WO1988010303A1

WO1988010303A1 - Preparation of novel protein sweeteners

Info

Publication number: WO1988010303A1
Application number: PCT/KR1988/000010
Authority: WO
Inventors: Joong Myung Cho
Original assignee: Lucky, Ltd.; Lucky Biotech Corporation
Priority date: 1987-06-19
Filing date: 1988-06-02
Publication date: 1988-12-29
Also published as: GR880100384A; JPH02500717A; GR1000110B; KR890701740A; IN168525B; AU1939788A; KR910008642B1; EP0323489A1; BR8807102A; AU619193B2; ES2012530A6

Abstract

Novel proteinacious sweeteners are provided comprising an amino acid sequence based on the sequences of monellin subunits. The single protein may be prepared by recombinant techniques, to provide for a stable strong sweetening agent, which may be utilized in a wide variety of contexts.

Description

PREPARATION OF NOVEL PROTEIN SWEETENERS

TECHNICAL FIELD

Novel proteinacious sweeteners are provided produced by recombinant techniques.

BACKGROUND ART

Monellin is an intensely sweet material present in the sap of "Serendipity Berries", the fruit of the West African plant, Dioscoreophyllum comminisii. The material has been purified to homogeneity and shown to be a basic protein with a molecular weight of about 1.1 x 10⁴ and is completely free of carbohydrate. Monellin is the first well characterized material among several sweet or taste modifying substances found in tropical plants. It has. been characterized and shown to have two subunits of about the same size held together by non-covalent bonds. The two subunits are not identical and the flavor modifying ability of monellin is dependent upon the presence of both subunits and a single mercaptan group, which if blocked abolishes the sweetness.

Because of the uncertainties and cost of extracting natural products from plant sources, an alternative route to the production of protein sweetners is of substantial interest. Recombinant techniques offer an opportunity to synthesize proteins of varying types. However, in employing recombinant techniques, one is required to develop a strategy for producing the gene, demonstrate successful expression of the protein in a cellular host, and isolate a product which is shown to have physiological activity. In many instances, it is necessary or desirable to modify the naturally occurring sequence, which substantially increases the uncertainties of success of the production of a useful product.

The relevant literatures are as follows : Morris et al., J. Biol. Cheia. ( 1973 ) 248 : 534-539 describe the characterization of monellin. See also Cagan, Science (1973) 181 : 32-35 ; Wlodawer and Hodgson, Proc. Natl. Acad. Sci. USA (1975) 72: 398-399 ; Bohak and Li, Biochimica et Biophysica Acta (1976) 427 : 153-170 ; Hudson and Bieman, Biochem. Biophys. Res. Comrn. ( 1976 ) 71: 212-220 ; Jirgenson, Biochem. Biophys. Acta (1976) 446 : 255-261 ; and Van der Wei and Loeve, FEBS Lett. (1973) 29: 181-183 for further characterization. U.S. Patent No. 3,998,798 describes the preparation of natural monellin.

SUMMARY OF THE INVENTION

Novel DNA open reading frames, constructs employing the open reading frames and expression systems are provided for expressing novel proteins having sweetening capability, where the proteins employ a substantial proportion of the amion acid sequence of monellin. The proteins are a single molecule as distinct from the two subunits of monellin, so as to define a single sequence.

DISCLOSURE OF INVENTION

Novel proteinacious sweeteners, methods for their production, and intermediates used in the methods, particularly nucleic acid intermediates are provided. The sweeteners are modelled after the naturally occurring sweetener monellin, where the two independent subunits of monellin are joined together in a continuous sequence. The two subunits may be joined end to end, by modifying the amino acids adjacent the juncture between the two subunits, or by introducing a short bridge extending the sequence.

The amino acid sequence will be in substantial part the amino acid sequence of the subunits of monellin, usually having at least about 80% homology with the monellin sequence, more usually at least about 90% homology with the monellin sequence. The sequence may be varied by insertions, deletions, or substitutions, where insertions and deletions will usually not exceed about 9 amino acids, more usually not exceed about 6 amino acids, and substitu- tions may be conservative or non-conservative, where the following table indicates as conservative substitutions those amino acid on the same line. For the most part, polar amino acids will not be substituted for non-polar amino acids and aliphatic amino acids will not be substituted for aromatic amino acids. Amino Acids

Aliphatic non-polar

G, A, P V, I, L polar neutral

S, T, C, M, N, Q charged basic

K, R, H acidic

D, E Aromatic F, W, Y For the most part, conservative substitutions will be preferred and the cysteine and methionine at positions 41 and 42 of subunit II will be retained. (In the numbering of amino acids relating to monellin as distinct from the subject constructions, the numbering of the natural monellin subunits will be employed.) The protein may have either subunit II or subunit I as the N-terminus, particularly subunit II. Depending on the construction, the product may or may not have an N- terminal methionine. The two subunits may be joined by a short bridge, usually of not more than 10, usually not more than 8 amion acids, or may be joined directly, or preferably the amino acids at. the juncture will be modified. The amino acids at the juncture forming the bridge will provide for a polar juncture, that is, at least 50 number %, usually at least about 75 number % of the amino acids will be polar and conveniently, at least about 25 number %, generally about 50 number % will be amino acids naturally present at the subunit terminal. The amino acids may come from a loop of subunit I. In referring to the juncture, the juncture will include as a bridge not more than about 10, usually not more than about 6 amino acids of the naturally occurring sequence of the subunits. For the joining of the C-terminus of subunit II with the N-terminus of subunit I, the juncture will be at He(46) of subunit II and Gly(6) of subunit 1 with the intervening amino acids, if any, as the bridge. Where subunit II is the N-terminus, one or more of the wild-type amino acids at the juncture may be removed or substituted, usually not more than about 10 amino acids will be removed or substituted, more usually not more than about 6 amino acids. Generally not more than 75% of the removed or substituted amino acids will be associated with one of the subunits.

Bridges of interest will include :

where only one amino acid need be present, and the individual amino acids as defined are as follows : aa¹ is A, D, E, K, R or Y ; aa² is Y, A, D, E, N, Q, R, T or S ; aa³ is N, Q, S, T, D, E, R or Y ; aa⁴ is F, W, Y, S, T, D, E, K or R ; aa⁵ is D, E, K, R, L or T ; aa⁶ is D, E, V, 1, L, K or R ; aa⁷ is G, A, V, I, L, K or R ; aa⁶ is K or R ; where x is 0 or 1, at least one x being 1.

Compositions of interest include sequences where : aa¹ is Y or E ; aa² is D, E, Y or K ; aa³ is N, T, A or Y ; aa⁴ is R, S, K or E ; aa⁵ is E, D or T ; aa⁶ is K, D or R ; aa⁷ is G, I or L ; aa⁸ is K or R ; For sequences having the first two amino acids Y and E, there may be from 0 to 4 x's plus y that are 0, while for chains having different amino acids as the first two amino acids there may be form 0 to 5 x's plus y that are 0. That is, the above chains will usually be from 3 to 8, more usually 4 to 8 amino acids. Of particular interest is removal of the phenylalanine where the juncture will be Y-E-N-E-R-E-I-K. Other bridges include Y-E-N-R-E-D-I-K ; Y-K-T-R-E-D-I-K ; Y-E-R-E-I-K ; Y- E-N-I-K ; Y-E-I-K ; Y-Y-A-S-D-K-L-K ; Y-A-S-D-K-L ; Y-A-S-D-K ; Y-S-D-K ; E-D-Y-K-T-R-G-R ; and E-D-Y-T-R. Usually there will be at least one Y, E, D, K or R present in the chain, more usually at least one of E, D, K or R. Preferred amino acids for the bridge are Y, I, S, T, D, E, K, R, N or Q, where greater than 50% of the amino acids of the bridge will be selected from this group.

The total number of changes, insertions, deletions, and substitutions will generally not exceed a total of 12, more usually 10 amino acids, where substitutions will be counted first, followed by deletions or insertions to arrive at the total.

The subject compositions can be prepared by recombinant technology. In order to provide for expression, a gene must be provided. Sequences for subunits I and II may be obtained from the natural source as genomic DNA or cDNA. Alternatively, a strategy may be developed for preparing single stranded sequences which may be ligated together to provide the desired double-strand. The sequences are designed to minimize heteroduplexing, so as to substantially insure that the resulting ligated double-strand DNA has the proper open reading frame. The strategy employed in the Experimental section is particularly preferred. Once the double-stranded sequence has been designed, the various single-stranded fragments may be synthesized and ligated together in accordance with conventional techniques. The coding region may then be used to prepare an expression cassette. The expression cassette will comprise a trans- criptional and translational initiation regulatory region at the 5' terminus in the direction of transcription of the open reading frame and a translational and transcriptional termination region at the 3' terminus of the open reading frame in the direction of transcription.

Today, there are many vectors which include transcrip- tional and translational regulatory regions of a wide variety of genes, where the initiation and termination regions are separated by a polylinker, so that an open reading frame may be inserted between the initiation and termination regions to be under their transcriptional and translational regulation. Depending upon the particular expression host, vectors are commercially available or have been described in the literature and may be prepared from available segments having the necessary functions. For the most part, the vectors will include a replication system, which may be low or high copy number , usually having copy numbers of fewer than about 1000, although in certain situations, runaway vectors may be employed. Alternatively, instead of having extrachromosomal maintenance, one may provide for homology between the vector and the host genome, to enhance the opportunity for integration. Where integration is involoved, one may provide for an amplifying gene in tandem with the expression cassette.

Amplifying genes include dihydrofolate reductase, the metallo- thioneins, thymidine kinase, or the like. These genes will be accompanied with an appropriate transcriptional and translational regulatory region to provide for expression in the expression host. With prokaryotes, a polycistronic message may be employed, where the amplifying gene and the sweetener gene may be under the regulation of the same transcriptional and translational regulatory regions.

Usually, the vector will include a marker which allows for selection of those host cells containing the expression cassette for expressing the subject protein. Markers may include biocide resistance, particularly from antibiotics, heavy metals, or the like; complementarity to an auxotrophic host to provide prototrophy; resistance to viral infection; etc. One or more markers may be present, particularly where one marker is used for insertion of the construct, so that loss of the particular capability will indicate the presence of the expression cassette.

Transcription intiation regions which may be employed include those associated with such genes as trp, lac, gal, his ; or viral promoters such as λP_L, λP_R and P₄ promoters, yeast promoters such as those associated with the genes adh-1, adh-2, mat, gal, pgk, pyk, pho5, mA, gapdh, amy or dbfr, etc. Joint promoter regions may be employed, such as the tac, adh- 2/gapdh, gal/gapdh, cye/gal transcriptional initiation regions. See, for example, U. S. Patent Nos. 4,418,149 ; 4,304,863 ; 4,350,764 ; 4,363,877 and 4,366, 246.

Specialty sequences may also be used, such as enhancers, to enhance the level of transcription. A wide variety of enhancers have been reported in the literature associated with a wide variety of genes in a range of hosts.

Another specialty sequence is a signal leader, which provides for secretion and processing of the protein. Again, a large number of signal leaders have been described in the literature and have been shown to be effective with a broad spectrum of proteins. Thus, if one signal leader is not efficient, other available signal leaders may be tried. As exemplary of signal sequences are U.S. Patent Nos. 4,336,336; 4,338,397 ; and 4,546,082.

The signal sequence, if any, will be joined to the open reading frame coding for the sweetener at its 5' terminus and will provide the methionine codon, where the open reading frame will be in proper reading phase with the methionine. Thus, the precursor protein will include the signal sequence, the processing signal, and the protein sweetener in going from the N- to the C-terminus, where the signal sequence and processing signal will be enzymatically removed as the precursor protein is secreted. A number of processing signals are known, based on the host and the enzymatic system employed for secretion and processing whereby the signal sequence is removed. A wide variety of hosts may be employed, both prokaryotic and eukaryotic. Common hosts which are exemplary include E. coli, B. subtilis, B. licheniformis, S. cerevisie, K. lactis, N. crassa, Streptomyces, Aspergillis niger, and the like. Other members of each of the genera may also be employed. For the most part, microbial expression hosts will be employed, particularly procaryotic. Depending upon the nature of the host, various techniques may be employed for transforming the expression host with the expression cassette, either by itself, or as part of a vector or other construct. The introduction of the expression cassette may be as a result of conjugation, transformation, transfection, transduction, fusion, etc. Intact host cells, protoplasts, partially regenerated protoplasts, or the like may be employed for the introduction of the exogenous DNA. Once the host has been transformed, it may then be grown in a selective medium, so as to select for those hosts having the marker or associated expression cassette. Where antibiotic resistance is involved, the nutrient may contain a level of the antibiotic cytotoxic in the absence of the antibiotic resistance gene. In the case of auxotrophy complementation, the nutrient medium lacks the necessary metabolite. Where the product is produced and retained in the cytoplasm, after sufficient time for the cells to grow, the cells may .be lysed and the desired protein obtained by conventional purification procedures. These procedures included liquid-liquid extraction, HPLC, chromatography, electrophoresis, etc. The product may then be subjected to further purification, such as gel exclusion, chromatography, etc.

The resulting product may be used in a variety of ways as a sweetener. It may be used in canned products, in conjunction with various carbonated drinks, as a powder or liquid for addition to various beverages, such as coffee, tea, or the like, in cooking, chewing gum, toothpaste, mouthwash, dental hygiene products, pharma- ceuticals, meat products, e.g. ham, sausage, etc., instant soups, yogurt, desserts, cereals, animal food, etc.

The subject proteanase sweeteners may be formulated as a liquid or powder. As a liquid, other additives may be combined, such as stabilizers, buffers, bactericides, protease inhibitors, or the like. An aqueous medium will mormally be used where the sweetener will be from about 0.1 to 90 weight % of the composition. For powders, various excipients may be added which are conventional food extenders. Rather than providing the sweetener as an independent product, the expression cassette can be prepared for use in plants. Particularly, expression cassettes can be prepared where a constitutive or regulated transcriptional initiation region functional in a plant may be employed, so that products, such as fruit, vegetables, melons, or the like may have enhanced sweetening. A wide variety of constructs are described in the literature, demonstrating expression of a wide variety of genes in plants, using either constitutive or regulated transcriptional initiation regions. Transcriptional initiation regions include the various opine initiation regions, such as octopine, mannopine, nopaline, etc. Alternatively, plant viral transcription initiation regions may be employed, such as the cauliflower mosaic virus 35S promoter. Other transcription initiation regions, particularly inducible regions, more particularly regions associated with cell differentiation, include the small subunit or large subunit transcriptional initiation regions of ribulose-1,3-biphosphate carboxylase, fruit specific promoters, heat shock promoters, etc. The following examples are offered by way of illustration and not by way of limitation. Example

1. Oligonucleotide Synthesis and Purification

The following oligomers were synthesized using Applied Biosystems 38OB DNA Synthesizer.

5 5' -------> 3'

U1 : TATGGGAGAATGGGAMTTATCGATATTGGACCATTCACTCAAAC ( 46mer) U2 : TTGGGTMGTTCGCTGTTGACGAAGAAACAAGATTGGTCAATAT ( 45mer) U3 : GGTAGATTGACTTTCAACAAGGTTATTAGACCATGTATGAAGAAG ( 45mer) U4 : ACTATTTACGAAMCGAMGAGAAATTAAGGGGTACGAATACCAA (45mer) U5 : TTGTATGTTTACCCTTCTGACMGCTTTTCAGAGCTGACATTTCT ( 45mer)

U6 : GAAGACTACAAGACCCGCCGGTAGAAAGTTGTTGAGATTCAACGGT ( 45mer ) U7 : CCAGTTCCACCACCATAATAG ( 21mer ) L1 : CGATAATTTCCCATTCTCCCA ( 21mer )

L2 : CGTCAACAGCGAACTTACCCAAGTTTTGAGTGAATGGTCCAATAT ( 45mer ) L3 : CCITGTTGAAAGTCAATCTACCATATTGACAATCTTGTTTTCTT ( 45mer )

L4 : CTΗTTCGTTTTCGTAAATAGTCTTTCTTCATACATGGTCTAATAA ( 45mer )

L5 : TGTCAGAAGGTAAACATACAATTGGTATTCGTACCCCTTAATTT ( 45mer ) L6 : TACCGGGGTCTTGTAGTCTTCAGAMTGTCAGCTCTGAAMGCT ( 45mer ) L7 : TCGACTATTATGGTGGTGGAACTGGACCGTTGMTCTCMCAACTTTC (48mer ) The oligomers were isolated by urea-polyacrylamide gel electrophoresis and purified by passing through a Seppak C18 column (Whatman).

The following is the amino acid sequence encoded

by gene indicating the monellin subunits, the bridge,

and the ligation strategy.

(Ligation strategy)

Fused Monellin

Met Gly Glu Trp Glu He He Asp He Gly

Pro Phe Thr Gin Asn Leu Gly Lys Phe Ala

Val Asp Glu Glu Asn Lys He Gly Gin Tyr

Gly Arg Leu Thr Phe Asn Lys Val He Arg

Subunit II Pro Cys Met Lys Lys Thr He Tyr Glu Asn

Glu Arg Glu He Lys Gly Tyr Glu Tyr Gin

Subunit I Leu Tyr Val Tyr Ala Ser Asp Lys Leu Phe

Arg Ala Asp He Ser Glu Asp Tyr Lys Thr

Arg Gly Arg Lys Leu Leu Arg Phe Asn Gly

Pro Val Pro Pro Pro Ndel Sall

U1 U2 U3 U4 U5 U6 U7

L1 L2 L3 L4 L5 L6 L7

2. Annealing, Ligation of oligomers, and Isolation of Fused Monellin Gene

Each oligomer was phosphorylated at 37°C for 45 min. in a reaction mixture of 30 μ 1 containing 50 mM Tris-HCl, pH 8.0, 10 mM MgCl₂, 10 mM DTT, 1 mM ATP, and 5 units of T4 polynucleotide kinase. Each reaction mixture was pooled, extracted by phenol/chloroform, precipitated with ethanol, and dried under Speed-Vac. The dried pellet was dissolved in 50 μ 1 distilled water and 7 μ 1 ligation buffer (0.2 M Tris-HCl, pH 7.5, 0.1 M MgCl₂, 0.1 M DTT) added. The solution was placed in a 95°C water-bath and cooled slowly to room-temperature overnight. To the mixture was added 7 μ 1 of 10 mM ATP, 40 units of T4 DNA ligase (New England Biolab Inc. ) and 2 μ 1 of water. The reaction mixture was kept at room temperature for 10 min., extracted by phenol/chloroform, precipitated, dried and redissolved in 85 μ 1 water. The ligated oligomer mixture was treated with restriction endonuclease Ndel and Sail (New England Biolabs, Inc.). The 290 base pair fragment was isolated by electrophoresis with a 7% polyacrylamide gel, the band electroeluted and purified using the Elutip-D column (S & S Co.).

3. Molecular Cloning M13mp19RF was used for cloning the fused synthetic monellin gene. First, M13mp19RF was cut with Xbal/Sall (New England Biolabs, Inc.). The large fragment was isolated and purified as described previously. A synthetic Xbal/Ndel adaptor was synthesized.

Xbal Ndel

5' - CTTAGAMCTGCAATGTTGAATAAACGCTGATTΓΓCGATCA - 3' (40mer) 3' - TTTGACGTTACAACTTATTTGCGACTAAAAGCTAGTAT - 5 ' (38mer) The adaptor was purified as described above. The Ndel/ Sall digested, annealed fused synthetic monellin DNA fragment was combined with Xbal/Sall-treated M13mpl9RF and Xbal/Ndel adaptor in 10 μ 1 of 20 mM Tris-HCl, pH 7.5, 10 mM MgCla, 10 mM DTT, 200 units T4 DNA ligase (N. E. Biolabs, Inc. ) and incubated at 4°C overnight to provide M13mpl9 MON-1RF. The transformation was done by adding 5 μ 1 of the ligation mixture to 200 μ 1 of E. coli JM101 competent cells (Messing, J. Methods in Enzymology (1983) 101 : 20-78). The dideoxy DNA sequencing and M13mpl9 NON-1RF preparation were done as described in Messing, J. (1983) Methods in Enzymology ; and Sanger, T. et al. Proc. Natl. Acad. Sci. USA (1985) 74 : 5463-5467.

4. Construction of Expression Vector

Synthetic fused monellin DNA (293 bp) was isolated from M13mp19 M0N-1RF and purified. The vector pDR720 containing trp 0, P (Pharmacia, Inc. ;Cat. # 27-4930-01) was digested with Smal/PvuII and blunt-end ligated to produce ptrp322. The ptrp322 was digested with Hpal/ Sail and a 2.5 kbp large fragment isolated. A synthetic Hpal/Ndel adaptor, 5' - AACTAGTACGCAAGTΓCACGTAAAAAGGGTAATACA - 3' (36mer) 3' - TTGATCATGCGTTCAAGTGCATTTTTCCATTATGTAT - 5' (38mer)

Hpal Ndel was synthesized using Applied Biosystems DNA Synthesizer Model 380B. The ligation reaction of the 293 bp . synthetic fused monellin, Hpal/Sall-treated ptrp322 vector and the Hpal/Ndel synthetic adaptor was carried out in the presence of 10 μ 1 of 20 mM Tris-HCl, pH 7.5, 10 mM MgCl₂, 10 mM DTT, and 200 units of T4 DNA ligase (N.E. Biolabs, Inc.) at 14°C overnight to give ptrp322H MON-1. The transformation of E.coli W3110 (ATCC 27325) with this plasmid and screening of recombinant clones was done as described above.

5. Identification of Expression of Synthetic Fused

Monellin Gene

For a gene expression study, an overnight culture of 50 μ 1 of ptrp322H MON-1 in W3110 with Luria Broth was inoculated into 5 ml of M9 media containing 0.4% casamino acid, 10μ g/ml vitamin Bi, 40μ g/ml ampicillin and cultured at 37°C in a temperature controlled- shaking incubator until OD_650nm reached about 0.5. Then 0.1 mg of indoleacrylic acid was added to the reaction mixture to a concentration of 50 μ g/ml and the mixture incubated further for about 8 hrs. The cultured cells were pelleted at 2500 rpm for 5 min. in a Beckman J6 centrifuge. Laemmli protein sample buffer was added to the cell pellet, followed by heating at 95°C for 5min. and the DNA loaded onto a 15% Laemmli SDS-polyacrylamide gel (Laemmli, Nature (1970) 227 : 680-685). The electrophoresis was run at 300 for 2.5 hours. The gel was stained with Coomassie blue brilliant dye demonstrating a product having the correct molecular weight. The expressed product was isolated and shown to have a sweet taste. Following the above procedures, modified DNA sequences were prepared, where the amino acids at the juncture were varied. The following sequences indicate the sequence joining the isoleucine of subunit II(amino acid 46), (Bohak and Lee, supra, numbering) to the glycine (amino acid 6) of subunit I.

2. Y-E-N-R-E-D-I-K 8. Y-A-S-D-K-L 3. Y-K-T-R-E-D-I-K 9. Y-A-S-D-K

4. Y-E-R-E-I-K 10. Y-S-D-K

5. Y-E-N-I-K 11. E-D-Y-K-T-R-G-R

6. Y-E-I-K 12. E-D-Y-K-T-R 7. Y-Y-A-S-D-K-L-K

The codons employed were the same as the codons indicated for the MON-1 construct, with the exception of the sequence indicated as 3, where codons preferred by S. cerevisiae glycolytic enzymes were employed. That sequence is AAG, ACT, AGA.

It is evident from the above results, that novel proteinacious sweetners based on the monellin sequence may be produced as a stable single-chain protein for use in a wide variety of ways. The product can be produced efficiently and economically by employing microbial hosts, so that a stable uniform supply of the sweetener can be obtained, as distinct from isolation from natural sources. In addition, various changes may be made in the structure of the amino acid, without affecting its sweetening characteristic, while providing for other advantages, such as chemical and physical stabilty, storage life, ease of formulation and purification, enhancement of sweetness, etc.

All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

WHAT IS CLAIMED IS :

1. A DNA sequence encoding a polypeptide comprising an amino acid sequence having at least 80% of the amino acid sequence of the subunits of monellin covalently bonded together through a peptide linkage.

2. A DNA sequence according to Claim 1, wherein said polypeptide has a sequence of subunit II as the N- terminus and subunit I as the C-terminus.

3. A DNA sequence according to Claim 2, wherein in said polypeptide sequence the interventing sequence from tyr(41) to leu(3) of the monellin wild-type sequence is modified by substitution, deletion or insertion consisting of a total of not more than ten amino acids.

4. A DNA sequence according to Claim 3, wherein said intervening sequence is of the formula : x

wherein : aa¹ is D or E ; aa² is K, R, N or Q ; aa³ is D, E, S or T ; aa⁴ is F, W or Y ; aa⁵ is K or W ; aa⁶ is D or E ; wherein x is 0 or 1, at least one x being 1,

5. A DNA sequence according to Claim 4, wherein said interventing sequence is Y-E-N-E-R-E-I-K ; Y-E-N-R-E-D- I-K ; Y-K-T-R-E-D-I-K ; Y-E-R-E-I-K ; Y-E-N-I-K ; Y-E-I- K ; Y-Y-A-S-D-K-L-K ; Y-A-S-D-K-L ; Y-A-S-D-K ; Y-S-D-K ; E-D-Y-K-T-R-G-R ; or E-D-Y-T-R.

6. An expression cassette comprising in the direction of transcription, a transcriptional and translational initiation regulatory region, a DNA sequence according to any. of Claims 1 to 5, wherein said DNA sequence has methionine at its 5' terminus, and a translational and transcriptional termination region, wherein said regul- atory regions are functional in a microbial host.

7. A mincrobial host comprising an expression cassette comprising in the direction of transcription, a transcriptional and translational initiation.regulatory region, a DNA sequence according to any of Claims 1 to 5, wherein said DNA sequence has a methionine at its 5' terminus, and a translational and transcriptional termination region, wherein said regulatory regions are functional in a microbial host.

8. A method for producing a proteinaceous sweetener having at least about 80% homology with the two subunits of monellin, said sweetener consisting of a single chain, said method comprising growing in a suitable nutrient a microbial host comprising an expression cassette comprising in the direction of transcription, a transcriptional and translational Initiation regulatory region, a DNA sequence according to any of Claims 1 to 5, wherein said DNA sequence has a methionine at its 5' terminus, and a translational and transcriptional termination region, wherein said regulatory regions are functional in a microbial host, whereby said DNA sequence is expressed to produce said proteinaceous sweetener ; and isolating said proteinaceous sweetener.