US9833497B2 - Human originated EGF domain proteins and use of the same - Google Patents

Human originated EGF domain proteins and use of the same Download PDF

Info

Publication number
US9833497B2
US9833497B2 US14/894,417 US201414894417A US9833497B2 US 9833497 B2 US9833497 B2 US 9833497B2 US 201414894417 A US201414894417 A US 201414894417A US 9833497 B2 US9833497 B2 US 9833497B2
Authority
US
United States
Prior art keywords
protein
seq
human
egf1
egf2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US14/894,417
Other languages
English (en)
Other versions
US20160184396A1 (en
Inventor
Xu Song
Ling Li
Jinwu Chen
Deng Jiao Ma
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHENGDU SOURCEBIO LIMITED-LIABILITY Co
Original Assignee
CHENGDU SOURCEBIO LIMITED-LIABILITY Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CHENGDU SOURCEBIO LIMITED-LIABILITY Co filed Critical CHENGDU SOURCEBIO LIMITED-LIABILITY Co
Publication of US20160184396A1 publication Critical patent/US20160184396A1/en
Assigned to CHENGDU SOURCEBIO LIMITED-LIABILITY COMPANY reassignment CHENGDU SOURCEBIO LIMITED-LIABILITY COMPANY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SICHUAN UNIVERSITY
Assigned to SICHUAN UNIVERSITY reassignment SICHUAN UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHEN, Jinwu, LI, LING, MA, Dengjiao, SONG, XU
Application granted granted Critical
Publication of US9833497B2 publication Critical patent/US9833497B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • A61K38/1808Epidermal growth factor [EGF] urogastrone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/36Blood coagulation or fibrinolysis factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/485Epidermal growth factor [EGF], i.e. urogastrone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention belongs to biomedical field, and especially relates to human-originated EGF domain proteins and use thereof in the pharmaceutical industry.
  • Gram-negative bacteria refer broadly to the bacteria which are stained in red in Gram's staining reaction, and they are different from the Gram-positive bacteria during the Gram's staining due to the difference in the structure of the cell wall (the positive bacteria being stained in violet).
  • the Gram-negative bacteria are represented by Escherichia coli , as well as Proteus, Shigella dysenteriae, Klebsiella pneumoniae, Brucella bacilli, Haemophilus influenzae, Haemophilus parainfluenzae, Moraxella catarrhalis, Acinetobacter and so on. Pathogenicity of such bacteria is often associated with a particular component in their cell-walls, lipopolysaccharide (also known as endotoxin).
  • lipopolysaccharide will induce the body to produce a large amount of cytokines and to activate the immune system, eventually evoking innate immune responses against the pathogenic bacteria within the body. For instance, redness and swelling are the results of generation and release of a large amount of cytokines.
  • antibiotics In addition to eliminating the focus of infection and a symptomatic and supportive treatment, antibiotics also need to be used during the treatment of a Gram-negative bacteria infection.
  • the antibiotics mainly used are aminoglycosides, beta-lactams, etc. These antibiotics have potent bactericidal effects on various Gram-negative bacteria, and moreover exhibit longer post-antibiotic effects on the common Gram-negative bacilli such as Pseudomonas aeruginosa, Klebsiella pneumonia , and E. coli .
  • the agents such as prostaglandin synthetase inhibitor, levamisole, and tuftsin are also useful in treatment of the Gram-negative bacteria infection.
  • antibiotics have a better effect of eliminating the bacteria, they have no effect on the lipopolysaccharide free in the blood and a wide variety of detrimental cytokines produced by target cells which are persistently stimulated with the free lipopolysaccharide. Therefore, when choosing an antibacterial drug clinically, a comprehensive consideration should be taken for the result of drug sensitive test and the feature of inducing release of the endotoxin. Thirdly, since lipopolysaccharide is located on the surface of the cell wall of Gram-negative bacteria, many early types of antibiotics are unable to inhibit such bacteria effectively. Based on these reasons, novel fields are being explored actively in treating Gram-negative bacteria infection in the recent years.
  • Antimicrobial peptides refer to short peptides having antibacterial activities, most of which have thermal stability, high alkalincity and broad-spectrum anti-bacterial activities.
  • AMPs Antimicrobial peptides
  • These AMPs are synthesized after induction, play an important key role in an organism's resistance against the invasion of a pathogen, and are considered an important defensive constituent for the non-specific immunological function in an organism. Accordingly, it becomes a hot spot and a challenge to find out novel APMs against Gram-negative bacteria.
  • the EGF domain (the EGF-like domain, epidermal growth factor-like domain) is protein domains which is relatively conserved in evolution and has been designated due to first identification of the domain in epidermal growth factor.
  • the EGF domain usually comprises 30-50 amino acid residues and has been currently identified in many animal proteins.
  • E.g. human coagulation factor VII human factor VII, hF VII.
  • hF VII is a naturally-occurring protein in the human's body with molecular weight of about 50 kD.
  • the molecule thereof comprises four domains: a membrane-bound N-terminal ⁇ -carboxyglutamic acid domain (Gla domain), two EGF domains (EGF1 and EGF2), and a C-terminal serine protease domain.
  • the human coagulation factor VII-EGF1 domain has a molecular weight of about 3.9 kD.
  • analogues with the sequences similar to that of hF VII-EGF1, such as human-originated coagulation factor VII-EGF2 protein (hF VII-EGF2), human-originated coagulation factor IX-EGF1 protein (hF IX-EGF1), human-originated coagulation factor IX-EGF2 protein (hF IX-EGF2), human-originated coagulation factor X-EGF1 protein (hF X-EGF1), human-originated coagulation factor X-EGF2 protein (hF X-EGF2), etc.
  • One of the objectives of the present invention is to provide artificially-prepared human-originated EGF domain proteins. Another objective of the present invention is to prove that the human-originated EGF domain proteins have an inhibitory effect on the Gram-negative bacteria and that the human-originated EGF domain proteins can hydrolyze and thus eliminate endotoxin, so as to develop a novel class of medicaments for treating Gram-negative bacteria infection and medicaments for treating endotoxemia caused by the Gram-negative bacteria.
  • the human-originated EGF domain protein set forth in the present invention has the amino acid sequence described in SEQ ID NO: 1 in the sequence listing, or is the protein having homology of over 50% to the amino acid sequence described in SEQ ID NO: 1.
  • the protein having homology of over 50% to the amino acid sequence of the protein described in SEQ ID NO: 1 has any of the amino acid sequences described in SEQ ID NO: 2 to SEQ ID NO: 1498 in the sequence listing.
  • the human-originated EGF domain proteins set forth in the present invention are designated as shown in Table 1.
  • the human-originated EGF domain proteins mentioned above are expressed from a prokaryotic or eukaryotic recombinant plasmid or prepared by chemical synthesis.
  • the prokaryotic vector is the pET plasmid system which includes the prokaryotic expression plasmids such as pET-14b, pET-19b, pET-21a (+), pET-28a (+), pET-42a (+), etc; and the eukaryotic vector is pcDNA3.1 (+), pcDNA3.1 ( ⁇ ), etc.
  • 1498 of the human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) set forth in the present invention such as hF VII-EGF1 protein are able to hydrolyze the lipopolysaccharide of Gram-negative bacteria (also known as endotoxin, a major component in the outer-membrane of a Gram-negative bacterium) and disrupt the stability of cellular structure, thereby exerting the bactericidal action.
  • Gram-negative bacteria also known as endotoxin, a major component in the outer-membrane of a Gram-negative bacterium
  • the human-originated EGF domain proteins such as hF VII-EGF1, hF VII-EGF2, hF IX-EGF1, hF IX-EGF2, hF X-EGF1, and hF X-EGF2, have very strong binding to the tissue factor.
  • the tissue factor When the body is injured, the tissue factor will be exposed at the wound in a large amount, which allows such EGF domain-containing proteins to aggregate accordingly at the wound, exerting a targeted bacteriostatic effect.
  • Assays on the antibacterial activity demonstrate that 1498 of the human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) such as hF VII-EGF1 protein can inhibit the Gram-negative bacteria significantly.
  • the minimum inhibitory concentrations (MICs) of the abovementioned recombinant proteins for E. coli DH5 ⁇ , E. coli BL21, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris, Serratia marcescens are shown in Tables 2 and 3 in the Examples below.
  • 1498 of the human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) set forth in the present invention such as hF VII-EGF1 protein can hydrolyze the lipopolysaccharide of Gram-negative bacteria (also known as endotoxin, seen in Example 17) and lipopolysaccharide is the major pathogenic factor causing endotoxemia. Therefore, 1498 of the human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) set forth in the present invention such as hF VII-EGF1 protein can be used in preparing a medicament for treating endotoxemia caused by the Gram-negative bacteria.
  • 1498 of the artificially-prepared human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) provided in the present invention such as hF VII-EGF1 protein are able to hydrolyze the outer membrane of the Gram-negative bacteria and has been shown experimentally to have significant inhibitory effects on the Gram-negative bacteria, thereby providing a novel class of therapeutic drugs for treating diseases caused by the Gram-negative bacteria infection.
  • 1498 of the artificially-prepared human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) provided in the present invention such as hF VII-EGF1 protein are able to hydrolyze the lipopolysaccharide (also known as endotoxin) of the Gram-negative bacteria, thereby providing a novel class of therapeutic drugs for treating endotoxemia caused by the Gram-negative bacteria.
  • EGF domain proteins provided in the present invention which are artificially prepared, i.e. hF VII-EGF1, hF VII-EGF2, hF IX-EGF1, hF IX-EGF2, hF X-EGF1, and hF X-EGF2, can exhibit an excellent targeted bactericidal effect on Gram-negative bacteria at the wound site by targeted localization at the wound site via binding to tissue factor, and be prospective to be used in preparation of a novel targeted antibacterial drug.
  • EGF domain proteins such as hF VII-EGF1 protein are natural and intrinsic components in the human body, and use of the EGF domain proteins as the bacteriostatic domain in the present invention can reduce the immunogenicity of the medicament effectively.
  • FIG. 1 is the electrophoregram of PCR amplification of the gene sequence encoding the recombinant protein hF VII-EGF1 in Example 1, wherein Lane 1 is the DNA molecular weight marker (Marker 1, purchased from TIANGEN BIOTECH Co. Ltd.) and Lane 2 is PCR amplification of the sequence encoding hF VII-EGF1. The arrowhead is directed toward the amplified fragment of interest.
  • FIG. 2 is the electrophoregram of PCR amplification of the gene sequence encoding the fusion protein RFP-hF VII-EGF1 in Example 1, wherein Lane 1 is the DNA molecular weight marker (1 kb Marker, purchased from TIANGEN BIOTECH Co. Ltd.) and Lane 2 is PCR amplification of the sequence encoding RFP-hF VII-EGF1.
  • FIG. 3 is the schematic representation of the recombinant prokaryotic plasmid pET19bRFP-hF VII-EGF1 in Example 2, wherein the counterclockwise sequence is the forward gene fragment and the clockwise one is the reverse gene fragment.
  • FIG. 4 is the electrophoregram for identification of the restriction-endonuclease digested fragments of the recombinant plasmid pET19bRFP-hF VII-EGF1 in Example 2, wherein Lane 1 is the DNA molecular weight marker (1 kb Marker, purchased from TIANGEN BIOTECH Co. Ltd.) and Lane 2 is the pET19b vector fragment and the DNA fragment encoding the recombinant protein RFP-hF VII-EGF1 which are obtained after restriction-endonuclease double digestion of the recombinant plasmid pET19bRFP-hF VII-EGF1.
  • FIG. 5 is the electrophoregram of PCR amplification of the gene sequence encoding the fusion protein RFP-hF VII-EGF2 in Example 3, wherein Lane 1 is the DNA molecular weight marker (1 kb Marker, purchased from TIANGEN BIOTECH Co. Ltd.) and Lane 2 is PCR amplification of the sequence encoding RFP-hF VII-EGF2.
  • FIG. 6 is the SDS-PAGE analysis of inducible expression of the fusion proteins RFP-hF VII-EGF1 and RFP-hF VII-EGF2 from the recombinant plasmids pET19bRFP-hF VII-EGF1 and pET19bRFP-FVII-EGF2 in E. coli in Examples 5 and 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF VII-EGF1 before induction; Lane 3 is the total protein of the E.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF VII-EGF1 before induction
  • Lane 3 is the total protein of the E.
  • Lane 4 is the total protein of the E. coli without expressing the fusion protein RFP-hF VII-EGF2 before induction
  • Lane 5 is the total protein of the E. coli after expressing the fusion protein RFP-hF VII-EGF2 by induction.
  • the arrowheads indicate the expressed fusion proteins.
  • FIG. 7 is picture of Tricien gel analysis for identifying the recombination proteins hF VII-EGF1 and hF VII-EGF2 obtained after enzymatic digestion of the fusion proteins RFP-hF VII-EGF1 and RFP-hF VII-EGF2 with rTEV in Examples 7 and 8, in which Lane 1 is the lower molecular weight protein marker (PageRuler Unstained Low Range Protein Ladder, purchased from Thermo Scientific); Lane 2 is the recombination protein hF VII-EGF2 obtained after rTEV enzymatic digestion; Lane 3 is the recombination protein hF VII-EGF1 obtained after rTEV enzymatic digestion; and the arrowheads indicate the proteins of interest after enzymatic digestion.
  • Lane 1 is the lower molecular weight protein marker (PageRuler Unstained Low Range Protein Ladder, purchased from Thermo Scientific)
  • Lane 2 is the recombination protein hF VII-EGF2 obtained after
  • FIG. 8 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-hF IX-EGF1 from the recombinant plasmid pET21ahF IX-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF IX-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-hF IX-EGF1 by induction. The arrowhead indicates the expressed fusion protein.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF IX-EGF1 before induction
  • Lane 3 is the total protein of the E. coli
  • FIG. 9 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-hF IX-EGF2 from the recombinant plasmid pET21ahF IX-EGF2-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF IX-EGF2 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-hF IX-EGF2 by induction. The arrowhead indicates the expressed fusion protein.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF IX-EGF2 before induction
  • Lane 3 is the total protein of the E. coli after
  • FIG. 10 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-hF X-EGF1 from the recombinant plasmid pET21ahF X-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF X-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-hF X-EGF1 by induction. The arrowhead indicates the expressed fusion protein.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF X-EGF1 before induction
  • Lane 3 is the total protein of the E. coli
  • FIG. 11 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-hF X-EGF2 from the recombinant plasmid pET21ahF X-EGF2-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF X-EGF2 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-hF X-EGF2 by induction. The arrowhead indicates the expressed fusion protein.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-hF X-EGF2 before induction
  • Lane 3 is the total protein of the E. coli after
  • FIG. 12 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Delta and Notch-like epidermal growth factor-related-EGF1 from the recombinant plasmid pET21ahDelta and Notch-like epidermal growth factor-related-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Delta and Notch-like epidermal growth factor-related-EGF1 before induction; and Lane 3 is the total protein of the E.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Delta and Notch-like epidermal growth factor-related-EGF1 before induction
  • Lane 4 is the purified fusion protein RFP-Delta and Notch-like epidermal growth factor-related-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 13 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Zonadhesin-EGF1 from the recombinant plasmid pET21ahZonadhesin-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Zonadhesin-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Zonadhesin-EGF1 by induction; and Lane 4 is the purified fusion protein RFP-Zonadhesin-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 14 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-EGF, latrophilin and seven transmembrane domain-containing protein 1-EGF2 from the recombinant plasmid pET21ahEGF-latrophilin and seven transmembrane domain-containing protein 1-EGF2-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-EGF, latrophilin and seven transmembrane domain-containing protein 1-EGF2 before induction; and Lane 3 is the total protein of the E.
  • Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-EGF, latrophilin and seven transmembrane domain-containing protein 1-EGF2 before induction
  • Lane 4 is the purified fusion protein RFP-EGF, latrophilin and seven transmembrane domain-containing protein 1-EGF2.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 15 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Prostaglandin G/H synthase 1-EGF1 from the recombinant plasmid pET21ahProstaglandin G/H synthase 1-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Prostaglandin G/H synthase 1-EGF1 before induction; and Lane 3 is the total protein of the E.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Prostaglandin G/H synthase 1-EGF1 before induction
  • Lane 3 is the total protein of the E.
  • Lane 4 is the purified fusion protein RFP-Prostaglandin G/H synthase 1-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 16 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Neurexin-1-EGF1 from the recombinant plasmid pET21ahNeurexin-1-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Neurexin-1-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Neurexin-1-EGF1 by induction; and Lane 4 is the purified fusion protein RFP-Neurexin-1-EGF1. The arrowhead indicates the expressed fusion protein.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein R
  • FIG. 17 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-EGF-containing fibulin-like extracellular matrix protein 1-EGF1 from the recombinant plasmid pET21ahEGF-containing fibulin-like extracellular matrix protein 1-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-EGF-containing fibulin-like extracellular matrix protein 1-EGF1 before induction; and Lane 3 is the total protein of the E.
  • Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-EGF-containing fibulin-like extracellular matrix protein 1-EGF1 before induction
  • Lane 3 is the total protein of the E.
  • Lane 4 is the purified fusion protein RFP-EGF-containing fibulin-like extracellular matrix protein 1-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 18 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Netrin-3-EGF1 from the recombinant plasmid pET21ahNetrin-3-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Netrin-3-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Netrin-3-EGF1 by induction; and Lane 4 is the purified fusion protein RFP-Netrin-3-EGF1. The arrowhead indicates the expressed fusion protein.
  • Lane 1 is the protein molecular weight marker (Unst. Protein Marker, purchased from Thermo Scientific)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Netrin
  • FIG. 19 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Putative EGF-like module-containing mucin-like hormone receptor-like 4-EGF2 from the recombinant plasmid pET21ahPutative EGF-like module-containing mucin-like hormone receptor-like 4-EGF2-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Putative EGF-like module-containing mucin-like hormone receptor-like 4-EGF2 before induction; and Lane 3 is the total protein of the E.
  • Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD)
  • Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Putative EGF-like module-containing mucin-like hormone receptor-like
  • Lane 4 is the purified fusion protein RFP-Putative EGF-like module-containing mucin-like hormone receptor-like 4-EGF2.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 20 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Protransforming growth factor alpha-EGF1 from the recombinant plasmid pET21ahProtransforming growth factor alpha-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Protransforming growth factor alpha-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Protransforming growth factor alpha-EGF1 by induction; and Lane 4 is the purified fusion protein RFP-Protransforming growth factor alpha-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 21 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Delta-like protein 4-EGF2 from the recombinant plasmid pET21ahDelta-like protein 4-EGF2-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Delta-like protein 4-EGF2 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Delta-like protein 4-EGF2 by induction; and Lane 4 is the purified fusion protein RFP-Delta-like protein 4-EGF2.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 22 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Nidogen-1-EGF1 from the recombinant plasmid pET21ahNidogen-1-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Nidogen-1-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Nidogen-1-EGF1 by induction; and Lane 4 is the purified fusion protein RFP-Nidogen-1-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 23 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Uromodulin-like 1-EGF3 from the recombinant plasmid pET21ahNidogen-1-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Uromodulin-like 1-EGF3 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Uromodulin-like 1-EGF3 by induction; and Lane 4 is the purified fusion protein RFP-Uromodulin-like 1-EGF3.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 24 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Sushi, von Willebrand factor type A-EGF and pentraxin domain-containing protein 1-EGF2 from the recombinant plasmid pET21 ahSushi, von Willebrand factor type A-EGF and pentraxin domain-containing protein 1-EGF2-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E.
  • Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Sushi, von Willebrand factor type A-EGF and pentraxin domain-containing protein 1-EGF2 by induction; and Lane 4 is the purified fusion protein RFP-Sushi, von Willebrand factor type A-EGF and pentraxin domain-containing protein 1-EGF2.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 25 is the SDS-PAGE analysis of inducible expression of the fusion protein RFP-Protocadherin Fat 2-EGF1 from the recombinant plasmid pET21ahProtocadherin Fat 2-EGF1-RFP in E. coli in Example 8, wherein Lane 1 is the protein molecular weight marker (Precision Plus Protein Standards, purchased from BIO-RAD); Lane 2 is the total protein of the E. coli without expressing the fusion protein RFP-Protocadherin Fat 2-EGF1 before induction; and Lane 3 is the total protein of the E. coli after expressing the fusion protein RFP-Protocadherin Fat 2-EGF1 by induction; and Lane 4 is the purified fusion protein RFP-Protocadherin Fat 2-EGF1.
  • the arrowhead indicates the expressed fusion protein.
  • FIG. 26 is the schematic representation of the recombinant eukaryotic plasmid pcDNA3.1-RFP-hF VII-EGF1 in Example 9, wherein the counterclockwise sequence is the forward gene fragment and the clockwise one is the reverse gene fragment.
  • FIG. 27 is the growth curve of E. coli DH5 ⁇ treated with the recombinant protein hF VII-EGF1 in Example 14.
  • FIG. 28 is a silver staining image for hydrolysis of E. coli EH100 LPS by the recombinant protein hF VII-EGF1 in Example 17, in which Lane 1 is the prestained protein marker; Lane 2 is the E. coli EH100 LPS untreated; and Lane 3 is the E. coli EH100 LPS treated with hF VII-EGF1.
  • EGF domain proteins (PRT2 to PRT1498 in Table 1) are performed with reference to those for the protein hF VII-EGF1.
  • Nucleotide sequences for the expressed proteins of interest can be obtained from the databases on the web www.uniprot.org/or www.ncbi.nlm.nih.gov/).
  • the primers for PCR amplification as shown below were synthesized (by Invitrogen Biological Technology Co. Ltd.):
  • Primer 1 SEQ ID NO: 1499 5′-TAA CATATG GTGAGCAAGGGCGAGGAGGATA-3′ Nde I
  • Primer 2 SEQ ID NO: 1500 5′- GAAAACCTGTACTTCCAGGGT CAA TTCGAA GATGGGGACCAGTGTGC CTC-3′ Bsp119 I
  • PrimerTEV SEQ ID NO: 1501 5′-CCTGGAAGTACAGGTTTTCCTTGTACAGCTCGTC-3′
  • Primer 4 SEQ ID NO: 1502 5′-TAT GGATCC TTACTCACAGTTCCGGCCCTCGAA-3′ BamH I
  • the PCR amplification was performed with Primers 2 and 4 using a plasmid comprising the hF VII CDS region (FulenGen Co. Ltd., Guangzhou) as the template.
  • a BamH I restriction site introduced into the sequence of Primer 4 and an enzymatic cleavage site for the recombinant tobacco mosaic virus proteinase (rTEV) and a restriction site for Bsp119 I were introduced into the sequence of Primer 2, in order to facilitate replacement with the expressible sequences for expressing other human-originated EGF domain proteins (PRT2 to PRT1498 in Table 1).
  • the PCR reaction system 50 ⁇ L was as follows:
  • the reaction condition for the PCR amplification was set with reference to the instruction of PrimeStar DNA polymerase (purchased from Takara): pre-denaturation at 98° C. for 2 min, 30 cycles of denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, and elongation at 72° C. for 30 sec, followed by elongation at 72° C. for 4 min.
  • PrimeStar DNA polymerase purchased from Takara
  • the amplified products were analyzed with 2% agarose gel electrophoresis, the DNA fragments comprising the coding sequence for hF VII-EGF1 was obtained (see FIG. 1 ), and the fragments of interest was recovered according to the instruction of a gel recovery kit (purchased from Omega).
  • the PCR amplification was performed with Primers 1 and 3 using a plasmid comprising the coding sequence of the gene for the RFP protein (purchased from Takara) as the template.
  • An Nde I restriction site was introduced into the sequence of Primer 1.
  • the reaction system was set up with reference to that for obtaining the DNA fragment encoding for hF VII-EGF1.
  • the reaction condition for the PCR amplification was set up with reference to the instruction of PrimeStar DNA polymerase: pre-denaturation at 98° C. for 2 min, 30 cycles of denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, and elongation at 72° C. for 1 min, followed by elongation at 72° C. for 4 min.
  • the amplified products were analyzed with 2% agarose gel electrophoresis, the DNA fragment comprising the coding sequence for RFP was obtained, and the fragment of interest was recovered according to the instruction of a gel recovery kit (purchased from Omega).
  • a overlapping PCR amplification was performed with Primers 1 and 4 using the DNA fragment obtained from the two PCR amplifications mentioned above as templates, yielding a fusion gene fragment RFP-hF VII-EGF1 which comprises a coding sequence for the RFP-TEV enzymatic cleavage site and the human coagulation factor VII-EGF1 protein.
  • the PCR reaction system (50 ⁇ L) was as follows:
  • the reaction condition for the PCR amplification was set up with reference to the instruction of PrimeStar DNA polymerase: pre-denaturation at 98° C. for 2 min, 30 cycles of denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, and elongation at 72° C. for 1.5 min, followed by elongation at 72° C. for 4 min.
  • the amplified products were analyzed with 2% agarose gel electrophoresis, the fragment comprising the sequence encoding for RFP-hF VII-EGF1 was obtained (see FIG. 2 ), and the fragment of interest was recovered according to the instruction of a gel recovery kit (purchased from Omega).
  • the RFP-hF VII-EGF1 gene fragment obtained in Example 1 and the prokaryotic expression vector pET19b (the product from Novagen, the plasmid had been modified to carry a gene encoding for a red fluorescent protein) were individually double digested with the restriction endonucleases Nde I and BamH I (both purchased from TaKaRa or Fermentas) at 37° C. overnight, and the reaction systems were established as follows:
  • reaction products were analyzed with 1% agarose gel electrophoresis and the fragments of interest were recovered under the ultraviolet lamp of a gel imaging system according to the instruction of a gel recovery kit (purchased from Omega).
  • the gene fragment RFP-hF VII-EGF1 and the prokaryotic vector fragment obtained in the above steps were quantified approximately and then subjected to ligation according to the ligation reaction principle where a ratio of the molecule number of the gene fragment to the molecule number of the prokaryotic vector is 3:1.
  • the ligation reaction system was set up as follows:
  • the ligation product was transformed into the competent cells (prepared according to Molecular Cloning: a Laboratory Manual) of E. coli Top10 (purchased from Invitrogen company). The main steps of the procedure for transforming the ligation product were as follows:
  • SOC medium (10 g peptone, 5 g yeast extract, 0.5 g NaCl, 0.186 g KCl, 0.95 g MgCl 2 , dissolved with ddH 2 O and made up to a volume of 980 mL, autoclaved, cooled to room temperature and then 20 mL of sterile 20% aqueous glucose solution was added) was added, and placed on ice;
  • the single clone of the transformed E. coli Top 10 mentioned above was picked, cultured in a small quantity and subjected to plasmid extraction with a plasmid extraction kit (purchased from OMEGA), followed by double digestion set forth in the steps of the present Example step 1.
  • the result of the double digested product resolved by gel-electrophoresis is shown in FIG. 4 .
  • the sizes of the two bands produced by the enzymatic digestion are consistent with those of the expected products, demonstrating the success of construction of the plasmid of interest.
  • pET19bRFP-hF VII-EGF1 The plasmids which had been identified by double digestion to be correct ones were send to Beijing Genomics Institute for sequencing of the inserted fusion gene fragment. Finally, the recombinant prokaryotic plasmid comprising the RFP-hF VII-EGF1 gene with the correct sequencing result was designated as pET19bRFP-hF VII-EGF1.
  • Example 3 Obtaining the Fusion Genes for the RFP Fusion Proteins of Other Human-Originated EGF Domain Proteins (PRT2 to PRT1498 in Table 1) with a Red Fluorescent Protein (RFP) Tag
  • Example 4 Construction of the Prokaryotic Recombinant Plasmids for Expression of the RFP Fusion Proteins of Other Human-Originated EGF Domain Proteins (PRT2 to PRT1498 in Table 1)
  • the gene fragments for other human-originated EGF domain proteins and the recombinant plasmid pET19bRFP-hF VII-EGF1 constructed in Example 2 were double digested with the restriction endonucleases Bsp119 I and BamH I (both purchased from TaKaRa or Fermentas) at 37° C. overnight.
  • the recombinant plasmid pET19bRFP-hF VII-EGF1 constructed in Example 2 was transformed into E. coli BL21(DE3) (purchased from Invitrogen); the single clone was picked into the LB medium containing 0.1 g/mL ampicillin and incubated at 37° C. with shaking at 185 rpm to OD 600 of about 0.6, and 1 mL of the bacterial suspension was taken and frozen at ⁇ 20° C. Then, IPTG (isopropyl- ⁇ -D-thiogalactoside) was added to the remaining bacterial suspension at a final concentration of 0.8 mM. The incubation proceeded for 6 h and 1 mL of the bacterial suspension was taken and frozen at ⁇ 20° C.
  • the bacterium RFP-hF VII-EGF1-pET19bBL21-(DE3) was cultured on a large scale according to the method in Example 5, induced by addition of IPTG, and cultured overnight at 18° C., with shaking at 175 rpm.
  • the above-mentioned bacterial suspension was centrifuged at 4000 ⁇ g for 3 min to collect the bacteria.
  • the bacterial pellet was washed by resuspension in the EW buffer (20 mM sodium phosphate, 500 mM NaCl, 1 mM DTT, 0.1 mM PMSF, pH 7.4).
  • the bacterial suspension was centrifuged at 4000 ⁇ g for 3 min, and the supernatant was discarded. Again, the bacterial pellet was resuspended with 10 mL of the EW buffer.
  • the bacteria were disrupted by sonication (power: 300 W; duration for sonication: 10 s; interval: 10 s; total time for sonication: 3 min; performed in ice-bath). After completion of the sonication, the bacterial suspension was centrifuged at 48,400 ⁇ g at 4° C. for 1 h. The supernatant was collected and placed on ice.
  • the chromatographic column was preloaded according to the instruction of Co 2+ purification system (Talon Metal Affinity Resin, Clontech company product), and the sample was loaded.
  • the column was washed twice with 10 mL EW buffer and the protein impurities were washed out with 10 mM imidazole solution. Finally, the protein was eluted with 100 mM imidazole.
  • the eluent comprising the proteins of interest was ultrafiltrated with Tris-Cl buffer (pH 7.4), for buffer exchange and concentration. After ultrafiltration, the high concentration of the fusion protein RFP-hF VII-EGF1 can be obtained. It was shown by protein quantitation that about 15 mg of the proteins of interest with more than 95% of purity can be obtained per liter of the expressing bacterium suspension.
  • Example 7 Enzymatic Cleavage of the Fusion Protein RFP-hF VII-EGF1 and Purification of the Recombination Protein hF VII-EGF1
  • the Reasin Ni column (Ni column purchased from GE) was treated as follows: 200 ⁇ L of the Ni column mix was pipetted into a 1.5 mL EP tube (AxyGEN) and centrifuged at 700 ⁇ g for 2 min, the preservative solution for the Reasin Ni column (20% ethanol) was discarded, then, the Ni column was washed twice with 1 mL deionised water, followed by equilibration of the Ni column with 1 mL binding buffer (0.5 M NaCl, 20 mM phosphate buffer, pH 7.4).
  • 1 mL binding buffer 0.5 M NaCl, 20 mM phosphate buffer, pH 7.4
  • the beads were resuspended with 423 ⁇ l of binding buffer. After resuspending and mixing well, the resultant mixture was subjected to cleavage at 4° C. with the rTEV proteinase (purchased from Shanghai Sangon). The mixture was placed on a vertical rotary mixer overnight with the time of period limited to 10 h. After completion of the enzymatic cleavage, the mixture was centrifuged at 700 ⁇ g at 4° C. for 5 min. After completion of centrifugation, the supernatant was collected as the recombination protein hF VII-EGF1.
  • the picture of Tricien gel analysis for identifying the recombination protein hF VII-EGF1 obtained after enzymatic cleavage of the fusion protein RFP-hF VII-EGF1 with rTEV is seen in FIG. 7 .
  • the enzymatic cleavage system was set up as follows:
  • the other human-originated EGF domain proteins (PRT2 to PRT1498 in Table 1) can be expressed prokaryotically and then purified with the same methods as those in Examples 5-7. Partial profiles are shown in FIGS. 6 to 25 .
  • the primers for PCR amplification as shown below were synthesized (by Invitrogen Biological Technology Co. Ltd.):
  • Primer 1 SEQ ID NO: 1503 TAA GGATCC TGCAGAGATTTCATC ATGCATCATCATCAT BamH I Kozak
  • Primer 2 SEQ ID NO: 1504 TAT CTCGAG TTACTCACAGTTCCGG Xho I
  • the PCR amplification was performed with Primers 1 and 2 using the plasmid pET19bRFP-hF VII-EGF1 constructed in Example 2 as the template.
  • a BamH I restriction enzyme cutting site and a Kozak sequence were introduced into the sequence of Primer 1, and an Xho I restriction enzyme cutting site was introduced into the sequence of Primer 2.
  • the PCR reaction was performed with reference to Example 1.
  • the cloned gene fragment RFP-hF VII-EGF1 and the eukaryotic expression vector pcDNA3.1 (+) were double digested with the restriction endonucleases BamH I and Xho I (both purchased from TaKaRa or Fermentas), and the reaction systems were set up with reference to Example 2.
  • the steps for ligating the gene fragment to the eukaryotic expression vector and for transforming and identifying the recombinant plasmid were performed with reference to Example 2.
  • the recombinant plasmid comprising the RFP-hF VII-EGF1 gene with the correct sequencing result was designated as pcDNA3.1-RFP-hF VII-EGF1.
  • the plasmid map of the recombinant plasmid is seen in FIG. 26 .
  • DG44 cells (purchased from ATCC) were cultured in the ⁇ -MEM complete culture medium (containing L-glutamine, ribonucleic acid and deoxyribonucleic acid, purchased from Hiclony) supplemented with 10% FBS (fetal bovine serum, purchased from Hiclony). On the day before transfection, DG44 cells were seeded in a 6-well plate at 4 ⁇ 10 5 cells/mL with 2 mL per well.
  • ⁇ -MEM complete culture medium containing L-glutamine, ribonucleic acid and deoxyribonucleic acid, purchased from Hiclony
  • FBS fetal bovine serum
  • the cells were transferred into 100 mm petri dishes at a ratio of 1:2000.
  • G418 purchased from Gibco
  • Cells transfected with an empty vector or not transfected were used as controls.
  • the single clones were picked into and cultured in 24-well plates, and sequentially transferred into 6-well plates and into 100 mm petri-dishes for expanding culture once cellular confluence was reached. When the cell confluency was 90%, cells were frozen at a rate of 1:4 in FBS with 10% DMSO (purchased from Gibco).
  • the picked positive cell clones were identified by the genomic PCR and RT-PCR.
  • the fragment of interest could be amplified by both of the techniques, which demonstrated that the fusion gene has been integrated into the genome of the cell and a functional mRNA is transcribed.
  • the stable cell line obtained was designated as DG44-RFP-hF VII-EGF1.
  • the DG44-RFP-hF VII-EGF1 cells were cultured in the ⁇ -MEM complete culture medium containing 10% FBS supplemented with 400 ⁇ g/mL G418, and passaged into 10 plates.
  • the ⁇ -MEM complete culture medium containing 10% FBS was replaced with CHO serum-free medium, and supplemented with Vitamin K (Sigma) to a final concentration of 1 ⁇ g/mL.
  • Example 6 After 3 days of cultivation, the cellular pellet was collected and disrupted. Then, the supernatant was obtained by centrifugation, purified by cobalt ion affinity chromatography and identified by SDS-PAGE plus Western Blot. The steps were referred to those in Example 6.
  • Example 12 Enzymatic Cleavage of the Eukaryotically Expressed Fusion Protein RFP-hF VII-EGF1 and Recovery of hF VII-EGF1
  • Example 13 Eukaryotic Expression of the Other Human-Originated EGF Domain Proteins (PRT2 to PRT1498 in Table 1) and Purification of the Same
  • the eukaryotic expression plasmids for the RFP fusion proteins of other human-originated EGF domain proteins were constructed and the cell lines stably expressing these fusion proteins were established.
  • the eukaryotically expressed fusion proteins were collected and subjected to enzymatic cleavage, and the other human-originated EGF domain proteins (PRT2 to PRT1498 in Table 1) were finally obtained.
  • E. coli DH5 ⁇ was exemplified. E. coli DH5 ⁇ was streaked and cultured on LB solid medium. Then, a typical clone was picked and inoculated into common LB liquid medium, cultured at 37° C. with shaking at 185 rpm until the logarithmic growth phase was reached (OD 600 of about 0.5). The bacterial culture was centrifuged at 4000 ⁇ g for 3 min, the supernatant was discarded, and the thalli were resuspended with fresh LB medium.
  • the above-mentioned bacterial suspension was diluted and inoculated into a 96-well plate with the total volume of 100 ⁇ L per well and a bacterial count of 5 ⁇ 10 5 CFU/mL.
  • the recombinant protein hF VII-EGF1 was added to the above-mentioned wells with the final protein concentration in the well of the highest protein concentration being 50 ⁇ g/mL. Basing on this final concentration, a two-fold serial dilution was performed till a protein concentration gradient consisting of 50, 25, and 12.5 ⁇ g/mL was set up. Three parallel wells were set up for each concentration in the gradient.
  • the above-mentioned 96-well plate was placed and cultured at 37° C. in shaking incubator shaking at 175 rpm. Samples were taken every 30 min, the absorbance values were determined at 600 nm wavelength under a ultra violet spectrophotometer, and an inhibition curve was plotted.
  • Judgement on MIC After 8 h of cultivation, the growth was observed with naked eyes or judged under the ultra violet spectrophotometer at a wavelength of 600 nm.
  • the minimal inhibitory concentration MIC is defined as the lowest concentration of the recombinant protein at which there is no growth of the bacteria.
  • the growth curve of E. coli DH5 ⁇ treated with the recombinant protein hF VII-EGF1 is seen in FIG. 27 .
  • the curve indicates that the recombinant protein hF VII-EGF1 exhibits a significant inhibitory effect on the growth of E. coli DH5 ⁇ , with the MIC being 12.5 ⁇ g/mL.
  • Example 15 Determination of Antibacterial Activities of the Other Human-Originated EGF Domain Proteins (PRT2 to PRT1498 in Table 1)
  • Example 14 the minimal inhibitory concentrations (MIC, ⁇ g/mL) of the other human-originated EGF domain proteins (PRT2 to PRT1498 in Table 1) for E. coli DH5 ⁇ were determined. The results are shown in Table 2:
  • Gram-negative bacteria such as E. coli BL21, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris, Serratia marcescens , etc were streaked on solid LB medium and cultured respectively. Then, typical clones were picked, inoculated into common liquid LB medium respectively, and cultured at 37° C. with shaking at 185 rpm until the McFarland specific turbidity was 0.5. The bacterial culture of each of Gram-negative bacteria was centrifuged at 4000 ⁇ g for 3 min, the supernatant was discarded, and the thalli were resuspended with fresh LB medium.
  • the above-mentioned bacterial suspensions were diluted and inoculated into 96-well plates with the final concentration of the bacterial suspension being 5 ⁇ 10 5 CFU/mL per well.
  • Example 17 Silver Staining Detection of Endotoxin (LPS) Hydrolyzed by the Human-Originated EGF Domain Proteins (PRT1 to PRT1498 in Table 1) Such as the Recombination Protein hF VII-EGF1, Etc.
  • LPS Endotoxin
  • E. coli EH100 LPS (Sigma) samples were respectively incubated with the obtained human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) such as the recombination protein hF VII-EGF1, etc.; and the control group was the LPS sample incubated with TB S buffer. The incubation lasted overnight. Then, the centrifugation was performed to collect the pellet.
  • PRT1 to PRT1498 in Table 1 human-originated EGF domain proteins
  • the 1 ⁇ loading buffer for LPS (0.05 mol/L Tris-HCl, containing 10 g/L SDS, 100 g/L sucrose, 0.5% ⁇ -mercaptoethanol, 10 mg/L Bromophenol Blue, pH 6.8) was mixed with the sample of the treated pellet and incubated on a metal bath at 100° C. for 5 min.
  • separating gel containing 4 mol/L urea, Bio-Rad with a thickness of 1.0 mm, the detailed composition as follows: 1.15 mL of deionized water, 2.5 mL of 30% acrylamide, 1.3 mL of 1.5 mol/L Tris-HCl (pH 8.8, containing 10% SDS), 50 ⁇ l of 10% ammonium persulfate, 4 ⁇ l of TEMED) was mixed well and prepared. The top of the separating gel was overlaid with water.
  • 4. 5% stacking gel was prepared as follows: 1.42 mL of deionized water, 0.33 mL of 30% acrylamide, 0.25 mL of 1 mol/L Tris-HCl (pH 6.8, containing 10% SDS), 20 ⁇ L of 10% ammonium persulfate, 2 ⁇ L of TEMED) were mixed well and poured. A ten-well comb was quickly inserted.
  • the gel was fixed with 50 mL of fixation solution (30% alcohol, 10% glacial acetic acid, 7 g/L periodic acid) for oxidation at room temperature for 25 min After completion of the fixation, the gel was washed three times each time with deionized water for 5 min.
  • fixation solution (30% alcohol, 10% glacial acetic acid, 7 g/L periodic acid)
  • the gel was stained in 100 mL of 1 g/L AgNO 3 at room temperature for 40 min After completion of the staining, the gel was washed one time with ddH 2 O.
  • the gel was transferred into 50 mL of 30 g/L Na 2 CO 3 pre-chilled on ice, to which 0.02% formaldehyde was added just before visualization. When the band appeared or began to become dark, the reaction was stopped by adding 6 mL glacial acetic acid. The stopping solution was removed upon completion of the termination reaction and the gel was kept in deionized water.
  • the silver staining picture was exemplified by the protein hF VII-EGF1, as shown in FIG. 28 .
  • the LPS band is obviously decreased and becomes weak, indicating that the protein hF VII-EGF1 eliminates the majority of LPS.
  • the silver staining pictures of PRT2 to PRT1498 in Table 1 are similar to that in FIG. 28 . This indicated that the human-originated EGF domain proteins (PRT1 to PRT1498 in Table 1) described in the present invention can hydrolyze LPS and may be used in preparation of a medicament for treating endotoxemia caused by the Gram-negative bacteria.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US14/894,417 2013-05-29 2014-05-19 Human originated EGF domain proteins and use of the same Active US9833497B2 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
CN201310206726 2013-05-29
CN201310206726 2013-05-29
CN201310206726.6 2013-05-29
CN201410182727.6A CN104211799B (zh) 2013-05-29 2014-04-30 人源egf结构域蛋白及其应用
CN201410182727.6 2014-04-30
CN201410182727 2014-04-30
PCT/CN2014/077789 WO2014190860A1 (zh) 2013-05-29 2014-05-19 人源egf结构域蛋白及其应用

Publications (2)

Publication Number Publication Date
US20160184396A1 US20160184396A1 (en) 2016-06-30
US9833497B2 true US9833497B2 (en) 2017-12-05

Family

ID=51987987

Family Applications (1)

Application Number Title Priority Date Filing Date
US14/894,417 Active US9833497B2 (en) 2013-05-29 2014-05-19 Human originated EGF domain proteins and use of the same

Country Status (5)

Country Link
US (1) US9833497B2 (enExample)
EP (1) EP3006460B1 (enExample)
JP (1) JP6503342B2 (enExample)
CN (2) CN104211799B (enExample)
WO (1) WO2014190860A1 (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11242370B2 (en) 2019-04-01 2022-02-08 Eli Lilly And Company Neuregulin-4 compounds and methods of use
US20240067713A1 (en) * 2021-04-09 2024-02-29 Board Of Regents, The University Of Texas System Compositions and methods for treatment of chronic lung diseases

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EA201691749A1 (ru) * 2014-02-28 2016-12-30 3Б Фармасьютикалз Гмбх Пептиды и способы применения
WO2015153402A1 (en) * 2014-04-03 2015-10-08 The Regents Of The University Of California Peptide fragments of netrin-1 and compositions and methods thereof
AU2018293925B2 (en) * 2017-06-30 2024-06-13 Adelaide university A method of treatment
EP4198045A1 (en) * 2021-12-16 2023-06-21 Université de Lille Antimicrobial peptides, variants and chemical analogues thereof and their uses

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004108763A2 (en) 2003-06-05 2004-12-16 Canadian Blood Services Mutants of the factor vii epidermal growth factor domain
US20130202596A1 (en) * 2010-07-09 2013-08-08 Biogen Idec Hemophilia Inc. Processable Single Chain Molecules and Polypeptides Made Using Same

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2450127A1 (en) * 2001-06-14 2002-12-27 Shujian Wu Polynucleotide encoding a novel human growth factor with homology to epidermal growth factor, bgs-8, expressed highly in immune tissue
WO2005111070A2 (en) * 2004-05-13 2005-11-24 Regents Of The University Of Minnesota Mucin3 egf-like domains
US20110212108A1 (en) * 2008-05-09 2011-09-01 The Regents Of The University Of California Neuregulin/erbb signaling and integrin
WO2010006136A2 (en) * 2008-07-09 2010-01-14 Mayo Foundation For Medical Education And Research Adenovirus targeting
JP5909180B2 (ja) * 2009-06-25 2016-04-26 ザ・ユニヴァーシティ・オヴ・ノース・キャロライナ・アト・チャペル・ヒル キメラ第vii因子分子

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004108763A2 (en) 2003-06-05 2004-12-16 Canadian Blood Services Mutants of the factor vii epidermal growth factor domain
US20060234935A1 (en) * 2003-06-05 2006-10-19 Morris Blajchman Mutants of the factor VII epidermal growth factor domain
US20130202596A1 (en) * 2010-07-09 2013-08-08 Biogen Idec Hemophilia Inc. Processable Single Chain Molecules and Polypeptides Made Using Same

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Escherichia coli Infections from Merck Manual, pp. 1-3. Accessed Dec. 8, 2016. *
Gram Negative Bacteria from Merck Manual, pp. 1-4. Accessed Dec. 8, 2016. *
Gram-negative Bacteria from www.niaid.nih.gov/research/gram-negative-bacteria. pp. 1-2. Accessed Dec. 8, 2016. *
Introduction to Gram-negative Bacilli from Merck Manual, p. 1. Accessed Dec. 8, 2016. *
Mei et al., "Binding of EGF1 Domain Peptide in Coagulation Factor VII with Tissue Factor and Its Implications for the Triggering of Coagulation", J Huazhong Univ Sci Technol 30(1), 2010, pp. 42-47.
Zhang et al., "Capability of the First Epidermal Growth Factor Domain of Rat Coagulation Factor VII in Vitro", Chinese Journal of Thrombosis and Hemostasis, 2007, vol. 12, No. 4, pp. 148-151.

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11242370B2 (en) 2019-04-01 2022-02-08 Eli Lilly And Company Neuregulin-4 compounds and methods of use
US12145972B2 (en) 2019-04-01 2024-11-19 Eli Lilly And Company Neuregulin-4 compounds and methods of use
US20240067713A1 (en) * 2021-04-09 2024-02-29 Board Of Regents, The University Of Texas System Compositions and methods for treatment of chronic lung diseases
US12173061B2 (en) * 2021-04-09 2024-12-24 Board Of Regents, The University Of Texas System Compositions and methods for treatment of chronic lung diseases

Also Published As

Publication number Publication date
WO2014190860A1 (zh) 2014-12-04
JP2016520599A (ja) 2016-07-14
CN104211799B (zh) 2017-12-26
US20160184396A1 (en) 2016-06-30
EP3006460A1 (en) 2016-04-13
CN104211799A (zh) 2014-12-17
EP3006460A4 (en) 2017-05-10
JP6503342B2 (ja) 2019-04-17
CN105683216B (zh) 2021-03-26
CN105683216A (zh) 2016-06-15
EP3006460B1 (en) 2020-08-26

Similar Documents

Publication Publication Date Title
US9833497B2 (en) Human originated EGF domain proteins and use of the same
US20250018062A1 (en) Modified polynucleotides for the production of biologics and proteins associated with human disease
US10385106B2 (en) Modified polynucleotides for the production of secreted proteins
JP2002501077A (ja) Meth1およびmeth2のポリヌクレオチドおよびポリペプチド
JP6441906B2 (ja) ヒト凝固因子軽鎖タンパク質及びその使用
CN108295242A (zh) 用于预防和/或治疗银屑病药物组合物、cd317胞外段蛋白的应用
AU2020283188A1 (en) Expression regulator of P2X7 receptor
US6825005B2 (en) Methods and reagents to regulate apoptosis
EP3528831B1 (en) Use of fkbp-l polypeptides and nucleic acids for the treatment of obesity
Dijk Chicken antimicrobial peptides: biological functions and possible applications
KR100917705B1 (ko) 카스파제-7 절단에서 유래하는 세포사멸과 관련된폴리뉴클레오티드 서열, 세포사멸의 억제, 유도 인자 및이의 스크리닝 방법
KR100917695B1 (ko) 카스파제-7 절단에서 유래하는 세포사멸과 관련된폴리뉴클레오티드 서열, 세포사멸의 억제, 유도 인자 및이의 스크리닝 방법
KR100917692B1 (ko) 카스파제-7 절단에서 유래하는 세포사멸과 관련된폴리뉴클레오티드 서열, 세포사멸의 억제, 유도 인자 및이의 스크리닝 방법
CN102807613A (zh) 具有趋化活性的分泌蛋白及其医药用途
CN103751764A (zh) Bat3蛋白在制备由朊病毒引起的神经系统疾病药物中的应用
NI UJN1f1O1SDNINOID 11V11133101AI
Tasiemski et al. Deciphering the Immune Function and
Class et al. Patent application title: HSP70-Based Treatment for Autoimmune Diseases and Cancer Inventors: Isabelle Caroline Le Poole (Downers Grove, IL, US) Josephus Dirk Nieland (Arhus C, DK) Thor Las Holtet (Ronde, DK) Thor Las Holtet (Ronde, DK)
Filewod Immunomodulatory effects of LL-37 in the epithelia
DEFENSINS Karen Taylor
JP2008523068A (ja) 有機化合物の使用

Legal Events

Date Code Title Description
AS Assignment

Owner name: SICHUAN UNIVERSITY, CHINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SONG, XU;LI, LING;CHEN, JINWU;AND OTHERS;REEL/FRAME:040644/0814

Effective date: 20151117

Owner name: CHENGDU SOURCEBIO LIMITED-LIABILITY COMPANY, CHINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SICHUAN UNIVERSITY;REEL/FRAME:040362/0288

Effective date: 20151118

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 8