USRE37952E1 - Grb3-3 cDNA and polypeptides - Google Patents
Grb3-3 cDNA and polypeptides Download PDFInfo
- Publication number
- USRE37952E1 USRE37952E1 US09/641,640 US64164000A USRE37952E US RE37952 E1 USRE37952 E1 US RE37952E1 US 64164000 A US64164000 A US 64164000A US RE37952 E USRE37952 E US RE37952E
- Authority
- US
- United States
- Prior art keywords
- host cell
- grb
- polynucleotide
- grb3
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to a new gene, designated Grb3-3, its variants, and their uses, especially in anti-cancer gene therapy.
- oncogenes and suppressor genes are involved in the control of cell division.
- the ras genes and their products generally designated p21 proteins, play a key role in the control of cell proliferation in all eukaryotic organisms where they have been searched out.
- certain specific modifications of these proteins cause them to lose their normal control and lead them to become oncogenic.
- a large number of human tumours have been associated with the presence of modified ras genes.
- an overexpression of these p21 proteins can lead to a deregulation of cell proliferation.
- An understanding of the exact role of these p21 proteins in cells, of their mode of operation and their characteristics therefore constitutes a major stake for the understanding and the therapeutic approach to carcinogenesis.
- Grb2 gene which encodes a protein of 23-25 kDa having a SH3-SH2-SH3 structure
- the product of the Grb2 gene appears to interact with the tyrosine phosphorylated proteins via its SH2 domain, and with a factor for exchange of GDP of the SOS class via its SH3 domain (Egan et al., Nature 363 (1993) 45). It would thus be one of the components of the transformant activity of the product of the ras gene.
- the present invention derives from the demonstration of the cloning and characterization of an isoform of the Grb2 gene, designated Grb3-3, possessing a deletion in the SH2 domain.
- This gene is expressed in adult tissues: the corresponding mRNA is present in the form of a single band of 1.5 kb, and is translated into a 19 kDa protein.
- the product of the Grb3-3 gene is no longer capable of interacting with the tyrosine phosphorylated proteins (phosphorylated EGF receptor), but it retains the capacity to interact with the proline-rich domains of the SOS proteins. Because of its deletion, the product of the Grb3-3 gene is thus capable of preventing the cellular effects of the product of the Grb2 gene.
- the transfer of this gene in vivo, or of variants thereof, including antisense sequences therefore makes it possible to interfere with the processes of proliferation, differentiation and/or cell death.
- a first subject of the invention therefore relates to a nucleotide sequence comprising all or part of the Grb3-3 gene (sequence SEQ ID No. 1).
- Another subject of the invention relates to a nucleotide sequence derived from the sequence SEQ ID No. 1 and capable of inhibiting, at least partially, the expression of the Grb2 or Grb3-3 protein.
- the invention relates to the antisense sequences whose expression in a target cell makes it possible to control the transcription of cellular mRNAs.
- Such sequences can for example be transcribed, in the target cell, into RNAs complementary to the cellular mRNAs Grb2 or Grb3-3 and thus block their translation into protein, according to the technique described in patent EP 140 308.
- Such sequences may consist of all or part of the nucleic sequence SEQ ID No. 1, transcribed in the reverse orientation.
- Grb2 is a protein which is at least bifunctional, and which is anchored via its SH2 domain to specific sequences phosphorylated at the tyrosine, and via its two SH3 domains, to the exchange factors of the SOS family.
- Grb3-3 having lost its capacity to associate with proteins phosphorylated at the tyrosine can therefore only form a complex with the SOS proteins.
- Grb3-3 can therefore prevent the recruitment of the Grb2-SOS complex by the receptors of the self-phosphorylated growth factors or by associated proteins which are also phosphorylated at the tyrosine such as HSC or IRS1.
- Grb3-3 being capable of blocking this recruitment, it is capable of blocking mytogenic pathways and of inducing cell death.
- Grb3-3 protein was expressed during certain physiological processes such as for example the maturation of the thymus in rats.
- the Applicant has also shown that Grb3-3 is capable of inducing cell death by apoptosis of various cell types. It was possible to detect these completely advantageous properties (i) by injecting recombinant protein into the 3T3 fibroblasts and (ii) by transferring the sequence encoding Grb3-3 into the 3T3 cells (Example 4).
- Grb3-3 is therefore capable of inducing the cellular death of viable cells such as immortalized, cancer or embryonic cells.
- Grb2 is capable of preventing the effects of Grb3-3.
- the invention also relates to the use of compounds capable of eliminating or blocking, at least partially, the cellular effects of Grb3-3 for the preparation of a pharmaceutical composition intended for the treatment of AIDS. More particularly, the compounds used may be:
- oligonucleotides specific to Grb3-3 modified or otherwise for better stability or bioavailability (phosphorothioates, intercalating agents and the like). They may be preferably oligonucleotides covering the coding sequence localized between the N-terminal SH3 domain and the residual SH2 domain,
- the nucleic acid sequences according to the invention can be used as such, for example after injection into man or animals, to induce a protection or to treat cancers.
- they can be injected in the form of naked DNA according to the technique described in application WO 90/11092.
- They can also be administered in complexed form, for example with DEAE-dextran (Pagano et al., J. Virol. 1 (1967) 891), with nuclear proteins (Kaneda et al., Science 243 (1989) 375), with lipids (Felgner et al., PNAS 84 (1987) 7413), in the form of liposomes (Fraley et al., J. Biol. Chem. 255 (1980) 10431), and the like.
- the nucleic acid sequences according to the invention form part of a vector.
- a vector indeed makes it possible to improve the administration of the nucleic acid into the cells to be treated, and also to increase its stability in the said cells, which makes it possible to obtain a durable therapeutic effect.
- the vector used may be of diverse origin, as long as it is capable of transforming animal cells, preferably human tumour cells.
- a viral vector is used which can be chosen from adenoviruses, retroviruses, adeno-associated viruses (AAV), herpes virus, cytomegalovirus (CMV), vaccinia virus and the like.
- Vectors derived from adenoviruses, retroviruses or AAVs incorporating heterologous nucleic acid sequences have been described in the literature [Akli et al., Nature Genetics 3 (1993) 224; Stratford-Perricaudet et al., Human Gene Therapy 1 (1990) 241; EP 185 573, Levrero et al., Gene 101 (1991) 195; Le Gal la Salle et al., Science 259 (1993) 988; Roemer and Friedmann, Eur. J. Biochem. 208 (1992) 211; Dobson et al., Neuron 5 (1990) 353; Chiocca et al., New Biol. 2 (1990) 739; Miyanohara et al., New Biol. 4 (1992) 238; WO91/18088].
- the present invention therefore also relates to any recombinant virus comprising, inserted into its genome, a nucleic acid sequence as defined before.
- the recombinant virus according to the invention is a defective virus.
- the term “defective virus” designates a virus incapable of replicating in the target cell.
- the genome of the defective viruses used within the framework of the present invention is therefore devoid of at least the sequences necessary for the replication of the said virus in the infected cell. These regions can either be removed (completely or partially), or rendered non-functional, or substituted by other sequences and especially by the nucleic acid of the invention.
- the defective virus nevertheless conserves the sequences of its genome which are necessary for the encapsulation of the viral particles.
- nucleic acid sequences of the invention in a form incorporated in an adenovirus, an AAV or a defective recombinant retrovirus.
- adenoviruses various serotypes exist whose structure and properties vary somewhat, but which are not pathogenic for man, and especially non-immunosuppressed individuals. Moreover, these viruses do not integrate into the genome of the cells which they infect, and can incorporate large fragments of exogenous DNA.
- Ad2 or Ad5 adenoviruses Ad2 or Ad5
- Ad5 adenoviruses the sequences necessary for the replication are the E1A and E1B regions.
- the defective recombinant viruses of the invention can be prepared by homologous recombination between a defective virus and a plasmid carrying, inter alia, the nucleotide sequence as defined above (Levrero et al., Gene 101 (1991) 195; Graham, EMBO J. 3(12)(1984) 2917).
- the homologous recombination is produced after co-transfection of the said viruses and plasmid into an appropriate cell line.
- the cell line used should preferably (i) be transformable by the said elements, and (ii), contain sequences capable of complementing the part of the genome of the defective virus, preferably in integrated form so as to avoid the risks of recombination.
- a line which can be used for the preparation of defective recombinant adenoviruses there may be mentioned the human embryonic kidney line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which contains especially, integrated into its genome, the left part of the genome of an Ad5 adenovirus (12%).
- the CRIP line Danos and Mulligan, PNAS 85 (1988) 6460.
- viruses which have multiplied are recovered and purified according to conventional molecular biology techniques.
- the subject of the present invention is also a pharmaceutical composition containing at last one recombinant virus or a nucleotide sequence as defined above.
- compositions of the invention can be formulated for a topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous or intraocular administration and the like.
- the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected, optionally directly into the tumour to be treated.
- vehicles which are pharmaceutically acceptable for a formulation capable of being injected, optionally directly into the tumour to be treated.
- These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
- the doses of nucleic acids (sequence or vector) used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, of the nucleic acid to be expressed, or alternatively of the desired duration of treatment.
- the latter are formulated and administered in the form of doses of between 10 4 and 10 14 pfu/ml, and preferably 10 6 to 10 10 pfu/ml.
- the term pfu (“plaque forming unit”) corresponds to the infectivity of a virus solution, and is determined by infecting an appropriate cell culture and measuring, generally after 48 hours, the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature.
- compositions can be used in man, for the treatment and/or prevention of cancer.
- the products of the invention are capable of modulating the activity of ras proteins, they make it possible to intervene in the cancer development process, and in particular, they can inhibit the activity of oncogenes whose transformant activity depends on a p21-functional GAP interaction. Numerous cancers have indeed been associated with the presence of oncogenic ras proteins.
- adenocarcinomas of the pancreas of which 90% have a Ki-ras oncogene mutated on the twelfth codon (Almoguera et coll., Cell 53 (1988) 549), adenocarcinomas of the colon and cancers of the thyroid (50%), or carcinomas of the lung and myeloid leukaemias (30%, Bos, J. L. Cancer Res. 49 (1989) 4682).
- compositions according to the invention can be used for treating any type of pathology in which an abnormal cell proliferation is observed, by inducing apoptosis, as well as any pathology characterized by a cell death by apoptosis (AIDS, Huntington's chorea, Parkinson), by means of compounds which block the effects of Grb3-3 (antisense in particular).
- FIG. 1 schematic representation of the structural domains of Grb2 and Grb3-3.
- FIG. 2 study of the binding of Grb3-3 to the EGF receptor (FIG. 2a) and to proline-rich peptides (FIG. 2 b).
- FIG. 3 effect of Grb3-3 on the transactivation, by ras, of an RRE derived from the polyoma virus enhancer.
- FIG. 4 demonstration of Grb3-3-induced cell death on 3T3 fibroblasts.
- FIG. 5 demonstration of the expression of Grb3-3 in cells infected with the HIV virus.
- the pBR322 and pUC type plasmids and the phages of the M13 series are of commercial origin (Bethesda Research Laboratories).
- the DNA fragments can be separated according to their size by agarose or acrylamide gel electrophoresis, extracted with phenol or with a phenol/chloroform mixture, precipitated with ethanol and then incubated in the presence of phage T4 DNA ligase (Biolabs) according to the recommendations of the supplier.
- the filling of the protruding 5′ ends can be carried out by the Klenow fragment of DNA polymerase I of E. coli (Biolabs) according to the specifications of the supplier.
- the destruction of the protruding 3′ ends is carried out in the presence of phage T4 DNA polymerase (Biolabs) used according to the recommendations of the manufacturer.
- the destruction of the protruding 5′ ends is carried out by a controlled treatment with S1 nuclease.
- the site-directed mutagenesis in vitro with synthetic oligodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 13 (1985) 8749-8764] using the kit distributed by Amersham.
- the verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467] using the kit distributed by Amersham.
- the Grb3-3 gene was isolated by screening a human DNA library by means of a probe derived from the sequence of the Grb2 gene.
- 500,000 lambda gt11 recombinant phages carrying DNA fragments derived from a human placenta library were screened by means of a probe derived from the sequence of the Grb2 gene.
- the probe used corresponds to the first 8 amino acids of the Grb2 protein, and has the following sequence:
- the Grb2 protein is the mediator of the interaction between the phosphorylated growth factor receptors and the SOS factors.
- This example demonstrates that the Grb3-3 protein is incapable of interacting with the phosphorylated EGF receptor but that it conserves its capacity to interact with a proline-rich peptide derived from the sequence of the human SOS1 factor.
- Grb3-3 The binding capacity of Grb3-3 was studied using biotinylated Glutathione-S-transferase (GST) fusion proteins. This type of fusion permits a rapid and efficient purification of the recombinant products.
- GST biotinylated Glutathione-S-transferase
- the sequences of the invention were expressed in the E. coli GT1 strain in the form of fusion proteins with GST according to the technique described by Smith and Johnson [Gene 67 (1988) 31]. Briefly, the Grb2 and Grb3-3 genes were first modified by introducing a BamHI site on either side of the start and stop codons. For that, the open reading frames of these genes were amplified by PCR by means of the following oligonucleotides:
- Oligonucleotide I (5′)(SEQ ID NO. 4): GAATTCGGATCCATGGAAGCCATCGCCAAATATGACTTC
- Oligonucleotide II (3′)(SEQ ID NO. 5): GAATTCGGATCCTTAGACGTTCCGGTTCACGGGGGTGAC
- the underlined part corresponds to the BamHI site created, followed or preceded by the start and stop codons.
- the genes thus amplified were then cloned in the form of BamHI fragments into the vector pGEX 2T (Pharmacia) linearized by the same enzyme, in 3′ and in frame in a cDNA encoding GST.
- the vectors thus obtained were then used to transform the E. coli TG1 strain.
- the cells thus transformed were precultured overnight at 37° C., diluted 1/10 in LB medium, supplemented with IPTG in order to induce the expression (2 hours, 25° C.) and then cultured for about 21 hours at 25° C.
- the cells were then lysed, and the fusion proteins produced affinity-purified on an agarose-GHS column.
- the bacterial lysate is incubated in the presence of the gel (prepared and equilibrated with lysis buffer) for 15 minutes at 4° C. After 3 washes with Tris-HCl buffer pH 7.4, the proteins are eluted in the presence of a tris-HCl buffer pH 7.7 containing an excess of GST. The supernatent is harvested and centrifuged.
- Grb2G203R a mutant of Grb2 in which the glycine 203 is replaced by an arginine
- Grb3-3G162R a Grb3-3 mutant in which the glycine 162 is replaced by an arginine
- the Grb2G203R mutant has been described as no longer having any activity in a test of reinitiation of DNA synthesis (Lowenstein et al., previously cited).
- the Grb3-3G162R mutant carries the same mutation in the same position, and should therefore also be inactive.
- Oligonucleotide III (3′) (SEQ ID No. 6):
- the fragments thus amplified were then eluted, reamplified by PCR by means of the oligonucleotides I and II, and then cloned into the vector pGEX 2T.
- the mutants were then produced as described above.
- GST fusion proteins (GST-Grb2, GST-Grb3-3, GST-Grb3-3G162R and GST) were then biotinylated by conventional techniques known to persons skilled in the art (cf. general molecular biology techniques as well as Mayer et al., PNAS 88 (1991) 627), and used as probes to determine the binding to the immobilized phosphorylated EGF receptor (2.1.) and then to a peptide derived from hSOS1 (2.2.).
- the samples are then deposited on a 4-20% SDS-PAGE gel and then transferred onto polyvinylidene difluoride membranes (PVDF).
- PVDF polyvinylidene difluoride membranes
- the blots were then incubated in the presence of various biotinylated GST fusions (2 ⁇ g/ml) and then revealed by means of alkaline-phosphatase coupled streptavidin (Promega).
- the EGF receptors were also subjected to an immunoblotting in the presence of anti-phosphotyrosine antibodies (anti-PY) in order to verify that the receptors have indeed been phosphorylated.
- anti-PY anti-phosphotyrosine antibodies
- results are presented in FIG. 2 a. They show, as expected, that the Grb2 protein interacts with the EGF receptor in phosphorylated form alone. They also show that the Grb3-3 protein does not bind the EGF receptor, regardless of its degree of phosphorylation.
- hSOS1 Peptide GTPEVPVPPPVPPRRRPESA: This peptide corresponds to residues 1143 to 1162 of the hSOS1 protein (Li et al., Nature 363 (1993) 83) responsible for the interaction between Grb2 and hSOS1 (SEQ ID No. 7).
- 3BP1 Peptide PPPLPPLV: This peptide is derived from the 3BP1 protein, which is known to efficiently bind the SH3 domain of Ab1 and Src (Cicchetti et al., Science 257 (1992) 803)(SEQ ID No. 8).
- Each of these peptides (1 ⁇ l, 10 mg/ml) was immobilized on nitrocellulose membrane.
- the membranes were then incubated overnight at 4° C. in the presence of the various biotinylated GST fusions (4 ⁇ g/ml) and then revealed by means of alkaline phosphatase-coupled streptavidin (Promega).
- results are presented in FIG. 2 b. They show that Grb3-3, like Grb2, is capable of binding the hSOS1 peptide. They also show that this interaction is specific since no binding is observed with the 3BP1 peptide. Moreover, the results also show that the Grb3-3G162R mutant is no longer capable of binding the hSOS1 peptide, which confirms the importance of this residue and the functional role of this interaction.
- the activity of the Grb3-3 protein was studied by determining its capacity to cooperate with ras for the transactivation of a promoter possessing ras response elements (RRE) and governing the expression of a reporter gene.
- RRE ras response elements
- the promoter used is a synthetic promoter composed of the murine promoter of the thymidine kinase gene and 4 repeated PEA1 elements derived from the polyoma enhancer (Wasylyk et al., EMBO J. 7 (1988) 2475): Py-TK promoter.
- This promoter directs the expression of the reporter gene, in this case of the bacterial gene for chloramphenicol acetyl transferase (CAT): Py-TK-CAT vector.
- the vectors for expressing the tested genes were constructed by inserting the said genes, in the form of BamHI fragments, into the BglII site of the plasmid pSV2. This site makes it possible to place the genes under the control of the early SV40 promoter.
- ER22 cells which are 40% confluent were transfected with 0.5 ⁇ g of the vector Py-TK-CAT alone (Py) or in the presence of the expression vector carrying, under the control of the early SV40 promoter, the gene: Grb2, 2 ⁇ g, Grb3-3, 2 ⁇ g, Grb2(G203R) 2 ⁇ g, Grb3-3(G162R) 2 ⁇ g, or Grb3-3, 2 ⁇ g+Grb2, 2 ⁇ g.
- the total quantity of DNA was adjusted to 5 ⁇ g with an expression vector without insert.
- the transfection was carried out in the presence of lipospermine (Transfectam, IBF-Sepracor).
- the cells were maintained for 48 hours in culture in a DMEM medium supplemented with 0.5% foetal calf serum.
- the CAT activity was then determined as described by Wasylyk et al. (PNAS 85 (1988) 7952).
- This example demonstrates the direct involvement of Grb3-3 in cellular apoptosis. This property offers particularly advantageous applications for the treatment of pathologies resulting from a cellular proliferation (cancers, restenosis, and the like).
- the recombinant Grb3-3 protein was prepared in the form of fusion protein with GST according to the procedure described in Example 2.
- the fusion protein was then treated with thrombin (0.25%, Sigma) in order to separate the GST part, and then purified by ion-exchange chromatography on a monoQ column.
- the fractions containing the recombinant protein were then concentrated by means of Microsep microconcentrators (Filtron) in a 20 mM phosphate buffer (pH 7) containing 100 mM NaCl.
- the purified protein thus obtained was injected (1 to 3 mg/ml) into cultured 3T3 cells by means of an automatic Eppendorf microinjector. The cells were then incubated at 34° C.
- a plasmid was constructed comprising the sequence SEQ ID No. 1 encoding the Grb3-3 protein under the control of the early promoter of the SV40 virus.
- the 3T3 fibroblasts which are 40% confluent were transfected in the presence of lipospermine (Transfectam, IBF-Sepracor) with 0.5 or 2 ⁇ g of this expression plasmid. 48 hours after the transfection, 50% of the cells were in suspension in the medium, and the remaining cells, adhering to the wall, exhibited very substantial morphological changes (FIG. 4 ). Analysis by agarose gel electrophoresis showed, moreover, that the cells had an oligo-nucleosomal DNA fragmentation pattern characteristic of dead cells (FIG. 4 ).
- the cells transfected under the same conditions with a Grb2, Grb3-3 (G162R) or Grb2 (G203R) expression plasmid retain a normal morphology, are always viable and show no DNA fragmentation.
- the co-expression of Grb2 makes it possible to prevent the effects of Grb3-3.
- Grb3-3 constitutes a killer gene capable of inducing cellular apoptosis. As indicated above, this property offers particularly advantageous applications for the treatment of pathologies resulting from a cellular proliferation such as especially cancers, restenosis and the like.
- This example shows that, during the cycle for infection of the T lymphocytes by the HIV virus, the relative proportion of the Grb2 and Grb3-3 mRNAs is modified, and that the Grb3-3 messenger is overexpressed at the time of massive viral production and cell death.
- Peripheral blood lymphocytes were infected with the HIV-1 virus at two dilutions (1/10 and 1/100) for 1, 4 or 7 days.
- the mRNAs from the cells were then analysed by inverse-PCR by means of oligonucleotides specific for Grb2 and Grb3-3 in order to determine the relative proportion of the Grb2 and Grb3-3 messengers.
- the Grb3-3-specific oligonucleotides used are the following:
- Oligonucleotide IV (3′): ATCGTTTCCAAACGGATGTGGTTT (SEQ ID NO. 9)
- Oligonucleotide V (5′): ATAGAAATGAAACCACATCCGTTT (SEQ ID NO. 10)
- results obtained are presented in FIG. 5 . They show clearly that 7 days after the infection with the HIV virus, the Grb3-3 MRNA is overexpressed. As shown by assaying the p24 protein and the virus reverse transcriptase, day 7 also corresponds to the period during which a massive viral production is observed.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Virology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Communicable Diseases (AREA)
- AIDS & HIV (AREA)
- Tropical Medicine & Parasitology (AREA)
- Engineering & Computer Science (AREA)
- Oncology (AREA)
- Immunology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/641,640 USRE37952E1 (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR9310971 | 1993-09-15 | ||
FR9310971A FR2710074B1 (fr) | 1993-09-15 | 1993-09-15 | Gène GRB3-3, ses variants et leurs utilisations. |
US09/641,640 USRE37952E1 (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
US08/612,857 US5831048A (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
PCT/FR1994/000542 WO1995007981A1 (fr) | 1993-09-15 | 1994-05-09 | Gene grb3-3, ses variants et leurs utilisations |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/612,857 Reissue US5831048A (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
Publications (1)
Publication Number | Publication Date |
---|---|
USRE37952E1 true USRE37952E1 (en) | 2002-12-31 |
Family
ID=9450882
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/641,640 Expired - Fee Related USRE37952E1 (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
US08/612,857 Ceased US5831048A (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/612,857 Ceased US5831048A (en) | 1993-09-15 | 1994-05-09 | Grb3-3 cDNA and polypeptides |
Country Status (27)
Country | Link |
---|---|
US (2) | USRE37952E1 (sv) |
EP (1) | EP0719328B1 (sv) |
JP (1) | JP3794697B2 (sv) |
KR (1) | KR100330477B1 (sv) |
CN (1) | CN1098930C (sv) |
AT (1) | ATE196926T1 (sv) |
AU (1) | AU698819B2 (sv) |
BR (1) | BR9407693A (sv) |
CA (1) | CA2169938A1 (sv) |
CZ (1) | CZ288882B6 (sv) |
DE (1) | DE69426121T2 (sv) |
DK (1) | DK0719328T3 (sv) |
ES (1) | ES2152313T3 (sv) |
FI (1) | FI120499B (sv) |
FR (1) | FR2710074B1 (sv) |
GR (1) | GR3034600T3 (sv) |
HU (1) | HU221516B (sv) |
IL (2) | IL126756A (sv) |
NO (1) | NO319144B1 (sv) |
NZ (1) | NZ266162A (sv) |
PL (1) | PL178402B1 (sv) |
PT (1) | PT719328E (sv) |
RU (1) | RU2159815C2 (sv) |
SK (1) | SK281123B6 (sv) |
UA (1) | UA46715C2 (sv) |
WO (1) | WO1995007981A1 (sv) |
ZA (1) | ZA947059B (sv) |
Families Citing this family (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2732348B1 (fr) * | 1995-03-31 | 1997-04-30 | Rhone Poulenc Rorer Sa | Systeme d'expression conditionnel |
US6171800B1 (en) | 1995-06-07 | 2001-01-09 | Biogen, Inc. | Method of making and binding CAIP polypeptides |
US5837844A (en) * | 1995-06-07 | 1998-11-17 | Biogen, Inc. | CAIP-like gene family |
US6423824B1 (en) | 1995-06-07 | 2002-07-23 | Biogen, Inc. | CAIP-like gene family |
US5855911A (en) * | 1995-08-29 | 1999-01-05 | Board Of Regents, The University Of Texas System | Liposomal phosphodiester, phosphorothioate, and P-ethoxy oligonucleotides |
WO1997049808A1 (en) * | 1996-06-27 | 1997-12-31 | Biogen, Inc. | The caip-like gene family |
US7309692B1 (en) * | 1996-07-08 | 2007-12-18 | Board Of Regents, The University Of Texas System | Inhibition of chronic myelogenous leukemic cell growth by liposomal-antisense oligodeoxy-nucleotides targeting to GRB2 or CRK1 |
US6977244B2 (en) * | 1996-10-04 | 2005-12-20 | Board Of Regents, The University Of Texas Systems | Inhibition of Bcl-2 protein expression by liposomal antisense oligodeoxynucleotides |
US7704962B1 (en) | 1997-10-03 | 2010-04-27 | Board Of Regents, The University Of Texas System | Small oligonucleotides with anti-tumor activity |
US7285288B1 (en) | 1997-10-03 | 2007-10-23 | Board Of Regents, The University Of Texas System | Inhibition of Bcl-2 protein expression by liposomal antisense oligodeoxynucleotides |
EP0998945A1 (en) * | 1998-09-30 | 2000-05-10 | Transgene S.A. | Use of magnesium (Mg2+) for the enhancement of gene delivery in gene therapy |
NZ553687A (en) | 2000-03-30 | 2010-03-26 | Whitehead Biomedical Inst | RNA sequence-specific mediators of RNA interference |
EP1873259B1 (en) | 2000-12-01 | 2012-01-25 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediated by 21 and 22nt RNAs |
WO2003061386A1 (en) * | 2002-01-03 | 2003-07-31 | Board Of Regents, The University Of Texas System | Wt1 antisense oligos for the inhibition of breast cancer |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994007913A1 (en) | 1992-09-25 | 1994-04-14 | Warner-Lambert Company | Peptide antagonists of sh2 binding and therapeutic uses thereof |
US5434064A (en) | 1991-01-18 | 1995-07-18 | New York University | Expression-cloning method for identifying target proteins for eukaryotic tyrosine kinases and novel target proteins |
-
1993
- 1993-09-15 FR FR9310971A patent/FR2710074B1/fr not_active Expired - Fee Related
-
1994
- 1994-05-09 AT AT94915598T patent/ATE196926T1/de not_active IP Right Cessation
- 1994-05-09 CA CA002169938A patent/CA2169938A1/fr not_active Abandoned
- 1994-05-09 US US09/641,640 patent/USRE37952E1/en not_active Expired - Fee Related
- 1994-05-09 AU AU67247/94A patent/AU698819B2/en not_active Ceased
- 1994-05-09 DE DE69426121T patent/DE69426121T2/de not_active Expired - Fee Related
- 1994-05-09 JP JP50901595A patent/JP3794697B2/ja not_active Expired - Fee Related
- 1994-05-09 PL PL94313445A patent/PL178402B1/pl not_active IP Right Cessation
- 1994-05-09 WO PCT/FR1994/000542 patent/WO1995007981A1/fr active IP Right Grant
- 1994-05-09 KR KR1019960701323A patent/KR100330477B1/ko not_active IP Right Cessation
- 1994-05-09 CN CN94193814A patent/CN1098930C/zh not_active Expired - Fee Related
- 1994-05-09 SK SK345-96A patent/SK281123B6/sk not_active IP Right Cessation
- 1994-05-09 HU HU9600668A patent/HU221516B/hu not_active IP Right Cessation
- 1994-05-09 US US08/612,857 patent/US5831048A/en not_active Ceased
- 1994-05-09 PT PT94915598T patent/PT719328E/pt unknown
- 1994-05-09 DK DK94915598T patent/DK0719328T3/da active
- 1994-05-09 BR BR9407693A patent/BR9407693A/pt not_active Application Discontinuation
- 1994-05-09 CZ CZ1996758A patent/CZ288882B6/cs not_active IP Right Cessation
- 1994-05-09 UA UA96030994A patent/UA46715C2/uk unknown
- 1994-05-09 EP EP94915598A patent/EP0719328B1/fr not_active Expired - Lifetime
- 1994-05-09 NZ NZ266162A patent/NZ266162A/en not_active IP Right Cessation
- 1994-05-09 RU RU96107888/13A patent/RU2159815C2/ru active
- 1994-05-09 ES ES94915598T patent/ES2152313T3/es not_active Expired - Lifetime
- 1994-09-12 IL IL126756A patent/IL126756A/en not_active IP Right Cessation
- 1994-09-12 IL IL11094294A patent/IL110942A/en not_active IP Right Cessation
- 1994-09-13 ZA ZA947059A patent/ZA947059B/xx unknown
-
1996
- 1996-03-08 NO NO19960965A patent/NO319144B1/no not_active IP Right Cessation
- 1996-03-14 FI FI961202A patent/FI120499B/sv active IP Right Grant
-
2000
- 2000-10-12 GR GR20000401514T patent/GR3034600T3/el not_active IP Right Cessation
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5434064A (en) | 1991-01-18 | 1995-07-18 | New York University | Expression-cloning method for identifying target proteins for eukaryotic tyrosine kinases and novel target proteins |
WO1994007913A1 (en) | 1992-09-25 | 1994-04-14 | Warner-Lambert Company | Peptide antagonists of sh2 binding and therapeutic uses thereof |
Non-Patent Citations (5)
Title |
---|
Lowenstein et al., "The SH2 and SH3 Domain-containing Protein GRB2 Links Receptor Tyrosine Kinases to Ras Signaling," Cell., vol. 70, pp. 431-442 (1992). |
Matuoka et al., "Cloning of ASH, a Ubiquitous Protein Composed of One Src Homology Region (SH) 2 and Two SH3 Domains, From Human and Rat cDNA Libraries," Proc. Nat'l. Acad. Sci., USA, vol. 89, pp. 9015-9019 (1992). |
Rey et al., "A Role for Grb2 in Apoptosis?" Cell Death and Diff., vol. 2, pp. 105-111 (1995). |
Suen et al., "Molecular Cloning of the Mouse Grb2 Gene: Differential Interaction of the Grb2 Adaptor Protein with Epidermal Growth Factor and Nerve Growth Factor Receptors," Mol. Cell. Biol., vol. 13, pp. 5500-5512 (1993). |
Watanabe et al., "Splicing Isoforms of Rat Ash/Grb2. Isolation and Characterization of the cDNA and genomic DNA Clones and Implications for the Physiological Roles of the Isoforms," J. Biol. Chem., vol. 270, pp. 13733-13739 (1995). |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
USRE37952E1 (en) | Grb3-3 cDNA and polypeptides | |
US6468985B1 (en) | Retinoblastoma protein-interacting zinc finger proteins | |
US6368829B1 (en) | Smad2 phosphorylation and interaction with Smad4 | |
CA2370098C (en) | Human beta-trcp protein | |
US6323335B1 (en) | Retinoblastoma protein-interacting zinc finger proteins | |
AU722973B2 (en) | Grb3-3 gene, variants and uses thereof | |
US20040086933A1 (en) | Protein and gene involved in myocyte differentiation | |
US8088892B2 (en) | Inhibitors of proteins from the Rho-GEF family | |
AU741708B2 (en) | A new cytokine family and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FPAY | Fee payment |
Year of fee payment: 8 |
|
REMI | Maintenance fee reminder mailed | ||
LAPS | Lapse for failure to pay maintenance fees |