JP2003079379A - Dna for achieving high expression of growth hormone and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a technique that can largely produce growth hormone, a functional fragment, a mutant, or an analogue of the hormone. SOLUTION: This invention provides the DNA encoding the fused protein in which the leader peptide comprising one or more amino acid residues starting with the N-terminus of the cell wall protein (CWP) of a Bacillus bacteria, the amino acid sequence that is used in the enzymatic cleavage (Cleavage) and the amino acid sequence of the growth hormone, or its functional cleavage, its mutant or its analogue (GH) and the nH comprising a plurality of His residue and the linker are suitably linked. In addition, the followings are disclosed: the DNA including the fused protein DNA and another DNA expressing the fused protein; the vector including the expressible DNA of the fused protein; the host cells including the vector; and a method of producing the recombinant growth hormone using the host cells.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a growth hormone having a physiological activity particularly related to the regulation of growth and morphogenesis in mammals including humans, etc., or a fragment or analogue having an equivalent or further improved function. The present invention relates to a DNA encoding a fusion protein containing a body, the use of the DNA for producing a desired growth hormone or a functional fragment, mutant or analogue thereof in large amounts through its expression.

[0002]

2. Description of the Related Art Growth hormone is a peptide hormone secreted from the anterior pituitary gland and is a substance essential for the growth of the body during growth, particularly bone growth. When growth hormone is no longer secreted for some reason, growth stops and dwarfism occurs. Medical growth hormone is used to treat dwarfism. The growth hormone is being applied not only to the treatment of dwarfism, but also to a variety of uses such as a short stature derived from various diseases and an antiaging effect.

Conventionally, since medical growth hormone has been extracted from the pituitary gland of a cadaver, the available amount was very small and very expensive. The gene recombination technology established in the 1970s was also applied to growth hormone, and in the 1980s a method for producing a gene recombinant growth hormone using Escherichia coli was established (Japanese Patent Publication No. 6-65318, JP-A-7-46988). (See Japanese Patent Publication No. 8-2314). Generally, when a foreign protein is expressed in Escherichia coli, it may be expressed in the cytoplasm (Japanese Patent Publication No. 6-65318) or secreted into the periplasm (Japanese Patent Publication No. 7-46988, Japanese Patent Publication No. 888). -2314 publication). However, in the former,
Problems often occurred such that inclusion bodies were often formed to denature the protein, and disulfide bonds, which are important for the physiological activity of the protein, could not be formed. On the other hand, in the latter, although the problems of protein folding and disulfide bond were solved, the amount secreted into the periplasmic space was limited. As described above, there is a limit to the large amount of expression of a protein having a disulfide bond such as growth hormone in Escherichia coli.

In a recently developed gene recombinant protein expression system using Bacillus brevis of the genus Bacillus subtilis, a polypeptide having a disulfide bond (human epidermal growth factor) is active in the medium. That is, since it can be secreted and expressed in a large amount in a state in which a disulfide bond is accurately formed (Patent No. 20
82727, JP 62-201583, Yamagata, H.
Et al., J. Bacteriol. 169,1239-1245 (1987), Shigezo Utaka,
Journal of Japan Society for Agricultural Chemistry 61, 669-676 (1987), Takao, M. et al., A
ppl. Microbiol. Biotechnol. 30, 75-80 (1989), Yama
gata, H. et al., Proc. Natl. Acad. Sci. USA 86, 3589-35.
93 (1989)), attracting attention as a mass production system for proteins having disulfide bonds.

In the Bacillus brevis expression system, the foreign protein is secreted into the medium. The foreign protein linked immediately after the signal peptide of the cell wall protein is induced by the signal peptide to pass through the cell membrane, and then the signal peptidase. By this, the foreign protein is cleaved from the signal peptide and secreted into the medium. Human epidermal growth factor is a good example of high expression and secretion achieved in this system, but not all foreign proteins are expressed and secreted in large amounts in this expression system. As a report that expresses and secretes human growth hormone using this expression system, there was a report that human growth hormone was linked immediately after the signal peptide and secreted into the medium (JP-A-7-51072), and expression and secretion. For the purpose of increasing the amount, it has been reported that the signal peptide was linked immediately after the signal peptide and secreted in the form of a fusion protein (JP-A-11-341).
No. 991 bulletin). In the latter expression mode, high expression of the fusion protein was observed, but due to the amino acid sequence recognized by the protease used to separate growth hormone from the fusion protein, mutant growth with Gly or Ser added at the N-terminus The technology to obtain the natural growth hormone from which the hormone was excised has not been completed. Further, also for the production of such mutant growth hormone, there has been a demand for a technique capable of obtaining a target protein more efficiently and in a large amount.

[0006]

Therefore, the present invention is
PROBLEM TO BE SOLVED: To provide a fusion protein in which a secretion peptide of a growth hormone in a host cell can be further increased, which is a fusion protein in which a large amount of the growth hormone is secreted and expressed by using a signal peptide of a cell wall protein and the amino acid composition is appropriately selected and linked. The purpose is to In addition, an enzymatic cleavage site is selected from the expressed fusion protein so as to obtain the same growth hormone as that of the natural type, which does not contain an extra sequence, and the secretion amount of the fusion protein containing the amino acid sequence for cleavage is reduced. The aim is to discover combinations of each amino acid sequence without.

[0007]

[Means for Solving the Problems] Therefore, the applicant of the present invention has independently added an amino acid sequence (Leader) from the N-terminal 1 to 20th positions of MWP, which is one of the cell wall proteins (CWP) of Bacillus bacteria, Or multiple His residues, or Asp as Linker
Together with TyrAspIleProThrThr, the enzymatic cleavage site (Cleavag
IIeGluGlyArg as e) or GluAsnLeuTyrPheGln
By placing growth hormone immediately after Gly, we succeeded in secreting large-scale expression of a fusion protein containing a growth hormone containing a disulfide bond and having biological activity, or a functional fragment, variant or analog thereof. Furthermore, by treating the fusion protein with an enzyme that recognizes the above cleavage site, natural growth hormone (20kd, 22kd) and N-terminal are added.
We have developed a technology for mass-producing mutant growth hormones (20kd, 22kd) that have an extra Gly.

That is, provided in the first embodiment of the present invention is the following amino acid sequence: a leader peptide consisting of one or more amino acid residues from the N terminus of the cell wall protein (CWP) of Bacillus bacteria. (Leade
r); amino acid sequence used for enzymatic cleavage (Cleavag
e); and the amino acid sequence (GH) of growth hormone or a functional fragment, mutant or analogue thereof are linked in this order, and the amino acid sequence of Cleavage is IleGluGlyArg.
(Cleavage 1, SEQ ID NO: 1), which is the DNA encoding the fusion protein.

In a further embodiment of the present invention, the following amino acid sequence: a leader peptide (Leader) consisting of one or more amino acid residues from the N-terminus of the Bacillus cell wall protein (CWP); used for enzymatic cleavage Amino acid sequence (Cleavage); and the amino acid sequence (GH) of growth hormone or a functional fragment, mutant or analogue thereof are linked in this order, and a fusion protein in which GH is 20 kd human growth hormone (GH20kd) DN to code
A is provided.

In another embodiment of the present invention, the following amino acid sequence: a leader peptide (Leader) consisting of one or more amino acid residues from the N-terminus of the cell wall protein (CWP) of Bacillus bacterium; NH consisting of a group; amino acid sequence used for enzymatic cleavage (Cleavag
e); and a DNA encoding a fusion protein in which the amino acid sequences (GH) of growth hormone or a functional fragment, variant or analog thereof are linked in this order,
In a preferred embodiment, the number of His residues is 6.

In a further preferred embodiment of the present invention said GH is 22kd human growth hormone (GH22kd) or
20kd human growth hormone, said Cleavage is IleGluGl
yArg (Cleavage 1, SEQ ID NO: 1) or GluAsnLeuTyr
PheGlnGly (Cleavage 2, SEQ ID NO: 2).

[0012] A DNA encoding a fusion protein in which a linker (Linker) consisting of one or more amino acid residues is further linked upstream of Cleavage is preferable in the present invention described above, and preferably the Linker is AspTyrAspIlePr
oThrThr (SEQ ID NO: 3).

Further, the CWP is preferably MWP, and the leader is particularly preferably an amino acid sequence from the N terminus of MWP to the 1st to 20th positions.

[0014] In a further embodiment of the present invention, further upstream of the 5'end of the DNA encoding the fusion protein,
DN containing a promoter sequence required for gene expression
A (Promoter); downstream of the 3'end of the Promoter, SD sequence (SD); and Bacillus bacterium cell wall protein (CWP)
The DNA (CWPsp) encoding the signal peptide of the above is ligated in this order. Here, the promoter is preferably derived from a Bacillus bacterium CWP.

In another embodiment of the present invention, a DNA (P (P) containing a promoter sequence required for gene expression is further provided upstream of the 5'end of the DNA encoding the above fusion protein.
romoter); The SD sequence (S
D); and a DNA (CWPsp) encoding the signal peptide of the cell wall protein (CWP) of Bacillus bacterium is ligated in this order.

The present invention further provides a host cell transformed or transfected with the above vector. A preferred host cell is a Bacillus bacterium, of which Bacillus brevis is preferred. In a particularly preferred embodiment of the invention, the host cell containing the above vector is provided by the strain deposited under accession number FERM BP-7727.

The present invention further provides a method for producing growth hormone or a functional fragment, mutant or analogue thereof, which comprises growing the host cell to express a fusion protein in a growth medium, and activating the enzyme from the fusion protein. The present invention provides a method for producing a recombinant growth hormone or a functional fragment, mutant or analog thereof by cleaving growth hormone or a functional fragment, mutant or analog thereof by using a selective cleavage method.

[0018]

BEST MODE FOR CARRYING OUT THE INVENTION According to the present invention, the production amount of growth hormone having a disulfide bond and exhibiting biological activity, or a functional fragment, mutant or analog thereof, can be dramatically increased and the same as the natural type. It has become possible to mass-produce a recombinant of growth hormone or a functional fragment thereof having the N-terminal sequence of

The cell wall protein (CWP) used in the leader contained in the fusion protein is, for example, Bacillus brevis strain 47 (FERM P-7224: JP-A-60-58074, JP-A-62-201589). Origin of MWP (middle wall protei
n, J. Bacteriol., 169: 1239-1245, 1989, SEQ ID NO: 40), HWP (surface (S) -layer protein, which is derived from HPD31 (FERM BP-1087: Japanese Patent Laid-Open No. 4-278091). fo
rms a hexagonal array in the cell wall, J. Bacterio
l., 172: 1312-1320, 1990, SEQ ID NO: 41) can be used, but is not limited thereto. According to an embodiment of the invention, the preferred leader is a subsequence of MWP. A preferred leader is an amino acid residue from the N-terminal of the mature protein of MWP, and as disclosed in JP-A No. 11-341991, one or more amino acid residues are arranged from the N-terminal to grow hormone. The effect of increasing the expression and secretion amount of is found. In the examples of the present invention, the amino acid sequence of 20 amino acids from the N-terminus of the mature protein of MWP is preferably used, but if the effect of increasing the expression and secretion amount of growth hormone is recognized, the number of amino acid residues from the N-terminus is used. May be less or more than 20.

Cleavage is an amino acid sequence that enables enzymatic cleavage, and the cleavage sequence is not particularly limited as long as GH linked downstream thereof is not affected by such a cleavage operation. According to one embodiment of the present invention, the preferred Cleavage amino acid sequence is IleGluGlyArg (SEQ ID NO: 1) recognized by factor Xa, and the N-terminal of GH obtained after the cleavage treatment contains an extra amino acid residue. This sequence is preferable because it does not occur. Furthermore, in another embodiment of the present invention, GluAsnLeuTyrPheGlnGly (SEQ ID NO:
2) is mentioned. Further, as reported in (US Patent 5,179,007), the amino acid sequence recognized by TEV protease is GluAsnLeuTyrPheGlnSer (SEQ ID NO: 4).
May be When these sequences of SEQ ID NO: 2 or 4 are used, GH obtained by the cleavage treatment has Gl at the N-terminus.
It was confirmed by the present invention that the biological activity of GH having y or Ser but having Gly at the N-terminal is equivalent to that of natural GH.

According to the embodiment of the present invention, the preferred GH is human growth hormone, but if it is expected that a high expression / secretion effect can be expected by arranging it in the GH portion in the form of the fusion protein of the present invention. It is not limited to human growth hormone. That is, it may be growth hormone of mammals other than human, or growth hormone of other species.
Such a growth hormone has a function equivalent to or better than that of a natural growth hormone having a physiological activity related to the regulation of growth and morphogenesis in an organism, such as promotion of bone growth and metabolic action (desirably, Fragment or analogue (including suppression of non-effects). So-called human growth hormone hGH (SEQ ID NO:
38) is encoded by the gene GH-1, and contains two SS bonds in the molecule after the signal peptide consisting of 26 amino acids is excised by processing.
It is produced and secreted in the anterior pituitary gland as a mature body consisting of 1 amino acid and having a molecular weight of about 22 kd. As its variant, the gene GH
HGH-V (SEQ ID NO: 3
9) is known, and the mature body also consisting of 191 amino acids has a molecular weight of about 22 kd, but it is expressed in the placenta rather than in the pituitary. Although hGH and hGH-V differ in 13 amino acids in the mature form, both have physiological activity as growth hormone. Therefore, mutants and analogues such as those in which only a part of these 13 amino acids are changed from hGH and those in which these amino acids are changed to other similar amino acids also have physiological activity as growth hormone. Are expected and can be included in the GH of the present invention. Furthermore, both hGH and hGH-V have been found to have a molecular weight of 20 kd in which the 32nd to 46th amino acids have been deleted, and these show a growth promoting action equivalent to that of 22kd. It has been clarified that the activities of diabetes and insulin are low. Therefore, it may be more desirable to use such a deletion fragment when only a growth promoting effect is required or depending on the health condition of the patient. As described above, the GH expressed as the fusion protein in the present invention may include, in addition to the natural growth hormone, a potent fragment, mutant or analog thereof as long as it has suitable physiological activity.

DN encoding human growth hormone, for example
A is commercially available cDNA 1st-st derived from commercially available human pituitary mRNA.
It can be obtained using a rand synthesis kit or the like. Furthermore, based on a known DNA sequence, if a short-chain DNA that serves as a primer can be synthesized using a commercially available DNA synthesizer,
A desired DNA fragment can be amplified by a general polymerase chain reaction (PCR). In the PCR amplification method,
One cycle of denaturation of DNA, annealing with a primer, and extension reaction is repeated for 20 cycles or more to obtain a desired amount of DNA.

Linker is Leader-nH or Leader, and C
It is an amino acid sequence linking with leavage-GH, which has the function of increasing the secretion amount of the fused fusion protein linked thereto or guaranteeing efficient enzymatic cleavage. The amino acid sequence is not particularly limited as long as such a function is satisfied, but according to the embodiment of the present invention, a particularly preferred amino acid sequence is AspTyrAspIleProThrThr (SEQ ID NO: 3), and some of the amino acids in this sequence are A sequence that retains the effect of increasing the secretion amount even if it is substituted with an amino acid can be preferably used.

A plurality of His residues arranged immediately after Leader have an effect of further increasing the expression and secretion amount of the fusion protein containing growth hormone. Multiple His residues placed before and after the foreign protein have been used as a tag for efficiently separating and purifying the foreign protein. The surprising effect of increasing the secretion amount of the fusion protein containing is discovered. According to the embodiment of the present invention, the preferred number of His residues is 6, but the number of His residues is not limited to this, and a sequence composed of a plurality of His residues may be used.

The DNA of the present invention encoding a fusion protein in which the sequences described above are linked in an appropriate order can be prepared by combining techniques known in the art. For example, each DNA sequence of a component can be individually prepared by a chemical synthesis method or a cloning method, these components can be sequentially ligated using a ligase, and a PCR amplification method can be combined to produce a target DNA. . The details are understood by specifically referring to Examples, but as individual techniques, Maniatis, T. et al., Molecular
Cloning 2nd ed., A Laboratory Manual, Cold Spring
Harbor Laboratory (1989), Innis, MA et al., PCR Prot
ocols, A guide to methods and applications, Academ
The general technique described in ic Press (1990), etc. can be used.

In another embodiment of the present invention, in order to express the above fusion protein in a host cell, a promoter sequence required for gene expression is further provided upstream of the 5 ′ end of the DNA encoding the fusion protein. Contains DNA (P
romoter), SD sequence (SD) downstream of the 3'end of the Promoter, and cell wall protein (CWP) of Bacillus bacterium
However, a vector containing DNA ligated in this order is provided.

According to an embodiment of the invention, the preferred promoter is the Bacillus CWP promoter. C
As WP, the same as described above for Leader, MWP, HPD31 derived from Bacillus brevis strain 47 (FERM P-7224).
Although HWP derived from (FERM BP-1087) can be used,
It is not limited to these. Examples of bacillus promoters that can be regulated include Spac promoter, φ105 phage-derived promoter, and host structural gene-derived promoters such as amylase and protease promoters (Molecular
Biological Methods for Bacillus, Harwood, CR &
Cutting, SM eds., Pp202-203, 1990), and those having an effect of expressing a gene linked 3 ′ downstream thereof may be appropriately selected. For example, as the MWP and HWP promoters, DNA sequences selected from the promoter regions present in the transcription initiation sites 1 to 5 present in the 5'untranslated region described in SEQ ID NOs: 40 and 41, respectively, can be preferably used. .

SD linked downstream of the 3'end of Promoter
The sequence is a conventionally known pyrimidine-rich nucleotide sequence (Shine J. and Dalgarno, L. Eur. J. Biochem. 1;
57 (1), 221-230 (19750)), which can promote the complex formation of protein biosynthesis. As a preferred sequence in the present invention, AGAGGAGGAGA existing upstream of the translation initiation site of Bacillus brevis MWP
(SEQ ID NO: 42, SD2) and GAAAGGAGGTGA (SEQ ID NO:
43, SD1) and the like.

Further, the cell wall protein (CW of Bacillus genus)
By ligating the DNA (CWPsp) encoding the signal peptide of P) upstream of the N5 ′ end of the DNA encoding the above fusion protein, the conjugate of the signal peptide translated into the protein and the fusion protein reaches the cell membrane. Then, the fusion protein is cleaved from the linking body by signal peptidase and secreted extracellularly. As CWPsp, the signal peptide is the same as MW for Leader.
P and HWP can be mentioned, and the amino acid sequence of the signal peptide of MWP is particularly preferably used.

The present invention further provides a vector containing the above-mentioned DNA of the present invention. The usable vector has an appropriate insertion site, that is, a restriction enzyme site into which the DNA of the present invention can be incorporated, is capable of expressing the DNA in a host cell, and is autonomous in the host cell. It is necessary to have at least the characteristics that it can be duplicated. The vector may include an origin of replication, a terminator sequence, and may further include a selection marker such as a drug resistance gene or a gene that complements an auxotrophy. Preferably, the vector of the present invention is a plasmid capable of replicating in Bacillus bacteria. As a vector, for example pN
U200, pHY500 (Proc.Natl.Acad.Sci.USA, 86: 3589-359
3, 1989), pHY4831 (J. Bacteriol., 169: 1239-1245, 198)
7), pNU100 (Appl. Microbiol. Biotechnol., 30: 75-80,
1989), pNU211 (J. Biochem., 112: 488-491, 1992), pNU2
11R2L5 (JP-A-7-170984), pHY700 (JP-A-4-2780)
91), pHT210 (JP-A-6-133782), pHT110
R2L5 (Appl. Microbiol. Biotechnol., 42: 358-363, 1994)
Can be used, but is not limited to these.
In a specific example of the present invention, the expression vector pNU-hGH can be constructed in the construction manner shown in FIG.

The invention further provides a host cell containing a Bacillus bacterium transformed with a vector as defined above. The bacterium of the genus Bacillus is not limited to the following, but includes, for example, Bacillus brevis strain 47 (FERM P
-7224: JP-A-60-58074, JP-A-62-201589), 47K (JP-A-2-257876), 31 OK (JP-A-60-58074)
6-296485) and HPD31 (FERM BP-1087; JP-A-4)
-278091 publication) and the like. The recombinant bacterium obtained by transferring the expression vector pNU-hGH into the Bacillus brevis 47-5Q strain was the National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center (Tsukuba City East, Ibaraki Prefecture) dated September 7, 2001. It was deposited internationally under the Budapest Treaty under the deposit number FERM BP-7727 at 1-1, 1-1, Central 6).

The expression vector obtained as described above was electroporated (Methods in Enzymol., 2
17: 23-33, 1993) and the like, and transferred to a host cell such as a competent Bacillus bacterium and cultivated in an appropriate medium under an expressible condition to grow a fusion protein containing growth hormone. It can be secreted outside the body.

After the culture is completed, the fusion protein is combined with a method such as gel filtration chromatography, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, electrophoresis, isoelectric focusing, etc. in a growth medium. Can be separated and purified from By subjecting the separated and purified fusion protein to an enzymatic cleavage treatment, G
H, that is, natural human growth hormone (20kd, 22kd),
Alternatively, a mutant human growth hormone having a Gly at the N-terminus (2
2kd) and functional fragments, mutants or analogues can be excised. Since the recombinant growth hormone thus obtained retains the disulfide bond required for biological activity, it can be used as a drug as it is.

The enzymatic cleavage treatment is performed in the fusion protein with Cl.
It goes without saying that it is carried out depending on the sequence introduced as eavage, and it may be carried out under the optimum conditions of the enzyme reaction using an enzyme capable of cleaving with Cleavage. For example, in the fusion protein in which SEQ ID NO: 1 is introduced, Factor Xa is reacted under the conditions of 4 to 25 ° C. and pH 7 to 9 and that in which SEQ ID NO: 2 or 3 is introduced is 4 to TEV protease. PH 7 at 37 ° C
The cleavage treatment is accomplished by reacting under conditions of ~ 9.

Therefore, according to the present invention, a host cell such as Bacillus bacterium transformed with the above expression vector is grown to express the fusion protein in a growth medium,
A method for producing a large amount of recombinant growth hormone or a functional fragment, mutant or analog thereof by cleaving growth hormone or a functional fragment, mutant or analog thereof from the fusion protein using an enzymatic cleavage method is provided. It becomes possible to provide.

[0036]

The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

In preparing the DNA encoding the fusion protein, a method of ligating the DNA fragments amplified by the PCR reaction (polymerase chain reaction) by the ligation reaction using DNA ligase was adopted. In the text, MWPsp means a signal peptide of MWP, and MWPmp20 means N of the MWP mature protein.
It means the 20 amino acids from the end.

In Example 1, a fusion protein with MWPsp (corresponding to 20 amino acids from the C terminus of the signal peptide of MWP) was used.
MWPmp20- (His) 6-Linker-Cleavage 1-GH 22kd ligated fusion DNA, MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH
The 22kd construction method and the construction method of the vector incorporating it will be described, but the construction method of other fusion proteins will be outlined.

[Example 1] Construction of vector (phGH) incorporating MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH22kd fusion DNA (1) Acquisition of DNA fragment MWPsp-MWPmp20 a. Template DNA Bacillus A method known from Brevis (47-5Q strain) (Molec
ular Cloning 2nd ed., A Laboratory Manual, Cold Sp
genomic DNA extracted by ring Harbor Laboratory f (1989) 840 ng b. primer (Yamagata, H. et al. (J. Bacteriol., 16
9, 1239-1245, 1987) and Tsuboi, A. et al. (J. Bacterio
l., 170, 935-945, 1988) based on the MWP nucleotide sequence determined by organic chemical synthesis) Forward primer: 5'- GTCGTTAACAGTGTATTGCT-3 '
(SEQ ID NO: 5, final concentration 0.1 μM) Reverse primer: 5'- TACGGTTTTTTCCATATCAGC-3 '
(SEQ ID NO: 6 final concentration 0.1 μM) c. Taq DNA polymerase Commercial product (GIBCO BRL) 5U d. Other Tris-HCl (final concentration 20 mM, pH 8), MgCl ₂ (final concentration)
2.5 mM), dNTPs (dATP, dGTP, dCTP, and dTTP each have a final concentration of 50 μM) Procedure: Add a to d to a reaction volume of 100 μl in a 0.5 ml tube and use a known method (Innis, MA et al., PCR Protocols, Ag
uide to methods and applications, AcademicPress,
(1990)) PCR reaction (denaturation: 94 ° C-1 min, annealing: 5
3 ° C.-1 min, DNA strand extension: 72 ° C.-1 min as one cycle, repeated 30 times). After completion of the PCR reaction, the reaction solution was concentrated with phenol, applied to 0.8% agarose gel and electrophoresed under normal conditions, and the PCR product, that is, DNA fragment MWPsp, from the agarose gel with Millipore Ultra Free C3H. -Recovered MWPmp20. Recovered PC
The R product was extracted with phenol, precipitated with ethanol, vacuum-dried, dissolved in an appropriate amount of distilled water, and subjected to a blunt end reaction (using a DNA blunting kit manufactured by Takara Shuzo Co., Ltd., according to the instruction manual).

(2) DNA fragment (His) 6-Linker-Cleavage 1
Acquisition of genetic code (Molecular Cloning 2nd ed., A Laborato
ry Manual, Cold Spring Harbor Laboratory (1989))
According to (His) 6-Linker-Cleavage 1 (H
isHisHisHisHisHisHisAspTyrAspIleProThrThrIleGluGlyArg
(SEQ ID NO: 7)) encoding forward oligonucleotide 5'-CATCATCATCATCATCACGACTATGATATCCCGACCACTAT
CGAAGGTCGT-3 '(SEQ ID NO: 8), reverse oligonucleotide, 5'- ACGACCTTCGATAGTGGTCGGGATATCATAGTCGT
GATGATGATGATGATG-3 '(SEQ ID NO: 9) was chemically synthesized and phosphorylated (T4 polynucleot of Nippon Gene Co., Ltd.
idekinase was used and the method was according to the instruction manual)
After that, it was treated at 95 ° C. for 5 min in 10 mM Tris-HCl (pH 8) and 5 mM MgCl ₂ solution, and annealed at 37 ° C. for 15 min. The annealed double-stranded DNA fragment TEV was extracted with phenol, precipitated with ethanol, vacuum dried, and dissolved in an appropriate amount of distilled water.

(3) DNA fragment, human growth hormone GH22kd
Acquisition of blunt-ended DNA fragment GH22kd was carried out following the same procedure as in (1) except for the following points.

A plasmid vector incorporating the DNA fragment GH22kd was used as the template DNA. The plasmid vector incorporating GH22kd was obtained as follows. Human pituitary gland cDNA was synthesized from commercially available human pituitary gland mRNA (CLONTECH) using 1st strand cDNA synthesis kit from Pharmacia according to the instruction manual. This cD
Roskam, WG et al. (Nucleic Acids Re
s., 7, 305-320, 1979) and Martial, JA et al. (Sci.
ence, 205, 602-607, 1979), a forward primer (5'-ATGGCTACAGGCTCCCGGAC-3 '(SEQ ID NO: 10)) synthesized based on the nucleotide sequence of the human growth hormone gene, and a reverse primer. (5 '-CTAGAAGCCACAG
PCR reaction (conditions: 94 ℃ -1 min, 55 ℃ -1 min, 72 ℃ -1 min) using CTGCCCT-3 '(SEQ ID NO: 11)
35 cycles were repeated) to obtain
PCR product, human growth hormone (hGH) DNA
It was cloned into the pGEM-T vector (Promega).

As a primer, a forward primer,
5'-TTCCCAACCATTCCCTTATC-3 '(SEQ ID NO: 12),
Reverse primer, 5'-CTAGAAGCCACAGCTGCCCT-3 '
(SEQ ID NO: 11) was used.

・ PCR reaction conditions (denaturation: 94 ° C-1 mi
n, Annealing: 55 ℃-1 min, DNA strand extension: 72 ℃-30 se
c is set as one cycle and repeated 25 times).

(4) MWPsp-MWPmp20- (His) 6-Linker-Clea
Obtaining vage 1 fusion DNA Fusion DNA blunt-ended by the same procedure as in (1) except for the following points, MWPsp-MWPmp20- (His) 6-Linker-Cleavage
Got one.

As the template DNA for the first PCR reaction,
The DNA fragment MWPsp-MWPmp20 obtained in (1) and the DNA fragment (His) 6-Linker-Cleavage 1 obtained in (2) were mixed in appropriate amounts and reacted with Takara Shuzo DNA ligation kit at 16 ° C for 30 minutes. I used one.

As the reverse primer for the first PCR reaction, 5'-ACGACCTTCGATAGTGGTCGG-3 '(SEQ ID NO: 13) was used.

The reaction conditions for the first PCR are (denaturation: 94
℃-1 min, annealing: 53 ℃-1 min, DNA strand extension: 72
25 ° C.-1 min as one cycle).
After that, Nippon Gene's T4 polynucleotide kinase
Was used to phosphorylate the PCR product according to the instruction manual. The phosphorylated PCR product is DNAligati from Takara Shuzo.
using the on kit to cut the vector (S
It is incorporated into TRATAGENE's Blue Script SK-) and a known method (Molecular Cloning 2nd ed., A Laboratory Ma) is used.
n., Cold Spring Harbor Laboratory (1989)), Escherichia coli DH5α was transformed, and a plasmid DNA as a vector was purified from the transformant. MWPsp-MWPmp20- (His) 6-Linker-Cl by determining the base sequence using the forward primer (M13 forward primer) or reverse primer (M13 reverse primer) for determining the base sequence of the vector.
It was confirmed that eavage 1 fusion DNA was made. Then M
Using the vector containing WPsp- MWPmp20- (His) 6-Linker-Cleavage 1 as the template DNA, the forward primer (5 '-GTCG
TTAACAGTGTATTGCT-3 '(SEQ ID NO: 5)) and reverse primer (5'- ACGACCTTCGATAGTGGTCGG-3' (SEQ ID NO: 13)) under the same conditions as above for the second PC
R-reaction, blunt-ended fusion DNA, MWPsp-MWPmp20-
Obtained (His) 6-Linker-Cleavage 1.

(5) MWPsp-MWPmp20- (His) 6-Linker-Clea
Obtaining a vector incorporating the vage 1-GH22kd fusion DNA Follow the same procedure as in (4) except for the following points.
A vector (phGH) incorporating WPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH22kd was obtained.

Fusion D obtained in (4) as template DNA
NA, MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1 and (3)
An appropriate amount of the DNA fragment obtained in step 2 and GH22kd were mixed and reacted with a DNA ligation kit manufactured by Takara Shuzo Co., Ltd. at 16 ° C. for 30 minutes.

As a primer, a forward primer,
5'-GTCGTTAACAGTGTATTGCT-3 '(SEQ ID NO: 5), reverse primer, 5'- CTAGAAGCCACAGCTGCCCT-3' (SEQ ID NO: 11) were used.

・ PCR reaction conditions (denaturation: 94 ° C-1 mi
n, Annealing: 53 ℃ -1 min, DNA strand extension: 72 ℃ -1 min
As one cycle and repeated 25 times).

[Example 2] Construction of vector incorporating MWPsp-MWPmp20-Linker-Cleavage 1-GH22kd fusion DNA The fusion DNA obtained in Example 1, MWPsp-MWPmp20- (His) 6-Li.
Using the nker-Cleavage 1-GH22kd as a template, the forward primer, 5'-GACTATGATATCCCGACCACT-3 '(SEQ ID NO: 1
4), reverse primer, 5'-CTAGAAGCCACAGCTGCCCT-
DNA fragment using the 3 '(SEQ ID NO: 11), Linker-Cleav
age 1-GH22kd amplified. Next, the DNA fragment obtained in (1) of Example 1, MWPsp-MWPmp20 and the DNA fragment, Linker-Cleava
From ge 1-GH22kd, by combining the ligation reaction and the PCR reaction described in Example 1, the fusion DNA, MW
A vector incorporating Psp-MWPmp20-Linker-Cleavage 1-GH22kd was obtained.

Example 3 Construction of Vector Incorporating MWPsp-MWPmp20-Cleavage 1-GH22kd Fusion DNA Fusion DNA obtained in Example 1, MWPsp-MWPmp20- (His) 6-Li
Using the nker-Cleavage 1-GH22kd as a template, the forward primer, 5'-ATCGAAGGTCGTTTCCCAACC-3 '(SEQ ID NO: 1
5), reverse primer, 5'- CTAGAAGCCACAGCTGCCCT-
DNA fragment, Cleavage 1-G, using 3 '(SEQ ID NO: 11)
H22kd was amplified. Next, the DNA obtained in (1) of Example 1
From the fragment, MWPsp-MWPmp20 and the DNA fragment, Cleavage 1-GH22kd, the fusion DNA, MWPsp-MWPmp20-C, was prepared by combining the ligation reaction and the PCR reaction described in Example 1.
A vector incorporating leavage 1-GH22kd was obtained.

[Example 4] MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH20kd fusion
Construction of vector incorporating DNA Fusion DNA obtained in Example 1, MWPsp-MWPmp20- (His) 6-Li
nker-Cleavage 1-GH22kd as a template, forward primer, 5'- GTCGTTAACAGTGTATTGCT -3 '(SEQ ID NO: 5),
Reverse primer, 5'- AAACTCCTGGTAGGTGTCAAA -3 '
(SEQ ID NO: 16), DNA fragment, MWPsp-MWPmp20-
(His) 6-Linker-Cleavage 1-GH (A), forward primer,
5'- AACCCCCAGACCTCCCTCTGT-3 '(SEQ ID NO: 17),
Reverse primer, 5'- CTAGAAGCCACAGCTGCCCT-3 '
A DNA fragment, GH (B), was amplified using (SEQ ID NO: 11). Next, the fusion DNA, MWPsp-MWPmp20- (His) 6-Linker-Cleav, was prepared from these two DNA fragments by combining the ligation reaction and the PCR reaction described in Example 1.
A vector incorporating age 1-GH20kd was obtained.

Example 5 Construction of Vector Incorporating MWPsp-MWPmp20-Linker-Cleavage 1-GH20kd Fusion DNA Fusion DNA obtained in Example 2, MWPsp-MWPmp20-Linker-Cl
eavage 1-GH22kd as template, forward primer, 5'-
GTCGTTAACAGTGTATTGCT-3 '(SEQ ID NO: 5), reverse primer, 5'- AAACTCCTGGTAGGTGTCAAA-3' (SEQ ID NO: 16) using DNA fragment, MWPsp-MWPmp20-Linker-Cl
eavage 1-GH (A), forward primer, 5'- AACCCCCAGACC
TCCCTCTGT-3 '(SEQ ID NO: 17), reverse primer, 5'-CTAGAAGCCACAGCTGCCCT-3' (SEQ ID NO: 11)
Was used to amplify the DNA fragment, GH (B). Next, by combining the ligation reaction and the PCR reaction described in Example 1 from these two DNA fragments, the fused DNA and MWPs were
A vector incorporating p-MWPmp20-Linker-Cleavage 1-GH20kd was obtained.

[Example 6] MWPsp-MWPmp20- (His) 6-Linker-Cleavage 2-GH22kd fusion D
Construction of vector incorporating NA The amino acid sequence HisHisHi was prepared in the same manner as in (2) of Example 1.
sHisHisHisAspTyrAspIleProThrThrGluAsnLeuTyrPheGlnG
Forward oligonucleotide 5'coding ly (SEQ ID NO: 18)-CATCATCATCATCATCACGACTATGATATCCCGACCACT
GAAAACCTGTACTTCCAAGGT -3 '(SEQ ID NO: 19), reverse oligonucleotide, 5'- ACCTTGGAAGTACAGGTTTTCAG
TGGTCGGGATATCATAGTCGTGATGATGATGATGATG-3 '(SEQ ID NO: 20) was chemically synthesized to obtain a DNA fragment, (His) 6-Linker-Cle.
I got avage 2. Next, the DNA fragment obtained in (1) of Example 1, MWPsp-MWPmp20 and the DNA fragment, (His) 6-Linker-C.
By combining the ligation reaction and the PCR reaction described in Example 1 from leavage 2, the fusion DNA, MWPs
We obtained p-MWPmp20- (His) 6-Linker-Cleavage 2. Further, in the same manner, the fusion DNA, the DNA fragment obtained in (3) of Example 1, GH22kd to the fusion DNA, MWPsp-MWPmp20-.
A vector incorporating (His) 6-Linker-Cleavage 2-GH22kd was obtained.

[Example 7] Construction of vector incorporating MWPsp-MWPmp20-Linker-Cleavage 2-GH22kd fusion DNA The fusion DNA obtained in Example 6, MWPsp-MWPmp20- (His) 6-Li.
Using nker-Cleavage 2-GH22kd as a template, forward primer, 5'-GACTATGATATCCCGACCACT-3 '(SEQ ID NO: 1
4), reverse primer, 5'-CTAGAAGCCACAGCTGCCCT-
DNA fragment using the 3 '(SEQ ID NO: 11), Linker-Cleav
age 2-GH22kd Amplified. Next, the DNA fragment obtained in (1) of Example 1, MWPsp-MWPmp20 and the DNA fragment, Linker-Cleava
From ge2-GH22kd, by combining the ligation reaction and the PCR reaction described in Example 1, the fused DNA, MW
A vector incorporating Psp-MWPmp20-Linker-Cleavage 2-GH22kd was obtained.

Example 8 Construction of Vector Incorporating MWPsp-GH22kd Fusion DNA Using 840 ng of genomic DNA of Bacillus brevis (47-5Q strain) as a template, forward primer: 5'-GTCGTTAACAGTGTA
TTGCT-3 '(SEQ ID NO: 5), reverse primer, 5'-
The DNA fragment, MWPsp, was amplified using TGCGAAAGCCATTGGAGCAAC-3 '(SEQ ID NO: 21). Next, a fusion DNA, MWPsp-GH22kd, was incorporated from the DNA fragment, MWPsp, the DNA fragment obtained in (3) of Example 1, GH22kd, by combining the ligation reaction and the PCR reaction described in Example 1. I got the vector.

[Example 9] Expression and secretion of fusion protein and analysis (1) Amino acid of fusion, and base sequence The amino acid sequences and base sequences of the fusions obtained in Examples 1 to 8 are respectively the following sequences. Shown in number. MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH22kd (SEQ ID NO: 22, 30) MWPsp-MWPmp20-Linker-Cleavage 1-GH22kd (SEQ ID NO:
23, 31) MWPsp-MWPmp20-Cleavage 1-GH22kd (SEQ ID NO: 24,
32) MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH20kd (SEQ ID NO: 25, 33) MWPsp-MWPmp20-Linker-Cleavage 1-GH20kd (SEQ ID NO: 25)
26, 34) MWPsp-MWPmp20- (His) 6-Linker-Cleavage 2-GH22kd (SEQ ID NO: 27, 35) MWPsp-MWPmp20-Linker-Cleavage 2-GH22kd (SEQ ID NO: 27)
28, 36) MWPsp-GH22kd (SEQ ID NOs: 29, 37) (2) Secretion of fusion expression The fusion proteins encoded by the various fusion DNAs obtained in Examples 1 to 8 were expressed. As a typical example, MWPs
The manner of incorporating p-MWPmp20- (His) 6-Linker-Cleavage 1-GH22kd into an expression vector is shown in FIG.

That is, the fused DN obtained in Examples 1 to 8
A vector containing A was used as restriction enzymes ApaL I and Hind III
(When the fused DNA is inserted in the forward direction with respect to the M13 primer for sequencing), or ApaL I and Kpn I
(When inserted in the opposite direction to the M13 primer), 0.8% agarose electrophoresis was performed, and the DNA fragment containing each fusion DNA was excised. Cut out
An expression vector pN for Bacillus brevis containing a DNA fragment and the MWP promoter and SD sequence shown in SEQ ID NO: 40
U211R2L5 (refer to Japanese Patent Laid-Open No. 5-304962) is replaced with ApaLI and Hind
III (Kpn I for the fused DNA inserted in the opposite direction)
Mix the appropriate amount with the one cut with, and add DNA li from Takara Shuzo.
The fusion DNA was incorporated into an expression vector by reacting with a gation kit at 16 ° C for 30 minutes. With the obtained expression vector, the 47-5Q strain of Bacillus brevis (FERM P-7224: JP-A-60-5
No. 8074, JP-A-62-201589) is transformed according to a known method (Methods in Enzymol., 217, 23, (1993)), and T2 agar medium (T2 agar medium: polypeptone (1%) is used. ), Meat extract (0.5%), yeast extract (0.2%),
Uracil (0.1 mg / ml), glucose (1%), erythromycin (10 μg / ml), agar (1.5%), pH 7) was seeded to obtain a transformant.

The transformant was cultured in T2 medium (T2 agar medium without agar) at 37 ° C. for 1 day and then the known method (Molecular Cloning 2nd ed., A Laboratory Manual,
Cold Spring Harbor Laboratory f (1989))
The DNA was purified and treated with ApaL I and Hind III (or Kpn I) to confirm that each fused DNA was incorporated. With regard to the transformant in which it was confirmed that the fused DNA was integrated, an attempt was made to express and secrete a fusion protein encoded by the integrated fusion DNA. That is, a bacterial suspension that had been cultured in T2 medium at 37 ° C for 1 day at a ratio of 1/1000 volume (polypeptone (3%), yeast extract (0.4%), glucose (3%), MgSO ₄ · 7H ₂ O (0.01%), MnSO ₄・ 4H ₂
O (0.001%), erythromycin (10 μg / ml), pH
8) and add to test tube (2 ml / 20 ml for 4 days at 30 ℃)
The culture was carried out by shaking in a test tube) or an Erlenmeyer flask (50 ml / 500 ml Erlenmeyer flask).

After completion of the culture, the culture medium was centrifuged at 15,000 rpm for 2 minutes to obtain a culture supernatant, which was prepared by a known method (Laemmli, UK, Na.
, 227, 680-685, (1970)) and analyzed the protein by electrophoresis. That is, 1 μl of buffer 1 (125 mM Tris-HCl (pH 6.8), 20% glycerol, 4% SDS, 10% 2-mercaptoethanol) was added to 10 μl of the culture supernatant and boiled for 5 minutes, and buffer 2 (250 mM Tris -HCl (pH 6.
5), 50% glycerol, 0.5% BPB) was added in an amount of 2 μl and applied to a commercially available 15/25% SDS polyacrylamide gel (Daiichi Pure Co., Ltd.) for electrophoresis (electrophoresis buffer: 100 mM T).
ris, 100 mM Tricine, 0.1% SDS). After electrophoresis, Coomassie staining was performed to examine the presence or absence of expression secretion.

FIG. 2 shows SDS-PAGE images of the proteins secreted in the medium by expressing various fusions. M in which the human growth hormone gene was linked immediately after the MWP signal peptide
SDS-PAGE image of WPsp-GH22kd (lane 3) shows pNU211R2L5 (lane 2) with no foreign protein gene incorporated
Similar to, but immediately following the MWP signal peptide, Lead
In the fusion in which the human growth hormone gene was arranged by arranging the amino acid sequences of r, (His) 6, Linker and Cleavage, remarkable expression and secretion of the fusion protein (arrow) was observed (lanes 4-10). For 22kd human growth hormone, MWPsp
-MWPmp20-Cleavage 1-GH22kd (lane 4), MWPsp-MWPm
p20-Linker-Cleavage 1-GH22kd (lane 5), MWPsp-MW
Pmp20- (His) 6-Linker-Cleavage 1-GH22kd (lane 6)
As shown in, the placement of Linker in front of Cleavage 1-GH22kd increased the secretion amount of fusion protein. Moreover, the secretion amount was further increased by placing (His) 6 in front of Linker-Cleavage 1-GH22kd. The placement effect of (His) 6 is as follows: MWPsp-MWPmp20-Linker-Cleavage 2-GH22kd (lane 9), MWPsp-MWPmp20- (His) 6-Linker-Cleavage 2-GH22k
Also shown in d (lane 10). On the other hand, 20kd human growth hormone MWPsp-MWPmp20-Linker-Cleavage 1-GH20kd (lane 7), MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-G
In H20kd (lane 8), no significant increase in secretion amount was observed due to the arrangement of (His) 6.

(3) Immunological identification of human growth hormone Human growth hormone was identified by Western blotting, which is one of the immunological techniques. The culture medium obtained by culturing each transformant obtained in (2) of Example 9 was centrifuged at 15,000 rpm for 2 minutes, and the culture supernatant 15
After electrophoresing μl in the same manner as in Example 9 (2), it was electrically blotted onto a nitrocellulose membrane by a known method (Towbin, H. et al., 76, 4350-4354, (1979)).
Next, apply the membrane to buffer 3 (20 mM Tris-HCl (pH
7.4), soaked in 5% skim milk solution in 150 mM NaCl, 0.1% Tween20) for 15 min, then in buffer 3 to 2000
Rabbit anti-human growth hormone antibody (Biostride,
It was immersed in Inc.) for 30 minutes with shaking. Then, wash with buffer 3 for 3 times with shaking for 10 minutes.
It was immersed in a peroxidase-labeled anti-rabbit IgG antibody (manufactured by EY Laboratories) diluted 2000-fold with 30 minutes with shaking. After completion of the immersion, the plate was washed 3 times with buffer 3 for 10 minutes while shaking, and the presence of human growth hormone was examined using an ECL detection kit from Amersham. The method followed the instruction manual of the kit. As shown in FIG. 3, all fusions except pNU211R2L5 (lane 1) in which no GH gene sequence was integrated, namely, MWPsp-GH22kd (lane 2), MWPsp-MWPmp20-Cleavage 1-GH22kd (lane). 3), MWPsp-MWPmp20-Linker-Cleavage 1-GH22kd (lane 4), MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH2
2kd (lane 5), MWPsp-MWPmp20-Linker-Cleavage 1-G
H20kd (lane 6), MWPsp-MWPmp20- (His) 6-Linker-Cle
avage 1-GH20kd (lane 7), MWPsp-MWPmp20-Linker-C
leavage 2-GH22kd (lane 8), MWPsp-MWPmp20- (His) 6
A remarkable signal (arrow) of the fusion protein reacted with the anti-human growth hormone antibody was detected in -Linker-Cleavage 2-GH22kd (lane 9). MWPsp-MWPmp20-Cleavage 1-GH2
2kd (lane 3), MWPsp-MWPmp20-Linker-Cleavage 1-G
H22kd (lane 4), MWPsp-MWPmp20- (His) 6-Linker-Cle
In the order of avage 1-GH22kd (lane 5), the band indicated by the arrow was darkened, indicating that the secretory amount was increased. That is, it was shown that Linker alone or the coexistence of (His) 6 and Linker increased the secretion amount. Also in the fusion of cleavage mode Cleavage 2, compared to Linker alone (lane 8) (Hi
s) 6 and Linker co-existence (lane 9) was observed to have an effect on the increase in secretion amount. In addition, in the fusion of GH20kd, the secretion amount is GH
It was less than 22kd. Moreover, the effects of Linker and (His) 6 were not significant. Meanwhile, the human growth hormone gene
MWPsp-GH22kd linked immediately after the MWP signal peptide
In, the signal was slight and the secreted amount was very low.

(4) Quantification of human growth hormone expression level by HPLC Fusion using Cleavage 1, ie, MWPsp-MWPmp2
0-Cleavage 1-GH22kd, MWPsp-MWPmp20-Linker-Cleavage
1-GH22kd, MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-
For GH22kd, Leader's MWPmp20, Linker, and (His) were determined by HPLC quantifying human growth hormone in the medium while comparing the negative control pNU211R2L5, MW22sp-GH22kd with GH22kd ligated immediately after the MWP signal peptide. )
The effect of 6 on secretion was examined.

The medium obtained by culturing each transformant obtained in (2) of Example 9 was centrifuged at 1,5000 rpm for 20 minutes, and 194 μl of the obtained supernatant was treated with 6N HCl. 6 μl was added and mixed, and the mixture was further centrifuged at 1,5000 rpm for 10 minutes. 0.22μ of supernatant
C4 column (Waters Symmetry3) filtered through a membrane filter of m and equilibrated with 0.1% TFA / 45% acetonitrile.
00, 4.6 x 250 mm, 5 μm) and 0.1% TFA / 45
Eluted with -73% acetonitrile. When the concentration of acetonitrile was increased at a rate of 2% / min, the peak that appeared around 20.35 min was quantified. FIG. 4 shows the quantitative values of growth hormone secreted per 1 L of the medium of each clone. Only slight secretion was observed in MWPsp-GH22kd (column B), but Leader (MWPmp20) -Cleavage 1 was found between MWPsp and GH22kd, which are signal peptides of MWP.
(Column C), Leader (MWPmp20) -Linker-Cleavage 1
(Column D), Leader (MWPmp20)-(His) 6-Linker-Cleava
It was shown that the amount of secretion is increased by inserting ge 1 (column E).

Example 10 Cleavage and Analysis of Human Growth Hormone from Fusion Protein Fusion DNA, MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH
22kd, MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH20
kd, MWPsp-MWPmp20- (His) 6-Linker-Cleavage2-GH22kd
A 1/1000 volume of the culture suspension obtained by culturing overnight the transformant containing the expression vector in which was incorporated, contained 50 ml of the same medium as used for the expression in (2) of Example 9. 500
It was added to an Erlenmeyer flask (10 tubes) of ml and cultured at 30 ° C. for 4 days with shaking. The culture medium was centrifuged at 9,500 rpm for 20 min at 4 ° C, ammonium sulfate was added to the obtained culture supernatant so that the final concentration was 40%, and the mixture was allowed to stand at 4 ° C for 1 hour or longer, then again at 4 ° C.
It was centrifuged at 500 rpm for 20 min. The precipitate was dissolved by adding 1/2 volume of distilled water, and the mixture was centrifuged at 20,000 rpm for 20 minutes. Supernatant was equilibrated with 20 mM phosphate buffer (pH 8) to Ni chelate column (Che
lating Sepharose HP, Amersham Pharmacia Biotech)
Was applied to the column, adsorbed on the resin, and eluted with 90 mM imidazole to obtain a fraction containing the fusion protein. Next, urea and isopropanol were added to the fractions at 1 M and 20%, respectively, and the mixture was allowed to stand at 4 ° C. for 1 hour or more. afterwards,
Anion exchange column dialyzed against 20 mM Tris-HCl buffer (pH 8) / 1 mM EDTA and equilibrated with the same buffer (Q Seph
arose HP, Amersham Pharmacia Biotech) and adsorbed on the resin, and the fusion protein containing the growth hormone, which is the desired product, was eluted with 0.05M-0.3M NaCl.

Next, the following enzyme treatment was carried out in order to excise the growth hormone from the fusion protein. Cleavage 1, a fusion protein having the amino acid sequence of IleGluGlyArg (SEQ ID NO: 1), MWPmp20- (His) 6-Linker-Cleavage 1-GH2
For 2kd, MWPmp20- (His) 6-Linker-Cleavage 1-GH20kd, 50mM Tris-HCl buffer (pH8) / 100mM NaCl / 5mM
In CaCl2, 1 unit of Factor Xa (Novagen) was added to 100 μg of the fusion protein, and the mixture was reacted at 8 ° C. for 6 days. From this, the fusion protein is derived from the natural human growth hormone, GH22.
I was able to cut out kd and GH20kd.

Cleavage 2, ie GluAsnLeuTyrPheGl
Regarding the fusion protein having the amino acid sequence of nGly (SEQ ID NO: 2), MWPmp20- (His) 6-Linker-Cleavage 2-GH22kd, 20 mM Tris-HCl buffer (pH8) / 1 mM EDTA / 10 mM
In DTT, 1 unit of TEV protease (Invitrogen) was added to 50 μg of the fusion protein, and the mixture was reacted at room temperature (25 ° C.) for one day (about 16 hours). From this, the fusion protein
At the end, we were able to excise human growth hormone with an extra Gly.

In order to purify only growth hormone from the above enzyme reaction product, the above reaction product was equilibrated with 0.1% TFA / 10% acetonitrile by a reverse phase column (Resource RPC, Amersh).
amPharmacia Biotech) applied and adsorbed, 38%
Eluted with -52% acetonitrile. This was further dialyzed against 20 mM Tris-HCl buffer to obtain the desired growth hormone.

Commercially available human growth hormone (Norditropi
n), and isolated and purified natural human growth hormone 22k
TFA was added to d, 20kd, and 22kd mutant growth hormone having an extra Gly at the N terminus to give a final concentration of 0.5%.
% TFA / 40% acetonitrile equilibrated C4 column (Wat
ers Symmetry300, 4.6 × 250 mm, 5 μm) and eluted with 0.1% TFA / 52-55% acetonitrile. The elution pattern is shown in FIG. Natural human growth hormone
22kd (B) and 22kd (C), a mutant growth hormone having an extra Gly at the N-terminus, showed the same elution pattern as the commercially available growth hormone (A). Natural human growth hormone 20kd (D)
Were eluted at different positions, reflecting the difference in molecular weight.

[Example 11] Measurement of biological activity of natural type human growth hormones 22kd, 20kd and mutant type growth hormone The peak fraction containing the growth hormone eluted by HPLC of Example 10 was dried and distilled water. After dissolution, a part was eluted by HPLC under the same conditions as above, and the concentration was determined from the obtained peak area. At this time, the concentration of each growth hormone was adjusted with 0.25% BSA / 0.9% NaCl based on the peak area of commercially available growth hormone. This was used in the following bioactivity test. The biological activity of human growth hormone was examined by its effect on growth after administration to hypophysectomized rats. 35 days old female Wistar rats 4 days after pituitary gland removal (1 group 7
0.05 IU per animal for each specimen
Each was administered daily for 4 days. As a negative control, 0.25% B
SA / 0.9% NaCl was administered. Four days after the administration, the rat was sacrificed, the femur was taken out, and the bone length was measured. In addition, the body weight during the administration period was also measured. Student's t is the test of significance
I went with test. FIG. 6 shows the change in body weight after administration. No weight gain was seen in the negative controls,
Mutant GH22kd with Gly at the N-terminal of the test substance, natural GH22k
d. Natural GH20kd showed the same weight gain effect as the positive control. Regarding the bone length of the femur, the same effect of increasing bone length as in the positive control was observed in the animals to which the test substance was administered (Fig. 7).

[0074]

INDUSTRIAL APPLICABILITY As described above, according to the present invention, the production of genetically modified human growth hormone is dramatically increased, and active natural human growth hormone, a functional fragment, mutant or analogue thereof is provided. The technology for mass production was established.

[0075]

[Sequence list]                           SEQUENCE LISTING <110> ITOHAM FOODS INC. <120> DNA for high expression of growth hormone, and use thereof <130> 2001PA0412 <160> 43 <210> 1 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Cleavage 1 used as a cleave site of a fusion protein with factor X a to yield GH. <400> 1 Ile Glu Gly Arg   1 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Cleavage 2 used as a cleavage site of a fusion protein with TEV pr otease to yield GH. <400> 2 Glu Asn Leu Tyr Phe Gln Gly   1 5 <210> 3 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> A Candidate of Linker for efficient production of GH. <400> 3 Asp Tyr Asp Ile Pro Thr Thr   1 5 <210> 4 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> A candidate of Cleavage used as a cleavage site of a fusion protei n with TEV protease to yield GH. <400> 4 Glu Asn Leu Tyr Phe Gln Ser   1 5 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR amplification of DNA containing MWPsp-MWPmp 20 at its 5'-end. <400> 5 gtcgttaaca gtgtattgct 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PCR amplification of MWPsp-MWPmp20 DNA. <400> 6 tacggttttt tccatatcag c 21 <210> 7 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Designed peptide containing Linker and Cleavage, (His) 6-Linker-Cle avage 1. <400> 7 His His His His His Asp Tyr Asp Ile Pro Thr Thr Ile Glu Gly   1 5 10 15 Arg <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Forward oligonucleotide encoding (His) 6-Linker-Cleavage 1. <400> 8 catcatcatc atcatcacga ctatgatatc ccgaccacta tcgaaggtcg t 51 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Reverse oligonucleotide encoding (His) 6-Linker-Cleavage 1. <400> 9 acgaccttcg atagtggtcg ggatatcata gtcgtgatga tgatgatgat g 51 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR amplification of DNA encoding GH22kd. <400> 10 atggctacag gctcccggac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PCR amplification of DNA including a sequence e ncoding GH22kd at its 3'-end. <400> 11 ctagaagcca cagctgccct 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR amplification of GH22kd. <400> 12 ttcccaacca ttcccttatc 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PCR amplification of a fusion DNA designated as  MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1. <400> 13 acgaccttcg atagtggtcg g 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR amplification of a fusion DNA of Linker-Cle avage 1-GH22kd. <400> 14 gactatgata tcccgaccac t 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR amplification of a fusion DNA of Cleavage 1 -GH22kd. <400> 15 atcgaaggtc gtttcccaac c 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PCR amplification of a DNA fragment designated as MWPsp-MWPmp20-Linker-Cleavage 1-GH (A). <400> 16 aaactcctgg taggtgtcaa a 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR amplification of DNA encoding a fragment of  growth human hormone, GH (B). <400> 17 aacccccaga cctccctctg t 21 <210> 18 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> Designed fusion protein, (His) 6-Linker-Cleavage 2. <400> 18 His His His His His Asp Tyr Asp Ile Pro Thr Thr Glu Asn Leu   1 5 10 15 Tyr Phe Gln Gly              20 <210> 19 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Forward oligonucleotide encoding (His) 6-Linker-Cleavage 2. <400> 19 catcatcatc atcatcacga ctatgatatc ccgaccactg aaaacctgta cttccaaggt 60 <210> 20 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Reverse oligonucleotide encoding (His) 6-Linker-Cleavage 2. <400> 20 accttggaag tacaggtttt cagtggtcgg gatatcatag tcgtgatgat gatgatgatg 60 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PCR amplification of MWPsp. <400> 21 tgcgaaagcc attggagcaa c 21 <210> 22 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH22kd. <400> 22 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val His His His His His His Asp Tyr          35 40 45 Asp Ile Pro Thr Thr Ile Glu Gly Arg Phe Pro Thr Ile Pro Leu Ser      50 55 60 Arg Leu Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu His Gln Leu  65 70 75 80 Ala Phe Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys Glu                  85 90 95 Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe Ser             100 105 110 Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys Ser         115 120 125 Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp Leu     130 135 140 Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val Tyr 145 150 155 160 Gly Ala Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu                 165 170 175 Gly Ile Gln Thr Leu Met Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr             180 185 190 Gly Gln Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser His         195 200 205 Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg     210 215 220 Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys Arg 225 230 235 240 Ser Val Glu Gly Ser Cys Gly Phe                 245 <210> 23 <211> 242 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20-Linker-Cleavage 1-GH22k d. <400> 23 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val Asp Tyr Asp Ile Pro Thr Thr Ile          35 40 45 Glu Gly Arg Phe Pro Thr Ile Pro Leu Ser Arg Leu Phe Asp Asn Ala      50 55 60 Met Leu Arg Ala His Arg Leu His Gln Leu Ala Phe Asp Thr Tyr Gln  65 70 75 80 Glu Phe Glu Glu Ala Tyr Ile Pro Lys Glu Gln Lys Tyr Ser Phe Leu                  85 90 95 Gln Asn Pro Gln Thr Ser Leu Cys Phe Ser Glu Ser Ile Pro Thr Pro             100 105 110 Ser Asn Arg Glu Glu Thr Gln Gln Lys Ser Asn Leu Glu Leu Leu Arg         115 120 125 Ile Ser Leu Leu Leu Ile Gln Ser Trp Leu Glu Pro Val Gln Phe Leu     130 135 140 Arg Ser Val Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser Asp Ser Asn 145 150 155 160 Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln Thr Leu Met                 165 170 175 Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr Gly Gln Ile Phe Lys Gln             180 185 190 Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp Asp Ala Leu Leu         195 200 205 Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg Lys Asp Met Asp Lys Val     210 215 220 Glu Thr Phe Leu Arg Ile Val Gln Cys Arg Ser Val Glu Gly Ser Cys 225 230 235 240 Gly Phe <210> 24 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20-Cleavage 1-GH22kd. <400> 24 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val Ile Glu Gly Arg Phe Pro Thr Ile          35 40 45 Pro Leu Ser Arg Leu Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu      50 55 60 His Gln Leu Ala Phe Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile  65 70 75 80 Pro Lys Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu                  85 90 95 Cys Phe Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln             100 105 110 Gln Lys Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln         115 120 125 Ser Trp Leu Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala Asn Ser     130 135 140 Leu Val Tyr Gly Ala Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp 145 150 155 160 Leu Glu Glu Gly Ile Gln Thr Leu Met Gly Arg Leu Glu Asp Gly Ser                 165 170 175 Pro Arg Thr Gly Gln Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr             180 185 190 Asn Ser His Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr         195 200 205 Cys Phe Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val     210 215 220 Gln Cys Arg Ser Val Glu Gly Ser Cys Gly Phe 225 230 235 <210> 25 <211> 233 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH20kd. <400> 25 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val His His His His His His Asp Tyr          35 40 45 Asp Ile Pro Thr Thr Ile Glu Gly Arg Phe Pro Thr Ile Pro Leu Ser      50 55 60 Arg Leu Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu His Gln Leu  65 70 75 80 Ala Phe Asp Thr Tyr Gln Glu Phe Asn Pro Gln Thr Ser Leu Cys Phe                  85 90 95 Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys             100 105 110 Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp         115 120 125 Leu Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val     130 135 140 Tyr Gly Ala Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu 145 150 155 160 Glu Gly Ile Gln Thr Leu Met Gly Arg Leu Glu Asp Gly Ser Pro Arg                 165 170 175 Thr Gly Gln Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser             180 185 190 His Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe         195 200 205 Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys     210 215 220 Arg Ser Val Glu Gly Ser Cys Gly Phe 225 230 <210> 26 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20-Linker-Cleavage 1-GH20k d. <400> 26 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val Asp Tyr Asp Ile Pro Thr Thr Ile          35 40 45 Glu Gly Arg Phe Pro Thr Ile Pro Leu Ser Arg Leu Phe Asp Asn Ala      50 55 60 Met Leu Arg Ala His Arg Leu His Gln Leu Ala Phe Asp Thr Tyr Gln  65 70 75 80 Glu Phe Asn Pro Gln Thr Ser Leu Cys Phe Ser Glu Ser Ile Pro Thr                  85 90 95 Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys Ser Asn Leu Glu Leu Leu             100 105 110 Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp Leu Glu Pro Val Gln Phe         115 120 125 Leu Arg Ser Val Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser Asp Ser     130 135 140 Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln Thr Leu 145 150 155 160 Met Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr Gly Gln Ile Phe Lys                 165 170 175 Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp Asp Ala Leu             180 185 190 Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg Lys Asp Met Asp Lys         195 200 205 Val Glu Thr Phe Leu Arg Ile Val Gln Cys Arg Ser Val Glu Gly Ser     210 215 220 Cys Gly Phe 225 <210> 27 <211> 251 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20- (His) 6-Linker-Cleavage 2-GH22kd. <400> 27 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val His His His His His His Asp Tyr          35 40 45 Asp Ile Pro Thr Thr Glu Asn Leu Tyr Phe Gln Gly Phe Pro Thr Ile      50 55 60 Pro Leu Ser Arg Leu Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu  65 70 75 80 His Gln Leu Ala Phe Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile                  85 90 95 Pro Lys Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu             100 105 110 Cys Phe Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln         115 120 125 Gln Lys Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln     130 135 140 Ser Trp Leu Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala Asn Ser 145 150 155 160 Leu Val Tyr Gly Ala Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp                 165 170 175 Leu Glu Glu Gly Ile Gln Thr Leu Met Gly Arg Leu Glu Asp Gly Ser             180 185 190 Pro Arg Thr Gly Gln Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr         195 200 205 Asn Ser His Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr     210 215 220 Cys Phe Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val 225 230 235 240 Gln Cys Arg Ser Val Glu Gly Ser Cys Gly Phe                 245 250 <210> 28 <211> 245 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-MWPmp20-Linker-Cleavage 2-GH22k d. <400> 28 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Ala Glu Glu Ala Ala Thr Thr Thr Ala Pro Lys Met              20 25 30 Asp Ala Asp Met Glu Lys Thr Val Asp Tyr Asp Ile Pro Thr Thr Glu          35 40 45 Asn Leu Tyr Phe Gln Gly Phe Pro Thr Ile Pro Leu Ser Arg Leu Phe      50 55 60 Asp Asn Ala Met Leu Arg Ala His Arg Leu His Gln Leu Ala Phe Asp  65 70 75 80 Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys Glu Gln Lys Tyr                  85 90 95 Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe Ser Glu Ser Ile             100 105 110 Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys Ser Asn Leu Glu         115 120 125 Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp Leu Glu Pro Val     130 135 140 Gln Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser 145 150 155 160 Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln                 165 170 175 Thr Leu Met Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr Gly Gln Ile             180 185 190 Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp Asp         195 200 205 Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg Lys Asp Met     210 215 220 Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys Arg Ser Val Glu 225 230 235 240 Gly Ser Cys Gly Phe                 245 <210> 29 <211> 211 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein designated as MWPsp-GH22kd. <400> 29 Val Val Asn Ser Val Leu Ala Ser Ala Leu Ala Leu Thr Val Ala Pro   1 5 10 15 Met Ala Phe Ala Phe Pro Thr Ile Pro Leu Ser Arg Leu Phe Asp Asn              20 25 30 Ala Met Leu Arg Ala His Arg Leu His Gln Leu Ala Phe Asp Thr Tyr          35 40 45 Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys Glu Gln Lys Tyr Ser Phe      50 55 60 Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe Ser Glu Ser Ile Pro Thr  65 70 75 80 Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys Ser Asn Leu Glu Leu Leu                  85 90 95 Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp Leu Glu Pro Val Gln Phe             100 105 110 Leu Arg Ser Val Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser Asp Ser         115 120 125 Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln Thr Leu     130 135 140 Met Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr Gly Gln Ile Phe Lys 145 150 155 160 Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp Asp Ala Leu                 165 170 175 Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg Lys Asp Met Asp Lys             180 185 190 Val Glu Thr Phe Leu Arg Ile Val Gln Cys Arg Ser Val Glu Gly Ser         195 200 205 Cys Gly Phe     210 <210> 30 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20- (His) 6-Linker- Cleavage 1-GH22kd. <400> 30 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 catcatcatc atcatcacga ctatgatatc ccgaccacta tcgaaggtcg tttcccaacc 180 attcccttat ccaggctttt tgacaacgct atgctccgcg cccatcgtct gcaccagctg 240 gcctttgaca cctaccagga gtttgaagaa gcctatatcc caaaggaaca gaagtattca 300 ttcctgcaga acccccagac ctccctctgt ttctcagagt ctattccgac accctccaac 360 agggaggaaa cacaacagaa atccaaccta gagctgctcc gcatctccct gctgctcatc 420 cagtcgtggc tggagcccgt gcagttcctc aggagtgtct tcgccaacag cctggtgtac 480 ggcgcctctg acagcaacgt ctatgacctc ctaaaggacc tagaggaagg catccaaacg 540 ctgatgggga ggctggaaga tggcagcccc cggactgggc agatcttcaa gcagacctac 600 agcaagttcg acacaaactc acacaacgat gacgcactac tcaagaacta cgggctgctc 660 tactgcttca ggaaggacat ggacaaggtc gagacattcc tgcgcatcgt gcagtgccgc 720 tctgtggagg gcagctgtgg cttc 744 <210> 31 <211> 726 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20-Linker-Cleavag e 1-GH22kd. <400> 31 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 gactatgata tcccgaccac tatcgaaggt cgtttcccaa ccattccctt atccaggctt 180 tttgacaacg ctatgctccg cgcccatcgt ctgcaccagc tggcctttga cacctaccag 240 gagtttgaag aagcctatat cccaaaggaa cagaagtatt cattcctgca gaacccccag 300 acctccctct gtttctcaga gtctattccg acaccctcca acagggagga aacacaacag 360 aaatccaacc tagagctgct ccgcatctcc ctgctgctca tccagtcgtg gctggagccc 420 gtgcagttcc tcaggagtgt cttcgccaac agcctggtgt acggcgcctc tgacagcaac 480 gtctatgacc tcctaaagga cctagaggaa ggcatccaaa cgctgatggg gaggctggaa 540 gatggcagcc cccggactgg gcagatcttc aagcagacct acagcaagtt cgacacaaac 600 tcacacaacg atgacgcact actcaagaac tacgggctgc tctactgctt caggaaggac 660 atggacaagg tcgagacatt cctgcgcatc gtgcagtgcc gctctgtgga gggcagctgt 720 ggcttc 726 <210> 32 <211> 705 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20-Cleavage 1-GH2 2kd. <400> 32 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 atcgaaggtc gtttcccaac cattccctta tccaggcttt ttgacaacgc tatgctccgc 180 gcccatcgtc tgcaccagct ggcctttgac acctaccagg agtttgaaga agcctatatc 240 ccaaaggaac agaagtattc attcctgcag aacccccaga cctccctctg tttctcagag 300 tctattccga caccctccaa cagggaggaa acacaacaga aatccaacct agagctgctc 360 cgcatctccc tgctgctcat ccagtcgtgg ctggagcccg tgcagttcct caggagtgtc 420 ttcgccaaca gcctggtgta cggcgcctct gacagcaacg tctatgacct cctaaaggac 480 ctagaggaag gcatccaaac gctgatgggg aggctggaag atggcagccc ccggactggg 540 cagatcttca agcagaccta cagcaagttc gacacaaact cacacaacga tgacgcacta 600 ctcaagaact acgggctgct ctactgcttc aggaaggaca tggacaaggt cgagacattc 660 ctgcgcatcg tgcagtgccg ctctgtggag ggcagctgtg gcttc 705 <210> 33 <211> 699 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20- (His) 6-Linker- Cleavage 1-GH20kd. <400> 33 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 catcatcatc atcatcacga ctatgatatc ccgaccacta tcgaaggtcg tttcccaacc 180 attcccttat ccaggctttt tgacaacgct atgctccgcg cccatcgtct gcaccagctg 240 gcctttgaca cctaccagga gtttaacccc cagacctccc tctgtttctc agagtctatt 300 ccgacaccct ccaacaggga ggaaacacaa cagaaatcca acctagagct gctccgcatc 360 tccctgctgc tcatccagtc gtggctggag cccgtgcagt tcctcaggag tgtcttcgcc 420 aacagcctgg tgtacggcgc ctctgacagc aacgtctatg acctcctaaa ggacctagag 480 gaaggcatcc aaacgctgat ggggaggctg gaagatggca gcccccggac tgggcagatc 540 ttcaagcaga cctacagcaa gttcgacaca aactcacaca acgatgacgc actactcaag 600 aactacgggc tgctctactg cttcaggaag gacatggaca aggtcgagac attcctgcgc 660 atcgtgcagt gccgctctgt ggagggcagc tgtggcttc 699 <210> 34 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20-Linker-Cleavag e 1-GH20kd. <400> 34 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 gactatgata tcccgaccac tatcgaaggt cgtttcccaa ccattccctt atccaggctt 180 tttgacaacg ctatgctccg cgcccatcgt ctgcaccagc tggcctttga cacctaccag 240 gagtttaacc cccagacctc cctctgtttc tcagagtcta ttccgacacc ctccaacagg 300 gaggaaacac aacagaaatc caacctagag ctgctccgca tctccctgct gctcatccag 360 tcgtggctgg agcccgtgca gttcctcagg agtgtcttcg ccaacagcct ggtgtacggc 420 gcctctgaca gcaacgtcta tgacctccta aaggacctag aggaaggcat ccaaacgctg 480 atggggaggc tggaagatgg cagcccccgg actgggcaga tcttcaagca gacctacagc 540 aagttcgaca caaactcaca caacgatgac gcactactca agaactacgg gctgctctac 600 tgcttcagga aggacatgga caaggtcgag acattcctgc gcatcgtgca gtgccgctct 660 gtggagggca gctgtggctt c 681 <210> 35 <211> 753 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20- (His) 6-Linker- Cleavage 2-GH22kd. <400> 35 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 catcatcatc atcatcacga ctatgatatc ccgaccactg aaaacctgta cttccaaggt 180 ttcccaacca ttcccttatc caggcttttt gacaacgcta tgctccgcgc ccatcgtctg 240 caccagctgg cctttgacac ctaccaggag tttgaagaag cctatatccc aaaggaacag 300 aagtattcat tcctgcagaa cccccagacc tccctcttttctcagagtc tattccgaca 360 ccctccaaca gggaggaaac acaacagaaa tccaacctag agctgctccg catctccctg 420 ctgctcatcc agtcgtggct ggagcccgtg cagttcctca ggagtgtctt cgccaacagc 480 ctggtgtacg gcgcctctga cagcaacgtc tatgacctcc taaaggacct agaggaaggc 540 atccaaacgc tgatggggag gctggaagat ggcagccccc ggactgggca gatcttcaag 600 cagacctaca gcaagttcga cacaaactca cacaacgatg acgcactact caagaactac 660 gggctgctct actgcttcag gaaggacatg gacaaggtcg agacattcct gcgcatcgtg 720 cagtgccgct ctgtggaggg cagctgtggc ttc 753 <210> 36 <211> 735 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-MWPmp20-Linker-Cleavag e 2-GH22kd. <400> 36 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 gcagaagaag cagcaactac tacagctcca aaaatggacg ctgatatgga aaaaaccgta 120 gactatgata tcccgaccac tgaaaacctg tacttccaag gtttcccaac cattccctta 180 tccaggcttt ttgacaacgc tatgctccgc gcccatcgtc tgcaccagct ggcctttgac 240 acctaccagg agtttgaaga agcctatatc ccaaaggaac agaagtattc attcctgcag 300 aacccccaga cctccctctg tttctcagag tctattccga caccctccaa cagggaggaa 360 acacaacaga aatccaacct agagctgctc cgcatctccc tgctgctcat ccagtcgtgg 420 ctggagcccg tgcagttcct caggagtgtc ttcgccaaca gcctggtgta cggcgcctct 480 gacagcaacg tctatgacct cctaaaggac ctagaggaag gcatccaaac gctgatgggg 540 aggctggaag atggcagccc ccggactggg cagatcttca agcagaccta cagcaagttc 600 gacacaaact cacacaacga tgacgcacta ctcaagaact acgggctgct ctactgcttc 660 aggaaggaca tggacaaggt cgagacattc ctgcgcatcg tgcagtgccg ctctgtggag 720 ggcagctgtg gcttc 735 <210> 37 <211> 633 <212> DNA <213> Artificial Sequence <220> <223> Designed nucleotide sequence encoding MWPsp-GH22kd. <400> 37 gtcgttaaca gtgtattggc tagtgcactc gcacttactg ttgctccaat ggctttcgca 60 ttcccaacca ttcccttatc caggcttttt gacaacgcta tgctccgcgc ccatcgtctg 120 caccagctgg cctttgacac ctaccaggag tttgaagaag cctatatccc aaaggaacag 180 aagtattcat tcctgcagaa cccccagacc tccctctgtt tctcagagtc tattccgaca 240 ccctccaaca gggaggaaac acaacagaaa tccaacctag agctgctccg catctccctg 300 ctgctcatcc agtcgtggct ggagcccgtg cagttcctca ggagtgtctt cgccaacagc 360 ctggtgtacg gcgcctctga cagcaacgtc tatgacctcc taaaggacct agaggaaggc 420 atccaaacgc tgatggggag gctggaagat ggcagccccc ggactgggca gatcttcaag 480 cagacctaca gcaagttcga cacaaactca cacaacgatg acgcactact caagaactac 540 gggctgctct actgcttcag gaaggacatg gacaaggtcg agacattcct gcgcatcgtg 600 cagtgccgct ctgtggaggg cagctgtggc ttc 633 <210> 38 <211> 217 <212> PRT <213> Homo sapiens <300> <303> Genomics <304> 4 <306> 479-497 <307> 1989 <400> 38 Met Ala Thr Gly Ser Arg Thr Ser Leu Leu Leu Ala Phe Gly Leu Leu   1 5 10 15 Cys Leu Pro Trp Leu Gln Glu Gly Ser Ala Phe Pro Thr Ile Pro Leu              20 25 30 Ser Arg Leu Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu His Gln          35 40 45 Leu Ala Phe Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys      50 55 60 Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe  65 70 75 80 Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys                  85 90 95 Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp             100 105 110 Leu Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val         115 120 125 Tyr Gly Ala Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu     130 135 140 Glu Gly Ile Gln Thr Leu Met Gly Arg Leu Glu Asp Gly Ser Pro Arg 145 150 155 160 Thr Gly Gln Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser                 165 170 175 His Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe             180 185 190 Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys         195 200 205 Arg Ser Val Glu Gly Ser Cys Gly Phe     210 215 <210> 39 <211> 217 <212> PRT <213> Homo sapiens <300> <303> Genomics <304> 4 <306> 479-497 <307> 1989 <400> 39 Met Ala Ala Gly Ser Arg Thr Ser Leu Leu Leu Ala Phe Gly Leu Leu   1 5 10 15 Cys Leu Ser Trp Leu Gln Glu Gly Ser Ala Phe Pro Thr Ile Pro Leu              20 25 30 Ser Arg Leu Phe Asp Asn Ala Met Leu Arg Ala Arg Arg Leu Tyr Gln          35 40 45 Leu Ala Tyr Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Leu Lys      50 55 60 Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe  65 70 75 80 Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Val Lys Thr Gln Gln Lys                  85 90 95 Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp             100 105 110 Leu Glu Pro Val Gln Leu Leu Arg Ser Val Phe Ala Asn Ser Leu Val         115 120 125 Tyr Gly Ala Ser Asp Ser Asn Val Tyr Arg His Leu Lys Asp Leu Glu     130 135 140 Glu Gly Ile Gln Thr Leu Met Trp Arg Leu Glu Asp Gly Ser Pro Arg 145 150 155 160 Thr Gly Gln Ile Phe Asn Gln Ser Tyr Ser Lys Phe Asp Thr Lys Ser                 165 170 175 His Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe             180 185 190 Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys         195 200 205 Arg Ser Val Glu Gly Ser Cys Gly Phe     210 215 <210> 40 <211> 1200 <212> DNA <213> Bacillus brevis <220> <221> CDS <222> (621) ... (> 1220) <220> <221> sig_peptide <222> (621) ... (689) <220> <221> mat_peptide <222> (690) ... (> 1217) <220> <221> misc_feature       / note = "transcription initiation site 1" <222> 260 <220> <221> misc_feature       / note = "transcription initiation site 2" <222> 374 <220> <221> misc_feature       / note = "transcription initiation site 3" <222> 444 <220> <221> misc_feature       / note = "transcription initiation site 4" <222> 490 <220> <221> misc_feature       / note = "transcription initiation site 5" <222> 504 <300> <303> J. Bacteriol. <304> 169 <306> 1239-1245 <307> 1987 <400> 40 cagctgagag ctatcgcttg aaaaatttgc gttatgaaaa tggacttgcg acgactttag 60 aggtcattca atcggaagaa acattgtcta ctcgtgagaa tgcgtaccaa aaagctatcc 120 tgtcttacaa cttggctgtt gtaaactttg aaaatgcatt aggaaattaa cctaattcaa 180 gcaagattat gaggttttga accaaattgg aaaaaggttc agtcgtgaca gcccgccata 240 tgtcccctat aatacggatt gtggcggatg tcacttcgta cataatggac aggtgaataa 300 cgaaccacga aaaaaacttt aaattttttt cgaaggcgcc gcaacttttg attcgctcag 360 gcgtttaata ggatgtcaca cgaaaaacgg ggaattgtgt aaaaaagatt cacgaattct 420 agcagttgtg ttacactagt gattgttgca ttttacacaa tactgaatat actagagatt 480 tttaacacaa aaagcgaggc tttcctgcga aaggaggtga cacgcgcttg caggattcgg 540 gctttaaaaa gaaagataga ttaacaacaa atattcccca agaacaattt gtttatacta 600 gaggaggaga acacaaggtt atg aaa aag gtc gtt aac agt gta ttg gct agt 653                       Met Lys Lys Val Val Asn Ser Val Leu Ala Ser                         1 5 10 gca ctc gca ctt act gtt gct cca atg gct ttc gca gca gaa gaa gca 701 Ala Leu Ala Leu Thr Val Ala Pro Met Ala Phe Ala Ala Glu Glu Ala              15 20 25 gca act act aca gct cca aaa atg gac gct gat atg gaa aaa acc gta 749 Ala Thr Thr Thr Ala Pro Lys Met Asp Ala Asp Met Glu Lys Thr Val          30 35 40 aaa cgt ctg gaa gct ctt ggc ctg gta gca ggt tat ggc aac ggc gaa 797 Lys Arg Leu Glu Ala Leu Gly Leu Val Ala Gly Tyr Gly Asn Gly Glu      45 50 55 tac ggt gta gac aaa act atc act cgt gca gag ttc gct act ctg gtt 845 Tyr Gly Val Asp Lys Thr Ile Thr Arg Ala Glu Phe Ala Thr Leu Val  60 65 70 75 gtt cgc gct cgc gga ctg gag caa ggt gcg aaa ttg gca caa ttc agc 893 Val Arg Ala Arg Gly Leu Glu Gln Gly Ala Lys Leu Ala Gln Phe Ser                  80 85 90 aat act tac aca gat gtg aaa tct act gat tgg ttt gct ggt ttc gta 941 Asn Thr Tyr Thr Asp Val Lys Ser Thr Asp Trp Phe Ala Gly Phe Val              95 100 105 aac gta gct tcc ggc gaa gaa atc gta aaa ggt ttc ccg gac aaa tct 989 Asn Val Ala Ser Gly Glu Glu Ile Val Lys Gly Phe Pro Asp Lys Ser         110 115 120 ttc aaa cca caa aac caa gtt act tat gct gaa gct gta act atg atc 1037 Phe Lys Pro Gln Asn Gln Val Thr Tyr Ala Glu Ala Val Thr Met Ile     125 130 135 gtt cgt gca ctg ggt tat gag cca tcc gtt aag ggt gta tgg cct aac 1085 Val Arg Ala Leu Gly Tyr Glu Pro Ser Val Lys Gly Val Trp Pro Asn 140 145 150 155 agc atg atc tcc aaa gct tcc gag ctg aac att gct aga agc atc act 1133 Ser Met Ile Ser Lys Ala Ser Glu Leu Asn Ile Ala Arg Ser Ile Thr                 160 165 170 act cct aac aat gca gca act cgt ggc gat atc ttc aaa atg ctc gac 1181 Thr Pro Asn Asn Ala Ala Thr Arg Gly Asp Ile Phe Lys Met Leu Asp             175 180 185 aac gct ctt cgc gta gac ctg atg gag caa gtt gaa ttc 1220 Asn Ala Leu Arg Val Asp Leu Met Glu Gln Val Glu Phe         190 195 200 <210> 41 <211> 4330 <212> DNA <213> Bacillus brevis <220> <221> CDS <222> (548) ... (3898) <220> <221> sig_peptide <222> (548) ... (706) <220> <221> mat_peptide <222> (707) ... (3895) <220> <221> misc_feature       / note = "transcription initiation site 1" <222> 280 <220> <221> misc_feature       / note = "transcription initiation site 2" <222> 390 <220> <221> misc_feature       / note = "transcription initiation site 3" <222> 460 <220> <221> misc_feature       / note = "transcription initiation site 4" <222> 508 <220> <221> misc_feature       / note = "transcription initiation site 5" <222> 521 <300> <303> J. Bacteriol. <304> 172 <306> 1312-1320 <307> 1990 <400> 41 atcgattacc aaaaaaccgc gaaagattcc gcggctgaga gctatcgttt gaccaatttg 60 cgctttgaaa cggtctggca acgaccctcg aagtgattca gccgaggagg aattatccaa 120 ccgtgagaat cagtaccaaa aagcgatcct gcagtacaat ctggctgtgg taaactttga 180 aactgccctc ggaagctaag aagaatttgt aaggttttga atggaactgg aaaaaggttc 240 aatggtgaca gtccgtccgg cgtaccctat aatacgagtt gtggcggatg tcactgctta 300 catattacaa gtgaatacga cccatgaaaa tttctttaaa ctttttttct gaggcgccgc 360 aacttttgct cgactgaggc gtttaatagg gtgtcacacg aaaaacgggg aattgtgtaa 420 aaaagattca cggattctag catttgtgtt acactagtga ttgttacatt ttacacaata 480 gctgaatata ctagagattt ttaacacaaa aaagcgaagc tgtcctgcga aaggaggtga 540 cacgcgcttg caggattcgg gctttaaaaa gaaagataga tcaacaaata ttccccaaga 600 acaatttgtt tatactagag gaggagaaca caaggtt atg aaa aag gtc gtt aac 655                                          Met Lys Lys Val Val Asn                                            1 5 agt gta ttg gct agt gcg ctc gcc atc aca gtt gct cca atg gct ttc 703 Ser Val Leu Ala Ser Ala Leu Ala Ile Thr Val Ala Pro Met Ala Phe                  10 15 20 gca gca gag gac aca act aca gct cct aaa atg gat gct gca atg gag 751 Ala Ala Glu Asp Thr Thr Thr Ala Pro Lys Met Asp Ala Ala Met Glu              25 30 35 aaa acc gta aaa cgt ctg gaa gct ctt ggc ctg gta gca ggt tat ggc 799 Lys Thr Val Lys Arg Leu Glu Ala Leu Gly Leu Val Ala Gly Tyr Gly          40 45 50 aac ggc gat ttc ggt gca gac aaa acc atc act cgt gca gag ttc gct 847 Asn Gly Asp Phe Gly Ala Asp Lys Thr Ile Thr Arg Ala Glu Phe Ala      55 60 65 act cta atc gtt cgc gct cgc ggt ctg gag caa ggt gcg aaa ctg gca 895 Thr Leu Ile Val Arg Ala Arg Gly Leu Glu Gln Gly Ala Lys Leu Ala  70 75 80 85 caa ttc aac act act tac aca gat gtt aga tcc act gac tgg ttc gct 943 Gln Phe Asn Thr Thr Tyr Thr Asp Val Arg Ser Thr Asp Trp Phe Ala                  90 95 100 ggt ttt gta aac gta gct tcc ggt gaa gaa atc gta aaa ggt ttc ccg 991 Gly Phe Val Asn Val Ala Ser Gly Glu Glu Ile Val Lys Gly Phe Pro             105 110 115 gac aaa tct ttt aaa cca caa aac caa gtt act tat gct gaa gca gta 1039 Asp Lys Ser Phe Lys Pro Gln Asn Gln Val Thr Tyr Ala Glu Ala Val         120 125 130 acc atg atc gtt cgt gct ttg ggt tat gag cca tcc gtt cga ggt gta 1087 Thr Met Ile Val Arg Ala Leu Gly Tyr Glu Pro Ser Val Arg Gly Val     135 140 145 tgg ccg aac agc atg atc tcc aaa ggt tcc gaa ctg aac att gca aaa 1135 Trp Pro Asn Ser Met Ile Ser Lys Gly Ser Glu Leu Asn Ile Ala Lys 150 155 160 165 ggt atc aac aac cct aac atg cag cag ttc gcg gcg aca atc ttc aaa 1183 Gly Ile Asn Asn Pro Asn Met Gln Gln Phe Ala Ala Thr Ile Phe Lys                 170 175 180 atg ctg gac aac gct ctt cgc gtt aag ctg atg gag caa atc gaa tac 1231 Met Leu Asp Asn Ala Leu Arg Val Lys Leu Met Glu Gln Ile Glu Tyr             185 190 195 ggt act gac atc cgt tta aac gta act gac gaa act ctc ttg act aaa 1279 Gly Thr Asp Ile Arg Leu Asn Val Thr Asp Glu Thr Leu Leu Thr Lys         200 205 210 tat ttg aaa gtt acc gta cgt gat atg gac tgg gct cac gaa aag ggt 1327 Tyr Leu Lys Val Thr Val Arg Asp Met Asp Trp Ala His Glu Lys Gly     215 220 225 aac aat tct gat gaa ttg cca ctt gta aca aac gta cct gct att ggt 1375 Asn Asn Ser Asp Glu Leu Pro Leu Val Thr Asn Val Pro Ala Ile Gly 230 235 240 245 ctg ggt agt ttg aaa gca aat gaa gtt act ttg aat gga aaa gat gct 1423 Leu Gly Ser Leu Lys Ala Asn Glu Val Thr Leu Asn Gly Lys Asp Ala                 250 255 260 gat ctg ggt agc aac act act tat aaa gta gct gaa ggc atc aat cct 1471 Asp Leu Gly Ser Asn Thr Thr Tyr Lys Val Ala Glu Gly Ile Asn Pro             265 270 275 aac gca ttt gat ggt caa aaa gta caa gtg tgg atc aaa gat gac cga 1519 Asn Ala Phe Asp Gly Gln Lys Val Gln Val Trp Ile Lys Asp Asp Arg         280 285 290 gaa aat gtc atc gtt tgg atg gaa ggt tcc gaa gac gaa gat gtc gtt 1567 Glu Asn Val Ile Val Trp Met Glu Gly Ser Glu Asp Glu Asp Val Val     295 300 305 atg gac cgt gtg agt gct ctg tac ctg aaa ggt aaa gcc ttc aca gat 1615 Met Asp Arg Val Ser Ala Leu Tyr Leu Lys Gly Lys Ala Phe Thr Asp 310 315 320 325 gat att gta aaa gat ctt agc aag tct gat ttg gat gat gta aaa atc 1663 Asp Ile Val Lys Asp Leu Ser Lys Ser Asp Leu Asp Asp Val Lys Ile                 330 335 340 gaa atg gat ggt agc gag aaa tcg tat cgc ttg acg gaa gat acg aaa 1711 Glu Met Asp Gly Ser Glu Lys Ser Tyr Arg Leu Thr Glu Asp Thr Lys             345 350 355 atc act tat aac ttc act cgt ttc aac gat cca gta gat gct ctg agc 1759 Ile Thr Tyr Asn Phe Thr Arg Phe Asn Asp Pro Val Asp Ala Leu Ser         360 365 370 aaa att tac aaa gac aac gac acg ttt ggt gtt aaa gtt gtt ttg aat 1807 Lys Ile Tyr Lys Asp Asn Asp Thr Phe Gly Val Lys Val Val Leu Asn     375 380 385 gat aac aat gaa gtt gca tac ctc cac atc att gac gat caa aca att 1855 Asp Asn Asn Glu Val Ala Tyr Leu His Ile Ile Asp Asp Gln Thr Ile 390 395 400 405 gat aaa agc gta aaa ggc gtt aaa tac ggt tcc aaa gtt att agc aaa 1903 Asp Lys Ser Val Lys Gly Val Lys Tyr Gly Ser Lys Val Ile Ser Lys                 410 415 420 atc gat gct gat aag aag aaa atc acc aac ttg gat aac tcc aaa ttt 1951 Ile Asp Ala Asp Lys Lys Lys Ile Thr Asn Leu Asp Asn Ser Lys Phe             425 430 435 agc gac ttg gaa gat cag gat gaa gga aaa gac ttc ttg gta ttc ctt 1999 Ser Asp Leu Glu Asp Gln Asp Glu Gly Lys Asp Phe Leu Val Phe Leu         440 445 450 gat ggc caa cca gct aaa ctg ggt gat ctg aaa gaa tcc gat gtt tac 2047 Asp Gly Gln Pro Ala Lys Leu Gly Asp Leu Lys Glu Ser Asp Val Tyr     455 460 465 tcg gta tac tat gct gat ggt gat aaa gat aag tac ttg gtg ttt gct 2095 Ser Val Tyr Tyr Ala Asp Gly Asp Lys Asp Lys Tyr Leu Val Phe Ala 470 475 480 485 aac cgt aac gtt gca gaa gga aaa gta gaa aaa gtg gta agc cgt aac 2143 Asn Arg Asn Val Ala Glu Gly Lys Val Glu Lys Val Val Ser Arg Asn                 490 495 500 aag aca gac att cgt ctg act gtt ggt ggt aaa act tac aaa gta tat 2191 Lys Thr Asp Ile Arg Leu Thr Val Gly Gly Lys Thr Tyr Lys Val Tyr             505 510 515 cca gat gct tct tac tcc gaa aac gca aat aaa gat gtt aag aag gtt 2239 Pro Asp Ala Ser Tyr Ser Glu Asn Ala Asn Lys Asp Val Lys Lys Val         520 525 530 aat tcc gac ttg gat ctg att agc aac ctt gat gga gaa gaa gta aaa 2287 Asn Ser Asp Leu Asp Leu Ile Ser Asn Leu Asp Gly Glu Glu Val Lys     535 540 545 ctt ctc ttg gat cca tcc ggt cga gtt cgt cac atc gaa aca aaa gac 2335 Leu Leu Leu Asp Pro Ser Gly Arg Val Arg His Ile Glu Thr Lys Asp 550 555 560 565 gcg atc gat gat cgt aaa cca ttg gca atc atc act aag ggt gct acc 2383 Ala Ile Asp Asp Arg Lys Pro Leu Ala Ile Ile Thr Lys Gly Ala Thr                 570 575 580 tat aac tcc agc aaa gat act tat gac ttt act gtt atg acc caa aaa 2431 Tyr Asn Ser Ser Lys Asp Thr Tyr Asp Phe Thr Val Met Thr Gln Lys             585 590 595 ggt aaa aca caa atc gta tct ttg gat caa aag gac atc tac gat aga 2479 Gly Lys Thr Gln Ile Val Ser Leu Asp Gln Lys Asp Ile Tyr Asp Arg         600 605 610 tat ggg gtt aac tac gat aaa tcc aat gat aag cgt caa gct ttc gaa 2527 Tyr Gly Val Asn Tyr Asp Lys Ser Asn Asp Lys Arg Gln Ala Phe Glu     615 620 625 aag gat tta gtt gag ctt ctg caa cct aag gta gtt aaa gag gac tca 2575 Lys Asp Leu Val Glu Leu Leu Gln Pro Lys Val Val Lys Glu Asp Ser 630 635 640 645 gct act gat gcc aat caa acc gtt ctt ttg gaa gtt aat ttt gat tcc 2623 Ala Thr Asp Ala Asn Gln Thr Val Leu Leu Glu Val Asn Phe Asp Ser                 650 655 660 aaa ggc gaa gtt gat aaa gtc aaa gtt ctt gat agc aag ctg aaa tac 2671 Lys Gly Glu Val Asp Lys Val Lys Val Leu Asp Ser Lys Leu Lys Tyr             665 670 675 tcc gag aaa agc act tgg gat aaa ctt gcg gat gaa gat gac gac gtc 2719 Ser Glu Lys Ser Thr Trp Asp Lys Leu Ala Asp Glu Asp Asp Asp Asp Val         680 685 690 gtt ggt gat tat gaa gta acc gat aag act gct gtc ttc aaa atg act 2767 Val Gly Asp Tyr Glu Val Thr Asp Lys Thr Ala Val Phe Lys Met Thr     695 700 705 ggt gac ctt act cca gct act gga act aaa cgt ggt gaa ctg aaa aac 2815 Gly Asp Leu Thr Pro Ala Thr Gly Thr Lys Arg Gly Glu Leu Lys Asn 710 715 720 725 gct ggt act gct aaa ttt aag gat gtt gct aag aag agc gat ctg aag 2863 Ala Gly Thr Ala Lys Phe Lys Asp Val Ala Lys Lys Ser Asp Leu Lys                 730 735 740 gtt tgg tac tca gtg gat gaa gac aaa ggt gaa gtt caa gcg atc ttc 2911 Val Trp Tyr Ser Val Asp Glu Asp Lys Gly Glu Val Gln Ala Ile Phe             745 750 755 gta gta gat ggc agt ggt ttg ggt ggc gac cat cag ttt ggt atg gtc 2959 Val Val Asp Gly Ser Gly Leu Gly Gly Asp His Gln Phe Gly Met Val         760 765 770 aaa caa tat ggt act gct agt aaa cag gac act atc act ata gtt aca 3007 Lys Gln Tyr Gly Thr Ala Ser Lys Gln Asp Thr Ile Thr Ile Val Thr     775 780 785 aaa gat ggt gat tct gtc act gaa aaa gag tac aaa ttg gat ggc gac 3055 Lys Asp Gly Asp Ser Val Thr Glu Lys Glu Tyr Lys Leu Asp Gly Asp 790 795 800 805 gct gat gat ttg aaa gtt gat caa gac atc aga cgt gga gat gtc att 3103 Ala Asp Asp Leu Lys Val Asp Gln Asp Ile Arg Arg Gly Asp Val Ile                 810 815 820 tct ttc aca ctg aat tct gat gga gaa gtt att gtt gac gat gta gtc 3151 Ser Phe Thr Leu Asn Ser Asp Gly Glu Val Ile Val Asp Asp Val Val             825 830 835 gag gtt gta aat aac aac cac att gat aac act gct tct aaa tca gct 3199 Glu Val Val Asn Asn Asn His Ile Asp Asn Thr Ala Ser Lys Ser Ala         840 845 850 acg ctc atg cct gaa gac gaa cgt caa aaa gca gga atc gac aaa ttg 3247 Thr Leu Met Pro Glu Asp Glu Arg Gln Lys Ala Gly Ile Asp Lys Leu     855 860 865 gtt gtt gct cgc gtt gac gaa gtt gat ggt aac act att tcc ttg aac 3295 Val Val Ala Arg Val Asp Glu Val Asp Gly Asn Thr Ile Ser Leu Asn 870 875 880 885 tat gct gac gga aag aca caa aaa tat tac aca aaa gca tcc act gcg 3343 Tyr Ala Asp Gly Lys Thr Gln Lys Tyr Tyr Thr Lys Ala Ser Thr Ala                 890 895 900 ttc att gat gtg tat gac ggt ctt gaa gga att gat gga gta gat gaa 3391 Phe Ile Asp Val Tyr Asp Gly Leu Glu Gly Ile Asp Gly Val Asp Glu             905 910 915 ggc gac tac atc gta atg atc gat agc gcc gat att gac gga act cgc 3439 Gly Asp Tyr Ile Val Met Ile Asp Ser Ala Asp Ile Asp Gly Thr Arg         920 925 930 ttt gac tat gta ctg gta gtt tct agc gat gat gag atc cgc acg caa 3487 Phe Asp Tyr Val Leu Val Val Ser Ser Asp Asp Glu Ile Arg Thr Gln     935 940 945 cac atc tcc act aaa gca gtt acg gac ttc ctg aac aag cca acc aga 3535 His Ile Ser Thr Lys Ala Val Thr Asp Phe Leu Asn Lys Pro Thr Arg 950 955 960 965 cta tgt acc aaa tcc tgg cga tgg gga aga agt agt cac ggc acc aaa 3583 Leu Cys Thr Lys Ser Trp Arg Trp Gly Arg Ser Ser His Gly Thr Lys                 970 975 980 gtt aat aca gtt aac gat gaa gca gtt gta gat ggt att gta act ctt 3631 Val Asn Thr Val Asn Asp Glu Ala Val Val Asp Gly Ile Val Thr Leu             985 990 995 cca gct gat gca tct gtt aga aac ttc aac att gca ttt gat caa gaa 3679 Pro Ala Asp Ala Ser Val Arg Asn Phe Asn Ile Ala Phe Asp Gln Glu         1000 1005 1010 att aac agc aaa gat gca acg gta act gtt act aat gaa gat acg ctt 3727 Ile Asn Ser Lys Asp Ala Thr Val Thr Val Thr Asn Glu Asp Thr Leu     1015 1020 1025 ggt aac gta acg gta tct gag gtt gcg aca gat gca aaa gta ttg agc 3775 Gly Asn Val Thr Val Ser Glu Val Ala Thr Asp Ala Lys Val Leu Ser 1030 1035 1040 1045 ttc aag act gct aaa ctg gac act aca aaa act tac atc atc aca gtt 3823 Phe Lys Thr Ala Lys Leu Asp Thr Thr Lys Thr Tyr Ile Ile Thr Val                 1050 1055 1060 aaa ggc ttg aaa gat aaa aac ggt aaa gca gtg aaa gat gta act ctt 3871 Lys Gly Leu Lys Asp Lys Asn Gly Lys Ala Val Lys Asp Val Thr Leu             1065 1070 1075 tac gtt gaa ttt gtt gct gga gtg tgacttgttg ctctataaac actaatagtg 3925 Tyr Val Glu Phe Val Ala Gly Val         1080 1085 tgaaatgagt gaagaaggga gaaggattaa aaccttctcc cttctttaac tgttttggcg 3985 aattgaaggg tgtaaccccc ttccgtggaa acaaccatta atccacgtga ctaatcctcc 4045 tgcatgcgtt gtaagctaac tcttacaggg tgtgaagcca ggtgaagacg taacccttag 4105 tggtgcgggt ctccgtaaaa gctaactatg gttaggaaac gaatctacgt ctgaggcgtg 4165 tcaggtttgg taattagccc ttcagctgct aattacccca caggctgaga tgcctggagg 4225 gttctaacga attaaggttg ttaacgttag ttcatcttga tatgtatagt aggaacctaa 4285 ggtttagcaa aaaaagggat agccaaaatg gaacaagtga gatct 4330 <210> 42 <211> 11 <212> DNA <213> Bacillus brevis <300> <303> J. Bacteriol. <304> 169 <306> 1239-1245 <307> 1987 <400> 42 agaggaggag a 11 <210> 43 <211> 12 <212> DNA <213> Bacillus brevis <300> <303> J. Bacteriol. <304> 169 <306> 1239-1245 <307> 1987 <400> 43 gaaaggaggt ga 12

[Brief description of drawings]

Figure 1: Fusion MWPsp-MWPmp20- (His) 6-Linker-Cleavage
1 is a schematic diagram of a Bacillus brevis expression vector (pNU211R2L5) in which 1-GH22kd is incorporated.

FIG. 2 is a diagram showing SDS-PAGE patterns of media of various transformants. Lane 1: Marker protein, Lane 2: Negative control (plasmid pNU211R2L5 containing no foreign protein), Lane 3:
MWPsp-GH22kd, Lane 4: MWPsp-MWPmp20-Cleavage 1-G
H22kd, Lane 5: MWPsp-MWPmp20-Linker-Cleavage 1-G
H22kd, Lane 6: MWPsp-MWPmp20- (His) 6-Linker-Clea
vage 1-GH22kd, Lane 7: MWPsp-MWPmp20-Linker-Clea
vage 1-GH20kd, Lane 8: MWPsp-MWPmp20- (His) 6-Link
er-Cleavage 1-GH20kd, Lane 9: MWPsp-MWPmp20-Link
er-Cleavage 2-GH22kd, Lane 10: MWPsp-MWPmp20- (Hi
s) 6-Linker-Cleavage 2-GH22kd

FIG. 3 is a diagram showing patterns of Western blotting of various transformants. Lane 1: Negative control (plasmid containing no foreign protein
pNU211R2L5), lane 2: MWPsp-GH22kd, lane 3: MW
Psp-MWPmp20-Cleavage 1-GH22kd, Lane 4: MWPsp-MWP
mp20-Linker-Cleavage 1-GH22kd, Lane 5: MWPsp-MW
Pmp20- (His) 6-Linker-Cleavage 1-GH22kd, Lane 6: M
WPsp-MWPmp20-Linker-Cleavage 1-GH20kd, Lane 7: M
WPsp-MWPmp20- (His) 6-Linker-Cleavage 1-GH20kd, Lane 8: MWPsp-MWPmp20-Linker-Cleavage 2-GH22kd, Lane 9: MWPsp-MWPmp20- (His) 6-Linker-Cleavage 2-GH22k
d

FIG. 4 is a graph showing the quantitative values by HPLC of human growth hormone secreted in various transformants. Column A: Negative control (plasmid containing no foreign protein
pNU211R2L5), column B: MWPsp-GH22kd, column C: MW
Psp-MWPmp20-Cleavage 1-GH22kd, Column D: MWPsp-MWP
mp20-Linker-Cleavage 1-GH22kd, Column E: MWPsp-MWP
mp20- (His) 6-Linker-Cleavage 1-GH22kd

FIG. 5 is a diagram showing elution patterns of various human growth hormones by HPLC. A: Positive control (Norditropin), B: Natural type GH22kd,
C: Mutant GH22kd having Gly at the N terminus, D: Natural GH20kd

FIG. 6 is a graph showing the weight gain effect of various human growth hormones. (Data: Mean ± SD, *: P <0.01) ●: Negative control (0.25% BSA / 09% NaCl), ○: Positive control (Norditropin), △: Mutant GH22kd with Gly at N-terminal,
◇: Natural type GH22kd, □: Natural type GH20kd

FIG. 7 is a graph showing bone length increasing action of various human growth hormones. (Data: Mean ± SD, *: P <0.05,
**: P <0.01) Column A: Negative control (0.25% BSA / 09% NaCl), Column B: Positive control (Norditropin), Column C: Mutant GH22kd with Gly at the N-terminal, Column D: Natural GH22kd , Column E: Natural type GH20kd

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) (C12P 21/02 C12R 1:08) (72) Inventor Shizuharu Sato 1 Kubogaoka, Moriya-cho, Kitasoma-gun, Ibaraki 2nd Itoham Co., Ltd. Health Sciences Division (72) Inventor Masaaki Kondo 1-2-2 Kubogaoka, Moriya-cho, Kitasoma-gun, Ibaraki Prefecture Itoham Corporation Health Sciences Division (72) Inventor Kino Kudo Moriya, Kitasoma-gun, Ibaraki Prefecture 1-2, Machikubogaoka Itoham Co., Ltd., Health Sciences Division (72) Inventor Hirosuke Endo 1-2c Kubogaoka, Moriya-cho, Kitasoma-gun, Ibaraki Prefecture Itoham Co., Ltd., Health Sciences Division (72) Inventor Shigeaki Watanabe, Ibaraki Prefecture 1-2 Kubogaoka, Moriya-cho, Kitasoma-gun To Itoham Co., Ltd. Science Science Division (72) Inventor Norihiro Waki 1-2-2 Kubogaoka, Moriya-cho, Kitasoma-gun, Ibaraki Itoham Co., Ltd. Health Science Division (72) Inventor Masaya Yamanaka 1-2 Kuboga-oka, Moriya-cho, Kitasoma-gun, Ibaraki Prefecture No. Itoham Co., Ltd. Health Science Division F-term (reference) 4B024 AA01 BA03 BA80 CA07 DA05 EA04 FA02 FA17 GA11 HA03 4B064 AG01 AG13 CA02 CA19 CC24 DA01 4B065 AA15X AA15Y AA93Y AB01 BA02 CA24 CA44

Claims (18)

[Claims] 1. The following amino acid sequence: 1 from the N-terminus of the cell wall protein (CWP) of Bacillus bacteria.
Leader peptide (Lead
er); amino acid sequence used for enzymatic cleavage (Cleavag
e); and the amino acid sequence (GH) of growth hormone or a functional fragment, mutant or analogue thereof are linked in this order, and the amino acid sequence of Cleavage is IleGluGlyArg.
(Cleavage 1, SEQ ID NO: 1), a DNA encoding a fusion protein. 2. The following amino acid sequence, that is, a leader peptide (Leader) consisting of one or more amino acid residues from the N-terminus of the cell wall protein (CWP) of a bacterium of the genus Bacillus; the amino acid sequence used for enzymatic cleavage (Cleavage). ); And the amino acid sequences (GH) of growth hormone or a functional fragment, variant or analog thereof, are linked in this order, and a DNA encoding a fusion protein in which GH is 20 kd human growth hormone (GH20kd). 3. The following amino acid sequence: a leader peptide (Leader) consisting of one or more amino acid residues from the N-terminus of the cell wall protein (CWP) of Bacillus bacterium; nH consisting of a plurality of His residues; enzymatic A DNA encoding a fusion protein in which the amino acid sequence (Cleavage) used for cleavage; and the amino acid sequence (GH) of growth hormone or a functional fragment, variant or analog thereof, are linked in this order. 4. The DNA according to claim 3, wherein the number of His residues is 6. 5. The GH is 22 kd human growth hormone (GH22
DNA according to claim 1, 3 or 4, which is kd) or 20 kd human growth hormone. 6. The Cleavage is IleGluGlyArg (Cleava
ge 1, SEQ ID NO: 1) or GluAsnLeuTyrPheGlnGly (C
The DNA according to any one of claims 2 to 4, which is leavage 2, SEQ ID NO: 2). 7. The DNA according to any one of claims 1 to 6, which encodes a fusion protein in which a linker consisting of one or more amino acid residues is further linked upstream of the cleavage. 8. The Linker is AspTyrAspIleProThrThr.
The DNA according to claim 7, which is (SEQ ID NO: 3). 9. The DNA according to claim 1, wherein the CWP is MWP. 10. The leader is 1 to 20 from the N-terminus of MWP.
The DNA according to claim 9, which is an amino acid sequence up to the position. 11. A DNA (Promoter) which further comprises a promoter sequence required for gene expression upstream of the 5 ′ end of the DNA encoding the fusion protein; and an SD sequence (downstream of the 3 ′ end of the Promoter). SD); and a DNA (CWPsp) encoding a signal peptide of a cell wall protein (CWP) of a bacterium of the genus Bacillus are ligated in this order. 12. The Bacillus bacterium is used as the promoter.
The DNA according to claim 11, which is derived from CWP. 13. A vector containing the DNA according to claim 11 or 12. 14. A host cell transformed or transfected with the vector of claim 13. 15. The host cell according to claim 14, which is a Bacillus bacterium. 16. The host cell according to claim 15, wherein the Bacillus bacterium is Bacillus brevis. 17. The host cell according to claim 16, which is a microorganism deposited under accession number FERM BP-7727. 18. Growth hormone or a functional fragment thereof,
A method for producing a mutant or analog, which comprises:
To a growth hormone or a functional fragment thereof using an enzymatic cleavage method from the fusion protein, wherein the fusion protein is expressed in a growth medium by growing the host cell.
A method for producing a recombinant growth hormone or a functional fragment, mutant or analog thereof by excising a mutant or analog.