. The material has been purified to homogeneity and shown to be a basic protein with a molecular weight of about 1.1 x 10 4 and is completely free of carbohydrate. Monellin is the first well characterized material among several sweet or taste modifying substances found in tropical plants. It has. been characterized and shown to have two subunits of about the same size held together by non-covalent bonds. The two subunits are not identical and the flavor modifying ability of monellin is dependent upon the presence of both subunits and a single mercaptan group, which if blocked abolishes the sweetness.
  • Novel DNA open reading frames, constructs employing the open reading frames and expression systems are provided for expressing novel proteins having sweetening capability, where the proteins employ a substantial proportion of the amion acid sequence of monellin.
  • the proteins are a single molecule as distinct from the two subunits of monellin, so as to define a single sequence.
  • Novel proteinacious sweeteners methods for their production, and intermediates used in the methods, particularly nucleic acid intermediates are provided.
  • the sweeteners are modelled after the naturally occurring sweetener monellin, where the two independent subunits of monellin are joined together in a continuous sequence.
  • the two subunits may be joined end to end, by modifying the amino acids adjacent the juncture between the two subunits, or by introducing a short bridge extending the sequence.
  • the amino acid sequence will be in substantial part the amino acid sequence of the subunits of monellin, usually having at least about 80% homology with the monellin sequence, more usually at least about 90% homology with the monellin sequence.
  • the sequence may be varied by insertions, deletions, or substitutions, where insertions and deletions will usually not exceed about 9 amino acids, more usually not exceed about 6 amino acids, and substitu- tions may be conservative or non-conservative, where the following table indicates as conservative substitutions those amino acid on the same line.
  • polar amino acids will not be substituted for non-polar amino acids and aliphatic amino acids will not be substituted for aromatic amino acids.
  • the protein may have either subunit II or subunit I as the N-terminus, particularly subunit II. Depending on the construction, the product may or may not have an N- terminal methionine.
  • the two subunits may be joined by a short bridge, usually of not more than 10, usually not more than 8 amion acids, or may be joined directly, or preferably the amino acids at. the juncture will be modified.
  • the amino acids at the juncture forming the bridge will provide for a polar juncture, that is, at least 50 number %, usually at least about 75 number % of the amino acids will be polar and conveniently, at least about 25 number %, generally about 50 number % will be amino acids naturally present at the subunit terminal.
  • the amino acids may come from a loop of subunit I.
  • the juncture will include as a bridge not more than about 10, usually not more than about 6 amino acids of the naturally occurring sequence of the subunits.
  • the juncture will be at He(46) of subunit II and Gly(6) of subunit 1 with the intervening amino acids, if any, as the bridge.
  • subunit II is the N-terminus
  • one or more of the wild-type amino acids at the juncture may be removed or substituted, usually not more than about 10 amino acids will be removed or substituted, more usually not more than about 6 amino acids. Generally not more than 75% of the removed or substituted amino acids will be associated with one of the subunits.
  • Bridges of interest will include : where only one amino acid need be present, and the individual amino acids as defined are as follows : aa 1 is A, D, E, K, R or Y ; aa 2 is Y, A, D, E, N, Q, R, T or S ; aa 3 is N, Q, S, T, D, E, R or Y ; aa 4 is F, W, Y, S, T, D, E, K or R ; aa 5 is D, E, K, R, L or T ; aa 6 is D, E, V, 1, L, K or R ; aa 7 is G, A, V, I, L, K or R ; aa 6 is K or R ; where x is 0 or 1, at least one x being 1.
  • compositions of interest include sequences where : aa 1 is Y or E ; aa 2 is D, E, Y or K ; aa 3 is N, T, A or Y ; aa 4 is R, S, K or E ; aa 5 is E, D or T ; aa 6 is K, D or R ; aa 7 is G, I or L ; aa 8 is K or R ;
  • aa 1 is Y or E
  • aa 2 is D, E, Y or K
  • aa 3 is N, T, A or Y
  • aa 4 is R, S, K or E
  • aa 5 is E, D or T
  • aa 6 is K, D or R
  • aa 7 is G, I or L
  • aa 8 is K or R ;
  • For sequences having the first two amino acids Y and E there may be from 0 to 4 x's plus y that are 0, while for chains having different amino acids
  • the above chains will usually be from 3 to 8, more usually 4 to 8 amino acids.
  • removal of the phenylalanine where the juncture will be Y-E-N-E-R-E-I-K.
  • Other bridges include Y-E-N-R-E-D-I-K ; Y-K-T-R-E-D-I-K ; Y-E-R-E-I-K ; Y- E-N-I-K ; Y-E-I-K ; Y-Y-A-S-D-K-L-K ; Y-A-S-D-K-L ; Y-A-S-D-K ; Y-S-D-K ; E-D-Y-K-T-R-G-R ; and E-D-Y-T-R.
  • Y, E, D, K or R there will be at least one Y, E, D, K or R present in the chain, more usually at least one of E, D, K or R.
  • Preferred amino acids for the bridge are Y, I, S, T, D, E, K, R, N or Q, where greater than 50% of the amino acids of the bridge will be selected from this group.
  • the total number of changes, insertions, deletions, and substitutions will generally not exceed a total of 12, more usually 10 amino acids, where substitutions will be counted first, followed by deletions or insertions to arrive at the total.
  • compositions can be prepared by recombinant technology.
  • a gene In order to provide for expression, a gene must be provided. Sequences for subunits I and II may be obtained from the natural source as genomic DNA or cDNA. Alternatively, a strategy may be developed for preparing single stranded sequences which may be ligated together to provide the desired double-strand. The sequences are designed to minimize heteroduplexing, so as to substantially insure that the resulting ligated double-strand DNA has the proper open reading frame. The strategy employed in the Experimental section is particularly preferred. Once the double-stranded sequence has been designed, the various single-stranded fragments may be synthesized and ligated together in accordance with conventional techniques. The coding region may then be used to prepare an expression cassette.
  • the expression cassette will comprise a trans- criptional and translational initiation regulatory region at the 5' terminus in the direction of transcription of the open reading frame and a translational and transcriptional termination region at the 3' terminus of the open reading frame in the direction of transcription.
  • vectors which include transcrip- tional and translational regulatory regions of a wide variety of genes, where the initiation and termination regions are separated by a polylinker, so that an open reading frame may be inserted between the initiation and termination regions to be under their transcriptional and translational regulation.
  • vectors are commercially available or have been described in the literature and may be prepared from available segments having the necessary functions.
  • the vectors will include a replication system, which may be low or high copy number , usually having copy numbers of fewer than about 1000, although in certain situations, runaway vectors may be employed.
  • Alternatively, instead of having extrachromosomal maintenance one may provide for homology between the vector and the host genome, to enhance the opportunity for integration. Where integration is involoved, one may provide for an amplifying gene in tandem with the expression cassette.
  • Amplifying genes include dihydrofolate reductase, the metallo- thioneins, thymidine kinase, or the like. These genes will be accompanied with an appropriate transcriptional and translational regulatory region to provide for expression in the expression host. With prokaryotes, a polycistronic message may be employed, where the amplifying gene and the sweetener gene may be under the regulation of the same transcriptional and translational regulatory regions.
  • the vector will include a marker which allows for selection of those host cells containing the expression cassette for expressing the subject protein.
  • Markers may include biocide resistance, particularly from antibiotics, heavy metals, or the like; complementarity to an auxotrophic host to provide prototrophy; resistance to viral infection; etc.
  • One or more markers may be present, particularly where one marker is used for insertion of the construct, so that loss of the particular capability will indicate the presence of the expression cassette.
  • Transcription intiation regions which may be employed include those associated with such genes as trp, lac, gal, his ; or viral promoters such as ⁇ P L , ⁇ P R and P 4 promoters, yeast promoters such as those associated with the genes adh-1, adh-2, mat, gal, pgk, pyk, pho5, mA, gapdh, amy or dbfr, etc. Joint promoter regions may be employed, such as the tac, adh- 2/gapdh, gal/gapdh, cye/gal transcriptional initiation regions. See, for example, U. S. Patent Nos. 4,418,149 ; 4,304,863 ; 4,350,764 ; 4,363,877 and 4,366, 246.
  • Specialty sequences may also be used, such as enhancers, to enhance the level of transcription.
  • enhancers have been reported in the literature associated with a wide variety of genes in a range of hosts.
  • signal leader Another specialty sequence is a signal leader, which provides for secretion and processing of the protein. Again, a large number of signal leaders have been described in the literature and have been shown to be effective with a broad spectrum of proteins. Thus, if one signal leader is not efficient, other available signal leaders may be tried. As exemplary of signal sequences are U.S. Patent Nos. 4,336,336; 4,338,397 ; and 4,546,082.
  • the precursor protein will include the signal sequence, the processing signal, and the protein sweetener in going from the N- to the C-terminus, where the signal sequence and processing signal will be enzymatically removed as the precursor protein is secreted.
  • a number of processing signals are known, based on the host and the enzymatic system employed for secretion and processing whereby the signal sequence is removed.
  • a wide variety of hosts may be employed, both prokaryotic and eukaryotic. Common hosts which are exemplary include E. coli, B. subtilis, B.
  • microbial expression hosts will be employed, particularly procaryotic. Depending upon the nature of the host, various techniques may be employed for transforming the expression host with the expression cassette, either by itself, or as part of a vector or other construct. The introduction of the expression cassette may be as a result of conjugation, transformation, transfection, transduction, fusion, etc. Intact host cells, protoplasts, partially regenerated protoplasts, or the like may be employed for the introduction of the exogenous DNA.
  • the host may then be grown in a selective medium, so as to select for those hosts having the marker or associated expression cassette.
  • the nutrient may contain a level of the antibiotic cytotoxic in the absence of the antibiotic resistance gene. In the case of auxotrophy complementation, the nutrient medium lacks the necessary metabolite.
  • the product is produced and retained in the cytoplasm, after sufficient time for the cells to grow, the cells may .be lysed and the desired protein obtained by conventional purification procedures. These procedures included liquid-liquid extraction, HPLC, chromatography, electrophoresis, etc. The product may then be subjected to further purification, such as gel exclusion, chromatography, etc.
  • the resulting product may be used in a variety of ways as a sweetener. It may be used in canned products, in conjunction with various carbonated drinks, as a powder or liquid for addition to various beverages, such as coffee, tea, or the like, in cooking, chewing gum, toothpaste, mouthwash, dental hygiene products, pharma- ceuticals, meat products, e.g. ham, sausage, etc., instant soups, yogurt, desserts, cereals, animal food, etc.
  • the subject proteanase sweeteners may be formulated as a liquid or powder.
  • other additives may be combined, such as stabilizers, buffers, bactericides, protease inhibitors, or the like.
  • An aqueous medium will mormally be used where the sweetener will be from about 0.1 to 90 weight % of the composition.
  • various excipients may be added which are conventional food extenders.
  • the expression cassette can be prepared for use in plants. Particularly, expression cassettes can be prepared where a constitutive or regulated transcriptional initiation region functional in a plant may be employed, so that products, such as fruit, vegetables, melons, or the like may have enhanced sweetening.
  • Transcriptional initiation regions include the various opine initiation regions, such as octopine, mannopine, nopaline, etc.
  • plant viral transcription initiation regions may be employed, such as the cauliflower mosaic virus 35S promoter.
  • Other transcription initiation regions, particularly inducible regions, more particularly regions associated with cell differentiation include the small subunit or large subunit transcriptional initiation regions of ribulose-1,3-biphosphate carboxylase, fruit specific promoters, heat shock promoters, etc. The following examples are offered by way of illustration and not by way of limitation. Example
  • U1 TATGGGAGAATGGGAMTTATCGATATTGGACCATTCACTCAAAC ( 46mer)
  • U2 TTGGGTMGTTCGCTGTTGACGAAGAAACAAGATTGGTCAATAT ( 45mer)
  • U3 GGTAGATTGACTTTCAACAAGGTTATTAGACCATGTATGAAGAAG ( 45mer)
  • U4 ACTATTTACGAAMCGAMGAGAAATTAAGGGGTACGAATACCAA (45mer)
  • U5 TTGTATGTTTACCCTTCTGACMGCTTTTCAGAGCTGACATTTCT ( 45mer)
  • U6 GAAGACTACAAGACCCGCCGGTAGAAAGTTGTTGAGATTCAACGGT ( 45mer )
  • U7 CCAGTTCCACCACCATAATAG ( 21mer )
  • L1 CGATAATTTCCCATTCTCCCA ( 21mer )
  • L2 CGTCAACAGCGAACTTACCCAAGTTTTGAGTGAATGGTCCAATAT ( 45mer )
  • L3 CCITGTTGAAAGTCAATCTACCATATTGACAATCTTGTTTTCTT ( 45mer )
  • Each oligomer was phosphorylated at 37°C for 45 min. in a reaction mixture of 30 ⁇ 1 containing 50 mM Tris-HCl, pH 8.0, 10 mM MgCl 2 , 10 mM DTT, 1 mM ATP, and 5 units of T4 polynucleotide kinase.
  • Each reaction mixture was pooled, extracted by phenol/chloroform, precipitated with ethanol, and dried under Speed-Vac. The dried pellet was dissolved in 50 ⁇ 1 distilled water and 7 ⁇ 1 ligation buffer (0.2 M Tris-HCl, pH 7.5, 0.1 M MgCl 2 , 0.1 M DTT) added.
  • the solution was placed in a 95°C water-bath and cooled slowly to room-temperature overnight.
  • the reaction mixture was kept at room temperature for 10 min., extracted by phenol/chloroform, precipitated, dried and redissolved in 85 ⁇ 1 water.
  • the ligated oligomer mixture was treated with restriction endonuclease Ndel and Sail (New England Biolabs, Inc.).
  • the 290 base pair fragment was isolated by electrophoresis with a 7% polyacrylamide gel, the band electroeluted and purified using the Elutip-D column (S & S Co.).
  • M13mp19RF was used for cloning the fused synthetic monellin gene.
  • M13mp19RF was cut with Xbal/Sall (New England Biolabs, Inc.). The large fragment was isolated and purified as described previously. A synthetic Xbal/Ndel adaptor was synthesized.
  • the adaptor was purified as described above.
  • the Ndel/ Sall digested, annealed fused synthetic monellin DNA fragment was combined with Xbal/Sall-treated M13mpl9RF and Xbal/Ndel adaptor in 10 ⁇ 1 of 20 mM Tris-HCl, pH 7.5, 10 mM MgCla, 10 mM DTT, 200 units T4 DNA ligase (N. E. Biolabs, Inc.
  • M13mpl9 MON-1RF M13mpl9 MON-1RF.
  • the transformation was done by adding 5 ⁇ 1 of the ligation mixture to 200 ⁇ 1 of E. coli JM101 competent cells (Messing, J. Methods in Enzymology (1983) 101 : 20-78).
  • the dideoxy DNA sequencing and M13mpl9 NON-1RF preparation were done as described in Messing, J. (1983) Methods in Enzymology ; and Sanger, T. et al. Proc. Natl. Acad. Sci. USA (1985) 74 : 5463-5467.
  • Synthetic fused monellin DNA (293 bp) was isolated from M13mp19 M0N-1RF and purified.
  • the vector pDR720 containing trp 0, P (Pharmacia, Inc. ;Cat. # 27-4930-01) was digested with Smal/PvuII and blunt-end ligated to produce ptrp322.
  • the ptrp322 was digested with Hpal/ Sail and a 2.5 kbp large fragment isolated.
  • Hpal Ndel was synthesized using Applied Biosystems DNA Synthesizer Model 380B.
  • the ligation reaction of the 293 bp . synthetic fused monellin, Hpal/Sall-treated ptrp322 vector and the Hpal/Ndel synthetic adaptor was carried out in the presence of 10 ⁇ 1 of 20 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 , 10 mM DTT, and 200 units of T4 DNA ligase (N.E. Biolabs, Inc.) at 14°C overnight to give ptrp322H MON-1.
  • the transformation of E.coli W3110 (ATCC 27325) with this plasmid and screening of recombinant clones was done as described above.
  • Laemmli protein sample buffer was added to the cell pellet, followed by heating at 95°C for 5min. and the DNA loaded onto a 15% Laemmli SDS-polyacrylamide gel (Laemmli, Nature (1970) 227 : 680-685). The electrophoresis was run at 300 for 2.5 hours. The gel was stained with Coomassie blue brilliant dye demonstrating a product having the correct molecular weight. The expressed product was isolated and shown to have a sweet taste. Following the above procedures, modified DNA sequences were prepared, where the amino acids at the juncture were varied. The following sequences indicate the sequence joining the isoleucine of subunit II(amino acid 46), (Bohak and Lee, supra, numbering) to the glycine (amino acid 6) of subunit I.
  • codons employed were the same as the codons indicated for the MON-1 construct, with the exception of the sequence indicated as 3, where codons preferred by S. cerevisiae glycolytic enzymes were employed. That sequence is AAG, ACT, AGA.
  • novel proteinacious sweetners based on the monellin sequence may be produced as a stable single-chain protein for use in a wide variety of ways.
  • the product can be produced efficiently and economically by employing microbial hosts, so that a stable uniform supply of the sweetener can be obtained, as distinct from isolation from natural sources.
  • various changes may be made in the structure of the amino acid, without affecting its sweetening characteristic, while providing for other advantages, such as chemical and physical stabilty, storage life, ease of formulation and purification, enhancement of sweetness, etc.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Botany (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Seasonings (AREA)
PCT/KR1988/000010 1987-06-19 1988-06-02 Preparation of novel protein sweeteners Ceased WO1988010303A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
BR888807102A BR8807102A (pt) 1987-06-19 1988-06-02 Preparacao de novos adocantes de proteina
KR1019890700263A KR910008642B1 (ko) 1987-06-19 1988-06-02 신규한 단백질 감미료의 제조방법
AU19397/88A AU619193B2 (en) 1987-06-19 1988-06-02 Preparation of novel protein sweeteners - monellin type
PCT/KR1988/000010 WO1988010303A1 (en) 1987-06-19 1988-06-02 Preparation of novel protein sweeteners
IN460/CAL/88A IN168525B (enExample) 1987-06-19 1988-06-06

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US6434187A 1987-06-19 1987-06-19
US064,341 1987-06-19
PCT/KR1988/000010 WO1988010303A1 (en) 1987-06-19 1988-06-02 Preparation of novel protein sweeteners

Publications (1)

Publication Number Publication Date
WO1988010303A1 true WO1988010303A1 (en) 1988-12-29

Family

ID=22055274

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR1988/000010 Ceased WO1988010303A1 (en) 1987-06-19 1988-06-02 Preparation of novel protein sweeteners

Country Status (9)

Country Link
EP (1) EP0323489A1 (enExample)
JP (1) JPH02500717A (enExample)
KR (1) KR910008642B1 (enExample)
AU (1) AU619193B2 (enExample)
BR (1) BR8807102A (enExample)
ES (1) ES2012530A6 (enExample)
GR (1) GR1000110B (enExample)
IN (1) IN168525B (enExample)
WO (1) WO1988010303A1 (enExample)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990007580A1 (en) * 1988-12-29 1990-07-12 Lucky, Ltd. Expression of proteinaceous sweeteners in yeast
US5234834A (en) * 1987-06-19 1993-08-10 The Regents Of The University Of California Constructs for expression of monellin in plant cells
US5739409A (en) * 1987-06-19 1998-04-14 The Regents Of The University Of California Endogenously sweetened transgenic plant products

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3998798A (en) * 1972-12-22 1976-12-21 The Trustees Of The University Of Pennsylvania Monellin, a sweet polypeptide derived from fruit of dioscoreophyllum cumminsii
EP0054330A2 (en) * 1980-12-12 1982-06-23 Unilever N.V. DNA sequences encoding various allelic forms of mature thaumatin, recombinant plasmids comprising said DNA's and a process for their preparation, bacterial cultures comprising said recombinant plasmids, and method for producing mature thaumatin
WO1987003007A1 (en) * 1985-11-13 1987-05-21 Beatrice Companies, Inc. DNA ENCODING ADAsp113 BD AND ADLys46, Asp113 BD THAUMATIN I

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988010265A1 (en) * 1987-06-19 1988-12-29 The Regents Of The University Of California A new class of low calorie protein sweeteners
JPH02500641A (ja) * 1987-06-19 1990-03-08 ラッキー バイオテク コーポレイション 新規タンパク質性甘味剤の製造

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3998798A (en) * 1972-12-22 1976-12-21 The Trustees Of The University Of Pennsylvania Monellin, a sweet polypeptide derived from fruit of dioscoreophyllum cumminsii
EP0054330A2 (en) * 1980-12-12 1982-06-23 Unilever N.V. DNA sequences encoding various allelic forms of mature thaumatin, recombinant plasmids comprising said DNA's and a process for their preparation, bacterial cultures comprising said recombinant plasmids, and method for producing mature thaumatin
WO1987003007A1 (en) * 1985-11-13 1987-05-21 Beatrice Companies, Inc. DNA ENCODING ADAsp113 BD AND ADLys46, Asp113 BD THAUMATIN I

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Biochemical and Biophysical Research Communications, Volume 71, No. 1, issued 1976 (New York, London), G. HUDSON et al. "Mass Spectrometric Sequencing of Proteins: The Structure of Subunit I of Monellin", see pages 212-220. *
FEBS Letters, Volume 29, No. 2, issued January 1973 (Amsterdam), H. VAN DER WEL et al. "Characterization of the Sweet-Tasting Protein from Dioscoreophyllum Cumminisii (Stapf) Diels", see pages 181-184; especially page 181, Introduction; page 183, tables 1, 3. *
Science, Volume 181, No. 4094, issued July 6, 1973 (Washington DC.), R.H. CAGAN "Chemostimulatory Protein: A New Type of Taste Stimulus", see pages 32-35. *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5234834A (en) * 1987-06-19 1993-08-10 The Regents Of The University Of California Constructs for expression of monellin in plant cells
US5739409A (en) * 1987-06-19 1998-04-14 The Regents Of The University Of California Endogenously sweetened transgenic plant products
WO1990007580A1 (en) * 1988-12-29 1990-07-12 Lucky, Ltd. Expression of proteinaceous sweeteners in yeast

Also Published As

Publication number Publication date
ES2012530A6 (es) 1990-04-01
IN168525B (enExample) 1991-04-20
AU1939788A (en) 1989-01-19
EP0323489A1 (en) 1989-07-12
JPH02500717A (ja) 1990-03-15
AU619193B2 (en) 1992-01-23
BR8807102A (pt) 1989-10-17
KR910008642B1 (ko) 1991-10-19
GR1000110B (el) 1991-06-07
KR890701740A (ko) 1989-12-21
GR880100384A (en) 1989-03-08

Similar Documents

Publication Publication Date Title
US5811654A (en) Plants genetically enhanced for nutritional quality
CA1321157C (en) Plants genetically enhanced for disease resistance
US5721114A (en) Expression system for producing apolipoprotein AI-M
US5487983A (en) Expression systems for making single-chain monellin analogs
US5118792A (en) Ice crystal growth suppression polypeptides and method of making
CA2185343A1 (en) Enhanced secretion of polypeptides
EP0472662A1 (en) Antifreeze polypeptides
Edens et al. Microbial synthesis of the sweet-tasting plant protein thaumatin
KR100981087B1 (ko) 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중변이체의 제조방법
EP3407733B1 (en) Process for extracellular secretion of brazzein
EP0374157B1 (en) A new class of low calorie protein sweeteners
Berish et al. Expression of a functional neisserial fbp gene in Escherichia coli
AU618011B2 (en) Preparation of novel protein sweeteners-monellin type
WO1988010303A1 (en) Preparation of novel protein sweeteners
US5478923A (en) Class of low calorie protein sweeteners
US6054291A (en) Expression vectors for enhanced production of polypeptides, plasmids containing the vectors, hosts containing the plasmids, products manufactured thereby and related methods
JP2715000B2 (ja) 蛋白質甘味料の酵母中における発現
HU214698B (hu) Eljárás rekombináns deszulfátó-hirudin HV-1 peptidek előállítására
Nikaidou et al. Molecular cloning and nucleotide sequence of a pectin lyase gene from Pseudomonasmarginalis N6301
JP2003079379A (ja) 成長ホルモンの高発現用dnaおよびその使用
WO1992014826A1 (en) Bacillus thuringiensis-promoter
US5882884A (en) Expression of proteinaceous sweeteners in yeast
NO864206L (no) Derivat av interleukin-2, dets fremstilling og anvendelse.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BR JP KR

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1988905001

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1988905001

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1988905001

Country of ref document: EP