US20240026353A1 - Compounds and methods for modulating scn2a - Google Patents

Compounds and methods for modulating scn2a Download PDF

Info

Publication number
US20240026353A1
US20240026353A1 US18/017,276 US202118017276A US2024026353A1 US 20240026353 A1 US20240026353 A1 US 20240026353A1 US 202118017276 A US202118017276 A US 202118017276A US 2024026353 A1 US2024026353 A1 US 2024026353A1
Authority
US
United States
Prior art keywords
modified
oligomeric compound
modified oligonucleotide
nucleosides
certain embodiments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US18/017,276
Other languages
English (en)
Inventor
Paymaan Jafar-nejad
Huynh-Hoa Bui
Susan M. Freier
Frank Rigo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to US18/017,276 priority Critical patent/US20240026353A1/en
Assigned to IONIS PHARMACEUTICALS, INC. reassignment IONIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: RIGO, FRANK, JAFAR-NEJAD, Paymaan, BUI, HUYNH-HOA, FREIER, SUSAN M.
Publication of US20240026353A1 publication Critical patent/US20240026353A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525—MOE, methoxyethoxy

Definitions

  • Such compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA in a cell or subject, and in certain instances reducing the amount of SCN2A protein in a cell or subject.
  • Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a disease or disorder associated with a voltage-gated sodium channel protein, such as, for example, a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder.
  • symptoms and hallmarks include, but are not limited to seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
  • the human gene SCN2A encodes human SCN2A protein, the alpha-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual diseases and disorders, such as Developmental and Epileptic Encephalopathies (DEE), including Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, and Benign Familial Neonatal-Infantile Seizures (BFNIS); mutations in SCN2A are also associated with intellectual disability (ID) and/or autism spectrum disorder (ASD), with or without seizures (Wolff, M., et al., 2019, Epilepsia 60, S59-S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M., et al., 2017, Brain 140, 1316-1336).
  • DEE Developmental and Epileptic Encephalopathies
  • EE Early
  • DEEs include abroad range of diseases that include neonatal and early infantile DEE, for example Ohtahara Syndrome and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy (Wolff, M., et al., 2019; Harkin, L.
  • EIMFS infancy
  • infantile and childhood DEE for example West Syndrome and Lennon-Gastaut Syndrome
  • Dravet Syndrome Idiopathic/Generic Generalized Epilepsies
  • IGE/GGE Idiopathic/Generic Generalized Epilepsies
  • Symptoms and hallmarks associated with DEEs include seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
  • Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019).
  • Symptoms and hallmarks associated with ID and ASD include motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019).
  • the subject has a disease or disorder associated with a voltage-gated sodium channel protein.
  • the voltage-gated sodium channel protein is SCN2A.
  • the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A.
  • the subject has a disease or disorder associated with SCN1A.
  • the subject has a Developmental or Epileptic Encephalopathy; in certain embodiments, the subject has Early Seizure Onset Epileptic Encephalopathy; in certain embodiments, the subject has Late Seizure Onset Epileptic Encephalopathy; in certain embodiments the subject has Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the subject has an intellectual disability (ID); in certain embodiments, the subject has an autism spectrum disorder (ASD); in certain embodiments, the subject has Dravet Syndrome.
  • compounds useful for reducing the amount or activity of SCN2A RNA are oligomeric compounds.
  • compounds useful for reducing the amount or activity of SCN2A RNA are modified oligonucleotides.
  • compounds useful for reducing expression of SCN2A protein are oligomeric compounds.
  • compounds useful for reducing expression of SCN2A protein are modified oligonucleotides.
  • the symptom or hallmark includes seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), and sleep problems.
  • the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
  • 2′-deoxynucleoside means a nucleoside comprising a 2′-H(H) deoxyfuranosyl sugar moiety.
  • a 2′-deoxynucleoside is a 2′- ⁇ -D-deoxynucleoside and comprises a 2′- ⁇ -D-deoxyribosyl sugar moiety, which has the ⁇ -D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2′-MOE means a 2′-OCH 2 CH 2 OCH 3 group in place of the 2′—OH group of a furanosyl sugar moiety.
  • a “2′-MOE sugar moiety” means a sugar moiety with a 2′-OCH 2 CH 2 OCH 3 group in place of the 2′—OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the ⁇ -D-ribosyl configuration. “MOE” means O-methoxyethyl.
  • 2′-MOE nucleoside means a nucleoside comprising a 2′-MOE sugar moiety.
  • 2′-OMe means a 2′-OCH 3 group in place of the 2′—OH group of a furanosyl sugar moiety.
  • a “2′-O-methyl sugar moiety” or “2′-OMe sugar moiety” means a sugar moiety with a 2′-OCH 3 group in place of the 2′-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the ⁇ -D-ribosyl configuration.
  • 2′-OMe nucleoside means a nucleoside comprising a 2′-OMe sugar moiety.
  • 2′-substituted nucleoside means a nucleoside comprising a 2′-substituted sugar moiety.
  • 2′-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methyl cytosine is a modified nucleobase.
  • administering means providing a pharmaceutical agent to a subject.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease or reduction in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
  • An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
  • Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
  • the symptom or hallmark is seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), or sleep problems.
  • the seizures are focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), or frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, or tonic seizures).
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the furanosyl sugar moiety is a ribosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
  • Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of a another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G).
  • Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotide or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • cEt means a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH 3 )—O-2′, and wherein the methyl group of the bridge is in the S configuration.
  • a “cEt sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH 3 )—O-2′, and wherein the methyl group of the bridge is in the S configuration.
  • cEt means constrained ethyl.
  • cEt nucleoside means a nucleoside comprising a cEt modified sugar moiety.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • chirally controlled in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
  • deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2′- ⁇ -D-deoxynucleosides.
  • each nucleoside is selected from a 2′- ⁇ -D-deoxynucleoside, a bicyclic nucleoside, and a 2′-substituted nucleoside.
  • a deoxy region supports RNase H activity.
  • a deoxy region is the gap or internal region of a gapmer.
  • gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
  • the internal region is a deoxy region.
  • the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5′-end of the internal region.
  • each nucleoside of the gap is a 2′- ⁇ -D-deoxynucleoside.
  • the gap comprises one 2′-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2′- ⁇ -D-deoxynucleosides.
  • MOE gapmer indicates a gapmer having a gap comprising 2′- ⁇ -D-deoxynucleosides and wings comprising 2′-MOE nucleosides.
  • the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • internucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
  • modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage.
  • Phosphorothioate internucleoside linkage or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • LNA means locked nucleic acid.
  • An “LNA sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a furanosyl sugar moiety, wherein the bridge has the formula of 4′-CH 2 —O-2′.
  • LNA means locked nucleic acid.
  • the furanosyl sugar moiety is a ribosyl sugar moiety.
  • LNA nucleoside means a nucleoside comprising a LNA sugar moiety.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
  • nucleoside means a compound or a fragment of a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof.
  • conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • reducing the amount,” “reducing the activity,” “decreasing the amount,” or “decreasing the activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
  • the term RNAi compound excludes antisense compounds that act through RNase H.
  • oligonucleotide that at least partially hybridizes to itself.
  • standard in vitro assay means the assay described in Example 1 and reasonable variations thereof.
  • standard in vivo assay means the assay described in Example 8 and reasonable variations thereof.
  • stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
  • subject means a human or non-human animal. In certain embodiments, the subject is a human.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2′-OH(H) ⁇ -D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) ⁇ -D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • a hallmark is apparent on a brain MRI scan.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject.
  • a therapeutically effective amount improves a symptom or hallmark of a disease or disorder.
  • treating means improving a subject's disease or disorder by administering an oligomeric agent or oligomeric compound described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 2 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 16-2531, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 3 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2532-2539, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 4 The oligomeric compound of any of embodiments 1 to 3, wherein the modified oligonucleotide is at least 90% complementary to an equal length portion of SEQ ID NO: 2 and is not more than 50% complementary to an equal length portion of SEQ ID NO: 1.
  • Embodiment 5 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
  • Embodiment 6 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
  • Embodiment 7 The oligomeric compound of any of embodiments 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2487, 2493, 2510, or 2514.
  • Embodiment 8 The oligomeric compound of any of embodiments 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of SEQ ID NO: 2534.
  • Embodiment 9 The oligomeric compound of any of embodiments 1-8, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 10 The oligomeric compound of embodiment 9 wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to
  • Embodiment 11 The oligomeric compound of any of embodiments 1-10, wherein the nucleobase sequence of the modified oligonucleotide is no more than 50%, no more than 60%, no more than 70%, no more than 80%, no more than 90%, or no more than 95% complementary to an exonic region of the nucleobase sequence of SEQ ID NO: 2.
  • Embodiment 12 The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to
  • Embodiment 13 The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides.
  • Embodiment 14 The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
  • Embodiment 15 The oligomeric compound of embodiment 14, wherein the modified oligonucleotide consists of 20 linked nucleosides.
  • Embodiment 16 The oligomeric compound of embodiment 14, wherein the modified oligonucleotide consists of 18 linked nucleosides.
  • Embodiment 17 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
  • Embodiment 18 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 19 The oligomeric compound of embodiment 18, wherein the bicyclic sugar moiety comprises a 4′-2′ bridge, wherein the 4′-2′ bridge is selected from —CH 2 —O—; and —CH(CH 3 )—O—.
  • Embodiment 20 The oligomeric compound of any of embodiments 17-19, wherein the modified oligonucleotide does not comprise more than six bicyclic sugar moieties.
  • Embodiment 21 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.
  • Embodiment 22 The oligomeric compound of any of embodiments 17-20, wherein the modified oligonucleotide does not comprise more than six LNA sugar moieties.
  • Embodiment 23 The oligomeric compound of any of embodiments 17-21, wherein the modified oligonucleotide does not comprise a LNA sugar moiety.
  • Embodiment 24 The oligomeric compound of any of embodiments 17-23, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
  • Embodiment 25 The oligomeric compound of embodiment 24, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety or a 2′-OMe sugar moiety.
  • Embodiment 26 The oligomeric compound of any of embodiments 17-25, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 27 The oligomeric compound of embodiment 26, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 29 The oligomeric compound of any of embodiments 1-28, wherein the modified oligonucleotide comprises:
  • Embodiment 30 The oligomeric compound of any of embodiments 1-28, wherein the modified oligonucleotide comprises:
  • Embodiment 31 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises: a 5′-region consisting of 5 linked 5′-region nucleosides;
  • Embodiment 32 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 33 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 34 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 35 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 36 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 37 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 38 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 39 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 40 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 41 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 42 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 43 The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one bicyclic nucleoside.
  • Embodiment 44 The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a bicyclic nucleoside.
  • Embodiment 45 The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a LNA nucleoside.
  • Embodiment 46 The oligomeric compound of any of embodiments 1-45, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
  • Embodiment 47 The oligomeric compound of embodiment 46, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 48 The oligomeric compound of embodiment 46 or embodiment 47, wherein each internucleoside linkage is a modified internucleoside linkage.
  • Embodiment 49 The oligomeric compound of embodiment 48, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 50 The oligomeric compound of any of embodiments 46-47, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
  • Embodiment 51 The oligomeric compound of any of embodiments 1-46, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
  • Embodiment 52 The oligomeric compound of any of embodiments 1-47 or 50-51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.
  • Embodiment 54 The oligomeric compound of any of embodiments 1-53, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 55 The oligomeric compound of embodiment 54, wherein the modified nucleobase is a 5-methyl cytosine.
  • Embodiment 56 The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound is capable of reducing the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay.
  • Embodiment 57 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es m C eo A eo T eo A eo A ds T ds m C ds m C ds m C ds A ds T ds T ds A eo m C eo A es A es A e (SEQ ID NO: 2493), wherein:
  • Embodiment 58 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 59 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 60 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 61 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 62 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 63 The oligomeric compound of any of embodiments 1-62 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 64 The oligomeric compound of any of embodiments 1-63, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.
  • Embodiment 65 The oligomeric compound of any of embodiments 1-64, consisting of the modified oligonucleotide.
  • Embodiment 66 The oligomeric compound of any of embodiments 1-62, wherein the modified oligonucleotide is an RNAi compound.
  • Embodiment 67 The oligomeric compound of any of embodiments 1-66, further comprising a conjugate group.
  • Embodiment 68 The oligomeric compound of embodiment 67, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
  • Embodiment 69 The oligomeric compound of embodiment 68, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
  • Embodiment 70 The oligomeric compound of embodiment 68, wherein the conjugate linker consists of a single bond.
  • Embodiment 71 The oligomeric compound of embodiment 68, wherein the conjugate linker is cleavable.
  • Embodiment 72 The oligomeric compound of embodiment 68, wherein the conjugate linker comprises 1-3 linker-nucleosides.
  • Embodiment 73 The oligomeric compound of any of embodiments 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
  • Embodiment 74 The oligomeric compound of any of embodiments 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
  • Embodiment 75 The oligomeric compound of any of embodiments 1-74 further comprising a terminal group.
  • Embodiment 76 The oligomeric compound of any of embodiments 1-71 or 73-75, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 77 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 78 The modified oligonucleotide of embodiment 77, which is the sodium salt or the potassium salt.
  • Embodiment 79 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 80 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 81 The modified oligonucleotide of embodiment 80, which is the sodium salt or the potassium salt.
  • Embodiment 82 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 83 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 84 The modified oligonucleotide of embodiment 83, which is the sodium salt or the potassium salt.
  • Embodiment 85 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 86 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 87 The modified oligonucleotide of embodiment 86, which is the sodium salt or the potassium salt.
  • Embodiment 88 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 89 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 90 The modified oligonucleotide of embodiment 89, which is the sodium salt or the potassium salt.
  • Embodiment 91 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 92 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 93 The modified oligonucleotide of embodiment 92, which is the sodium salt or the potassium salt.
  • Embodiment 94 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 95 A chirally enriched population of oligomeric compounds of any of embodiments 1-76 or modified oligonucleotides of any of embodiments 77-94, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
  • Embodiment 96 The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
  • Embodiment 97 The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.
  • Embodiment 98 The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 99 The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 100 The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
  • Embodiment 101 The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.
  • Embodiment 102 A population of oligomeric compounds of any of embodiments 1-76 or modified oligonucleotides of any of embodiments 77-94, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 103 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-76.
  • Embodiment 104 The oligomeric duplex of embodiment 103, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 105 An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound of any of embodiments 1-76 or a modified oligonucleotide of any of embodiments 77-94.
  • Embodiment 106 The antisense agent of embodiment 103, wherein the antisense agent is an oligomeric duplex of embodiment 103 or embodiment 104.
  • Embodiment 107 The antisense agent of embodiment 105 or embodiment 106, wherein the antisense agent is:
  • Embodiment 108 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, or an antisense agent of any of embodiments 105-107, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 109 The pharmaceutical composition of embodiment 108, comprising a pharmaceutically acceptable diluent and wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).
  • aCSF artificial CSF
  • PBS phosphate-buffered saline
  • Embodiment 110 The pharmaceutical composition of embodiment 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and aCSF.
  • Embodiment 111 The pharmaceutical composition of embodiment 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and PBS.
  • Embodiment 112. A pharmaceutical composition comprising a modified oligonucleotide of any of embodiments 77-94 and a pharmaceutically acceptable diluent.
  • Embodiment 113 The pharmaceutical composition of embodiment 112, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
  • aCSF artificial cerebrospinal fluid
  • PBS phosphate-buffered saline
  • Embodiment 114 The pharmaceutical composition of embodiment 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF.
  • Embodiment 115 The pharmaceutical composition of embodiment 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
  • Embodiment 116 A method comprising administering to a subject an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115.
  • Embodiment 117 A method of treating a disease or disorder associated with a voltage-gated sodium channel protein, comprising administering to a subject having or at risk for developing the disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby treating the disease or disorder associated with a voltage-gated sodium channel protein.
  • Embodiment 118 A method of reducing the amount of SCN2A protein in the CSF of a subject having or at risk for developing a disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A protein in the CSF.
  • Embodiment 119 The method of embodiment 117 or embodiment 118, wherein the disease or disorder is a neurodevelopmental disease.
  • Embodiment 120 The method of embodiment 117 or embodiment 118, wherein the disease or disorder is associated with SCN1A or SCN2A.
  • Embodiment 121 A method of treating a disease or disorder associated with SCN2A, comprising administering to an subject having or at risk for developing a disease or disorder associated with SCN2A a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby treating the disease or disorder associated with SCN2A.
  • Embodiment 122 The method of embodiment 121, wherein the disease or disorder associated with SCN2A is a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder.
  • Embodiment 123 The method of embodiment 122, wherein the Developmental and Epileptic Encephalopathy is any of Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, or Benign Familial Neonatal-Infantile Seizures.
  • EE Early Seizure Onset Epileptic Encephalopathy
  • Late Seizure Onset Epileptic Encephalopathy or Benign Familial Neonatal-Infantile Seizures.
  • Embodiment 124 The method of embodiment 121, wherein the disease or disorder associated with SCN2A is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • the disease or disorder associated with SCN2A is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • Embodiment 125 The method of any of embodiments 118-120, wherein the disease or disorder is associated with SCN1A.
  • Embodiment 126 The method of embodiment 125, wherein the disease or disorder associated with SCN1A is a Developmental and Epileptic Encephalopathy.
  • Embodiment 127 The method of embodiment 125 or embodiment 126, wherein the Developmental and Epileptic Encephalopathy is Dravet Syndrome.
  • Embodiment 128 The method of embodiment 126 or embodiment 127, wherein the Developmental and Epileptic Encephalopathy is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • the Developmental and Epileptic Encephalopathy is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • Embodiment 129 The method of any of embodiments 117-128, wherein at least one symptom or hallmark of the disease or disorder is ameliorated.
  • Embodiment 130 The method of embodiment 129, wherein the symptom or hallmark is seizures.
  • Embodiment 131 The method of any of embodiment 130, wherein the seizures are any of focal, clonic, tonic, generalized tonic and clonic, convulsive, myoclonic, absence, or obtundation status.
  • Embodiment 132 The method of embodiment 130, wherein the seizures are any of focal, clonic, tonic, or generalized tonic.
  • Embodiment 133 The method of embodiment 129, wherein the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, or sudden unexpected death in epilepsy.
  • Embodiment 134 The method of embodiment 129, wherein the symptom or hallmark is any of motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disoders, sleep problems, or seizures.
  • Embodiment 135. The method of any of embodiments 130-134, wherein the seizures are frequent or prolonged.
  • Embodiment 136 The method of any of embodiments 116-135 wherein administering the modified oligonucleotide reduces seizures, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements, or sleep problems, or delays death in the subject.
  • Embodiment 137 The method of any of embodiments 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system or systemically.
  • Embodiment 138 The method of any of embodiments 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system and systemically.
  • Embodiment 139 The method of any of embodiments 111-131, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered by any of intrathecally, systemically, subcutaneously, or intramuscularly.
  • Embodiment 140 The method of any of embodiments 116-139, wherein the subject is human.
  • Embodiment 141 A method of reducing the amount of SCN2A RNA in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A RNA in the cell.
  • Embodiment 142 A method of reducing the amount of SCN2A protein in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A protein in the cell.
  • Embodiment 143 The method of embodiment 141 or embodiment 142, wherein the cell is a cortical cell, a hippocampal cell, or a spinal cord cell.
  • Embodiment 144 The method of any of embodiments 141-143, wherein the cell is in an animal.
  • Embodiment 145 The method of any of embodiments 141-144, wherein the cell is a human cell.
  • Embodiment 146 Use of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115 for reducing SCN2A expression in a cell.
  • Embodiment 147 The use of embodiment 146, wherein the level of SCN2A RNA in the cell is reduced.
  • Embodiment 148 The use of embodiment 146 or embodiment 147, wherein the level of SCN2A protein in the cell is reduced.
  • Embodiment 149 The use of any of embodiments 146-148, wherein the cell is a corical cell, a hippocampal cell, or a spinal cord cell.
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions.
  • one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
  • 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH 3 (“OMe” or “O-methyl”), and 2′-O(CH 2 ) 2 OCH 3 (“MOE” or “O-methoxyethyl”).
  • 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, O—C 1 -C 10 alkyl, O—C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or
  • these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 ) 3 NH 2 , CH 2 CH ⁇ CH 2 , OCH 2 CH ⁇ CH 2 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamide (OCH 2 C( ⁇ O)—N(R m )(R n )), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C( ⁇ O)—N(H)CH 3 (“NMA”).
  • a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C( ⁇ O)—N(H)CH 3 (“NMA”).
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2′-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring ⁇ -D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2′-modified sugar moiety has an additional stereocenter at the 2′-position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • 2′-modified sugar moieties described herein are in the ⁇ -D-ribosyl isomeric configuration unless otherwise specified.
  • Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN).
  • BNAs bicyclic nucleosides
  • CNN conformationally restricted nucleotides
  • the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms.
  • the furanose ring is a ribose ring.
  • 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH 2 -2′, 4′-(CH 2 ) 2 -2′, 4′-(CH 2 ) 3 -2′, 4′-CH 2 —O-2′ (“LNA”), 4′-CH 2 —S-2′, 4′-(CH 2 ) 2 —O-2′ (“ENA”), 4′-CH(CH 3 )—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH 2 —O—CH 2 -2′, 4′-CH 2 —N(R)-2′, 4′-CH(CH 2 OCH 3 )—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R b is, independently, H, a protecting group, or C 1 -C 12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).
  • such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R a )(R b )] n —, —[C(R a )(R b )] n O—, —C(R a ) ⁇ C(R b )—, —C(R a ) ⁇ N—, —C( ⁇ NR a )—, —C( ⁇ O)—, —C( ⁇ S)—, —O—, —Si(R a ) 2 —, —S( ⁇ O) x —, and —N(R a )—;
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the ⁇ -L configuration or in the ⁇ -D configuration.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • TTP tetrahydropyrans
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“NINA”) (see, e.g., Leumann, CJ. Bioorg . & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • modified THP nucleosides are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q are each H.
  • At least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and g 7 is methyl.
  • modified THP nucleosides are provided wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modified morpholinos.”
  • sugar surrogates comprise acyclic moieties.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C ⁇ C—CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyla
  • nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No.
  • nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.
  • the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (“P(O 2 ) ⁇ O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P(O 2 ) ⁇ S”), and phosphorodithioates (“HS—P ⁇ S”).
  • Non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH 2 —N(CH 3 )—O—CH 2 —), thiodiester, thionocarbamate (—O—C( ⁇ O)(NH)—S—); siloxane (—O—SiH 2 —O—); and N,N′-dimethylhydrazine (—CH 2 —N(CH 3 )—N(CH 3 )—).
  • Modified internucleoside linkages compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
  • internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate internucleoside linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 2003, 125, 8307, Wan et al. Nuc. Acid. Res., 2014, 42, 13456, and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH 2 —N(CH 3 )—O-5′), amide-3 (3′-CH 2 —C( ⁇ O)—N(H)-5′), amide-4 (3′-CH 2 —N(H)—C( ⁇ O)-5′), formacetal (3′-O—CH 2 —O-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH 2 —O—5′).
  • Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research ; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety.
  • at least six nucleosides of the gap of a gapmer comprise a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a 2′-OMe sugar moiety.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction comprise 2′-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
  • at least six nucleosides of the gap of a gapmer comprise a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2′-deoxyribosyl sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
  • each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified oligonucleotide comprises the same 2′-modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing].
  • a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-wing, 10 linked 2′- ⁇ -D-deoxynucleosides in the gap, and 5 linked 2′-MOE nucleosides in the 3′-wing.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′- ⁇ -D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing.
  • a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked 2′- ⁇ -D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing.
  • a mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.
  • a 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-8-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers.
  • modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2′-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
  • modified oligonucleotides have the following sugar motif (5′ to 3′): eeeeedyddddddddddeeeee, eeeeedddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeeee, eeeeddddddddeeeeee, eeeeedddddddeeeee, wherein ‘d’ represents a 2′-deoxyribosyl sugar moiety, ‘e’ represents a 2′-MOE sugar moiety, and ‘y’ represents a 2′-OMe sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of the nucleoside is a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
  • oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
  • each internucleoside linking group is a phosphodiester internucleoside linkage (P ⁇ O).
  • each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P ⁇ S).
  • each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage.
  • each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified.
  • some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages.
  • the terminal internucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer
  • the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
  • all of the phosphorothioate internucleoside linkages are stereorandom.
  • all of the phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
  • modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sooossssssssssssss, soooosssssssssooss, sooooosssssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssssooss, or sooosssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16
  • modified oligonucleotides are incorporated into a modified oligonucleotide.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif.
  • such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for ⁇ -D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both ⁇ -D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, car
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • a conjugate moiety is attached to an oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieties, which are sub-units making up a conjugate linker.
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside linkage.
  • the cleavable moiety is 2′-deoxyadenosine.
  • a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
  • conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5′-phosphate.
  • Stabilized 5′-phosphates include, but are not limited to 5′-phosphonates, including, but not limited to 5′-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2′-linked nucleosides.
  • the 2′-linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target nucleic acid is a mature mRNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5′-end of the gap region.
  • the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5′-end of the 5′ wing region or the 3′ wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is an SCN2A nucleic acid.
  • the SCN2A nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000).
  • contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN1A protein in a cell.
  • contacting a cell with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN2A protein in a cell.
  • the cell is in vitro.
  • the cell is in a subject.
  • the oligomeric compound consists of a modified oligonucleotide.
  • contacting a cell in a subject with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 ameliorates one or more symptoms or hallmarks of a disease or disorder associated with a voltage-gated sodium channel protein.
  • the voltage-gated sodium channel protein is SCN2A.
  • the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A
  • the subject has a disease or disorder associated with SCN1A.
  • the disease or disorder is a Developmental or Epileptic Encephalopathy, such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the disease or disorder is an intellectual disability or an autism spectrum disorder; in certain embodiments, the disease or disorder is Dravet Syndrome.
  • Developmental or Epileptic Encephalopathy such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures
  • the disease or disorder is an intellectual disability or an autism spectrum disorder
  • the disease or disorder is Dravet Syndrome.
  • the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, and sleep problems.
  • the seizures are any of focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
  • an oligomeric compound complementary to SCN2A RNA in vivo is capable of reducing the detectable amount of SCN2A RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • oligomeric compounds do not comprise a bicyclic sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, oligomeric compounds do not comprise a LNA sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”).
  • artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.
  • a dose may be in the form of a dosage unit.
  • a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
  • the free acid is in equilibrium with anionic and salt forms.
  • the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
  • a modified oligonucleotide or an oligomeric compound may be partially or fully de-protonated and in association with Na+ ions.
  • the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose.
  • a dose, or dosage unit, of 10 mg of Compound No. 1348259 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No.
  • an oligomeric compound comprises a conjugate group
  • the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
  • Compound No. 1348259 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5′ to 3′) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 6-15 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348259 is represented b the following chemical notation:
  • Compound No. 1348259 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348259 is represented by the following chemical structure:
  • Compound No. 1348289 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CACGACATATTTTTCTACAC (SEQ ID NO: 2514), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348289 is represented by the following chemical notation: mCesAeomCeoGeoAeomCeoAdsTdsAdsTdsTdsTdsTdsmCdsTdsAeomCesAesmCe (SEQ ID NO: 2514), wherein:
  • Compound No. 1348289 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348289 is represented by the following chemical structure:
  • Compound No. 1348290 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 2510), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348290 is represented by the following chemical notation:
  • Compound No. 1348290 is represented by the following chemical structure:
  • Structure 5 Compound No. 1348290
  • the sodium salt of Compound No. 1348290 is represented by the following chemical structure:
  • Compound No. 1348331 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348331 is represented by the following chemical notation:
  • Compound No. 1348331 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348331 is represented by the following chemical structure:
  • Compound No. 1348347 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348347 is represented by the following chemical notation:
  • Compound No. 1348347 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348347 is represented by the following chemical structure:
  • Compound No. 1348937 is characterized as a 5-8-5 MOE gapmer having a sequence (from 5′ to 3′) of CTGCATGTAACCTTTATA (SEQ ID NO: 2534), wherein each of nucleosides 1-5 and 14-18 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 6-13 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 14 to 15 and 15 to 16 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348937 is represented by the following chemical notation:
  • Compound No. 1348937 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348937 is represented by the following chemical structure:
  • nucleobases in the ranges specified below comprise a hotspot region of SCN2A nucleic acid.
  • modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 69.9% or greater reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 59% or greater reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, and 2526 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve at least 53% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 69.9% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 77.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 63.2% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, and 2521 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 1348303, 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 1348375, 1348376, 1348377, 1348381, 1348382, 1348383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO
  • modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve at least 75% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 81.6% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 76.6% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 67.2% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 243124-243204 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, and 2527 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 71.4% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.3% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.5% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 243917-244073 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, and 2537 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 1348332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 1348420, 1348421, 1348427, 1348428, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937, and 1348938 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve at least 80% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 80.5% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 67.7% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 62.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, and 2522 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 910019, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 1348269, 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve at least 27% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 71.1% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 63.4% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 59.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, and 2539 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 89% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 74.8% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 67.8% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • the ranges described in the table below comprise hotspot regions.
  • Each hotspot region begins with the nucleobase of SEQ ID NO:2 identified in the “Start Site SEQ ID NO: 2” column and ends with the nucleobase of SEQ ID NO: 2 identified in the “Stop Site SEQ ID NO: 2” column.
  • modified oligonucleotides are complementary to an equal length portion within any of the hotspot regions 1-17, as defined in the table below. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequence of compounds listed in the “Compound IDs in range” column in the table below are complementary to SEQ ID NO: 2 within the specified hotspot region.
  • nucleobase sequence of the oligonucleotides listed in the “SEQ ID NOs in range” column in the table below are complementary to the target sequence, SEQ ID NO: 2, within the specified hotspot region.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve at least “Min.% Red. in vitro” (minimum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg.% Red. in vitro” (average % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve a maximum of “Max. % Red. in vitro” (maximum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Cortex” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in cortical tissue, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Spinal” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in spinal cord tissue, as indicated in the table below. “n.d.” indicates that no in vivo data is available for compounds within that range. In other cases, average reduction in vivo includes a subset of the compounds in any given hotspot, as not all compounds were tested in vivo.
  • Comparator Compound No. 1506060 was selected as a comparator compound in the experiment described in Example 4 of the instant specification.
  • Comparator Compound No. 1506060 previously described in WO2020/041348, incorporated herein by reference, is a 4-8-4 LNA gapmer with the sequence (from 5′ to 3′) TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ and 3′ wing segments each consist of four LNA modified nucleosides, and each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • compounds described herein are more tolerable relative to Comparator Compound No. 1506060.
  • Comparator Compound No. 1506060 had a 3-hour FOB of 6.00 in mice, whereas Compound Nos. 1348290, 1348331, and 1348347 each had a 3-hour FOB of 0.00 in mice, and Compound Nos. 1348259, 1348289, and 1348937 each had a 3-hour FOB of 0 or 1.00 in mice. Therefore, certain compounds described herein are more tolerable than Comparator Compound No. 1506060 in this assay.
  • RNA nucleoside comprising a 2′-OH sugar moiety and a thymine base
  • RNA methylated uracil
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or ⁇ such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures.
  • Oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which chirality of the phosphorothioate internucleoside linkages is controlled or is random.
  • compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Modified Oligonucleotides Complementary to Human SCN2A Nucleic Acid were Designed and Tested for their single dose effects on SCN2A RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides and the 5′ and 3′ wing segments each consists of five 2′-MOE modified nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeedddddddddddeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar, and ‘e’ represents a 2′-MOE sugar moiety.
  • the internucleoside linkage motif for the gapmers is (from 5′ to 3′): soooossssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to either human SCN2A mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or the human SCN2A genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SCN2A RNA levels were measured by Human primer probe set RTS36041 (forward sequence CCTTGAACCTGAAGCCTGTT, designated herein as SEQ ID NO: 10; reverse sequence CGAACCAATTGTGCTCCACTA, designated herein as SEQ ID NO: 11; probe sequence TTCCACCAGAGTTTCCCTTTGCCT, designated herein as SEQ ID NO: 12).
  • SCN2A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA amount relative to the amount in untreated control cells (% control). Each table represents results from an individual assay plate. The values marked with an “T” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Modified oligonucleotides selected from Example 1 above were tested at various doses in SH-SY5Y cells.
  • Cultured SH-SY5Y cells at a density of 20,000 cells perwell were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • SCN2A RNA levels were measured by quantitative real-time RTPCR.
  • Human SCN2A primer-probe set RTS36041 (described herein in Example 1) was used to measure RNA levels as described above.
  • SCN2A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. 0.0 Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control).
  • IC 50 half maximal inhibitory concentration
  • Modified oligonucleotides complementary to a human SCN2A nucleic acid were designed, as described in the tables below.
  • “Start site” in the tables below indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • the modified oligonucleotides in Table 51 are 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides and the 5′ and 3′ wing segments each consists of five 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeedddddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 52 below are 6-10-4 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of six 2′-MOE nucleosides, and the 3′ wing segment consists of four 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddddeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooooosssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 53 below are 4-10-6 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of four 2′-MOE nucleosides, and the 3′ wing segment consists of six 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeedddddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooossssssssoooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 54 below are 4-8-6 MOE gapmers.
  • the gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of four 2′-MOE nucleosides, and the 3′ wing segment consists of six 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeedddddddddeeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): soosssssssoooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 55 below are 6-8-4 MOE gapmers.
  • the gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of six 2′-MOE nucleosides, and the 3′ wing segment consists of four 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddeeee; wherein ‘d’ represents a 2′-N-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 56 below are 5-8-5 MOE gapmers.
  • the gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of five 2′-MOE nucleosides, and the 3′ wing segment consists of five 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeedddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooosssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • Modified oligonucleotides described above were tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides. Additionally, Comparator Compound No. 1506060 was tested. Wild-type female C57/B16 mice each received a single ICV dose of 700 ⁇ g of modified oligonucleotide as listed in the tables below. Each treatment group consisted of 3 mice. A group of 4 mice received PBS as a negative control for each experiment (identified in separate tables below). At 3 hours post-injection, mice were evaluated according to seven different criteria.
  • the criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing.
  • a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group.
  • Modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides.
  • Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of modified oligonucleotide listed in the tables below.
  • Each treatment group consisted of 3-4 rats.
  • a group of 4 rats received PBS as a negative control for each experiment (identified in separate tables below).
  • movement in 7 different parts of the body were evaluated for each rat.
  • the 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head.
  • each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed (the functional observational battery score or FOB). After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group.
  • a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1.
  • the scores were averaged for each treatment group, and presented in the tables below. Values marked with the symbol “ ⁇ ” indicate groups that had 3 or fewer animals in the group.
  • Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells.
  • Cultured SH-SY5Y cells at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • SCN2A RNA levels were measured by quantitative real-time RTPCR.
  • Human SCN2A primer-probe set RTS36041 (described herein above) was used to measure RNA levels.
  • SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH.
  • SCN2A RNA Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control). The results for each separate experiment are presented in separate tables below.
  • IC 50 half maximal inhibitory concentration
  • Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells.
  • Cultured SH-SY5Y cells at a density of 35,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • SCN2A RNA levels were measured by quantitative real-time RTPCR.
  • Human SCN2A primer-probe set RTS36041 (described herein above) was used to measure RNA levels.
  • SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH.
  • SCN2A RNA Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control).
  • IC 50 half maximal inhibitory concentration
  • Transgenic mice that express a human SCN2A transcript were generated in a C57Bl/6 background.
  • Transgenic mice may be prepared and are available from commercial and academic research facilities; for examples of transgenic mice that express human neurological genes see, for example, Heintz et al., 2002, Nature reviews Neuroscience 2, 861-870.
  • Human SCN2A transgenic mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 350 ⁇ g of modified oligonucleotide. A group of 4 mice received PBS as a negative control.
  • mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RTPCR analysis to measure the amount of SCN2A RNA using Human primer probe set RTS36041 (described in Example 1 above). Results are presented as percent human SCN2A RNA relative to the amount in PBS treated animals, normalized to mouse GAPDH RNA (% control).
  • Mouse GAPDH RNA was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 13; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 14; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 15).
  • mice Human SCN2A transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses indicated in tables below. A group of 8 mice received PBS as a negative control.
  • mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from the cortex and spinal cord for quantitative real-time RTPCR analysis of RNA expression of SCN2A using primer probe set RTS36041 (described herein in Example 1). Results are presented as percent human SCN2A RNA relative to the amount in PBS treated animals, normalized to mouse GAPDH RNA.
  • Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (described herein above).
  • the half maximal effective dose (ED 50 ) of each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Saccharide Compounds (AREA)
  • Liquid Crystal Substances (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US18/017,276 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a Abandoned US20240026353A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/017,276 US20240026353A1 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202063063120P 2020-08-07 2020-08-07
US18/017,276 US20240026353A1 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a
PCT/US2021/044887 WO2022032060A2 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/044887 A-371-Of-International WO2022032060A2 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/483,663 Continuation US12227746B2 (en) 2020-08-07 2023-10-10 Compounds and methods for modulating SCN2A

Publications (1)

Publication Number Publication Date
US20240026353A1 true US20240026353A1 (en) 2024-01-25

Family

ID=80118566

Family Applications (3)

Application Number Title Priority Date Filing Date
US18/017,276 Abandoned US20240026353A1 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a
US18/483,663 Active US12227746B2 (en) 2020-08-07 2023-10-10 Compounds and methods for modulating SCN2A
US19/023,239 Pending US20250270556A1 (en) 2020-08-07 2025-01-15 Compounds and methods for modulating scn2a

Family Applications After (2)

Application Number Title Priority Date Filing Date
US18/483,663 Active US12227746B2 (en) 2020-08-07 2023-10-10 Compounds and methods for modulating SCN2A
US19/023,239 Pending US20250270556A1 (en) 2020-08-07 2025-01-15 Compounds and methods for modulating scn2a

Country Status (16)

Country Link
US (3) US20240026353A1 (https=)
EP (1) EP4192476A4 (https=)
JP (1) JP7834712B2 (https=)
KR (1) KR20230048052A (https=)
CN (1) CN116322707B (https=)
AU (1) AU2021320384A1 (https=)
BR (1) BR112023002034A2 (https=)
CA (1) CA3186935A1 (https=)
CL (2) CL2023000393A1 (https=)
CO (1) CO2023002128A2 (https=)
EC (1) ECSP23008455A (https=)
IL (1) IL300258A (https=)
MX (1) MX2023001486A (https=)
PE (1) PE20231567A1 (https=)
TW (1) TW202221123A (https=)
WO (1) WO2022032060A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12227746B2 (en) 2020-08-07 2025-02-18 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating SCN2A

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240002852A1 (en) * 2020-10-01 2024-01-04 Ionis Pharmaceuticals, Inc. Compounds for modulating chmp7
CA3219942A1 (en) * 2021-05-10 2022-11-17 Q-State Biosciences, Inc. Compositions targeting sodium channel 1.6
AU2023244348A1 (en) * 2022-03-28 2024-10-10 Praxis Precision Medicines, Inc. Methods of using oligomeric compounds to treat scn2a-related disorders
AU2023348346A1 (en) * 2022-09-30 2025-03-27 Contera Pharma A/S Antisense oligonucleotides for the treatment of canavan disease
WO2025059511A1 (en) * 2023-09-15 2025-03-20 Praxis Precision Medicines, Inc. Elsunersen / prax-222 for use in the treatment of scn2a-related disorders

Family Cites Families (172)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
USRE34036E (en) 1984-06-06 1992-08-18 National Research Development Corporation Data transmission using a transparent tone-in band system
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
DE3788914T2 (de) 1986-09-08 1994-08-25 Ajinomoto Kk Verbindungen zur Spaltung von RNS an eine spezifische Position, Oligomere, verwendet bei der Herstellung dieser Verbindungen und Ausgangsprodukte für die Synthese dieser Oligomere.
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
AU598946B2 (en) 1987-06-24 1990-07-05 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
WO1989009221A1 (en) 1988-03-25 1989-10-05 University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
ATE269870T1 (de) 1989-10-24 2004-07-15 Isis Pharmaceuticals Inc 2'-modifizierte oligonukleotide
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
BR9106702A (pt) 1990-07-27 1993-06-08 Isis Pharmaceuticals Inc Analogo de oligonucleotideos e processos para modular a producao de uma proteina por um organismo e para tratar um organismo
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
ES2083593T3 (es) 1990-08-03 1996-04-16 Sterling Winthrop Inc Compuestos y metodos para inhibir la expresion de genes.
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
CA2092002A1 (en) 1990-09-20 1992-03-21 Mark Matteucci Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5948903A (en) 1991-01-11 1999-09-07 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
AU3222793A (en) 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
AU6449394A (en) 1993-03-30 1994-10-24 Sterling Winthrop Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
CA2159629A1 (en) 1993-03-31 1994-10-13 Sanofi Oligonucleotides with amide linkages replacing phosphodiester linkages
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
EP0733059B1 (en) 1993-12-09 2000-09-13 Thomas Jefferson University Compounds and methods for site-directed mutations in eukaryotic cells
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
AU1039397A (en) 1995-11-22 1997-06-27 Johns Hopkins University, The Ligands to enhance cellular uptake of biomolecules
USRE44779E1 (en) 1997-03-07 2014-02-25 Santaris Pharma A/S Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
EP1178999B1 (en) 1999-05-04 2007-03-14 Santaris Pharma A/S L-ribo-lna analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
EP1252330A2 (en) 1999-11-26 2002-10-30 McGill University Loci for idiopathic generalized epilepsy, mutations thereof and method using same to assess, diagnose, prognose or treat epilepsy
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
US6906182B2 (en) 2000-12-01 2005-06-14 Cell Works Therapeutics, Inc. Conjugates of glycosylated/galactosylated peptide, bifunctional linker, and nucleotidic monomers/polymers, and related compositions and method of use
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030175906A1 (en) 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
WO2003060525A1 (en) 2002-01-17 2003-07-24 Evotec Neurosciences Gmbh Diagnostic and therapeutic use of the voltage-gated ion channel scn2a for neurodegenerative diseases
AU2003268096A1 (en) 2002-08-14 2004-03-03 Pharmacia Corporation ANTISENSE MODULATION OF Nav1.3 EXPRESSION
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
CA2504694C (en) 2002-11-05 2013-10-01 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
EP2305812A3 (en) 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
WO2005027962A1 (en) 2003-09-18 2005-03-31 Isis Pharmaceuticals, Inc. 4’-thionucleosides and oligomeric compounds
EP1752536A4 (en) 2004-05-11 2008-04-16 Alphagen Co Ltd POLYNUCLEOTIDE CAUSING RNA INTERFERENCE AND METHOD OF REGULATING GENE EXPRESSION WITH THE USE OF THE SAME
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
JP5342881B2 (ja) 2006-01-27 2013-11-13 アイシス ファーマシューティカルズ， インコーポレーテッド ６−修飾された二環式核酸類似体
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
WO2008049085A1 (en) 2006-10-18 2008-04-24 Isis Pharmaceuticals, Inc. Antisense compounds
US20100190837A1 (en) 2007-02-15 2010-07-29 Isis Pharmaceuticals, Inc. 5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
CA2692579C (en) 2007-07-05 2016-05-03 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2009023855A2 (en) 2007-08-15 2009-02-19 Isis Pharmaceuticals, Inc. Tetrahydropyran nucleic acid analogs
US8546556B2 (en) 2007-11-21 2013-10-01 Isis Pharmaceuticals, Inc Carbocyclic alpha-L-bicyclic nucleic acid analogs
WO2009082607A2 (en) 2007-12-04 2009-07-02 Alnylam Pharmaceuticals, Inc. Targeting lipids
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
EP2462153B1 (en) 2009-08-06 2015-07-29 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
US10913767B2 (en) 2010-04-22 2021-02-09 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
WO2011163499A2 (en) * 2010-06-23 2011-12-29 Opko Curna, Llc Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna
CA2812046A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. Modified irna agents
US10017764B2 (en) 2011-02-08 2018-07-10 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP3453761A1 (en) 2011-08-29 2019-03-13 Ionis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2014059353A2 (en) 2012-10-11 2014-04-17 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
US10077443B2 (en) 2012-11-15 2018-09-18 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
DK2991656T3 (da) 2013-05-01 2020-03-23 Ionis Pharmaceuticals Inc Sammensætninger og fremgangsmåder til modulering af apolipoprotein c-iii-ekspression
EP3183347A4 (en) 2015-10-17 2018-04-18 Lifesplice Pharma LLC Splice modulating oligonucleotides and methods of use thereof
EP3443001B1 (en) * 2016-04-11 2025-04-30 Obsidian Therapeutics, Inc. REGULATED BIOCIRCUIT SYSTEMS
GB2610100B (en) 2017-10-23 2023-08-16 Stoke Therapeutics Inc Antisense oligomers for treatment of non-sense mediated RNA decay based conditions and diseases
WO2019143831A1 (en) * 2018-01-17 2019-07-25 Rogcon U.R., Inc. Compositions and methods for increasing expression of scn2a
BR112021003224A2 (pt) * 2018-08-20 2021-07-20 Rogcon, Inc. oligonucleotídeos antissentido direcionados a scn2a para o tratamento de encefalopatias por scn1a
AU2020210924A1 (en) * 2019-01-23 2021-09-16 The Florey Institute Of Neuroscience And Mental Health Antisense oligonucleotides targeting SCN2A retained introns
US20220228146A1 (en) 2019-05-06 2022-07-21 The Children's Hospital Of Philadelphia Micro-rna site blocking oligonucleotides for the treatment of epileptic encephalopathy and neurodevelopmental disorders
IL300258A (en) 2020-08-07 2023-03-01 Ionis Pharmaceuticals Inc Compounds and methods for modulating SCN2A

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12227746B2 (en) 2020-08-07 2025-02-18 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating SCN2A

Also Published As

Publication number Publication date
IL300258A (en) 2023-03-01
BR112023002034A2 (pt) 2023-04-04
US12227746B2 (en) 2025-02-18
CN116322707A (zh) 2023-06-23
CO2023002128A2 (es) 2023-03-07
EP4192476A4 (en) 2024-09-18
EP4192476A2 (en) 2023-06-14
MX2023001486A (es) 2023-03-27
AU2021320384A1 (en) 2023-02-16
WO2022032060A3 (en) 2022-03-17
TW202221123A (zh) 2022-06-01
US20250270556A1 (en) 2025-08-28
CL2023000393A1 (es) 2023-09-15
CL2024000541A1 (es) 2024-08-30
ECSP23008455A (es) 2023-05-31
JP7834712B2 (ja) 2026-03-24
CA3186935A1 (en) 2022-02-10
US20240102012A1 (en) 2024-03-28
CN116322707B (zh) 2026-02-03
WO2022032060A2 (en) 2022-02-10
KR20230048052A (ko) 2023-04-10
PE20231567A1 (es) 2023-10-04
JP2023536994A (ja) 2023-08-30

Similar Documents

Publication Publication Date Title
US12350285B2 (en) Compounds and methods for reducing ATXN3 expression
US12227746B2 (en) Compounds and methods for modulating SCN2A
US12129466B2 (en) Compounds and methods for modulating UBE3A-ATS
US20220064637A1 (en) Compounds and methods for reducing atxn3 expression
US20250320505A1 (en) Compounds and Methods for Reducing KCNT1 Expression
US20250297254A1 (en) Compounds and methods for modulating atxn1
US12502402B2 (en) Compounds and methods for modulating GFAP
US20240376469A1 (en) Compounds and methods for modulating huntingtin
US20220243203A1 (en) Compounds and methods for reducing fus expression
US20240279654A1 (en) Compounds for reducing ptbp1 expression
US20230043648A1 (en) Compounds and methods for modulating scn1a expression
US11732263B2 (en) Compounds and methods for modulating PLP1
US20240229042A1 (en) Compounds and methods for reducing kcnt1 expression
US20230124616A1 (en) Compounds and methods for modulating kcnq2
US20260115222A1 (en) Compounds and Methods for Reducing ATXN3 Expression
HK40129490A (en) Compounds and methods for modulating ube3a-ats

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION UNDERGOING PREEXAM PROCESSING

AS Assignment

Owner name: IONIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JAFAR-NEJAD, PAYMAAN;BUI, HUYNH-HOA;FREIER, SUSAN M.;AND OTHERS;SIGNING DATES FROM 20210817 TO 20211008;REEL/FRAME:065211/0885

STCB Information on status: application discontinuation

Free format text: ABANDONED -- INCOMPLETE APPLICATION (PRE-EXAMINATION)