US20240026353A1 - Compounds and methods for modulating scn2a - Google Patents

Compounds and methods for modulating scn2a Download PDF

Info

Publication number
US20240026353A1
US20240026353A1 US18/017,276 US202118017276A US2024026353A1 US 20240026353 A1 US20240026353 A1 US 20240026353A1 US 202118017276 A US202118017276 A US 202118017276A US 2024026353 A1 US2024026353 A1 US 2024026353A1
Authority
US
United States
Prior art keywords
modified
oligomeric compound
modified oligonucleotide
nucleosides
certain embodiments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US18/017,276
Inventor
Paymaan Jafar-nejad
Huynh-Hoa Bui
Susan M. Freier
Frank Rigo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to US18/017,276 priority Critical patent/US20240026353A1/en
Assigned to IONIS PHARMACEUTICALS, INC. reassignment IONIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: RIGO, FRANK, JAFAR-NEJAD, Paymaan, BUI, HUYNH-HOA, FREIER, SUSAN M.
Publication of US20240026353A1 publication Critical patent/US20240026353A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525—MOE, methoxyethoxy

Definitions

  • Such compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA in a cell or subject, and in certain instances reducing the amount of SCN2A protein in a cell or subject.
  • Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a disease or disorder associated with a voltage-gated sodium channel protein, such as, for example, a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder.
  • symptoms and hallmarks include, but are not limited to seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
  • the human gene SCN2A encodes human SCN2A protein, the alpha-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual diseases and disorders, such as Developmental and Epileptic Encephalopathies (DEE), including Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, and Benign Familial Neonatal-Infantile Seizures (BFNIS); mutations in SCN2A are also associated with intellectual disability (ID) and/or autism spectrum disorder (ASD), with or without seizures (Wolff, M., et al., 2019, Epilepsia 60, S59-S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M., et al., 2017, Brain 140, 1316-1336).
  • DEE Developmental and Epileptic Encephalopathies
  • EE Early
  • DEEs include abroad range of diseases that include neonatal and early infantile DEE, for example Ohtahara Syndrome and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy (Wolff, M., et al., 2019; Harkin, L.
  • EIMFS infancy
  • infantile and childhood DEE for example West Syndrome and Lennon-Gastaut Syndrome
  • Dravet Syndrome Idiopathic/Generic Generalized Epilepsies
  • IGE/GGE Idiopathic/Generic Generalized Epilepsies
  • Symptoms and hallmarks associated with DEEs include seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
  • Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019).
  • Symptoms and hallmarks associated with ID and ASD include motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019).
  • the subject has a disease or disorder associated with a voltage-gated sodium channel protein.
  • the voltage-gated sodium channel protein is SCN2A.
  • the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A.
  • the subject has a disease or disorder associated with SCN1A.
  • the subject has a Developmental or Epileptic Encephalopathy; in certain embodiments, the subject has Early Seizure Onset Epileptic Encephalopathy; in certain embodiments, the subject has Late Seizure Onset Epileptic Encephalopathy; in certain embodiments the subject has Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the subject has an intellectual disability (ID); in certain embodiments, the subject has an autism spectrum disorder (ASD); in certain embodiments, the subject has Dravet Syndrome.
  • compounds useful for reducing the amount or activity of SCN2A RNA are oligomeric compounds.
  • compounds useful for reducing the amount or activity of SCN2A RNA are modified oligonucleotides.
  • compounds useful for reducing expression of SCN2A protein are oligomeric compounds.
  • compounds useful for reducing expression of SCN2A protein are modified oligonucleotides.
  • the symptom or hallmark includes seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), and sleep problems.
  • the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
  • 2′-deoxynucleoside means a nucleoside comprising a 2′-H(H) deoxyfuranosyl sugar moiety.
  • a 2′-deoxynucleoside is a 2′- ⁇ -D-deoxynucleoside and comprises a 2′- ⁇ -D-deoxyribosyl sugar moiety, which has the ⁇ -D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2′-MOE means a 2′-OCH 2 CH 2 OCH 3 group in place of the 2′—OH group of a furanosyl sugar moiety.
  • a “2′-MOE sugar moiety” means a sugar moiety with a 2′-OCH 2 CH 2 OCH 3 group in place of the 2′—OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the ⁇ -D-ribosyl configuration. “MOE” means O-methoxyethyl.
  • 2′-MOE nucleoside means a nucleoside comprising a 2′-MOE sugar moiety.
  • 2′-OMe means a 2′-OCH 3 group in place of the 2′—OH group of a furanosyl sugar moiety.
  • a “2′-O-methyl sugar moiety” or “2′-OMe sugar moiety” means a sugar moiety with a 2′-OCH 3 group in place of the 2′-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the ⁇ -D-ribosyl configuration.
  • 2′-OMe nucleoside means a nucleoside comprising a 2′-OMe sugar moiety.
  • 2′-substituted nucleoside means a nucleoside comprising a 2′-substituted sugar moiety.
  • 2′-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methyl cytosine is a modified nucleobase.
  • administering means providing a pharmaceutical agent to a subject.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease or reduction in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
  • An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
  • Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
  • the symptom or hallmark is seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), or sleep problems.
  • the seizures are focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), or frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, or tonic seizures).
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the furanosyl sugar moiety is a ribosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
  • Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of a another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G).
  • Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotide or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • cEt means a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH 3 )—O-2′, and wherein the methyl group of the bridge is in the S configuration.
  • a “cEt sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH 3 )—O-2′, and wherein the methyl group of the bridge is in the S configuration.
  • cEt means constrained ethyl.
  • cEt nucleoside means a nucleoside comprising a cEt modified sugar moiety.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • chirally controlled in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
  • deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2′- ⁇ -D-deoxynucleosides.
  • each nucleoside is selected from a 2′- ⁇ -D-deoxynucleoside, a bicyclic nucleoside, and a 2′-substituted nucleoside.
  • a deoxy region supports RNase H activity.
  • a deoxy region is the gap or internal region of a gapmer.
  • gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
  • the internal region is a deoxy region.
  • the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5′-end of the internal region.
  • each nucleoside of the gap is a 2′- ⁇ -D-deoxynucleoside.
  • the gap comprises one 2′-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2′- ⁇ -D-deoxynucleosides.
  • MOE gapmer indicates a gapmer having a gap comprising 2′- ⁇ -D-deoxynucleosides and wings comprising 2′-MOE nucleosides.
  • the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • internucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
  • modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage.
  • Phosphorothioate internucleoside linkage or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • LNA means locked nucleic acid.
  • An “LNA sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a furanosyl sugar moiety, wherein the bridge has the formula of 4′-CH 2 —O-2′.
  • LNA means locked nucleic acid.
  • the furanosyl sugar moiety is a ribosyl sugar moiety.
  • LNA nucleoside means a nucleoside comprising a LNA sugar moiety.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
  • nucleoside means a compound or a fragment of a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof.
  • conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • reducing the amount,” “reducing the activity,” “decreasing the amount,” or “decreasing the activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
  • the term RNAi compound excludes antisense compounds that act through RNase H.
  • oligonucleotide that at least partially hybridizes to itself.
  • standard in vitro assay means the assay described in Example 1 and reasonable variations thereof.
  • standard in vivo assay means the assay described in Example 8 and reasonable variations thereof.
  • stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
  • subject means a human or non-human animal. In certain embodiments, the subject is a human.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2′-OH(H) ⁇ -D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) ⁇ -D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • a hallmark is apparent on a brain MRI scan.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject.
  • a therapeutically effective amount improves a symptom or hallmark of a disease or disorder.
  • treating means improving a subject's disease or disorder by administering an oligomeric agent or oligomeric compound described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 2 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 16-2531, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 3 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2532-2539, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 4 The oligomeric compound of any of embodiments 1 to 3, wherein the modified oligonucleotide is at least 90% complementary to an equal length portion of SEQ ID NO: 2 and is not more than 50% complementary to an equal length portion of SEQ ID NO: 1.
  • Embodiment 5 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
  • Embodiment 6 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
  • Embodiment 7 The oligomeric compound of any of embodiments 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2487, 2493, 2510, or 2514.
  • Embodiment 8 The oligomeric compound of any of embodiments 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of SEQ ID NO: 2534.
  • Embodiment 9 The oligomeric compound of any of embodiments 1-8, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 10 The oligomeric compound of embodiment 9 wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to
  • Embodiment 11 The oligomeric compound of any of embodiments 1-10, wherein the nucleobase sequence of the modified oligonucleotide is no more than 50%, no more than 60%, no more than 70%, no more than 80%, no more than 90%, or no more than 95% complementary to an exonic region of the nucleobase sequence of SEQ ID NO: 2.
  • Embodiment 12 The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to
  • Embodiment 13 The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides.
  • Embodiment 14 The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
  • Embodiment 15 The oligomeric compound of embodiment 14, wherein the modified oligonucleotide consists of 20 linked nucleosides.
  • Embodiment 16 The oligomeric compound of embodiment 14, wherein the modified oligonucleotide consists of 18 linked nucleosides.
  • Embodiment 17 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
  • Embodiment 18 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 19 The oligomeric compound of embodiment 18, wherein the bicyclic sugar moiety comprises a 4′-2′ bridge, wherein the 4′-2′ bridge is selected from —CH 2 —O—; and —CH(CH 3 )—O—.
  • Embodiment 20 The oligomeric compound of any of embodiments 17-19, wherein the modified oligonucleotide does not comprise more than six bicyclic sugar moieties.
  • Embodiment 21 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.
  • Embodiment 22 The oligomeric compound of any of embodiments 17-20, wherein the modified oligonucleotide does not comprise more than six LNA sugar moieties.
  • Embodiment 23 The oligomeric compound of any of embodiments 17-21, wherein the modified oligonucleotide does not comprise a LNA sugar moiety.
  • Embodiment 24 The oligomeric compound of any of embodiments 17-23, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
  • Embodiment 25 The oligomeric compound of embodiment 24, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety or a 2′-OMe sugar moiety.
  • Embodiment 26 The oligomeric compound of any of embodiments 17-25, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 27 The oligomeric compound of embodiment 26, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 29 The oligomeric compound of any of embodiments 1-28, wherein the modified oligonucleotide comprises:
  • Embodiment 30 The oligomeric compound of any of embodiments 1-28, wherein the modified oligonucleotide comprises:
  • Embodiment 31 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises: a 5′-region consisting of 5 linked 5′-region nucleosides;
  • Embodiment 32 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 33 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 34 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 35 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 36 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 37 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 38 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 39 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 40 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 41 The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
  • Embodiment 42 The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
  • Embodiment 43 The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one bicyclic nucleoside.
  • Embodiment 44 The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a bicyclic nucleoside.
  • Embodiment 45 The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a LNA nucleoside.
  • Embodiment 46 The oligomeric compound of any of embodiments 1-45, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
  • Embodiment 47 The oligomeric compound of embodiment 46, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 48 The oligomeric compound of embodiment 46 or embodiment 47, wherein each internucleoside linkage is a modified internucleoside linkage.
  • Embodiment 49 The oligomeric compound of embodiment 48, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 50 The oligomeric compound of any of embodiments 46-47, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
  • Embodiment 51 The oligomeric compound of any of embodiments 1-46, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
  • Embodiment 52 The oligomeric compound of any of embodiments 1-47 or 50-51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.
  • Embodiment 54 The oligomeric compound of any of embodiments 1-53, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 55 The oligomeric compound of embodiment 54, wherein the modified nucleobase is a 5-methyl cytosine.
  • Embodiment 56 The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound is capable of reducing the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay.
  • Embodiment 57 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es m C eo A eo T eo A eo A ds T ds m C ds m C ds m C ds A ds T ds T ds A eo m C eo A es A es A e (SEQ ID NO: 2493), wherein:
  • Embodiment 58 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 59 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 60 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 61 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 62 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • Embodiment 63 The oligomeric compound of any of embodiments 1-62 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 64 The oligomeric compound of any of embodiments 1-63, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.
  • Embodiment 65 The oligomeric compound of any of embodiments 1-64, consisting of the modified oligonucleotide.
  • Embodiment 66 The oligomeric compound of any of embodiments 1-62, wherein the modified oligonucleotide is an RNAi compound.
  • Embodiment 67 The oligomeric compound of any of embodiments 1-66, further comprising a conjugate group.
  • Embodiment 68 The oligomeric compound of embodiment 67, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
  • Embodiment 69 The oligomeric compound of embodiment 68, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
  • Embodiment 70 The oligomeric compound of embodiment 68, wherein the conjugate linker consists of a single bond.
  • Embodiment 71 The oligomeric compound of embodiment 68, wherein the conjugate linker is cleavable.
  • Embodiment 72 The oligomeric compound of embodiment 68, wherein the conjugate linker comprises 1-3 linker-nucleosides.
  • Embodiment 73 The oligomeric compound of any of embodiments 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
  • Embodiment 74 The oligomeric compound of any of embodiments 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
  • Embodiment 75 The oligomeric compound of any of embodiments 1-74 further comprising a terminal group.
  • Embodiment 76 The oligomeric compound of any of embodiments 1-71 or 73-75, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 77 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 78 The modified oligonucleotide of embodiment 77, which is the sodium salt or the potassium salt.
  • Embodiment 79 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 80 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 81 The modified oligonucleotide of embodiment 80, which is the sodium salt or the potassium salt.
  • Embodiment 82 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 83 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 84 The modified oligonucleotide of embodiment 83, which is the sodium salt or the potassium salt.
  • Embodiment 85 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 86 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 87 The modified oligonucleotide of embodiment 86, which is the sodium salt or the potassium salt.
  • Embodiment 88 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 89 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 90 The modified oligonucleotide of embodiment 89, which is the sodium salt or the potassium salt.
  • Embodiment 91 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 92 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 93 The modified oligonucleotide of embodiment 92, which is the sodium salt or the potassium salt.
  • Embodiment 94 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 95 A chirally enriched population of oligomeric compounds of any of embodiments 1-76 or modified oligonucleotides of any of embodiments 77-94, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
  • Embodiment 96 The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
  • Embodiment 97 The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.
  • Embodiment 98 The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 99 The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 100 The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
  • Embodiment 101 The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.
  • Embodiment 102 A population of oligomeric compounds of any of embodiments 1-76 or modified oligonucleotides of any of embodiments 77-94, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 103 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-76.
  • Embodiment 104 The oligomeric duplex of embodiment 103, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 105 An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound of any of embodiments 1-76 or a modified oligonucleotide of any of embodiments 77-94.
  • Embodiment 106 The antisense agent of embodiment 103, wherein the antisense agent is an oligomeric duplex of embodiment 103 or embodiment 104.
  • Embodiment 107 The antisense agent of embodiment 105 or embodiment 106, wherein the antisense agent is:
  • Embodiment 108 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, or an antisense agent of any of embodiments 105-107, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 109 The pharmaceutical composition of embodiment 108, comprising a pharmaceutically acceptable diluent and wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).
  • aCSF artificial CSF
  • PBS phosphate-buffered saline
  • Embodiment 110 The pharmaceutical composition of embodiment 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and aCSF.
  • Embodiment 111 The pharmaceutical composition of embodiment 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and PBS.
  • Embodiment 112. A pharmaceutical composition comprising a modified oligonucleotide of any of embodiments 77-94 and a pharmaceutically acceptable diluent.
  • Embodiment 113 The pharmaceutical composition of embodiment 112, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
  • aCSF artificial cerebrospinal fluid
  • PBS phosphate-buffered saline
  • Embodiment 114 The pharmaceutical composition of embodiment 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF.
  • Embodiment 115 The pharmaceutical composition of embodiment 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
  • Embodiment 116 A method comprising administering to a subject an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115.
  • Embodiment 117 A method of treating a disease or disorder associated with a voltage-gated sodium channel protein, comprising administering to a subject having or at risk for developing the disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby treating the disease or disorder associated with a voltage-gated sodium channel protein.
  • Embodiment 118 A method of reducing the amount of SCN2A protein in the CSF of a subject having or at risk for developing a disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A protein in the CSF.
  • Embodiment 119 The method of embodiment 117 or embodiment 118, wherein the disease or disorder is a neurodevelopmental disease.
  • Embodiment 120 The method of embodiment 117 or embodiment 118, wherein the disease or disorder is associated with SCN1A or SCN2A.
  • Embodiment 121 A method of treating a disease or disorder associated with SCN2A, comprising administering to an subject having or at risk for developing a disease or disorder associated with SCN2A a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby treating the disease or disorder associated with SCN2A.
  • Embodiment 122 The method of embodiment 121, wherein the disease or disorder associated with SCN2A is a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder.
  • Embodiment 123 The method of embodiment 122, wherein the Developmental and Epileptic Encephalopathy is any of Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, or Benign Familial Neonatal-Infantile Seizures.
  • EE Early Seizure Onset Epileptic Encephalopathy
  • Late Seizure Onset Epileptic Encephalopathy or Benign Familial Neonatal-Infantile Seizures.
  • Embodiment 124 The method of embodiment 121, wherein the disease or disorder associated with SCN2A is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • the disease or disorder associated with SCN2A is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • Embodiment 125 The method of any of embodiments 118-120, wherein the disease or disorder is associated with SCN1A.
  • Embodiment 126 The method of embodiment 125, wherein the disease or disorder associated with SCN1A is a Developmental and Epileptic Encephalopathy.
  • Embodiment 127 The method of embodiment 125 or embodiment 126, wherein the Developmental and Epileptic Encephalopathy is Dravet Syndrome.
  • Embodiment 128 The method of embodiment 126 or embodiment 127, wherein the Developmental and Epileptic Encephalopathy is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • the Developmental and Epileptic Encephalopathy is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • Embodiment 129 The method of any of embodiments 117-128, wherein at least one symptom or hallmark of the disease or disorder is ameliorated.
  • Embodiment 130 The method of embodiment 129, wherein the symptom or hallmark is seizures.
  • Embodiment 131 The method of any of embodiment 130, wherein the seizures are any of focal, clonic, tonic, generalized tonic and clonic, convulsive, myoclonic, absence, or obtundation status.
  • Embodiment 132 The method of embodiment 130, wherein the seizures are any of focal, clonic, tonic, or generalized tonic.
  • Embodiment 133 The method of embodiment 129, wherein the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, or sudden unexpected death in epilepsy.
  • Embodiment 134 The method of embodiment 129, wherein the symptom or hallmark is any of motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disoders, sleep problems, or seizures.
  • Embodiment 135. The method of any of embodiments 130-134, wherein the seizures are frequent or prolonged.
  • Embodiment 136 The method of any of embodiments 116-135 wherein administering the modified oligonucleotide reduces seizures, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements, or sleep problems, or delays death in the subject.
  • Embodiment 137 The method of any of embodiments 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system or systemically.
  • Embodiment 138 The method of any of embodiments 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system and systemically.
  • Embodiment 139 The method of any of embodiments 111-131, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered by any of intrathecally, systemically, subcutaneously, or intramuscularly.
  • Embodiment 140 The method of any of embodiments 116-139, wherein the subject is human.
  • Embodiment 141 A method of reducing the amount of SCN2A RNA in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A RNA in the cell.
  • Embodiment 142 A method of reducing the amount of SCN2A protein in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A protein in the cell.
  • Embodiment 143 The method of embodiment 141 or embodiment 142, wherein the cell is a cortical cell, a hippocampal cell, or a spinal cord cell.
  • Embodiment 144 The method of any of embodiments 141-143, wherein the cell is in an animal.
  • Embodiment 145 The method of any of embodiments 141-144, wherein the cell is a human cell.
  • Embodiment 146 Use of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115 for reducing SCN2A expression in a cell.
  • Embodiment 147 The use of embodiment 146, wherein the level of SCN2A RNA in the cell is reduced.
  • Embodiment 148 The use of embodiment 146 or embodiment 147, wherein the level of SCN2A protein in the cell is reduced.
  • Embodiment 149 The use of any of embodiments 146-148, wherein the cell is a corical cell, a hippocampal cell, or a spinal cord cell.
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions.
  • one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
  • 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH 3 (“OMe” or “O-methyl”), and 2′-O(CH 2 ) 2 OCH 3 (“MOE” or “O-methoxyethyl”).
  • 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, O—C 1 -C 10 alkyl, O—C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or
  • these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 ) 3 NH 2 , CH 2 CH ⁇ CH 2 , OCH 2 CH ⁇ CH 2 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamide (OCH 2 C( ⁇ O)—N(R m )(R n )), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C( ⁇ O)—N(H)CH 3 (“NMA”).
  • a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C( ⁇ O)—N(H)CH 3 (“NMA”).
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2′-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring ⁇ -D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2′-modified sugar moiety has an additional stereocenter at the 2′-position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • 2′-modified sugar moieties described herein are in the ⁇ -D-ribosyl isomeric configuration unless otherwise specified.
  • Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN).
  • BNAs bicyclic nucleosides
  • CNN conformationally restricted nucleotides
  • the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms.
  • the furanose ring is a ribose ring.
  • 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH 2 -2′, 4′-(CH 2 ) 2 -2′, 4′-(CH 2 ) 3 -2′, 4′-CH 2 —O-2′ (“LNA”), 4′-CH 2 —S-2′, 4′-(CH 2 ) 2 —O-2′ (“ENA”), 4′-CH(CH 3 )—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH 2 —O—CH 2 -2′, 4′-CH 2 —N(R)-2′, 4′-CH(CH 2 OCH 3 )—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R b is, independently, H, a protecting group, or C 1 -C 12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).
  • such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R a )(R b )] n —, —[C(R a )(R b )] n O—, —C(R a ) ⁇ C(R b )—, —C(R a ) ⁇ N—, —C( ⁇ NR a )—, —C( ⁇ O)—, —C( ⁇ S)—, —O—, —Si(R a ) 2 —, —S( ⁇ O) x —, and —N(R a )—;
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the ⁇ -L configuration or in the ⁇ -D configuration.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • TTP tetrahydropyrans
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“NINA”) (see, e.g., Leumann, CJ. Bioorg . & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • modified THP nucleosides are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q are each H.
  • At least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and g 7 is methyl.
  • modified THP nucleosides are provided wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modified morpholinos.”
  • sugar surrogates comprise acyclic moieties.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C ⁇ C—CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyla
  • nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No.
  • nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.
  • the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (“P(O 2 ) ⁇ O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P(O 2 ) ⁇ S”), and phosphorodithioates (“HS—P ⁇ S”).
  • Non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH 2 —N(CH 3 )—O—CH 2 —), thiodiester, thionocarbamate (—O—C( ⁇ O)(NH)—S—); siloxane (—O—SiH 2 —O—); and N,N′-dimethylhydrazine (—CH 2 —N(CH 3 )—N(CH 3 )—).
  • Modified internucleoside linkages compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
  • internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate internucleoside linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 2003, 125, 8307, Wan et al. Nuc. Acid. Res., 2014, 42, 13456, and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH 2 —N(CH 3 )—O-5′), amide-3 (3′-CH 2 —C( ⁇ O)—N(H)-5′), amide-4 (3′-CH 2 —N(H)—C( ⁇ O)-5′), formacetal (3′-O—CH 2 —O-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH 2 —O—5′).
  • Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research ; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety.
  • at least six nucleosides of the gap of a gapmer comprise a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a 2′-OMe sugar moiety.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction comprise 2′-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
  • at least six nucleosides of the gap of a gapmer comprise a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2′-deoxyribosyl sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
  • each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified oligonucleotide comprises the same 2′-modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing].
  • a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-wing, 10 linked 2′- ⁇ -D-deoxynucleosides in the gap, and 5 linked 2′-MOE nucleosides in the 3′-wing.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′- ⁇ -D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing.
  • a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked 2′- ⁇ -D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing.
  • a mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.
  • a 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-8-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers.
  • modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2′-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
  • modified oligonucleotides have the following sugar motif (5′ to 3′): eeeeedyddddddddddeeeee, eeeeedddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeeee, eeeeddddddddeeeeee, eeeeedddddddeeeee, wherein ‘d’ represents a 2′-deoxyribosyl sugar moiety, ‘e’ represents a 2′-MOE sugar moiety, and ‘y’ represents a 2′-OMe sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of the nucleoside is a 2′- ⁇ -D-deoxyribosyl sugar moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
  • oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
  • each internucleoside linking group is a phosphodiester internucleoside linkage (P ⁇ O).
  • each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P ⁇ S).
  • each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage.
  • each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified.
  • some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages.
  • the terminal internucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer
  • the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
  • all of the phosphorothioate internucleoside linkages are stereorandom.
  • all of the phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
  • modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sooossssssssssssss, soooosssssssssooss, sooooosssssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssssooss, or sooosssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16
  • modified oligonucleotides are incorporated into a modified oligonucleotide.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif.
  • such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for ⁇ -D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both ⁇ -D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, car
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • a conjugate moiety is attached to an oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieties, which are sub-units making up a conjugate linker.
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside linkage.
  • the cleavable moiety is 2′-deoxyadenosine.
  • a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
  • conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5′-phosphate.
  • Stabilized 5′-phosphates include, but are not limited to 5′-phosphonates, including, but not limited to 5′-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2′-linked nucleosides.
  • the 2′-linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target nucleic acid is a mature mRNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5′-end of the gap region.
  • the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5′-end of the 5′ wing region or the 3′ wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is an SCN2A nucleic acid.
  • the SCN2A nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000).
  • contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN1A protein in a cell.
  • contacting a cell with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN2A protein in a cell.
  • the cell is in vitro.
  • the cell is in a subject.
  • the oligomeric compound consists of a modified oligonucleotide.
  • contacting a cell in a subject with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 ameliorates one or more symptoms or hallmarks of a disease or disorder associated with a voltage-gated sodium channel protein.
  • the voltage-gated sodium channel protein is SCN2A.
  • the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A
  • the subject has a disease or disorder associated with SCN1A.
  • the disease or disorder is a Developmental or Epileptic Encephalopathy, such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the disease or disorder is an intellectual disability or an autism spectrum disorder; in certain embodiments, the disease or disorder is Dravet Syndrome.
  • Developmental or Epileptic Encephalopathy such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures
  • the disease or disorder is an intellectual disability or an autism spectrum disorder
  • the disease or disorder is Dravet Syndrome.
  • the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, and sleep problems.
  • the seizures are any of focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
  • an oligomeric compound complementary to SCN2A RNA in vivo is capable of reducing the detectable amount of SCN2A RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • oligomeric compounds do not comprise a bicyclic sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, oligomeric compounds do not comprise a LNA sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”).
  • artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.
  • a dose may be in the form of a dosage unit.
  • a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
  • the free acid is in equilibrium with anionic and salt forms.
  • the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
  • a modified oligonucleotide or an oligomeric compound may be partially or fully de-protonated and in association with Na+ ions.
  • the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose.
  • a dose, or dosage unit, of 10 mg of Compound No. 1348259 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No.
  • an oligomeric compound comprises a conjugate group
  • the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
  • Compound No. 1348259 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5′ to 3′) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 6-15 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348259 is represented b the following chemical notation:
  • Compound No. 1348259 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348259 is represented by the following chemical structure:
  • Compound No. 1348289 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CACGACATATTTTTCTACAC (SEQ ID NO: 2514), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348289 is represented by the following chemical notation: mCesAeomCeoGeoAeomCeoAdsTdsAdsTdsTdsTdsTdsmCdsTdsAeomCesAesmCe (SEQ ID NO: 2514), wherein:
  • Compound No. 1348289 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348289 is represented by the following chemical structure:
  • Compound No. 1348290 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 2510), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348290 is represented by the following chemical notation:
  • Compound No. 1348290 is represented by the following chemical structure:
  • Structure 5 Compound No. 1348290
  • the sodium salt of Compound No. 1348290 is represented by the following chemical structure:
  • Compound No. 1348331 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348331 is represented by the following chemical notation:
  • Compound No. 1348331 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348331 is represented by the following chemical structure:
  • Compound No. 1348347 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348347 is represented by the following chemical notation:
  • Compound No. 1348347 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348347 is represented by the following chemical structure:
  • Compound No. 1348937 is characterized as a 5-8-5 MOE gapmer having a sequence (from 5′ to 3′) of CTGCATGTAACCTTTATA (SEQ ID NO: 2534), wherein each of nucleosides 1-5 and 14-18 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 6-13 are 2′- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 14 to 15 and 15 to 16 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1348937 is represented by the following chemical notation:
  • Compound No. 1348937 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1348937 is represented by the following chemical structure:
  • nucleobases in the ranges specified below comprise a hotspot region of SCN2A nucleic acid.
  • modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 69.9% or greater reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 59% or greater reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, and 2526 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve at least 53% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 69.9% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 77.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 63.2% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, and 2521 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 1348303, 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 1348375, 1348376, 1348377, 1348381, 1348382, 1348383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO
  • modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve at least 75% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 81.6% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 76.6% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 67.2% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 243124-243204 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, and 2527 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 71.4% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.3% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.5% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 243917-244073 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, and 2537 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 1348332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 1348420, 1348421, 1348427, 1348428, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937, and 1348938 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve at least 80% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 80.5% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 67.7% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 62.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, and 2522 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 910019, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 1348269, 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve at least 27% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 71.1% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 63.4% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 59.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, and 2539 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • nucleobase sequence of Compound IDs: 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 89% reduction of SCN2A RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 74.8% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 67.8% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • the ranges described in the table below comprise hotspot regions.
  • Each hotspot region begins with the nucleobase of SEQ ID NO:2 identified in the “Start Site SEQ ID NO: 2” column and ends with the nucleobase of SEQ ID NO: 2 identified in the “Stop Site SEQ ID NO: 2” column.
  • modified oligonucleotides are complementary to an equal length portion within any of the hotspot regions 1-17, as defined in the table below. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers comprise a 2′-substituted nucleoside in the gap.
  • the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety.
  • the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′.
  • the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • nucleobase sequence of compounds listed in the “Compound IDs in range” column in the table below are complementary to SEQ ID NO: 2 within the specified hotspot region.
  • nucleobase sequence of the oligonucleotides listed in the “SEQ ID NOs in range” column in the table below are complementary to the target sequence, SEQ ID NO: 2, within the specified hotspot region.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve at least “Min.% Red. in vitro” (minimum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg.% Red. in vitro” (average % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve a maximum of “Max. % Red. in vitro” (maximum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Cortex” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in cortical tissue, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Spinal” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in spinal cord tissue, as indicated in the table below. “n.d.” indicates that no in vivo data is available for compounds within that range. In other cases, average reduction in vivo includes a subset of the compounds in any given hotspot, as not all compounds were tested in vivo.
  • Comparator Compound No. 1506060 was selected as a comparator compound in the experiment described in Example 4 of the instant specification.
  • Comparator Compound No. 1506060 previously described in WO2020/041348, incorporated herein by reference, is a 4-8-4 LNA gapmer with the sequence (from 5′ to 3′) TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ and 3′ wing segments each consist of four LNA modified nucleosides, and each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • compounds described herein are more tolerable relative to Comparator Compound No. 1506060.
  • Comparator Compound No. 1506060 had a 3-hour FOB of 6.00 in mice, whereas Compound Nos. 1348290, 1348331, and 1348347 each had a 3-hour FOB of 0.00 in mice, and Compound Nos. 1348259, 1348289, and 1348937 each had a 3-hour FOB of 0 or 1.00 in mice. Therefore, certain compounds described herein are more tolerable than Comparator Compound No. 1506060 in this assay.
  • RNA nucleoside comprising a 2′-OH sugar moiety and a thymine base
  • RNA methylated uracil
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or ⁇ such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures.
  • Oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which chirality of the phosphorothioate internucleoside linkages is controlled or is random.
  • compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Modified Oligonucleotides Complementary to Human SCN2A Nucleic Acid were Designed and Tested for their single dose effects on SCN2A RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides and the 5′ and 3′ wing segments each consists of five 2′-MOE modified nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeedddddddddddeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar, and ‘e’ represents a 2′-MOE sugar moiety.
  • the internucleoside linkage motif for the gapmers is (from 5′ to 3′): soooossssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to either human SCN2A mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or the human SCN2A genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SCN2A RNA levels were measured by Human primer probe set RTS36041 (forward sequence CCTTGAACCTGAAGCCTGTT, designated herein as SEQ ID NO: 10; reverse sequence CGAACCAATTGTGCTCCACTA, designated herein as SEQ ID NO: 11; probe sequence TTCCACCAGAGTTTCCCTTTGCCT, designated herein as SEQ ID NO: 12).
  • SCN2A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA amount relative to the amount in untreated control cells (% control). Each table represents results from an individual assay plate. The values marked with an “T” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Modified oligonucleotides selected from Example 1 above were tested at various doses in SH-SY5Y cells.
  • Cultured SH-SY5Y cells at a density of 20,000 cells perwell were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • SCN2A RNA levels were measured by quantitative real-time RTPCR.
  • Human SCN2A primer-probe set RTS36041 (described herein in Example 1) was used to measure RNA levels as described above.
  • SCN2A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. 0.0 Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control).
  • IC 50 half maximal inhibitory concentration
  • Modified oligonucleotides complementary to a human SCN2A nucleic acid were designed, as described in the tables below.
  • “Start site” in the tables below indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • the modified oligonucleotides in Table 51 are 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides and the 5′ and 3′ wing segments each consists of five 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeedddddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 52 below are 6-10-4 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of six 2′-MOE nucleosides, and the 3′ wing segment consists of four 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddddeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooooosssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 53 below are 4-10-6 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of four 2′-MOE nucleosides, and the 3′ wing segment consists of six 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeedddddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooossssssssoooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 54 below are 4-8-6 MOE gapmers.
  • the gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of four 2′-MOE nucleosides, and the 3′ wing segment consists of six 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeedddddddddeeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): soosssssssoooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 55 below are 6-8-4 MOE gapmers.
  • the gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of six 2′-MOE nucleosides, and the 3′ wing segment consists of four 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddeeee; wherein ‘d’ represents a 2′-N-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • the modified oligonucleotides in Table 56 below are 5-8-5 MOE gapmers.
  • the gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′- ⁇ -D-deoxynucleosides, the 5′ wing segment consists of five 2′-MOE nucleosides, and the 3′ wing segment consists of five 2′-MOE nucleosides.
  • the sugar motif for the gapmers is (from 5′ to 3′): eeeeedddddddddeeeee; wherein ‘d’ represents a 2′- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety.
  • the gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooosssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • Modified oligonucleotides described above were tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides. Additionally, Comparator Compound No. 1506060 was tested. Wild-type female C57/B16 mice each received a single ICV dose of 700 ⁇ g of modified oligonucleotide as listed in the tables below. Each treatment group consisted of 3 mice. A group of 4 mice received PBS as a negative control for each experiment (identified in separate tables below). At 3 hours post-injection, mice were evaluated according to seven different criteria.
  • the criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing.
  • a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group.
  • Modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides.
  • Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of modified oligonucleotide listed in the tables below.
  • Each treatment group consisted of 3-4 rats.
  • a group of 4 rats received PBS as a negative control for each experiment (identified in separate tables below).
  • movement in 7 different parts of the body were evaluated for each rat.
  • the 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head.
  • each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed (the functional observational battery score or FOB). After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group.
  • a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1.
  • the scores were averaged for each treatment group, and presented in the tables below. Values marked with the symbol “ ⁇ ” indicate groups that had 3 or fewer animals in the group.
  • Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells.
  • Cultured SH-SY5Y cells at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • SCN2A RNA levels were measured by quantitative real-time RTPCR.
  • Human SCN2A primer-probe set RTS36041 (described herein above) was used to measure RNA levels.
  • SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH.
  • SCN2A RNA Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control). The results for each separate experiment are presented in separate tables below.
  • IC 50 half maximal inhibitory concentration
  • Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells.
  • Cultured SH-SY5Y cells at a density of 35,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • SCN2A RNA levels were measured by quantitative real-time RTPCR.
  • Human SCN2A primer-probe set RTS36041 (described herein above) was used to measure RNA levels.
  • SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH.
  • SCN2A RNA Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control).
  • IC 50 half maximal inhibitory concentration
  • Transgenic mice that express a human SCN2A transcript were generated in a C57Bl/6 background.
  • Transgenic mice may be prepared and are available from commercial and academic research facilities; for examples of transgenic mice that express human neurological genes see, for example, Heintz et al., 2002, Nature reviews Neuroscience 2, 861-870.
  • Human SCN2A transgenic mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 350 ⁇ g of modified oligonucleotide. A group of 4 mice received PBS as a negative control.
  • mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RTPCR analysis to measure the amount of SCN2A RNA using Human primer probe set RTS36041 (described in Example 1 above). Results are presented as percent human SCN2A RNA relative to the amount in PBS treated animals, normalized to mouse GAPDH RNA (% control).
  • Mouse GAPDH RNA was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 13; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 14; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 15).
  • mice Human SCN2A transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses indicated in tables below. A group of 8 mice received PBS as a negative control.
  • mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from the cortex and spinal cord for quantitative real-time RTPCR analysis of RNA expression of SCN2A using primer probe set RTS36041 (described herein in Example 1). Results are presented as percent human SCN2A RNA relative to the amount in PBS treated animals, normalized to mouse GAPDH RNA.
  • Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (described herein above).
  • the half maximal effective dose (ED 50 ) of each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA).

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA in a cell or subject, and in certain instances reducing the amount of SCN2A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a disease or disorder associated with a voltage-gated sodium channel protein, such as, for example, a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder. Such symptoms and hallmarks include, but are not limited to seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.

Description

    SEQUENCE LISTING
  • The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0373WOSEQ_ST25.txt, created on Aug. 2, 2021, which is 850 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
    • FIELD
  • Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA in a cell or subject, and in certain instances reducing the amount of SCN2A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a disease or disorder associated with a voltage-gated sodium channel protein, such as, for example, a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder. Such symptoms and hallmarks include, but are not limited to seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
    • BACKGROUND
  • The human gene SCN2A encodes human SCN2A protein, the alpha-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual diseases and disorders, such as Developmental and Epileptic Encephalopathies (DEE), including Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, and Benign Familial Neonatal-Infantile Seizures (BFNIS); mutations in SCN2A are also associated with intellectual disability (ID) and/or autism spectrum disorder (ASD), with or without seizures (Wolff, M., et al., 2019, Epilepsia 60, S59-S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M., et al., 2017, Brain 140, 1316-1336). DEEs include abroad range of diseases that include neonatal and early infantile DEE, for example Ohtahara Syndrome and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy (Wolff, M., et al., 2019; Harkin, L. A., et al., 2007, Brain 130, 843-852; Escayg, A., et al., 2010, Epilepsia 51, 1650-1658; Miller I. O, et al., 2007 Nov. 29 [Updated 2019 Apr. 18]. In: Adam M P, Ardinger H H, Pagon R A, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020. Available from: www.ncbi.nlm.nih.gov/books/NBK1318/).
  • Symptoms and hallmarks associated with DEEs include seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy. Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019). Symptoms and hallmarks associated with ID and ASD include motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019).
  • Currently there is a lack of acceptable options for treating DEEs such as EEs, Late Onset EEs, and BFNIS; and for treating ID and ASD. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases and disorders.
    • SUMMARY OF THE INVENTION
  • Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SCN2A RNA, and in certain embodiments reducing the expression of SCN2A protein in a cell or subject. In certain embodiments, the subject has a disease or disorder associated with a voltage-gated sodium channel protein. In certain embodiments, the voltage-gated sodium channel protein is SCN2A. In certain embodiments, the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A. In certain embodiments, the subject has a disease or disorder associated with SCN1A.
  • In certain embodiments, the subject has a Developmental or Epileptic Encephalopathy; in certain embodiments, the subject has Early Seizure Onset Epileptic Encephalopathy; in certain embodiments, the subject has Late Seizure Onset Epileptic Encephalopathy; in certain embodiments the subject has Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the subject has an intellectual disability (ID); in certain embodiments, the subject has an autism spectrum disorder (ASD); in certain embodiments, the subject has Dravet Syndrome. In certain embodiments, compounds useful for reducing the amount or activity of SCN2A RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing the amount or activity of SCN2A RNA are modified oligonucleotides. In certain embodiments, compounds useful for reducing expression of SCN2A protein are oligomeric compounds. In certain embodiments, compounds useful for reducing expression of SCN2A protein are modified oligonucleotides.
  • Also provided are methods useful for ameliorating at least one symptom or hallmark of a Developmental or Epileptic Encephalopathy such as EEs, Late Seizure Onset EEs, and BFNIS; an intellectual disability; or autism spectrum disorder. In certain embodiments, the symptom or hallmark includes seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), and sleep problems. In certain embodiments, the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
    • DETAILED DESCRIPTION OF THE INVENTION
  • It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included,” is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
  • The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, ENSEMBL, and NCBI reference sequence records are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.
    • Definitions
  • Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
  • Unless otherwise indicated, the following terms have the following meanings:
    • Definitions
  • As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • As used herein, “2′-MOE” means a 2′-OCH2CH2OCH3 group in place of the 2′—OH group of a furanosyl sugar moiety. A “2′-MOE sugar moiety” means a sugar moiety with a 2′-OCH2CH2OCH3 group in place of the 2′—OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the β-D-ribosyl configuration. “MOE” means O-methoxyethyl.
  • As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety.
  • As used herein, “2′-OMe” means a 2′-OCH3 group in place of the 2′—OH group of a furanosyl sugar moiety. A “2′-O-methyl sugar moiety” or “2′-OMe sugar moiety” means a sugar moiety with a 2′-OCH3 group in place of the 2′-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the β-D-ribosyl configuration.
  • As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety.
  • As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.
  • As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.
  • As used herein, “administering” means providing a pharmaceutical agent to a subject.
  • As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease or reduction in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity. An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound.
  • As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
  • As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark. In certain embodiments, the symptom or hallmark is seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), or sleep problems. In certain embodiments, the seizures are focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), or frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, or tonic seizures).
  • As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
  • As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of a another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.
  • As used herein, “cEt” means a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH3)—O-2′, and wherein the methyl group of the bridge is in the S configuration. A “cEt sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH3)—O-2′, and wherein the methyl group of the bridge is in the S configuration. “cEt” means constrained ethyl.
  • As used herein, “cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.
  • As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • As used herein, “chirally controlled” in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
  • As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2′-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2′-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2′-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer.
  • As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5′-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2′-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2′-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2′-β-D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2′-β-D-deoxynucleosides and wings comprising 2′-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
  • As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • As used herein, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
  • As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • As used herein, “LNA” means locked nucleic acid. An “LNA sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a furanosyl sugar moiety, wherein the bridge has the formula of 4′-CH2—O-2′. “LNA” means locked nucleic acid. In some embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. As used herein, “LNA nucleoside” means a nucleoside comprising a LNA sugar moiety.
  • As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
  • As used herein, “nucleoside” means a compound or a fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • As used herein, “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • As used herein, “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • As used herein, “reducing the amount,” “reducing the activity,” “decreasing the amount,” or “decreasing the activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.
  • As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
  • As used herein, “standard in vitro assay” means the assay described in Example 1 and reasonable variations thereof.
  • As used herein, “standard in vivo assay” means the assay described in Example 8 and reasonable variations thereof.
  • As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
  • As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human.
  • As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) β-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. In certain embodiments, a hallmark is apparent on a brain MRI scan.
  • As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom or hallmark of a disease or disorder.
  • As used herein, “treating” means improving a subject's disease or disorder by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
    • CERTAIN EMBODIMENTS
  • The present disclosure provides the following non-limiting numbered embodiments:
  • Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 16-2531, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2532-2539, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 4. The oligomeric compound of any of embodiments 1 to 3, wherein the modified oligonucleotide is at least 90% complementary to an equal length portion of SEQ ID NO: 2 and is not more than 50% complementary to an equal length portion of SEQ ID NO: 1.
  • Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
      • a) the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 199863-199905, 227493-22755, 243124-243204, 247823-247921, 254142-254177, 168911-168945, 170026-170061, 183519-183562, 188630-188668, 199912-199962, 227419-227450, or 238173-238192 of SEQ ID NO: 2, provided that the modified oligonucleotide does not comprise more than six LNA nucleosides; or
      • b) the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 243917-244073, 170174-170200, 176724-176751, 180772-180801, 183968-184016, 202877-202906, 224198-224217, 224199-224218, or 243918-243937 of SEQ ID NO: 2,
      • wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
      • a) the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, 2527; 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 2522; 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, 2539; 18, 96, 485, 561, 638, 715, 791, 868, 2247, 2323, 2400; 174, 1328, 1405, 1482, 1559, 1636, 1713, 1790, 1865, 1942, 2019; 20, 98, 253, 332, 410, 1406, 1483, 1560, 1637, 1714, 1791, 1866, 1943; 21, 411, 1407, 1484, 1561, 1638, 1715; 24, 414, 871, 948, 1025, 1100; 25, 337, 415, 490, 566, 2099, 2176, 2252, 2328, 2405; and 182; provided that the modified oligonucleotide does not comprise more than six LNA nucleosides; or
      • b) wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537; 302, 1513, 1667, 1744, 1819, 1896, 1973; 148, 226, 1364, 1441, 1518, 1595, 1672, 1749; 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 1829; 228, 1679, 1756, 1831, 1908, 1985, 2061, 2138, 2214, 2290; 1226, 1303, 1380, 1457, 1534, 1611; 2079; 2523; and 2477
      • wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • Embodiment 7. The oligomeric compound of any of embodiments 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2487, 2493, 2510, or 2514.
  • Embodiment 8. The oligomeric compound of any of embodiments 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of SEQ ID NO: 2534.
  • Embodiment 9. The oligomeric compound of any of embodiments 1-8, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 10. The oligomeric compound of embodiment 9 wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to
      • an intronic region of the nucleobase sequence of SEQ ID NO: 2;
      • an untranslated region of the nucleobase sequence of SEQ ID NO: 2; or
      • an intron/exon junction region of the nucleobase sequence of SEQ ID NO: 2.
  • Embodiment 11. The oligomeric compound of any of embodiments 1-10, wherein the nucleobase sequence of the modified oligonucleotide is no more than 50%, no more than 60%, no more than 70%, no more than 80%, no more than 90%, or no more than 95% complementary to an exonic region of the nucleobase sequence of SEQ ID NO: 2.
  • Embodiment 12. The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • Embodiment 13. The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides.
  • Embodiment 14. The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
  • Embodiment 15. The oligomeric compound of embodiment 14, wherein the modified oligonucleotide consists of 20 linked nucleosides.
  • Embodiment 16. The oligomeric compound of embodiment 14, wherein the modified oligonucleotide consists of 18 linked nucleosides.
  • Embodiment 17. The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
  • Embodiment 18. The oligomeric compound of embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 19. The oligomeric compound of embodiment 18, wherein the bicyclic sugar moiety comprises a 4′-2′ bridge, wherein the 4′-2′ bridge is selected from —CH2—O—; and —CH(CH3)—O—.
  • Embodiment 20. The oligomeric compound of any of embodiments 17-19, wherein the modified oligonucleotide does not comprise more than six bicyclic sugar moieties.
  • Embodiment 21. The oligomeric compound of embodiment 17, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.
  • Embodiment 22. The oligomeric compound of any of embodiments 17-20, wherein the modified oligonucleotide does not comprise more than six LNA sugar moieties.
  • Embodiment 23. The oligomeric compound of any of embodiments 17-21, wherein the modified oligonucleotide does not comprise a LNA sugar moiety.
  • Embodiment 24. The oligomeric compound of any of embodiments 17-23, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
  • Embodiment 25. The oligomeric compound of embodiment 24, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety or a 2′-OMe sugar moiety.
  • Embodiment 26. The oligomeric compound of any of embodiments 17-25, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 27. The oligomeric compound of embodiment 26, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.
  • Embodiment 28. The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 29. The oligomeric compound of any of embodiments 1-28, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 1-6 linked 5′-region nucleosides;
      • a central region consisting of 6-10 linked central region nucleosides; and
      • a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 30. The oligomeric compound of any of embodiments 1-28, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 1-6 linked 5′-region nucleosides;
      • a central region consisting of 6-10 linked central region nucleosides; and
      • a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 31. The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises: a 5′-region consisting of 5 linked 5′-region nucleosides;
      • a central region consisting of 10 linked central region nucleosides; and
      • a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 32. The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 5 linked 5′-region nucleosides;
      • a central region consisting of 10 linked central region nucleosides; and
      • a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 33. The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 6 linked 5′-region nucleosides;
      • a central region consisting of 10 linked central region nucleosides; and
      • a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 34. The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 6 linked 5′-region nucleosides;
      • a central region consisting of 10 linked central region nucleosides; and
      • a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 35. The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 4 linked 5′-region nucleosides;
      • a central region consisting of 10 linked central region nucleosides; and
      • a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 36. The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 4 linked 5′-region nucleosides;
      • a central region consisting of 10 linked central region nucleosides; and
      • a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 37. The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 4 linked 5′-region nucleosides;
      • a central region consisting of 8 linked central region nucleosides; and
      • a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 38. The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 4 linked 5′-region nucleosides;
      • a central region consisting of 8 linked central region nucleosides; and
      • a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 39. The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 6 linked 5′-region nucleosides;
      • a central region consisting of 8 linked central region nucleosides; and
      • a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 40. The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 6 linked 5′-region nucleosides;
      • a central region consisting of 8 linked central region nucleosides; and
      • a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 41. The oligomeric compound of embodiment 29, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 5 linked 5′-region nucleosides;
      • a central region consisting of 8 linked central region nucleosides; and
      • a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 42. The oligomeric compound of embodiment 30, wherein the modified oligonucleotide comprises:
      • a 5′-region consisting of 5 linked 5′-region nucleosides;
      • a central region consisting of 8 linked central region nucleosides; and
      • a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
      • each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
  • Embodiment 43. The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one bicyclic nucleoside.
  • Embodiment 44. The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a bicyclic nucleoside.
  • Embodiment 45. The oligomeric compound of embodiment 29 or embodiment 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a LNA nucleoside.
  • Embodiment 46. The oligomeric compound of any of embodiments 1-45, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
  • Embodiment 47. The oligomeric compound of embodiment 46, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 48. The oligomeric compound of embodiment 46 or embodiment 47, wherein each internucleoside linkage is a modified internucleoside linkage.
  • Embodiment 49. The oligomeric compound of embodiment 48, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 50. The oligomeric compound of any of embodiments 46-47, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
  • Embodiment 51. The oligomeric compound of any of embodiments 1-46, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
  • Embodiment 52. The oligomeric compound of any of embodiments 1-47 or 50-51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.
  • Embodiment 53. The oligomeric compound of embodiment 46, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, and sooosssssssssooss, wherein s=a phosphorothioate internucleoside linkage and o=a phosphodiester internucleoside linkage.
  • Embodiment 54. The oligomeric compound of any of embodiments 1-53, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 55. The oligomeric compound of embodiment 54, wherein the modified nucleobase is a 5-methyl cytosine.
  • Embodiment 56. The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound is capable of reducing the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay.
  • Embodiment 57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: Ges mCeoAeoTeoAeoAdsTds mCds mCds mCdsAdsTdsTdsAdsTdsAeo mCeoAesAesAe (SEQ ID NO: 2493), wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internmucleoside linkage.
  • Embodiment 58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • (SEQ ID NO: 2514)
    mCesAeo mCeoGeoAeo mCeoAdsTdsAdsTdsTds
    TdsTdsTds mCdsTdsAeo mCesAes mCe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • Embodiment 59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • (SEQ ID NO: 2510)
    mCes mCeoAeo mCeoGeoAeo mCdsAdsTdsAdsTds
    TdsTdsTdsTds mCdsTeoAes mCesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • Embodiment 60. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • (SEQ ID NO: 2487)
    Tes mCeoTeoGeo mCeoAeoTdsGdsTdsAdsAds
    mCds mCdsTdsTdsTdsAeoTesAes mCe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • Embodiment 61. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • (SEQ ID NO: 2493)
    Ges mCeoAeoTeoAeoAeoTds mCds mCds mCds
    AdsTdsTdsAdsTdsAds mCeoAesAesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • Embodiment 62. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
  • (SEQ ID NO: 2534)
    GTmCesTeoGeo mCeoAesTdsGdsTdsAdsAds
    mCds mCdsTdsTeoTeoAesTesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • Embodiment 63. The oligomeric compound of any of embodiments 1-62 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 64. The oligomeric compound of any of embodiments 1-63, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.
  • Embodiment 65. The oligomeric compound of any of embodiments 1-64, consisting of the modified oligonucleotide.
  • Embodiment 66. The oligomeric compound of any of embodiments 1-62, wherein the modified oligonucleotide is an RNAi compound.
  • Embodiment 67. The oligomeric compound of any of embodiments 1-66, further comprising a conjugate group.
  • Embodiment 68. The oligomeric compound of embodiment 67, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
  • Embodiment 69. The oligomeric compound of embodiment 68, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
  • Embodiment 70. The oligomeric compound of embodiment 68, wherein the conjugate linker consists of a single bond.
  • Embodiment 71. The oligomeric compound of embodiment 68, wherein the conjugate linker is cleavable.
  • Embodiment 72. The oligomeric compound of embodiment 68, wherein the conjugate linker comprises 1-3 linker-nucleosides.
  • Embodiment 73. The oligomeric compound of any of embodiments 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
  • Embodiment 74. The oligomeric compound of any of embodiments 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
  • Embodiment 75. The oligomeric compound of any of embodiments 1-74 further comprising a terminal group.
  • Embodiment 76. The oligomeric compound of any of embodiments 1-71 or 73-75, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 77. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00001
  • or a salt thereof.
  • Embodiment 78. The modified oligonucleotide of embodiment 77, which is the sodium salt or the potassium salt.
  • Embodiment 79. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00002
  • Embodiment 80. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00003
  • or a salt thereof.
  • Embodiment 81. The modified oligonucleotide of embodiment 80, which is the sodium salt or the potassium salt.
  • Embodiment 82. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00004
  • Embodiment 83. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00005
  • or a salt thereof.
  • Embodiment 84. The modified oligonucleotide of embodiment 83, which is the sodium salt or the potassium salt.
  • Embodiment 85. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00006
  • Embodiment 86. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00007
  • or a salt thereof.
  • Embodiment 87. The modified oligonucleotide of embodiment 86, which is the sodium salt or the potassium salt.
  • Embodiment 88. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00008
  • Embodiment 89. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00009
  • or a salt thereof.
  • Embodiment 90. The modified oligonucleotide of embodiment 89, which is the sodium salt or the potassium salt.
  • Embodiment 91. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00010
  • Embodiment 92. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00011
  • or a salt thereof.
  • Embodiment 93. The modified oligonucleotide of embodiment 92, which is the sodium salt or the potassium salt.
  • Embodiment 94. A modified oligonucleotide according to the following chemical structure:
  • Figure US20240026353A1-20240125-C00012
  • Embodiment 95. A chirally enriched population of oligomeric compounds of any of embodiments 1-76 or modified oligonucleotides of any of embodiments 77-94, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
  • Embodiment 96. The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
  • Embodiment 97. The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.
  • Embodiment 98. The chirally enriched population of embodiment 95, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 99. The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 100. The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
  • Embodiment 101. The chirally enriched population of embodiment 98, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.
  • Embodiment 102. A population of oligomeric compounds of any of embodiments 1-76 or modified oligonucleotides of any of embodiments 77-94, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 103. An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-76.
  • Embodiment 104. The oligomeric duplex of embodiment 103, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 105. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound of any of embodiments 1-76 or a modified oligonucleotide of any of embodiments 77-94.
  • Embodiment 106. The antisense agent of embodiment 103, wherein the antisense agent is an oligomeric duplex of embodiment 103 or embodiment 104.
  • Embodiment 107. The antisense agent of embodiment 105 or embodiment 106, wherein the antisense agent is:
      • i. an RNase H agent capable of reducing the amount of SCN2A nucleic acid through the activation of RNase H; or
      • ii. an RNAi agent capable of reducing the amount of SCN2A nucleic acid through the activation of RISC/Ago2.
  • Embodiment 108. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, or an antisense agent of any of embodiments 105-107, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 109. The pharmaceutical composition of embodiment 108, comprising a pharmaceutically acceptable diluent and wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).
  • Embodiment 110. The pharmaceutical composition of embodiment 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and aCSF.
  • Embodiment 111. The pharmaceutical composition of embodiment 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and PBS.
  • Embodiment 112. A pharmaceutical composition comprising a modified oligonucleotide of any of embodiments 77-94 and a pharmaceutically acceptable diluent.
  • Embodiment 113. The pharmaceutical composition of embodiment 112, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
  • Embodiment 114. The pharmaceutical composition of embodiment 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF.
  • Embodiment 115. The pharmaceutical composition of embodiment 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
  • Embodiment 116. A method comprising administering to a subject an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115.
  • Embodiment 117. A method of treating a disease or disorder associated with a voltage-gated sodium channel protein, comprising administering to a subject having or at risk for developing the disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby treating the disease or disorder associated with a voltage-gated sodium channel protein.
  • Embodiment 118. A method of reducing the amount of SCN2A protein in the CSF of a subject having or at risk for developing a disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A protein in the CSF.
  • Embodiment 119. The method of embodiment 117 or embodiment 118, wherein the disease or disorder is a neurodevelopmental disease.
  • Embodiment 120. The method of embodiment 117 or embodiment 118, wherein the disease or disorder is associated with SCN1A or SCN2A.
  • Embodiment 121. A method of treating a disease or disorder associated with SCN2A, comprising administering to an subject having or at risk for developing a disease or disorder associated with SCN2A a therapeutically effective amount of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby treating the disease or disorder associated with SCN2A.
  • Embodiment 122. The method of embodiment 121, wherein the disease or disorder associated with SCN2A is a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder.
  • Embodiment 123. The method of embodiment 122, wherein the Developmental and Epileptic Encephalopathy is any of Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, or Benign Familial Neonatal-Infantile Seizures.
  • Embodiment 124. The method of embodiment 121, wherein the disease or disorder associated with SCN2A is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • Embodiment 125. The method of any of embodiments 118-120, wherein the disease or disorder is associated with SCN1A.
  • Embodiment 126. The method of embodiment 125, wherein the disease or disorder associated with SCN1A is a Developmental and Epileptic Encephalopathy.
  • Embodiment 127. The method of embodiment 125 or embodiment 126, wherein the Developmental and Epileptic Encephalopathy is Dravet Syndrome.
  • Embodiment 128. The method of embodiment 126 or embodiment 127, wherein the Developmental and Epileptic Encephalopathy is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
  • Embodiment 129. The method of any of embodiments 117-128, wherein at least one symptom or hallmark of the disease or disorder is ameliorated.
  • Embodiment 130. The method of embodiment 129, wherein the symptom or hallmark is seizures.
  • Embodiment 131. The method of any of embodiment 130, wherein the seizures are any of focal, clonic, tonic, generalized tonic and clonic, convulsive, myoclonic, absence, or obtundation status.
  • Embodiment 132. The method of embodiment 130, wherein the seizures are any of focal, clonic, tonic, or generalized tonic.
  • Embodiment 133. The method of embodiment 129, wherein the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, or sudden unexpected death in epilepsy.
  • Embodiment 134. The method of embodiment 129, wherein the symptom or hallmark is any of motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disoders, sleep problems, or seizures.
  • Embodiment 135. The method of any of embodiments 130-134, wherein the seizures are frequent or prolonged.
  • Embodiment 136. The method of any of embodiments 116-135 wherein administering the modified oligonucleotide reduces seizures, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements, or sleep problems, or delays death in the subject.
  • Embodiment 137. The method of any of embodiments 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system or systemically.
  • Embodiment 138. The method of any of embodiments 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system and systemically.
  • Embodiment 139. The method of any of embodiments 111-131, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered by any of intrathecally, systemically, subcutaneously, or intramuscularly.
  • Embodiment 140. The method of any of embodiments 116-139, wherein the subject is human.
  • Embodiment 141. A method of reducing the amount of SCN2A RNA in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A RNA in the cell.
  • Embodiment 142. A method of reducing the amount of SCN2A protein in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115, thereby reducing the amount of SCN2A protein in the cell.
  • Embodiment 143. The method of embodiment 141 or embodiment 142, wherein the cell is a cortical cell, a hippocampal cell, or a spinal cord cell.
  • Embodiment 144. The method of any of embodiments 141-143, wherein the cell is in an animal.
  • Embodiment 145. The method of any of embodiments 141-144, wherein the cell is a human cell.
  • Embodiment 146. Use of an oligomeric compound of any of embodiments 1-76, a modified oligonucleotide of any of embodiments 77-94, a population of any of embodiments 95-102, an oligomeric duplex of embodiment 103 or embodiment 104, an antisense agent of any of embodiments 105-107, or a pharmaceutical composition of any of embodiments 108-115 for reducing SCN2A expression in a cell.
  • Embodiment 147. The use of embodiment 146, wherein the level of SCN2A RNA in the cell is reduced.
  • Embodiment 148. The use of embodiment 146 or embodiment 147, wherein the level of SCN2A protein in the cell is reduced.
  • Embodiment 149. The use of any of embodiments 146-148, wherein the cell is a corical cell, a hippocampal cell, or a spinal cord cell.
  • I. Certain Oligonucleotides
  • In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
  • A. Certain Modified Nucleosides
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
  • 1. Certain Sugar Moieties
  • In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C10 alkoxy, O—C1-C10 substituted alkoxy, O—C1-C10 alkyl, O—C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
  • In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH═CH2, OCH2CH═CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(═O)—N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.
  • In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(═O)—N(H)CH3 (“NMA”).
  • In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH3, and OCH2CH2OCH3.
  • In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2′-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein. A 2′-modified sugar moiety has an additional stereocenter at the 2′-position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. 2′-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.
  • Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN). Certain such compounds are described in US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′ (“LNA”), 4′-CH2—S-2′, 4′-(CH2)2—O-2′ (“ENA”), 4′-CH(CH3)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH2—O—CH2-2′, 4′-CH2—N(R)-2′, 4′-CH(CH2OCH3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH3)(CH3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH2—N(OCH3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH2—O—N(CH3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH2—C(H)(CH3)-2′ (see, e.g., Zhou, et al., J Org. Chem., 2009, 74, 118-134), 4′-CH2—C(═CH2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(RaRb)—N(R)—O-2′, 4′-C(RaRb)—O—N(R)-2′, 4′-CH2—O—N(R)-2′, and 4′-CH2—N(R)—O-2′, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672). In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]nO—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—;
      • wherein:
      • x is 0, 1, or 2;
      • n is 1, 2, 3, or 4;
      • each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and
      • each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.
  • Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. Pat. No. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.
  • In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.
  • Figure US20240026353A1-20240125-C00013
      • α-L-methyleneoxy (4′-CH2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.
  • In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
  • In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.
  • In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“NINA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • Figure US20240026353A1-20240125-C00014
      • (“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
  • Figure US20240026353A1-20240125-C00015
      • wherein, independently, for each of the modified THP nucleosides:
        • Bx is a nucleobase moiety;
        • T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group;
      • q1, q2, q3, q4, q5, q6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and
        • each of R1 and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.
  • In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6 and q are each H.
  • In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and g7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.
  • In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:
  • Figure US20240026353A1-20240125-C00016
  • In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
  • In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.
  • 2. Certain Modified Nucleobases
  • In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C═C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.
  • Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.
  • 3. Certain Modified Internucleoside Linkages
  • In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (“P(O2)═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P(O2)═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
  • Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate internucleoside linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 2003, 125, 8307, Wan et al. Nuc. Acid. Res., 2014, 42, 13456, and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • Figure US20240026353A1-20240125-C00017
  • Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2—N(CH3)—O-5′), amide-3 (3′-CH2—C(═O)—N(H)-5′), amide-4 (3′-CH2—N(H)—C(═O)-5′), formacetal (3′-O—CH2—O-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH2—O—5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
  • B. Certain Motifs
  • In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • 1. Certain Sugar Motifs
  • In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • In certain embodiments, modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).
  • In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety. In certain embodiments, at least six nucleosides of the gap of a gapmer comprise a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2′-OMe sugar moiety.
  • In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2′-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties. In certain embodiments, at least six nucleosides of the gap of a gapmer comprise a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2′-deoxyribosyl sugar moiety.
  • In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2′-modification.
  • Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE nucleosides in the 3′-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing. A mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing. A 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.
  • In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-8-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2′-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
  • In certain embodiments, modified oligonucleotides have the following sugar motif (5′ to 3′): eeeeedyddddddddeeeee, eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee, wherein ‘d’ represents a 2′-deoxyribosyl sugar moiety, ‘e’ represents a 2′-MOE sugar moiety, and ‘y’ represents a 2′-OMe sugar moiety.
  • 2. Certain Nucleobase Motifs
  • In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.
  • In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
  • 3. Certain Internucleoside Linkage Motifs
  • In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, all of the phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
  • In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sooosssssssssssssss, soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • C. Certain Lengths
  • It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
  • D. Certain Modified Oligonucleotides
  • In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • E. Certain Populations of Modified Oligonucleotides
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
  • F. Nucleobase Sequence
  • In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • II. Certain Oligomeric Compounds
  • In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.
  • Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • A. Certain Conjugate Groups
  • In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a N-acetylgalactosamine (GalNAc) cluster (e.g., WO2014/179620).
  • In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • 1. Conjugate Moieties
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • 2. Conjugate Linkers
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain oligomeric compounds, a conjugate moiety is attached to an oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieties, which are sub-units making up a conjugate linker. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.
  • 3. Cell-Targeting Moieties
  • In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:
  • Figure US20240026353A1-20240125-C00018
      • wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
  • In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
  • In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • B. Certain Terminal Groups
  • In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phosphate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphonates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.
  • III. Oligomeric Duplexes
  • In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • IV. Antisense Activity
  • In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • V. Certain Target Nucleic Acids
  • In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
  • A. Complementarity/Mismatches to the Target Nucleic Acid
  • It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.
  • In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.
  • In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5′-end of the 5′ wing region or the 3′ wing region.
  • B. SCN2A
  • In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is an SCN2A nucleic acid. In certain embodiments, the SCN2A nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000).
  • In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN1A protein in a cell. In certain embodiments, contacting a cell with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN2A protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 ameliorates one or more symptoms or hallmarks of a disease or disorder associated with a voltage-gated sodium channel protein. In certain embodiments, the voltage-gated sodium channel protein is SCN2A. In certain embodiments, the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A In certain embodiments, the subject has a disease or disorder associated with SCN1A. In certain embodiments, the disease or disorder is a Developmental or Epileptic Encephalopathy, such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the disease or disorder is an intellectual disability or an autism spectrum disorder; in certain embodiments, the disease or disorder is Dravet Syndrome.
  • In certain embodiments, the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), neurodevelopmental delays, sudden unexpected death in epilepsy, motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, and sleep problems. In certain embodiments, the seizures are any of focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
  • In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2, is capable of reducing the detectable amount of SCN2A RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2, is capable of reducing the detectable amount of SCN2A protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • In certain embodiments, oligomeric compounds do not comprise a bicyclic sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, oligomeric compounds do not comprise a LNA sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • Certain Target Nucleic Acids in Certain Tissues
  • In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.
  • VI. Certain Pharmaceutical Compositions
  • In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
  • In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
  • In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.
  • Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with Na+ ions. However, the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No. 1348259, equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1348259. When an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
  • VI. Certain Compositions
  • 1. Compound No. 1348259
  • In certain embodiments, Compound No. 1348259 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5′ to 3′) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 6-15 are 2′-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • In certain embodiments Compound No. 1348259 is represented b the following chemical notation:
  • (SEQ ID NO: 2493)
    Ges mCeoAeoTeoAeoAdsTds mCds mCds mCdsAdsTdsTdsAdsTdsAeo mCeoAesAesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • In certain embodiments, Compound No. 1348259 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00019
    • Structure 1. Compound No. 1348259
  • In certain embodiments, the sodium salt of Compound No. 1348259 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00020
  • Structure 2. The sodium Salt of Compound No. 1348259
  • 2. Compound No. 1348289
  • In certain embodiments, Compound No. 1348289 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CACGACATATTTTTCTACAC (SEQ ID NO: 2514), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • In certain embodiments, Compound No. 1348289 is represented by the following chemical notation: mCesAeomCeoGeoAeomCeoAdsTdsAdsTdsTdsTdsTdsTdsmCdsTdsAeomCesAesmCe (SEQ ID NO: 2514), wherein:
  • (SEQ ID NO: 2514)
    mCesAeo mCeoGeoAeo mCeoAdsTdsAdsTdsTdsTdsTdsTds mCdsTdsAeo mCesAes mCe,
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • In certain embodiments, Compound No. 1348289 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00021
    • Structure 3. Compound No. 1348289
  • In certain embodiments, the sodium salt of Compound No. 1348289 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00022
  • Structure 4. The sodium salt of Compound No. 1348289
  • 3. Compound No. 1348290
  • In certain embodiments, Compound No. 1348290 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 2510), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • In certain embodiments, Compound No. 1348290 is represented by the following chemical notation:
  • (SEQ ID NO: 2510)
    mCes mCeoAeo mCeoGeoAeo mCdsAdsTdsAdsTdsTdsTdsTdsTds mCdsTeoAes mCesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • In certain embodiments, Compound No. 1348290 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00023
    • Structure 5: Compound No. 1348290
  • In certain embodiments, the sodium salt of Compound No. 1348290 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00024
    • Structure 6: The Sodium Salt of Compound No. 1348290
  • 4. Compound No. 1348331
  • In certain embodiments, Compound No. 1348331 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • In certain embodiments, Compound No. 1348331 is represented by the following chemical notation:
  • (SEQ ID NO: 2487)
    Tes mCeoTeoGeo mCeoAeoTdsGdsTdsAdsAds mCds mCdsTdsTdsTdsAeoTesAes mCe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • In certain embodiments, Compound No. 1348331 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00025
    • Structure 7: Compound No. 1348331
  • In certain embodiments, the sodium salt of Compound No. 1348331 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00026
    • Structure 8: The Sodium Salt of Compound No. 1348331
  • 5. Compound No. 1348347
  • In certain embodiments, Compound No. 1348347 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • In certain embodiments, Compound No. 1348347 is represented by the following chemical notation:
  • (SEQ ID NO: 2493)
    Ges mCeoAeoTeoAeoAeoTds mCds mCds mCdsAdsTdsTdsAdsTdsAds mCeoAesAesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • In certain embodiments, Compound No. 1348347 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00027
    • Structure 9: Compound No. 1348347
  • In certain embodiments, the sodium salt of Compound No. 1348347 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00028
    • Structure 10: The Sodium Salt of Compound No. 1348347
  • 6. Compound No. 1348937
  • In certain embodiments, Compound No. 1348937 is characterized as a 5-8-5 MOE gapmer having a sequence (from 5′ to 3′) of CTGCATGTAACCTTTATA (SEQ ID NO: 2534), wherein each of nucleosides 1-5 and 14-18 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 6-13 are 2′-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 14 to 15 and 15 to 16 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • In certain embodiments, Compound No. 1348937 is represented by the following chemical notation:
  • (SEQ ID NO: 2534)
    mCesTeoGeo mCeoAesTdsGdsTdsAdsAds mCds mCdsTdsTeoTeoAesTesAe,

    wherein:
      • A=an adenine nucleobase,
      • mC=a 5-methyl cytosine nucleobase,
      • G=a guanine nucleobase,
      • T=a thymine nucleobase,
      • e=a 2′-MOE sugar moiety,
      • d=a 2′-β-D-deoxyribosyl sugar moiety,
      • s=a phosphorothioate internucleoside linkage, and
      • o=a phosphodiester internucleoside linkage.
  • In certain embodiments, Compound No. 1348937 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00029
    • Structure 11: Compound No. 1348937
  • In certain embodiments, the sodium salt of Compound No. 1348937 is represented by the following chemical structure:
  • Figure US20240026353A1-20240125-C00030
    • Structure 12: The Sodium Salt of Compound No. 1348937
  • VIII. Certain Hotspot Regions
  • In certain embodiments, nucleobases in the ranges specified below comprise a hotspot region of SCN2A nucleic acid. In certain embodiments, modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 69.9% or greater reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 59% or greater reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 1. Nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2
  • In certain embodiments, nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequences of SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, and 2526 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • The nucleobase sequence of Compound IDs: 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve at least 53% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 69.9% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 77.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 63.2% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 2. Nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2
  • In certain embodiments, nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequences of SEQ ID NOs: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, and 2521 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
  • The nucleobase sequence of Compound IDs: 909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 1348303, 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 1348375, 1348376, 1348377, 1348381, 1348382, 1348383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve at least 75% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 81.6% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 76.6% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 67.2% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 3. Nucleobases 243124-243204 of SEQ ID NO: 2
  • In certain embodiments, nucleobases 243124-243204 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequences of SEQ ID NOs: 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, and 2527 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • The nucleobase sequence of Compound IDs: 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 71.4% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.3% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.5% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 4. Nucleobases 243917-244073 of SEQ ID NO: 2
  • In certain embodiments, nucleobases 243917-244073 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequences of SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, and 2537 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • The nucleobase sequence of Compound IDs: 1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 1348332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 1348420, 1348421, 1348427, 1348428, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937, and 1348938 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve at least 80% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 80.5% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 67.7% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 62.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 5. Nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2
  • In certain embodiments, nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequences of SEQ ID NOs: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, and 2522 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • The nucleobase sequence of Compound IDs: 910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 910019, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 1348269, 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve at least 27% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 71.1% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 63.4% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 59.1% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 6. Nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2
  • In certain embodiments, nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequences of SEQ ID NOs: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, and 2539 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • The nucleobase sequence of Compound IDs: 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
  • In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 89% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 74.8% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 67.8% reduction of SCN2A RNA in vivo in the standard in vivo assay.
  • 7. Additional Hotspot Regions
  • In certain embodiments, the ranges described in the table below comprise hotspot regions. Each hotspot region begins with the nucleobase of SEQ ID NO:2 identified in the “Start Site SEQ ID NO: 2” column and ends with the nucleobase of SEQ ID NO: 2 identified in the “Stop Site SEQ ID NO: 2” column. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within any of the hotspot regions 1-17, as defined in the table below. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
  • In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the gapmers have the sugar motif in order from 5′ to 3′: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeddddddddeeeeee, eeeeeeddddddddeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. In certain embodiments, the gapmers comprise a 2′-substituted nucleoside in the gap. In certain embodiments, the 2′-substituted nucleoside comprises a 2′-OMe sugar moiety. In certain embodiments, the 2′-substituted nucleoside is at position 2 of the gap (5′ to 3′).
  • In certain embodiments, modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
  • In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5′ to 3′. In certain embodiments, the modified nucleotides have an internucleoside linkage motif of (from 5′ to 3′) of soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • The nucleobase sequence of compounds listed in the “Compound IDs in range” column in the table below are complementary to SEQ ID NO: 2 within the specified hotspot region. The nucleobase sequence of the oligonucleotides listed in the “SEQ ID NOs in range” column in the table below are complementary to the target sequence, SEQ ID NO: 2, within the specified hotspot region.
  • In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve at least “Min.% Red. in vitro” (minimum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg.% Red. in vitro” (average % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve a maximum of “Max. % Red. in vitro” (maximum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Cortex” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in cortical tissue, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Spinal” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in spinal cord tissue, as indicated in the table below. “n.d.” indicates that no in vivo data is available for compounds within that range. In other cases, average reduction in vivo includes a subset of the compounds in any given hotspot, as not all compounds were tested in vivo.
  • TABLE 1
    SCN2A Hotspots
    Avg % Avg %
    Start Site Stop Site Min % Max % Avg % Red. in Red. in SEQ ID
    Hotspot SEQ ID SEQ ID Red. in Red. in Red. in vivo vivo Compound IDs NOs in
    ID NO: 2 NO: 2 vitro vitro vitro Cortex Spinal in range range
    1 199863 199905 53 83 69.9 77.1 63.2 909979, 1248427, 336, 488,
    1248428, 1248429, 2021,
    1248430, 1248431, 2097,
    1248432, 1248433, 2174,
    1348279, 1348282, 2250,
    1348286, 1348297, 2326,
    1348328, 1348343, 2403,
    1348358, 1348360, 2499,
    1348361, 1348362, 2500,
    1348364, 1348365, 2501,
    1348366, 1348367, 2502, and
    1348378, and 2526
    1348380
    2 227493 227551 75 88 81.6 76.6 67.2 909989, 909990, 181, 259,
    1248487, 1248488, 643, 720,
    1248489, 1348289, 796, 2504,
    1348290, 1348291, 2505,
    1348292, 1348295, 2506,
    1348298, 1348302, 2507,
    1348303, 1348304, 2508,
    1348306, 1348307, 2509,
    1348369, 1348370, 2510,
    1348371, 1348373, 2511,
    1348374, 1348375, 2512,
    1348376, 1348377, 2513,
    1348381, 1348382, 2514, and
    1348383, 1348384, 2521
    1348385, 1348386,
    1348387, 1348405,
    1348411, 1348423,
    1348439, 1348440,
    1348441, 1348442,
    1348443, 1348444,
    1348446, 1348447,
    and 1348456
    3 243124 243204 51 90 71.4 61.3 61.5 1248507, 1248508, 491, 567,
    1248509, 1248510, 644, 721,
    1248511, 1248512, 797, 2177,
    1248513, 1248514, 2253,
    1248515, 1250138, 2315,
    1348299, 1348379, 2329,
    1348388, and 2406, and
    1348397 2527
    4 243917 244073 80 81 80.5 67.7 62.1 1250148, 1250149, 1090,
    1348250, 1348251, 1166,
    1348253, 1348259, 2484,
    1348265, 1348266, 2485,
    1348267, 1348331, 2487,
    1348332, 1348333, 2493,
    1348338, 1348342, 2496,
    1348344, 1348345, 2497,
    1348347, 1348419, 2498,
    1348420, 1348421, 2533,
    1348427, 1348428, 2534,
    1348435, 1348436, 2535, and
    1348437, 1348920, 2537
    1348922, 1348923,
    1348925, 1348927,
    1348928, 1348929,
    1348931, 1348934,
    1348935, 1348937,
    and 1348938
    5 247823 247921 27 92 71.1 63.4 59.1 910009, 910010, 29, 30,
    910011, 910012, 107, 108,
    910013, 910014, 185, 186,
    910015, 910016, 263, 264,
    910017, 910018, 341, 342,
    910019, 910020, 419, 420,
    1248528, 1248529, 1796,
    1248530, 1248531, 1871,
    1248532, 1248533, 1948,
    1248534, 1248535, 2025,
    1348269, 1348270, 2101,
    1348271, 1348275, 2178,
    1348277, 1348348, 2254,
    1348353, 1348355, 2330,
    1348356, 1348396, 2503,
    and 1348450 2517, and
    2522
    6 254142 254177 51 89 71.7 74.8 67.8 1248544, 1250225, 1016,
    1250226, 1250227, 1093,
    1250228, 1250229, 1104,
    1250230, 1250231, 1169,
    1250232, 1250233, 1246,
    1250234, 1250235, 1323,
    1250236, 1250237, 1400,
    1250238, 1250239, 1477,
    1348936, and 1554,
    1348939 1708,
    1785,
    1860,
    1937,
    2014,
    1631,
    2090, and
    2539
    7 168911 168945 71 93 81.2 n.d. n.d. 909945, 909946, 18, 96,
    1248352, 1248353, 485, 561,
    1248354, 1248355, 638, 715,
    1248356, 1248357, 791, 868,
    1248358, 1248359, 2247,
    and 1248360. 2323, and
    2400
    8 170026 170061 65 84 82.3 n.d. n.d. 909947, 1248366, 174, 1328,
    1248367, 1248368, 1405,
    1248369, 1248370, 1482,
    1248371, 1248372, 1559,
    1248373, 1248374, 1636,
    and 1248375 1713,
    1790,
    1865,
    1942, and
    2019
    9 170174 170200 69 93 81.6 n.d. n.d. 910246, 1249167, 302, 1513,
    1249168, 1249169, 1667,
    1249170, 1249171, 1744,
    and 1249172 1819,
    1896, and
    1973
    10 176724 176751 75 94 86.7 n.d. n.d. 910256, 910257, 148, 226,
    1249294, 1249295, 1364,
    1249296, 1249297, 1441,
    1249298, and 1518,
    1249299 1595,
    1672, and
    1749
    11 180772 180801 67 93 78.6 n.d. n.d. 910263, 1249423, 227, 1292,
    1249424, 1249425, 1369.
    1249426, 1249427, 1446,
    1249428, 1249429, 1523,
    and 1249430 1600,
    1677,
    1754, and
    1829
    12 183519 183562 73 97 83.1 n.d. n.d. 909954, 909955, 20, 98,
    909956, 909957, 253, 332,
    909958, 1248393, 410, 1406,
    1248394, 1248395, 1483,
    1248396, 1248397, 1560,
    1248398, 1248399, 1637,
    and 1248400 1714,
    1791,
    1866, and
    1943
    13 183968 184016 60 95 77.1 n.d. n.d. 910269, 1249480, 228, 1679,
    1249481, 1249482, 1756,
    1249483, 1249484, 1831,
    1249485, 1249486, 1908,
    1249487, and 1985,
    1249488 2061,
    2138,
    2214, and
    2290
    14 188630 188668 68 86 77.1 n.d. n.d. 909962, 909963, 21, 411,
    1248419, 1248420, 1407,
    1248421, 1248422, 1484,
    and 1248423 1561,
    1638, and
    1715
    15 199912 199962 72 94 82.7 n.d. n.d. 909980, 909981, 24, 414,
    1248438, 1248439, 871, 948,
    1248440, and 1025, and
    1248441 1100
    16 202877 202906 70 92 81.5 n.d. n.d. 1249708, 1249709, 1226,
    1249710, 1249711, 1303,
    1249712, and 1380,
    1249713 1457,
    1534, and
    1611
    17 227419 227450 67 92 80.6 n.d. n.d. 909985, 909986, 25, 337,
    909987, 1248480, 415, 490,
    1248481, 1248482, 566, 2099,
    1248483, 1248484, 2176,
    1248485, and 2252,
    1248486 2328, and
    2405
  • IX. Certain Comparator Compounds
  • Comparator Compound No. 1506060 was selected as a comparator compound in the experiment described in Example 4 of the instant specification. Comparator Compound No. 1506060, previously described in WO2020/041348, incorporated herein by reference, is a 4-8-4 LNA gapmer with the sequence (from 5′ to 3′) TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), wherein the central gap segment consists of eight 2′-β-D-deoxynucleosides, the 5′ and 3′ wing segments each consist of four LNA modified nucleosides, and each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • In certain embodiments, compounds described herein are more tolerable relative to Comparator Compound No. 1506060.
  • For example, as described herein (see Example 4), Comparator Compound No. 1506060 had a 3-hour FOB of 6.00 in mice, whereas Compound Nos. 1348290, 1348331, and 1348347 each had a 3-hour FOB of 0.00 in mice, and Compound Nos. 1348259, 1348289, and 1348937 each had a 3-hour FOB of 0 or 1.00 in mice. Therefore, certain compounds described herein are more tolerable than Comparator Compound No. 1506060 in this assay.
    • Nonlimiting Disclosure and Incorporation by Reference
  • Each of the literature and patent publications listed herein is incorporated by reference in its entirety.
  • While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
  • Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or β such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms of the compounds herein are also included unless otherwise indicated. Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures. For example, oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which chirality of the phosphorothioate internucleoside linkages is controlled or is random. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
  • The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
    • EXAMPLES
  • The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
    • Example 1: Effect of 5-10-5 MOE Gapmer Modified Oligonucleotides on Human SCN2A RNA In Vitro, Single Dose
  • Modified Oligonucleotides Complementary to Human SCN2A Nucleic Acid were Designed and Tested for their single dose effects on SCN2A RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.
  • The modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides and the 5′ and 3′ wing segments each consists of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar, and ‘e’ represents a 2′-MOE sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): soooossssssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to either human SCN2A mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or the human SCN2A genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Cultured SH-SY5Y cells were treated with modified oligonucleotide at a concentration of 4000 or 5000 nM using electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SCN2A RNA levels were measured by quantitative real-time RTPCR. SCN2A RNA levels were measured by Human primer probe set RTS36041 (forward sequence CCTTGAACCTGAAGCCTGTT, designated herein as SEQ ID NO: 10; reverse sequence CGAACCAATTGTGCTCCACTA, designated herein as SEQ ID NO: 11; probe sequence TTCCACCAGAGTTTCCCTTTGCCT, designated herein as SEQ ID NO: 12). SCN2A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA amount relative to the amount in untreated control cells (% control). Each table represents results from an individual assay plate. The values marked with an “T” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • TABLE 2
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 5000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ SCN2A
    ID NO: ID NO: ID NO: ID NO: RNA SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    ID Site Site Site Site Sequence (5′ to 3′) control) NO
    909933 N/A N/A 166831 166850 GACATATGTCTGAAGCAGCC  77 16
    909939 N/A N/A 167084 167103 ATTGATAAGCTGGCACCAAG  27 17
    909945  374  393 168919 168938 GTTTGGGTCTCTTAGCTTTC  10 18
    909951 1064 1083 183411 183430 ACTGCAATCCTATTAGCGCA   7 19
    909957 1188 1207 183535 183554 GTCCTATTGAAAGTAGTACC  22 20
    909963 1840 1859 188649 188668 TTCCGATTTTCGGACTCTGT  23 21
    909969 2080 2099 196286 196305 TCGGCTGTCATTGTCCTCAA  17 22
    909975 2095 2114 196301 196320 GAACAGAGAGTCTCTTCGGC  21 23
    909981 2367 2386 199924 199943 CTTTGCCTTGATGTAGGATC  10 24
    909987 3437 3456 227431 227450 CTATGGTGGTATGGTTGGAA   8 25
    909993 3647 3666 227641 227660 CCTCCATATCTGACTCGCTG  26 26
    909999 3723 3742 238188 238207 TCTCCCTCGGCGGGAGCTCC  45 27
    910005† 3804 3823 240222 240241 CAACACTTGAACTTCCGTAC   8 28
    910010 4399 4418 247833 247852 GACCACGCTTACATCAAACA  24 29
    910016 4423 4442 247857 247876 AGCTTTGCACTCACTGTAGT  28 30
    910022 4587 4606 253592 253611 TACTTGGGTTGTAATTCTAC  13 31
    910028 6030 6049 262558 262577 TTTTGCTTCAAGAGGTAGCG  61 32
    910034 6196 6215 262724 262743 GGTCACACTATCATACGAGG  26 33
    910040 6482 6501 263010 263029 CCCATCGATACTATTTCTCC  54 34
    910046 6539 6558 263067 263086 GTAGCCATTACGCCTCTGCT  39 35
    910052 6848 6867 263376 263395 GAATTGCAGCATGCCTCCAT  37 36
    910057 7340 7359 263868 263887 CTATGTCAACCTTACCAAGA  39 37
    910063 7687 7706 264215 264234 GTTTGCTGCAACCTATTGCT  37 38
    910069 7994 8013 264522 264541 CCTACACTGCATCCTAGTCC  54 39
    910075 8251 8270 264779 264798 GTTCTAGTGCCATATGGGTC  45 40
    910081 8448 8467 264976 264995 ACCGTTCTTTATGGTAACAG  31 41
    910087 8471 8490 264999 265018 TTGGCTTGATTGTAATGTGG  30 42
    910093 N/A N/A 112411 112430 GGTACCCAATGTCTGTTAGA 120 43
    910099   17   36 112430 112449 GTTCTGACAGTCATTCGATG  81 44
    910105 N/A N/A  68142  68161 CACGCCAGTCTTCAGCAGTT  70 45
    910111 N/A N/A  67941  67960 CACCTAAATCAGGGCAGTGC 101 46
    910117 N/A N/A  67973  67992 GCATTCCCCGCTGCAGTAAG 125 47
    910123 N/A N/A  81138  81157 GCAGAACAGTAGTATTCCTC 141 48
    910129 N/A N/A   4279   4298 GGAGCTTGGTCTGTCAAATG  39 49
    910135 N/A N/A  45144  45163 TTAGTTAAGTAATGGTTGGC  78 50
     45306  45325
    910141 N/A N/A  60136  60155 ATGTTCCACTAGTCTACCTC  81 51
    910147 N/A N/A  86329  86348 GCACAAGACTAAACAGAGTG 106 52
    910153 N/A N/A 104618 104637 GCACCAGTGGCCCCCTTAGT 119 53
    910159 N/A N/A 114797 114816 GCCCCCCATGGACAGAAATT  66 54
    910165 N/A N/A 118897 118916 GCAGCTTAGCTGAATGCCCT 112 55
    910171 N/A N/A 121863 121882 CATGGTGCCCCTTAGTATGC  96 56
    910177 N/A N/A 125285 125304 TGTTGACAGAAAGTCCCCTC  69 57
    910183 N/A N/A 128499 128518 GGAGTTAAACCATAGAGCCA  63 58
    128542 128561
    910189 N/A N/A 131428 131447 CTCTCCAGCAAGCAACGGAC  74 59
    910195 N/A N/A 135640 135659 CGCCCATTAATCACTTGTTG  78 60
    910201 N/A N/A 142375 142394 CCACCATGTTTGCTTGGTGG  79 61
    910207 N/A N/A 146958 146977 CCCCACCATATTGCTGCACC  86 62
    910213 N/A N/A 150788 150807 GGGTGAAATAGCCTCTGTCG  75 63
    910219 N/A N/A 154773 154792 CCTTGTGTGGCTGCCCACGA 115 64
    910225 N/A N/A 158222 158241 GGTGGAACAGTCTACTGCCC  55 65
    910231 N/A N/A 161691 161710 TAACCTGAATCCACTAGCCC  85 66
    910237 N/A N/A 165153 165172 GTTCATGGTTTGTCCAGGGC  75 67
    910243 N/A N/A 168057 168076 GGTCTGTAGCTCGGACCCCC  39 68
    910249 N/A N/A 172552 172571 GACTATTAGCCTCACTGCCT  17 69
    910255 N/A N/A 175759 175778 CCCCTGTCTCCGTGGAGCGA  24 70
    910261 N/A N/A 179336 179355 CCCCGTGGCAGATTGGCACC  20 71
    910267 N/A N/A 182818 182837 GCAGCACTCATGCTATCCCT  16 72
    910273 N/A N/A 187114 187133 AGGACCGTATGCTTGTTCAC  36 73
    910279 N/A N/A 189972 189991 GGCATTCTTCATAGGCAACT  12 74
    910285 N/A N/A 196488 196507 GCCTCACCTCTGGTAGGAGC  43 75
    910291 N/A N/A 200571 200590 TCACAGATTAAGCTGTCCCC  17 76
    910297 N/A N/A 204970 204989 TGTCCCCTCCCTACATAGTC  39 77
    910303 N/A N/A 209576 209595 GCTCCCATTTACCCTAATCC  25 78
    910309 N/A N/A 214387 214406 ATATCACCACTGTGGGCCGG  55 79
    910315 N/A N/A 218046 218065 TGGTCTAAACTATACATGGC  19 80
    910321 N/A N/A 223836 223855 TGGACTTCCTTTGTTACCGA  15 81
    910327 N/A N/A 228592 228611 CTTCCTCGCCAAACAGTTCG  40 82
    910333 N/A N/A 231798 231817 ACACCCTAGGAGCAAGAGTT  20 83
    910339 N/A N/A 234815 234834 GAACTGTAGTTTAACTGTGG  32 84
    910345 N/A N/A 235696 235715 CGTACTCTAGGCCCTATGGA  13 85
    910351 N/A N/A 239653 239672 GACCTCGGCTCATGCACTGC  45 86
    910357 N/A N/A 242417 242436 AGCTCCATACAAGGACCTAA  20 87
    910363 N/A N/A 246343 246362 GGCATTCAGTCTTACCCTCA  14 88
    910369 N/A N/A 248839 248858 CATTGTGTATGTCTATAGGG  19 89
    910375 N/A N/A 252486 252505 CCCTTGGTGTACCCTTCTCA  25 90
    910381 N/A N/A 255582 255601 GCTATTCTTACAGCAGGTCG  11 91
    910387 N/A N/A 258291 258310 TAACCTCTGTTGGGCTGCCT  53 92
    910393 N/A N/A 259528 259547 CAGGTAAGTAGTGTAAATAG  27 93
  • TABLE 3
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 5000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
    909934 N/A N/A 166889 166908 TAACTACCACTAGAGGGCGG  96  94
    909940 N/A N/A 167087 167106 GGGATTGATAAGCTGGCACC  24  95
    909946  381  400 168926 168945 CGTTCCTGTTTGGGTCTCTT   7  96
    909952 1066 1085 183413 183432 CAACTGCAATCCTATTAGCG  31  97
    909958 1195 1214 183542 183561 GCTCACTGTCCTATTGAAAG   3  98
    909964 1842 1861 188651 188670 GATTCCGATTTTCGGACTCT  38  99
    909970 2082 2101 196288 196307 CTTCGGCTGTCATTGTCCTC  22 100
    909976 2138 2157 196344 196363 GGCTGACATTGCTGTGGCGC  15 101
    909982 2490 2509 204392 204411 GGTTTACAACAGTCCCAAAT  26 102
    909988 3471 3490 227465 227484 CCGTCTTTGAGATAATTGAG   5 103
    909994 3705 3724 238170 238189 CCAATATCAACCGTGCTGCC  47 104
    910000 3725 3744 238190 238209 GTTCTCCCTCGGCGGGAGCT  49 105
    910006† 3806 3825 240224 240243 GACAACACTTGAACTTCCGT   5 106
    910011 4403 4422 247837 247856 TGTTGACCACGCTTACATCA  28 107
    910017 4440 4459 247874 247893 TGATTGCTCTCAATGAGAGC  73 108
    910023 4598 4617 253603 253622 GGTTGTCTTCATACTTGGGT  11 109
    910029 6091 6110 262619 262638 GGGTGTTCCATCACATTCTT  59 110
    910035 6359 6378 262887 262906 GTGGGAGTCCTGTTGACACA  50 111
    910041 6486 6505 263014 263033 ACCTCCCATCGATACTATTT  46 112
    910047 6543 6562 263071 263090 CTGAGTAGCCATTACGCCTC  45 113
    910053 6944 6963 263472 263491 CGAATAGCTATTTAAGCACC  38 114
    910058 7344 7363 263872 263891 TATACTATGTCAACCTTACC  51 115
    910064 7753 7772 264281 264300 GTCGGGCTTTTCATCATTGA  27 116
    910070 8031 8050 264559 264578 TGTGTGCAAGTTTACAGTAC  27 117
    910076 8253 8272 264781 264800 CAGTTCTAGTGCCATATGGG  23 118
    910082 8453 8472 264981 265000 GGTTTACCGTTCTTTATGGT  41 119
    910088 8676 8695 265204 265223 GTAGTTATCCAATACACTCT  30 120
    910094    2   21 112415 112434 CGATGGTACCCAATGTCTGT  73 121
    910100   19   38 112432 112451 CTGTTCTGACAGTCATTCGA  87 122
    910106 N/A N/A  68149  68168 GACAGACCACGCCAGTCTTC 125 123
    910112 N/A N/A  67945  67964 TCCACACCTAAATCAGGGCA  88 124
    910118 N/A N/A  67975  67994 CTGCATTCCCCGCTGCAGTA  87 125
    910124 N/A N/A  81145  81164 TAGTCCAGCAGAACAGTAGT  96 126
    910130 N/A N/A  10920  10939 GGCCATGGAGCACTACCCCA 143 127
    910136 N/A N/A  45145  45164 GTTAGTTAAGTAATGGTTGG  95 128
    N/A N/A  45307  45326
    910142 N/A N/A  61499  61518 CGCGCCCTGCTGCACAGGTG 177 129
    910148 N/A N/A  88505  88524 CTACCCTTTTATTTGGGTAG  88 130
    910154 N/A N/A 110407 110426 ATGCTCACAATCTAGACTCC 100 131
    910160 N/A N/A 115370 115389 GGCCTCCTATGATATTGTTA  68 132
    910166 N/A N/A 119784 119803 GGCATGATTGCTGGGCATCA  70 133
    910172 N/A N/A 122320 122339 CCAGTGCTTTGCTCCACACG  68 134
    910178 N/A N/A 125962 125981 GCCCGTCCCCACTGACCAAT  72 135
    910184 N/A N/A 128500 128519 TGGAGTTAAACCATAGAGCC  78 136
    N/A N/A 128543 128562
    910190 N/A N/A 131799 131818 GCCTACTATAATAGCCCCCA  75 137
    910196 N/A N/A 137199 137218 TAGTGCAGGATTTTGCCCAC  81 138
    910202 N/A N/A 142673 142692 TGGTCACATATGAGGTCCAA  93 139
    910208 N/A N/A 147833 147852 AGCCCGGGCTGCCCGGAAAA 111 140
    910214 N/A N/A 151191 151210 ATAATGTGCTCACGGTCTTC  91 141
    910220 N/A N/A 155700 155719 CCCCAGCTGCGAGTAGTGCC  64 142
    910226 N/A N/A 159287 159306 GGTGAGCCCCATGTTCAGCC  75 143
    910232 N/A N/A 162056 162075 GTGGTTGTGGATAAGTGCGC  91 144
    910238 N/A N/A 165156 165175 TTGGTTCATGGTTTGTCCAG  81 145
    910244 N/A N/A 168609 168628 GAATCTCATATGTGCATCCA  22 146
    910250 N/A N/A 173305 173324 ATGTTGCATCCCAATGCTTA  21 147
    910256 N/A N/A 176729 176748 AGGGTCAAGTTTTTACGCTT  10 148
    910262 N/A N/A 180045 180064 GCAGGTATAGCCAATGCCCT  29 149
    910268 N/A N/A 183262 183281 AACAGCTATTTTACCGGCAA  34 150
    910274 N/A N/A 187485 187504 CCACCTCTGGTGATACTGCA  33 151
    910280 N/A N/A 191068 191087 CAGACACGATGGGCCCTCCA  34 152
    910286 N/A N/A 197133 197152 GTGATTGGTTTTGGGCCACT  15 153
    910292 N/A N/A 201329 201348 GCTAACGCAGGCGAGGTTGG  17 154
    910298 N/A N/A 205501 205520 GATACAGTTTCCCAACTGCG  19 155
    910304 N/A N/A 209963 209982 CTATGTACCGCTTTAATCTA  36 156
    910310 N/A N/A 214947 214966 CCTAGCAGTGCGGGCTTCCA  42 157
    910316 N/A N/A 218623 218642 CGGTGTGCTGTGACCCATCT  21 158
    910322 N/A N/A 224270 224289 GCAGCCAATCTACCCGTGGT  26 159
    910328 N/A N/A 229258 229277 GTAATTCTTTGCCCCAGGAC  14 160
    910334 N/A N/A 232338 232357 ACCCTTGCCTCTTTCCGAGA  37 161
    910340 N/A N/A 235294 235313 GCTCCCTTTCATTTTAGTGC  22 162
    910346 N/A N/A 236310 236329 GACTTCGGGTGACCCCAAGG  33 163
    910352 N/A N/A 240745 240764 GCTCCTACCGGCACCCATGC  47 164
    910358 N/A N/A 242892 242911 TTGGTCTCAGTGTACCCCCA  22 165
    910364 N/A N/A 246704 246723 CACAGCGGAGTAGTGAAGAA  32 166
    910370 N/A N/A 249680 249699 CCCTTTTCAACCCCCCTTGG  57 167
    910376 N/A N/A 253093 253112 GAACAGTGGCGGCCAGTAGT  13 168
    910382 N/A N/A 255973 255992 ACACCCCTACCACTACAGGT  47 169
    910388 N/A N/A 259152 259171 TCTTAATGCTACCTCATAGC  76 170
    N/A N/A 260854 260873
    910394 N/A N/A 260307 260326 CAGGAGTATGACCAGGTACA  52 171
  • TABLE 4
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 5000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
    909935 N/A N/A 166891 166910 TGTAACTACCACTAGAGGGC  81 172
    909941 N/A N/A 167093 167112 GAGTTTGGGATTGATAAGCT  29 173
    909947  566  585 170037 170056 ATCGAGAGATTGCTTTCCCT   9 174
    909953 1116 1135 183463 183482 GAATTATCTGGAGGCCATTG  23 175
    909959 1671 1690 188480 188499 GATTCAGCAGATGCGGCTGC  28 176
    909965 1989 2008 196195 196214 AGGCTCGCCCTACTGTTGCG  21 177
    909971 2084 2103 196290 196309 CTCTTCGGCTGTCATTGTCC  32 178
    909977 2236 2255 196442 196461 GCCCCCGACCAGGGAGACCA  49 179
    909983 2494 2513 204396 204415 CCATGGTTTACAACAGTCCC  28 180
    909989 3499 3518 227493 227512 GCTGCCTATGCCACTAGTAG  12 181
    909995 3708 3727 238173 238192 GCTCCAATATCAACCGTGCT  21 182
    910001 3729 3748 238194 238213 GGCTGTTCTCCCTCGGCGGG  35 183
    910007† 3880 3899 240298 240317 GTGCTCCACTATCTTATAGC   3 184
    910012 4406 4425 247840 247859 AGTTGTTGACCACGCTTACA  20 185
    910018 4443 4462 247877 247896 GTTTGATTGCTCTCAATGAG  34 186
    910024 5020 5039 259936 259955 GTAACGAAGAGAGATCAGTT  37 187
    910030 6095 6114 262623 262642 TGATGGGTGTTCCATCACAT  67 188
    910036 6362 6381 262890 262909 CCTGTGGGAGTCCTGTTGAC  48 189
    910042 6489 6508 263017 263036 GAAACCTCCCATCGATACTA  49 190
    910048 6545 6564 263073 263092 GTCTGAGTAGCCATTACGCC  66 191
    910054 6946 6965 263474 263493 TACGAATAGCTATTTAAGCA  37 192
    910059 7528 7547 264056 264075 GCTTCAAACTATAATGGAAC  33 193
    910065 7756 7775 264284 264303 ACAGTCGGGCTTTTCATCAT  23 194
    910071 8173 8192 264701 264720 GACTAGGTGGAAACATTGGA  32 195
    910077 8257 8276 264785 264804 GATACAGTTCTAGTGCCATA  26 196
    910083 8455 8474 264983 265002 GTGGTTTACCGTTCTTTATG  23 197
    910089 8705 8724 265233 265252 CCATATCTAGCTTTTTGGCC  56 198
    910095    6   25 112419 112438 CATTCGATGGTACCCAATGT  61 199
    910101 N/A N/A  68125  68144 GTTTGGTTGCTACAATCCCT  90 200
    910107 N/A N/A  68151  68170 CAGACAGACCACGCCAGTCT 105 201
    910113 N/A N/A  67952  67971 GGCATCATCCACACCTAAAT 146 202
    910119 N/A N/A  67979  67998 TACTCTGCATTCCCCGCTGC 129 203
    910125 N/A N/A  81153  81172 CACTTCATTAGTCCAGCAGA  84 204
    910131 N/A N/A  13052  13071 ATTGGCCCACATATGTCAAT  82 205
    910137 N/A N/A  45146  45165 GGTTAGTTAAGTAATGGTTG  82 206
    910143 N/A N/A  66809  66828 GCTAGACAAATCCCAATCCT  98 207
    910149 N/A N/A  92636  92655 GCTTTCCAGTGCGCCCCAGG 100 208
    910155 N/A N/A 110587 110606 GCACGCCACCTCATGCCCCC 106 209
    910161 N/A N/A 115772 115791 GTCTCTTCCACGACCTTGGT  92 210
    910167 N/A N/A 119798 119817 ATCTAGGGACATGTGGCATG  86 211
    910173 N/A N/A 122696 122715 GACTCTTTAGGAGAGTTAAC  75 212
    910179 N/A N/A 126382 126401 AGGCTATAAGTGGCCTCTCA  48 213
    910185 N/A N/A 128584 128603 GGGTTAAACCATAGAGCCAT 100 214
    910191 N/A N/A 132879 132898 GATTCCGTGAATGGGTCTGG  77 215
    910197 N/A N/A 137619 137638 CCTATCAGAGGGTGTGTGAC  74 216
    910203 N/A N/A 143552 143571 GGCGATAGTAGCCAGAGTCC  60 217
    910209 N/A N/A 147840 147859 ATAGCCAAGCCCGGGCTGCC  97 218
    910215 N/A N/A 151615 151634 CCTCTTACCAACCCCCACGA  77 219
    910221 N/A N/A 155704 155723 GAGGCCCCAGCTGCGAGTAG  94 220
    910227 N/A N/A 160224 160243 CGCCGTAACCAGGCCATAAC  63 221
    910233 N/A N/A 162830 162849 CTCTCCCATTGATTCTAGCC  56 222
    910239 N/A N/A 166137 166156 GATATTAGCCTCAGCCCCAG  72 223
    910245 N/A N/A 169307 169326 TTCCCGCGCTGGAGGATGCC  28 224
    910251 N/A N/A 173911 173930 ATCGGTCCCAGTCTCCTTGC  15 225
    910257 N/A N/A 176731 176750 CTAGGGTCAAGTTTTTACGC  14 226
    910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA   7 227
    910269 N/A N/A 183973 183992 GCATCAACCAAATAGGGCCA   5 228
    910275 N/A N/A 188458 188477 CTGCCGCCTAGAAGGGCGCA  79 229
    910281 N/A N/A 191544 191563 GTGCCCCATCCGTTAGCATC  33 230
    910287 N/A N/A 197777 197796 AGGTTCAGTAACCAGCATAC  35 231
    910293 N/A N/A 201697 201716 AACCCCATGTCACATAGTTC  44 232
    910299 N/A N/A 206261 206280 CGTAAGACCAGCCCCAGCTT  39 233
    910305 N/A N/A 210937 210956 AGCTGTCTACATACCCCTGA  33 234
    910311 N/A N/A 215590 215609 GGTGGTATGGCAATCCAATT  18 235
    910317 N/A N/A 220917 220936 ATCCCTCAGTCACTGGGTAC  36 236
    910323 N/A N/A 225034 225053 ATCAATCCTTCCCCAGGGCG  27 237
    910329 N/A N/A 229738 229757 CGCTCTTTTGGAAAACCCAC  13 238
    910335 N/A N/A 232818 232837 TGCTCAGTAGATTACCAGTG  11 239
    910341 N/A N/A 235624 235643 GGATAATACACCAATATAGT  19 240
    910347 N/A N/A 237210 237229 GGCCACAGCATTCTCGGACC  39 241
    910353 N/A N/A 241447 241466 AGGACGGGTACCTGGCGAGG  58 242
    910359 N/A N/A 243777 243796 GGCTACTTGGTCAATAGCCA  63 243
    910365 N/A N/A 247097 247116 ACACCATTCATCTCTAGTTG  33 244
    910371 N/A N/A 250433 250452 TGTTTTGCGATATGCATTGA  17 245
    910377 N/A N/A 254187 254206 TATTCTTACAGCAGGTCGAG  21 246
    255580 255599
    910383 N/A N/A 256523 256542 GTTAACGGTTTCTTACTGCT  19 247
    910389 N/A N/A 259509 259528 GGGAAGCTCCATGTCAGATC  28 248
    910395 N/A N/A 260723 260742 CCCCAAATAGGTAGAACCTT  56 249
  • TABLE 5
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 5000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
    909936 N/A N/A 166893 166912 ATTGTAACTACCACTAGAGG  65 250
    909942  285  304 168830 168849 GGCGGTACCAGCACTGACTG  20 251
    909948 1055 1074 183402 183421 CTATTAGCGCAAACACGCTT  29 252
    909954 1174 1193 183521 183540 AGTACCATTCCCATCCAATG  17 253
    909960 1674 1693 188483 188502 CTTGATTCAGCAGATGCGGC  38 254
    909966 1993 2012 196199 196218 GAAAAGGCTCGCCCTACTGT  39 255
    909972 2088 2107 196294 196313 GAGTCTCTTCGGCTGTCATT  39 256
    909978 2243 2262 196449 196468 TAGAAGGGCCCCCGACCAGG  52 257
    909984 2503 2522 204405 204424 CACCTTTAACCATGGTTTAC  60 258
    909990 3531 3550 227525 227544 TCACTTTCATCCACGACATA  22 259
    909996 3712 3731 238177 238196 GGGAGCTCCAATATCAACCG  18 260
    910002† 3752 3771 238217 238236 GGGATTCCTCAGGTTCAACC  19 261
    910008 4128 4147 246225 246244 GTTAAGCTAACCAGTGAGAC  39 262
    910013 4410 4429 247844 247863 CTGTAGTTGTTGACCACGCT  15 263
    910019 4447 4466 247881 247900 GGCAGTTTGATTGCTCTCAA  26 264
    910025 5031 5050 259947 259966 GTGAAATAGTAGTAACGAAG  38 265
    910031 6098 6117 262626 262645 CTTTGATGGGTGTTCCATCA  64 266
    910037 6368 6387 262896 262915 AGACCTCCTGTGGGAGTCCT  61 267
    910043 6491 6510 263019 263038 TAGAAACCTCCCATCGATAC  46 268
    910049 6564 6583 263092 263111 CTTTAAATTGGTTCCTATCG  80 269
    910055 7173 7192 263701 263720 GATAGTCATGCTGCTGGGAC  45 270
    910060 7607 7626 264135 264154 GGCTTCCCATATTAGACTTC  25 271
    910066 7758 7777 264286 264305 GTACAGTCGGGCTTTTCATC  35 272
    910072 8243 8262 264771 264790 GCCATATGGGTCAATAAGAT  19 273
    910078 8275 8294 264803 264822 GGATCCCATATTATATCTGA  60 274
    910084 8460 8479 264988 265007 GTAATGTGGTTTACCGTTCT  36 275
    910090 8723 8742 265251 265270 CCACTAGTCTACCTGATGCC  78 276
    910096    8   27 112421 112440 GTCATTCGATGGTACCCAAT  83 277
    910102 N/A N/A  68127  68146 CAGTTTGGTTGCTACAATCC 124 278
    910108 N/A N/A  67895  67914 CCAATGATGTGCTCGGAGCC 115 279
    910114 N/A N/A  67958  67977 GTAAGTGGCATCATCCACAC 124 280
    910120 N/A N/A  68026  68045 GAGCACTGAACAGCATCCCC  82 281
    910126 N/A N/A  81155  81174 GGCACTTCATTAGTCCAGCA 105 282
    910132 N/A N/A  25045  25064 TCGGGACATAGTTATGTTGT  73 283
    910138 N/A N/A  45303  45322 GTTAAGTAATGGTTGGCTCT 116 284
    910144 N/A N/A  72609  72628 ACCACAAGTTTCAATGTGCC  69 285
    910150 N/A N/A  97682  97701 AACTAATGAGGTCCTAGGCT  97 286
    910156 N/A N/A 112991 113010 GAGCCACTGCCATGTTAATC  65 287
    910162 N/A N/A 116308 116327 CCCGGCCATGACATTGACTC  72 288
    910168 N/A N/A 120435 120454 GGCAATAGGGTGGTCATCAG  79 289
    910174 N/A N/A 123275 123294 GTAGGACATAGTTATGTTGT  59 290
    910180 N/A N/A 127396 127415 TTTCCGAAAGAACACCCTCA  84 291
    910186 N/A N/A 128915 128934 CCATCAAGTTTCTGGTAGGG  57 292
    910192 N/A N/A 133286 133305 TGCCCGCACTCCATGGATCA  78 293
    910198 N/A N/A 138615 138634 CTATGGAGGTTGATAGTGGG 101 294
    910204 N/A N/A 144488 144507 TTGGTTACACCAAGCCAGGC  77 295
    910210 N/A N/A 148389 148408 GTGGTACAAATTGCTCCAGG  65 296
    910216 N/A N/A 152213 152232 GATGGAAGCTAACTCCCCCT  87 297
    910222 N/A N/A 156329 156348 GATCCCTAGTCCTGAGTGCT 100 298
    910228 N/A N/A 160587 160606 ACGGTCAGGTGGTTACTAAA  86 299
    910234 N/A N/A 163742 163761 GTCCTACTGCAATCAAGCGC  87 300
    910240 N/A N/A 166626 166645 GTAGTGCACTGCTTAATGGC  93 301
    910246 N/A N/A 170179 170198 GTGTAGCTCAATAACTTGGT  11 302
    910252 N/A N/A 174379 174398 TACTAGTGTGATTTGGAGGG  26 303
    910258 N/A N/A 177000 177019 ATGCTGCATTATGGACTCGG   9 304
    910264 N/A N/A 181552 181571 CACTTCCAGGTTGGTCCCCC  15 305
    910270 N/A N/A 184951 184970 GCCACCCTGTTTAGGTGGCA  91 306
    910276 N/A N/A 188459 188478 GCTGCCGCCTAGAAGGGCGC  72 307
    910282 N/A N/A 192994 193013 CCGATGAGGCTTTGTTTGGA  16 308
    910288 N/A N/A 198263 198282 GCTTCAAGCTGGCCCCAACT  34 309
    910294 N/A N/A 202319 202338 GCGCTTCTAACTCACCCTCC  32 310
    910300 N/A N/A 207031 207050 GCGCTTGTTACTCCCTAGGA  16 311
    910306 N/A N/A 211928 211947 CGCCCGGCTAGATGTAGGGT  47 312
    910312 N/A N/A 216181 216200 GTAACCGTGTACAGCCTCTG  22 313
    910318 N/A N/A 221714 221733 CAGCCCCAGTCAAGATAACT  52 314
    910324 N/A N/A 226106 226125 ATAGGCTCCACCAGTATGAA  28 315
    910330 N/A N/A 230447 230466 GTCCACTCAGTCTGCCTTAT  10 316
    910336 N/A N/A 233677 233696 GTAGCATAGCCCTTGCCTAG  19 317
    910342 N/A N/A 235631 235650 GCCATATGGATAATACACCA   9 318
    910348 N/A N/A 238060 238079 ATTAGGTGTGCCCCCCCCCC  69 319
    910354 N/A N/A 241551 241570 CAATAGCGAATCAGTGTGAA  34 320
    910360 N/A N/A 244598 244617 CCCGCCCTGCATGTCATGCA  68 321
    910366 N/A N/A 247538 247557 ACTAGACTCTGGTAGCTCCA  12 322
    910372 N/A N/A 250934 250953 TGACCAGGACTATCAGAGCC  23 323
    910378 N/A N/A 254189 254208 GTTATTCTTACAGCAGGTCG  15 324
    910384 N/A N/A 257640 257659 CCACTTGTTTTGAGGCCCCT  49 325
    910390 N/A N/A 259516 259535 GTAAATAGGGAAGCTCCATG  43 326
    910396 N/A N/A 260802 260821 GTTACAATGTTCTATTCGAC  49 327
  • TABLE 6
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 5000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
    909533 4131 4150 246228 246247 GCAGTTAAGCTAACCAGTGA  15 328
    909937 N/A N/A 166922 166941 TTCCTGTACAGGGACTACAA  68 329
    909943  316  335 168861 168880 CCTGGTAAAGAAGCGGAAGC  31 330
    909949 1058 1077 183405 183424 ATCCTATTAGCGCAAACACG  24 331
    909955 1177 1196 183524 183543 AGTAGTACCATTCCCATCCA  11 332
    909961 1676 1695 188485 188504 CTCTTGATTCAGCAGATGCG  28 333
    909967 1996 2015 196202 196221 GCTGAAAAGGCTCGCCCTAC  13 334
    909973 2090 2109 196296 196315 GAGAGTCTCTTCGGCTGTCA  30 335
    909979 2324 2343 199881 199900 GATAAGAACTGGACCGTCTC  25 336
    909985 3430 3449 227424 227443 GGTATGGTTGGAAATACAGC  11 337
    909991 3641 3660 227635 227654 TATCTGACTCGCTGCTGAAT  47 338
    909997 3715 3734 238180 238199 GGCGGGAGCTCCAATATCAA  37 339
    910003† 3797 3816 240215 240234 TGAACTTCCGTACACAGTCT   7 340
    910014 4414 4433 247848 247867 CTCACTGTAGTTGTTGACCA  19 341
    910020 4450 4469 247884 247903 CCTGGCAGTTTGATTGCTCT  24 342
    910026 5033 5052 259949 259968 TAGTGAAATAGTAGTAACGA  31 343
    910032 6149 6168 262677 262696 CGGTTTTCTCTGGAGTTGAA  45 344
    910038 6373 6392 262901 262920 GGCATAGACCTCCTGTGGGA  54 345
    910044 6493 6512 263021 263040 AATAGAAACCTCCCATCGAT  78 346
    910050 6569 6588 263097 263116 CCCCCCTTTAAATTGGTTCC  38 347
    910056 7247 7266 263775 263794 GGTCAATTCAGGCTTCTTAG  23 348
    910061 7610 7629 264138 264157 TATGGCTTCCCATATTAGAC  20 349
    910067 7762 7781 264290 264309 GTTTGTACAGTCGGGCTTTT  24 350
    910073 8245 8264 264773 264792 GTGCCATATGGGTCAATAAG  20 351
    910079 8323 8342 264851 264870 GGTAATATAACTTCACTACC  35 352
    910085 8464 8483 264992 265011 GATTGTAATGTGGTTTACCG  37 353
    910091 8725 8744 265253 265272 TTCCACTAGTCTACCTGATG  58 354
    910097   10   29 112423 112442 CAGTCATTCGATGGTACCCA  48 355
    910103 N/A N/A  68132  68151 TTCAGCAGTTTGGTTGCTAC  91 356
    910109 N/A N/A  67897  67916 TGCCAATGATGTGCTCGGAG  72 357
    910115 N/A N/A  67966  67985 CCGCTGCAGTAAGTGGCATC  81 358
    910121 N/A N/A  81130  81149 GTAGTATTCCTCCAATCACT  91 359
    910127 N/A N/A  81159  81178 GAGTGGCACTTCATTAGTCC  64 360
    910133 N/A N/A  38868  38887 AGATCAATTGAATTGTTGGG  69 361
    910139 N/A N/A  49570  49589 CAAGTTCAAATGTGTAGTGC  68 362
    910145 N/A N/A  83239  83258 TCAGGACAAGCTATCAAGTA  59 363
    910151 N/A N/A 101360 101379 ATTGGCAGGCTATGCTTAAT 105 364
    910157 N/A N/A 113713 113732 ATCCTGATGCACCTCCACCG  45 365
    910163 N/A N/A 116964 116983 AAGAGCCACGGTGGCCCATC 116 366
    910169 N/A N/A 121086 121105 GGTGGCTTGAGCAGGGTAGC 122 367
    910175 N/A N/A 123464 123483 AGCAAGAGGGCACCGTTTCC 100 368
    910181 N/A N/A 128203 128222 AACTGCAGTTGATATACCCC  58 369
    910187 N/A N/A 129655 129674 GCAAGGGAGTCCAGTTGGAT  43 370
    910193 N/A N/A 134589 134608 GGTGTACCCCACTTGAGGTG  64 371
    910199 N/A N/A 139454 139473 GGCTTTCCCGGCCCTTACTC  91 372
    910205 N/A N/A 145496 145515 GGTCTGCAGGTTTGATCCCT  98 373
    910211 N/A N/A 149375 149394 ATTAGTTACCTTGGAGGGCC  33 374
    910217 N/A N/A 152584 152603 CCGTTTGTTTCCCATCCATC  69 375
    910223 N/A N/A 157003 157022 GCATAGGAGACCATGGGTTC  45 376
    910229 N/A N/A 161047 161066 GGATGGAATAGGTTGTGCAC  30 377
    910235 N/A N/A 164328 164347 GACAGACAAGTCCCGGTGGC  94 378
    910241 N/A N/A 167416 167435 TACCAGCTAGCAGACTGCCC  43 379
    910247 N/A N/A 171039 171058 CGTGTAAATGCCCCTGCCCC  22 380
    910253 N/A N/A 174686 174705 TTACAGCAGTTGCTGCTAGA  23 381
    910259 N/A N/A 177827 177846 CGCTAGGAGGTCTGATCCCT  32 382
    910265 N/A N/A 181873 181892 ATGCTTGGTCTGTCAAGGCA  13 383
    910271 N/A N/A 186058 186077 TCAGGCACCTCGCATGTGAG  36 384
    910277 N/A N/A 189147 189166 GAACAACCCCGCAGGTGGCC  22 385
    910283 N/A N/A 193733 193752 GTGCCCTGTATCTCTGCGGC  19 386
    910289 N/A N/A 199584 199603 GGAGGGACCAGGTCCACTAC  51 387
    910295 N/A N/A 203237 203256 ATGTGGCCACCACCTCTTAG  32 388
    910301 N/A N/A 208608 208627 GCTCTACCTTTAGGCCTATG  21 389
    910307 N/A N/A 212293 212312 GGGCAAGAATTCACTACCTC  20 390
    910313 N/A N/A 216623 216642 TGTCAGGCTGAAAGTAGTGC  16 391
    910319 N/A N/A 222077 222096 GTAACCCTATGGCACTTTCT  15 392
    910325 N/A N/A 226685 226704 TTGTAGTGCCTCCTGCCCAC  36 393
    910331 N/A N/A 230983 231002 GTATGACTCAGCATAATAGC  31 394
    910337 N/A N/A 234351 234370 TGTAGGTTCAAGATAGTGCT  24 395
    910343 N/A N/A 235679 235698 GGATAATACACCAATATGGA  20 396
    910349 N/A N/A 238413 238432 ATGTACAGTTGTTGGATAGG  48 397
    910355 N/A N/A 241553 241572 GGCAATAGCGAATCAGTGTG  10 398
    910361 N/A N/A 245087 245106 TATAAGGACCTGTAGTACTT  43 399
    910367 N/A N/A 248036 248055 TCTAACAGGTGGATATCTCA  22 400
    910373 N/A N/A 251285 251304 AGCTAGCTGCTGGTGCTAGG  24 401
    910379 N/A N/A 254815 254834 GCGATTCTCCTGGCAGCAAC  33 402
    910385 N/A N/A 258128 258147 TCCAATGGTGATTTTTGGAC  36 403
    910391 N/A N/A 259525 259544 GTAAGTAGTGTAAATAGGGA  18 404
    260902 260921
    910397 N/A N/A 260852 260871 TTAATGCTACCTCATAGCAC  39 405
  • TABLE 7
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 5000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
    909603 7336 7355 263864 263883 GTCAACCTTACCAAGAGCAG  23 406
    909938 N/A N/A 166924 166943 ATTTCCTGTACAGGGACTAC  85 407
    909944  320  339 168865 168884 ATTCCCTGGTAAAGAAGCGG  25 408
    909950 1061 1080 183408 183427 GCAATCCTATTAGCGCAAAC  12 409
    909956 1186 1205 183533 183552 CCTATTGAAAGTAGTACCAT  14 410
    909962 1838 1857 188647 188666 CCGATTTTCGGACTCTGTCA  14 411
    909968 2023 2042 196229 196248 GCCAATGTCCTTTGCTCGAC  30 412
    909974 2092 2111 196298 196317 CAGAGAGTCTCTTCGGCTGT  35 413
    909980 2363 2382 199920 199939 GCCTTGATGTAGGATCTTCC   6 414
    909986 3433 3452 227427 227446 GGTGGTATGGTTGGAAATAC  21 415
    909992 3644 3663 227638 227657 CCATATCTGACTCGCTGCTG  25 416
    909998 3717 3736 238182 238201 TCGGCGGGAGCTCCAATATC  44 417
    910004† 3799 3818 240217 240236 CTTGAACTTCCGTACACAGT  15 418
    910009 4397 4416 247831 247850 CCACGCTTACATCAAACATC  30 419
    910015 4417 4436 247851 247870 GCACTCACTGTAGTTGTTGA   8 420
    910021 4499 4518 247933 247952 ACAGATATCCAAGTCCTACG  34 421
    910027 6003 6022 262531 262550 GCCCTCTGGATAATAATAGC  53 422
    910033 6156 6175 262684 262703 GTCATATCGGTTTTCTCTGG  40 423
    910039 6480 6499 263008 263027 CATCGATACTATTTCTCCAG  47 424
    910045 6537 6556 263065 263084 AGCCATTACGCCTCTGCTCT  44 425
    910051 6572 6591 263100 263119 CCTCCCCCCTTTAAATTGGT  58 426
    910062 7655 7674 264183 264202 GAATGAGGTCTTGGTAGAAC  25 427
    910068 7769 7788 264297 264316 GCAACATGTTTGTACAGTCG  15 428
    910074 8248 8267 264776 264795 CTAGTGCCATATGGGTCAAT  27 429
    910080 8446 8465 264974 264993 CGTTCTTTATGGTAACAGCA  16 430
    910086 8469 8488 264997 265016 GGCTTGATTGTAATGTGGTT  34 431
    910092 8731 8750 265259 265278 GTAACTTTCCACTAGTCTAC  68 432
    910098   15   34 112428 112447 TCTGACAGTCATTCGATGGT  46 433
    910104 N/A N/A  68140  68159 CGCCAGTCTTCAGCAGTTTG  76 434
    910110 N/A N/A  67899  67918 GGTGCCAATGATGTGCTCGG 112 435
    910116 N/A N/A  67969  67988 TCCCCGCTGCAGTAAGTGGC 108 436
    910122 N/A N/A  81132  81151 CAGTAGTATTCCTCCAATCA  89 437
    910128 N/A N/A  81162  81181 GTGGAGTGGCACTTCATTAG  51 438
    910134 N/A N/A  45141  45160 GTTAAGTAATGGTTGGCACC 112 439
    910140 N/A N/A  58777  58796 GTCAAGTTTTTGAACTGACC  96 440
    910146 N/A N/A  83241  83260 GATCAGGACAAGCTATCAAG  64 441
    910152 N/A N/A 102749 102768 GTTACAAAAGTAGGGACTCA  89 442
    910158 N/A N/A 114092 114111 GTCTATGCCATCCTGATATG  85 443
    910164 N/A N/A 118010 118029 GAGGGATAGTGTCAGTCTTC  67 444
    910170 N/A N/A 121443 121462 AGGAGGTTAGTCATGCAAGT  70 445
    910176 N/A N/A 124678 124697 GAGTGCACCCCAAGGCTAGC  57 446
    910182 N/A N/A 128498 128517 GAGTTAAACCATAGAGCCAT  36 447
    128541 128560
    910188 N/A N/A 130065 130084 TCCCATGGTTGGTCCTAGCC  83 448
    910194 N/A N/A 135044 135063 ATCCAGACCGTATTGCAACC  73 449
    910200 N/A N/A 141973 141992 CTACCCAGTAGCCCCTGGTA 103 450
    910206 N/A N/A 146430 146449 GTTGGCACTATAACCAATGC  62 451
    910212 N/A N/A 150028 150047 TGCTCTGTCGACACCTGTCT  56 452
    910218 N/A N/A 153536 153555 CACCGGCACTTCAGACTTGG  82 453
    910224 N/A N/A 157533 157552 GTAGATCTGAATGTCTGGGC  74 454
    910230 N/A N/A 161147 161166 TTAGGACAAGCTATCACCAG  44 455
    910236 N/A N/A 164991 165010 GTAGCAGCTCTAGCCTCCCA  39 456
    910242 N/A N/A 168052 168071 GTAGCTCGGACCCCCTGGCT  42 457
    910248 N/A N/A 171979 171998 TCATCATTCAGATGCACGAC  20 458
    910254 N/A N/A 174799 174818 GGTCTAAACTCTGGTGCTAT  20 459
    910260 N/A N/A 178626 178645 GGATGGTTCCTCCCCTTAGC  28 460
    910266 N/A N/A 182069 182088 ATTTCATGAGTGTCGCCATC  17 461
    910272 N/A N/A 186570 186589 TCAATAACGGCAAGTCTGCT  54 462
    910278 N/A N/A 189529 189548 TAGGTATTAAGGTTTCACTC  21 463
    910284 N/A N/A 195317 195336 GAGGCTCGGGTCTCCCAGTG  38 464
    910290 N/A N/A 200118 200137 ATCCATGAGTTATGCACGGA  26 465
    910296 N/A N/A 203948 203967 GATATCTCAGGAGATGTCCT  38 466
    910302 N/A N/A 209203 209222 GTGGTAACTCTACCCCAAAC  33 467
    910308 N/A N/A 213398 213417 AGGTGGTTACCTCAGAGACC  25 468
    910314 N/A N/A 217259 217278 GTGACTTGCTACCATAGAGC  17 469
    910320 N/A N/A 222990 223009 CTAGGCTGGCAGTCCCATCC  35 470
    910326 N/A N/A 228033 228052 GCAACTACCCTCTCATCAGA  17 471
    910332 N/A N/A 231406 231425 CCCATGCTGCTAGCAACTGA  28 472
    910338 N/A N/A 234496 234515 AGTTATAGCGAATCAGTGGT  40 473
    910344 N/A N/A 235686 235705 GCCCTATGGATAATACACCA  15 474
    910350 N/A N/A 238835 238854 CTCCAGTGACATATTGCCCC  43 475
    910356 N/A N/A 241826 241845 TTCGCCTTAGAGGCCTCCAG  14 476
    910362 N/A N/A 245575 245594 CATACAGTTGACTAATGTAG  24 477
    910368 N/A N/A 248605 248624 TCTGTTGTGCGGACATAGTA  24 478
    910374 N/A N/A 251753 251772 TTTGCAGCGGAAAAGGTCTG  58 479
    910380 N/A N/A 255569 255588 CAGGTCGAGGTATGGGTTAT  33 480
    910386 N/A N/A 258254 258273 TAGAATGACTAATACTCTGC  24 481
    910392 N/A N/A 259526 259545 GGTAAGTAGTGTAAATAGGG  14 482
    260903 260922
    910398 N/A N/A 261358 261377 GACTCAACCCTGGAAGGTCC  54 483
  • TABLE 8
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers
    with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  16 227
     910388 N/A N/A 259152 259171 TCTTAATGCTACCTCATAGC  68 170
    260854 260873
    1248329   24   43 112437 112456 GCTTTCTGTTCTGACAGTCA  70 484
    1248355  372  391 168917 168936 TTGGGTCTCTTAGCTTTCTC  14 485
    1248381  787  806 181698 181717 TGCAAGTATTTTAATAAGTG  37 486
    1248407 1318 1337 186625 186644 ACAGATGTATCCTTCAGGAC  26 487
    1248433 2329 2348 199886 199905 AACATGATAAGAACTGGACC  35 488
    1248459 2539 2558 204441 204460 AAATGGGTCCATTACAACCA  58 489
    1248485 3432 3451 227426 227445 GTGGTATGGTTGGAAATACA  16 490
    1248511 3995 4014 243167 243186 CAGCATATTCTAACATGGTC  10 491
    1248537 4540 4559 250604 250623 AATATCCATCCATCCCTTAA  60 492
    1248562 6137 6156 262665 262684 GAGTTGAATTCTCATTCAGT  50 493
    1248588 6872 6891 263400 263419 TGTGATTTTTTTATGTGTGA  33 494
    1248614 7218 7237 263746 263765 ATAGGATATTTTTATTTTAT  79 495
    1248639 7395 7414 263923 263942 ACTGGGTAAAATTACTATTT  60 496
    1248665 7518 7537 264046 264065 ATAATGGAACCAATTACATC  53 497
    1248689 7820 7839 264348 264367 TATTTTCTTAGAAAACTCTA  71 498
    1248714 8003 8022 264531 264550 AAGCAGAAACCTACACTGCA  60 499
    1248740 8353 8372 264881 264900 TTGTGAAACACAAAGTATTT  57 500
    1248766 8511 8530 265039 265058 AACAATTAAATACAAAAACA  88 501
    1248792 8651 8670 265179 265198 ATTAACTTCCATTCCATGAA  81 502
    1248816 8756 8775 265284 265303 GTTAGTCAATTTTTTATTAA  62 503
    1248842 N/A N/A 114536 114555 ATGACACATTTTAATCCCTT  63 504
    1248868 N/A N/A 117743 117762 TAACAACTTAAAACTATAAA  81 505
    1248894 N/A N/A 124032 124051 AACCATCACATCTTTTAGAA  72 506
    1248920 N/A N/A 127323 127342 ATAAAACATACAACTACTTA  90 507
    1248945 N/A N/A 128525 128544 CCATATTTTAATAATTGTTA  69 508
    128568 128587
    1248971 N/A N/A 141387 141406 GTATCCCATTTATTGAGTTA  76 509
    1248997 N/A N/A 144994 145013 AAACTTTTTTATACTAGTTA 105 510
    1249023 N/A N/A 146258 146277 CTTATTCAACTCTTTAATCA  99 511
    1249049 N/A N/A 149445 149464 GCTCATATTATAAATATATT  77 512
    1249075 N/A N/A 152582 152601 GTTTGTTTCCCATCCATCTA  61 513
    1249101 N/A N/A 156410 156429 ACATCTCTCCTCATATTCAT  80 514
    1249127 N/A N/A 162374 162393 TCTGATATTTCTATAATGTT  55 515
    1249153 N/A N/A 166559 166578 TTATAATACCATATTTTTTA 113 516
    1249179 N/A N/A 170517 170536 TATGTATATTTATTTTCCAA  33 517
    1249205 N/A N/A 171909 171928 ATCTGATTCTCTAATCTCTG  14 518
    1249231 N/A N/A 172653 172672 AATCAGTTACTAACTACAGC  31 519
    1249257 N/A N/A 174419 174438 CCATTTTCCTACCATTTTCA  23 520
    1249283 N/A N/A 175700 175719 CAGATACATCCCTTACCAGC  28 521
    1249309 N/A N/A 176889 176908 AGAGAAATAATTATTTTCTA  82 522
    1249335 N/A N/A 177800 177819 TCTCCAGTTTCATTTTCTTT  22 523
    1249361 N/A N/A 178410 178429 ACATAACCATTATATACCCA  24 524
    1249387 N/A N/A 179803 179822 CCTAATGTTTTTACTATAAA  62 525
    1249413 N/A N/A 180553 180572 ATTTATCAACTTAAATTTTC  75 526
    1249439 N/A N/A 181448 181467 ATATTGCATTTTCCACATTA  34 527
    1249465 N/A N/A 183699 183718 TTAAATCATCTTAAATTAGT  92 528
    1249491 N/A N/A 184369 184388 ATCTAGTTTTTATTTTTAAG  84 529
    184401 184420
    1249517 N/A N/A 185479 185498 AATATGCTAAATACTCCCCA  32 530
    1249543 N/A N/A 186071 186090 AACTTGCTAATCTTCAGGCA  53 531
    1249569 N/A N/A 188074 188093 ATTCCATTTTCACACAATAA  21 532
    1249595 N/A N/A 190182 190201 CCTATGTTAAATTTGAATTA  72 533
    1249621 N/A N/A 192560 192579 TTAAACCTCTTCCTTTGCCA  25 534
    1249647 N/A N/A 200316 200335 AAGCAGTTAATATAATCCAA  32 535
    1249673 N/A N/A 200756 200775 ATATTGATAATATTTATTAA  98 536
    1249699 N/A N/A 202762 202781 AACCTTATATTTACATTGAA  53 537
    1249725 N/A N/A 203198 203217 TTTCTTCTTTTTAAATCCAT  34 538
    1249751 N/A N/A 203777 203796 AACAAAGTTCCATCTCTCTA  50 539
    1249777 N/A N/A 205850 205869 TGAGAACCTGAATCTAGCCA  53 540
    1249803 N/A N/A 207409 207428 CTAAAAATCTAAATATGTTA  96 541
    1249829 N/A N/A 208944 208963 ACTCCTTTTTCAATATGTCT  35 542
    1249855 N/A N/A 210467 210486 ACTAACATTTTATAAGGTAA  57 543
    1249881 N/A N/A 213565 213584 TCTCTAGAAATACATACCCA  41 544
    1249907 N/A N/A 216475 216494 CTATTTCCCTTAACTGCATC  48 545
    1249933 N/A N/A 222131 222150 ATGAAATCAAATCTATAACA  84 546
    1249959 N/A N/A 224981 225000 TACTCTATTTACAAATGTCA  62 547
    1249985 N/A N/A 229139 229158 TCTGAATTTCCCATTAAACA  26 548
    1250011 N/A N/A 231494 231513 AAATTATATTCTAAATACAA  80 549
    1250037 N/A N/A 234138 234157 ATAACATCAATTAAATGACT  65 550
    1250063 N/A N/A 235630 235649 CCATATGGATAATACACCAA  33 551
    1250089 N/A N/A 237609 237628 AATATATTCTATAATTTTCT  91 552
    1250115 N/A N/A 241554 241573 TGGCAATAGCGAATCAGTGT  26 553
    1250141 N/A N/A 243533 243552 CTTGAGATTTTAAATATTAA  91 554
    1250167 N/A N/A 246823 246842 CTTTTGTACCACCCTTCTAA  52 555
    1250193 N/A N/A 250191 250210 TAATGCTTCCTTTCTACTTA  40 556
    1250219 N/A N/A 253267 253286 TTAAAGATTTCCTCTTCTTA  70 557
    1250245 N/A N/A 254716 254735 AATGATATCATCTCATTTAA  56 558
    1250271 N/A N/A 256711 256730 GACAAACTTTTAAATTTCAC  24 559
  • TABLE 9
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  21 227
    1248330   52   71 112465 112484 ACCACAGCATCCTCCCTCCT  87 560
    1248356  373  392 168918 168937 TTTGGGTCTCTTAGCTTTCT  19 561
    1248382  813  832 181724 181743 GTGAAATCTTCTAAACAAAA  27 562
    1248408 1521 1540 186968 186987 AAGATCAAATTTATTAGATA  96 563
    1248434 2348 2367 199905 199924 CTTCCAATAAATCCATGGAA  40 564
    1248460 2541 2560 204443 204462 ACAAATGGGTCCATTACAAC  71 565
    1248486 3435 3454 227429 227448 ATGGTGGTATGGTTGGAAAT  22 566
    1248512 3996 4015 243168 243187 TCAGCATATTCTAACATGGT  14 567
    1248538 4543 4562 250607 250626 CATAATATCCATCCATCCCT  31 568
    1248563 6201 6220 262729 262748 GGTTTGGTCACACTATCATA  28 569
    1248589 6945 6964 263473 263492 ACGAATAGCTATTTAAGCAC  31 570
    1248615 7251 7270 263779 263798 TTTTGGTCAATTCAGGCTTC  40 571
    1248640 7397 7416 263925 263944 CCACTGGGTAAAATTACTAT  52 572
    1248666 7519 7538 264047 264066 TATAATGGAACCAATTACAT  58 573
    1248690 7824 7843 264352 264371 TTTATATTTTCTTAGAAAAC 114 574
    1248715 8021 8040 264549 264568 TTTACAGTACTAATAAAAAA  92 575
    1248741 8356 8375 264884 264903 TGCTTGTGAAACACAAAGTA  43 576
    1248767 8512 8531 265040 265059 CAACAATTAAATACAAAAAC  96 577
    1248793 8654 8673 265182 265201 TTAATTAACTTCCATTCCAT  60 578
    1248817 8757 8776 265285 265304 TGTTAGTCAATTTTTTATTA  91 579
    1248843 N/A N/A 114700 114719 TTCACTTTCTCATCTTTCTT  66 580
    1248869 N/A N/A 117746 117765 ACTTAACAACTTAAAACTAT  94 581
    1248895 N/A N/A 124071 124090 CACTAAAACTAAAATAGTAT  91 582
    1248921 N/A N/A 127328 127347 CTTAAATAAAACATACAACT  90 583
    1248946 N/A N/A 128526 128545 GCCATATTTTAATAATTGTT  82 584
    128569 128588
    1248972 N/A N/A 141514 141533 GTATGTTTCTCCTATGCCAA  74 585
    1248998 N/A N/A 145140 145159 TTTTTACTTTCAACCTGTCT  69 586
    1249024 N/A N/A 146284 146303 AGAGATTTCACAACTTTCTT  67 587
    1249050 N/A N/A 149569 149588 TACTTTTAAAATACAACTAA  77 588
    1249076 N/A N/A 152615 152634 GGGTTACTCTAAACAGATAA  69 589
    1249102 N/A N/A 156412 156431 ATACATCTCTCCTCATATTC  74 590
    1249128 N/A N/A 162624 162643 GGTTTTTCTTCCATTTGTTC  71 591
    1249154 N/A N/A 166705 166724 CTCATGCTTTTTATTTGCTA  75 592
    1249180 N/A N/A 170593 170612 CTCAAAGCTTTTAAATGCTA  38 593
    1249206 N/A N/A 171947 171966 TTCTGATCCATTCAAACTTA  31 594
    1249232 N/A N/A 172760 172779 CCAAGCATTTTTAACTTACA  20 595
    1249258 N/A N/A 174424 174443 GTTTTCCATTTTCCTACCAT  14 596
    1249284 N/A N/A 175786 175805 TGGATCATCATAACACTGGC  19 597
    1249310 N/A N/A 176892 176911 ACAAGAGAAATAATTATTTT  90 598
    1249336 N/A N/A 177878 177897 CTTTCTATTACTCTTAGGAT  19 599
    1249362 N/A N/A 178414 178433 ACAAACATAACCATTATATA  95 600
    1249388 N/A N/A 179813 179832 TTTTCTCACTCCTAATGTTT  44 601
    1249414 N/A N/A 180595 180614 TTAAAAAGATTAAATGCAAA  90 602
    1249440 N/A N/A 181595 181614 GTACATATCTTAAAGATGAC  46 603
    1249466 N/A N/A 183701 183720 TATTAAATCATCTTAAATTA  89 604
    1249492 N/A N/A 184370 184389 TATCTAGTTTTTATTTTTAA  71 605
    184402 184421
    1249518 N/A N/A 185489 185508 ACTTTGCTAAAATATGCTAA  50 606
    1249544 N/A N/A 186082 186101 GCAAGTTACTTAACTTGCTA  81 607
    1249570 N/A N/A 188176 188195 AAGATCATAATAACATGTTC  70 608
    1249596 N/A N/A 190485 190504 ATTTAGGCAAATTTTGGCCA  82 609
    1249622 N/A N/A 192836 192855 CCCAGATCTCATCTTGAGTT  28 610
    194791 194810
    1249648 N/A N/A 200370 200389 ACATTTTTAATTTATATTTC  94 611
    1249674 N/A N/A 201016 201035 CTTTCATTCTCCTTTTCTCT  38 612
    1249700 N/A N/A 202776 202795 CTAAACTCCCAAATAACCTT  39 613
    1249726 N/A N/A 203264 203283 GTACACCCTATTACCTGTTC  19 614
    1249752 N/A N/A 203825 203844 AAGTCTCAAATTAAATTTTA  72 615
    1249778 N/A N/A 206284 206303 TACAGATCCTACATTCCTTA  54 616
    1249804 N/A N/A 207846 207865 ATAGGATTTTCTAAATACAA  48 617
    1249830 N/A N/A 209008 209027 CCTTTCCCCTAAAATTAGCC  36 618
    1249856 N/A N/A 210650 210669 TTCTTTATTTTATCTGGCCA  44 619
    1249882 N/A N/A 213610 213629 GTTCATATTTCAAAATCTAT  26 620
    1249908 N/A N/A 216476 216495 CCTATTTCCCTTAACTGCAT  53 621
    1249934 N/A N/A 222168 222187 CTTCTTCCAACATATACCAA  42 622
    1249960 N/A N/A 225049 225068 TCTTGATACACATCCATCAA  51 623
    1249986 N/A N/A 229172 229191 CTGTTATTTATACCTTCCTA  59 624
    1250012 N/A N/A 231744 231763 ATGATAAATTTAAATAATAT  70 625
    1250038 N/A N/A 234144 234163 TTCTTGATAACATCAATTAA  65 626
    1250064 N/A N/A 235632 235651 GGCCATATGGATAATACACC  24 627
    1250090 N/A N/A 237618 237637 TTGTTATTAAATATATTCTA  88 628
    1250116 N/A N/A 241555 241574 TTGGCAATAGCGAATCAGTG  27 629
    1250142 N/A N/A 243534 243553 ACTTGAGATTTTAAATATTA  71 630
    1250168 N/A N/A 246959 246978 ATCATTTTTTTAAAATCCTC  36 631
    1250194 N/A N/A 250202 250221 ATTATTTATCTTAATGCTTC  31 632
    1250220 N/A N/A 253310 253329 TGCACTTTCCTTTCTAAGCA  33 633
    1250246 N/A N/A 254960 254979 CGGTCTGTTTTATATTGTCA  20 634
    1250272 N/A N/A 256712 256731 AGACAAACTTTTAAATTTCA  55 635
    1250297 N/A N/A 259160 259179 ATCTTATCTCTTAATGCTAC  79 636
  • TABLE 10
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  16 227
    1248331   92  111 112505 112524 GCTCTATCCTCATTAAAGAA  63 637
    1248357  375  394 168920 168939 TGTTTGGGTCTCTTAGCTTT  18 638
    1248383  814  833 181725 181744 TGTGAAATCTTCTAAACAAA  53 639
    1248409 1605 1624 187052 187071 ATCTGCTGAAATTCAGCTTC  44 640
    1248435 2352 2371 199909 199928 GGATCTTCCAATAAATCCAT  42 641
    1248461 2604 2623 204506 204525 GGATAGTGCTCCATAGCCAT  11 642
    1248487 3516 3535 227510 227529 ACATATTTTTCTACACTGCT  15 643
    1248513 3999 4018 243171 243190 TTGTCAGCATATTCTAACAT  39 644
    1248539 4544 4563 250608 250627 ACATAATATCCATCCATCCC  39 645
    1248564 6226 6245 262754 262773 GTCTTTTTCAAATTTTTCTT  39 646
    1248590 6960 6979 263488 263507 AGACACCTTAAAAATACGAA  41 647
    1248616 7253 7272 263781 263800 TTTTTTGGTCAATTCAGGCT  27 648
    1248641 7414 7433 263942 263961 GTTTGCTCAAACATGCACCA  52 649
    1248667 7526 7545 264054 264073 TTCAAACTATAATGGAACCA  39 650
    1248691 7827 7846 264355 264374 GTATTTATATTTTCTTAGAA  79 651
    1248716 8022 8041 264550 264569 GTTTACAGTACTAATAAAAA  77 652
    1248742 8375 8394 264903 264922 AAGAATCTACATTTATTGTT  64 653
    1248768 8513 8532 265041 265060 ACAACAATTAAATACAAAAA  77 654
    1248794 8655 8674 265183 265202 CTTAATTAACTTCCATTCCA  59 655
    1248818 N/A N/A 166899 166918 GGCATTATTGTAACTACCAC  68 656
    1248844 N/A N/A 114822 114841 ATCCTCCTAAAATCTTTTCC  74 657
    1248870 N/A N/A 117753 117772 GCAAAAGACTTAACAACTTA  60 658
    1248896 N/A N/A 124079 124098 AACATTGTCACTAAAACTAA  71 659
    1248922 N/A N/A 127515 127534 ATATTGATATTATCTAGAAA 106 660
    1248947 N/A N/A 128527 128546 AGCCATATTTTAATAATTGT  56 661
    128570 128589
    1248973 N/A N/A 141858 141877 TTTTACTCAACCTAATGTCC  88 662
    1248999 N/A N/A 145147 145166 ACTGATTTTTTTACTTTCAA  82 663
    1249025 N/A N/A 146336 146355 TAAGGATTAAACTAAAATCA  96 664
    1249051 N/A N/A 149572 149591 GCTTACTTTTAAAATACAAC  76 665
    1249077 N/A N/A 152630 152649 TTATTATAATTAACTGGGTT 101 666
    1249103 N/A N/A 156668 156687 TGGATCCCTTTCTATACCTA  77 667
    1249129 N/A N/A 162671 162690 AGTCTGTTTCTCATTTCCCA  65 668
    1249155 N/A N/A 167626 167645 CTTTTCAAAAAATCAATCTA  76 669
    1249181 N/A N/A 170745 170764 ACTTCAATAAAACATAGGAA  38 670
    1249207 N/A N/A 171986 172005 CTCCATCTCATCATTCAGAT  19 671
    1249233 N/A N/A 172820 172839 CTAGTGGTAATAAATATACA  35 672
    1249259 N/A N/A 174427 174446 TATGTTTTCCATTTTCCTAC  39 673
    1249285 N/A N/A 175789 175808 GCCTGGATCATCATAACACT  22 674
    1249311 N/A N/A 176908 176927 ATATATTTCAACATTAACAA  59 675
    1249337 N/A N/A 177882 177901 GTAGCTTTCTATTACTCTTA   9 676
    1249363 N/A N/A 178420 178439 TGCTCAACAAACATAACCAT  41 677
    1249389 N/A N/A 179820 179839 TCATATCTTTTCTCACTCCT  38 678
    1249415 N/A N/A 180640 180659 GCCAAGCCATCAACTATTTT  35 679
    1249441 N/A N/A 181611 181630 AGTGGTTAATTTACAAGTAC  55 680
    1249467 N/A N/A 183705 183724 TATGTATTAAATCATCTTAA  50 681
    1249493 N/A N/A 184519 184538 ATTTATTCCCTCTTATGATA  53 682
    1249519 N/A N/A 185499 185518 GTTTGTAACCACTTTGCTAA  36 683
    1249545 N/A N/A 186349 186368 AAGCAATCATATCATGATTA  37 684
    1249571 N/A N/A 188217 188236 CTATGATATCTAATTATCTA  61 685
    1249597 N/A N/A 190580 190599 TAGTTTTATTCAATTAGAAA  82 686
    1249623 N/A N/A 192837 192856 ACCCAGATCTCATCTTGAGT  37 687
    194792 194811
    1249649 N/A N/A 200374 200393 ATTCACATTTTTAATTTATA  82 688
    1249675 N/A N/A 201589 201608 AGTAATGTCTTATTTAGCTC  17 689
    1249701 N/A N/A 202784 202803 AAATACTTCTAAACTCCCAA  40 690
    1249727 N/A N/A 203333 203352 ATAATCTCTTCATCAACTTA  56 691
    1249753 N/A N/A 203874 203893 GTGATCTTCTAATTAGATAA  25 692
    1249779 N/A N/A 206308 206327 TACTATTCCATAATTCACCT  45 693
    1249805 N/A N/A 207897 207916 GCAATCTTATTTATTAGTTC  24 694
    1249831 N/A N/A 209009 209028 GCCTTTCCCCTAAAATTAGC  28 695
    1249857 N/A N/A 210729 210748 TTTGTTTATCTTAAAATTCT  49 696
    1249883 N/A N/A 213626 213645 TTACATTTTTATAATAGTTC  82 697
    1249909 N/A N/A 216559 216578 ACCAAAGTATTTAATTTATT  84 698
    1249935 N/A N/A 222169 222188 TCTTCTTCCAACATATACCA  42 699
    1249961 N/A N/A 225181 225200 TGGATTAAAAAAACAGACAA  57 700
    1249987 N/A N/A 229264 229283 ATTAAAGTAATTCTTTGCCC  26 701
    1250013 N/A N/A 231745 231764 CATGATAAATTTAAATAATA  95 702
    1250039 N/A N/A 234163 234182 ATTCTGATTTATAAAACCCT  30 703
    1250065 N/A N/A 235633 235652 AGGCCATATGGATAATACAC  21 704
    1250091 N/A N/A 237640 237659 TGACATGAAAACATATACCA  56 705
    1250117 N/A N/A 241556 241575 GTTGGCAATAGCGAATCAGT  22 706
    1250143 N/A N/A 243555 243574 ATTCATATTTTATTTTGCAT  40 707
    1250169 N/A N/A 246960 246979 TATCATTTTTTTAAAATCCT  78 708
    1250195 N/A N/A 250330 250349 ATGCTATCATAAAAACAATA  40 709
    1250221 N/A N/A 253346 253365 TAGACAATTTCACCCAACAA  91 710
    1250247 N/A N/A 255011 255030 TATCCATTTTCTTTGAGTTA  61 711
    1250273 N/A N/A 256737 256756 TCTTTAGTTCCCATATTCAA  60 712
    1250298 N/A N/A 259161 259180 AATCTTATCTCTTAATGCTA  70 713
  • TABLE 11
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5' to 3') (% control) NO
     910059 7528 7547 264056 264075 GCTTCAAACTATAATGGAAC  35 193
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  18 227
    1248332   96  115 112509 112528 ATGTGCTCTATCCTCATTAA  70 714
    1248358  376  395 168921 168940 CTGTTTGGGTCTCTTAGCTT  24 715
    1248384  815  834 181726 181745 ATGTGAAATCTTCTAAACAA  60 716
    1248410 1608 1627 187055 187074 AGCATCTGCTGAAATTCAGC  32 717
    1248436 2353 2372 199910 199929 AGGATCTTCCAATAAATCCA  46 718
    1248462 2605 2624 204507 204526 GGGATAGTGCTCCATAGCCA  12 719
    1248488 3517 3536 227511 227530 GACATATTTTTCTACACTGC  25 720
    1248514 4002 4021 243174 243193 ACCTTGTCAGCATATTCTAA  44 721
    1248540 4545 4564 250609 250628 TACATAATATCCATCCATCC  49 722
    1248565 6230 6249 262758 262777 ATTTGTCTTTTTCAAATTTT  88 723
    1248591 6984 7003 263512 263531 GGCACATTAAATTTTTTCTG  57 724
    1248617 7282 7301 263810 263829 ATCAACTTTATAAAGTGGTG  35 725
    1248642 7417 7436 263945 263964 TTTGTTTGCTCAAACATGCA  70 726
    1248692 7830 7849 264358 264377 ACAGTATTTATATTTTCTTA  46 727
    1248717 8028 8047 264556 264575 GTGCAAGTTTACAGTACTAA  25 728
    1248743 8376 8395 264904 264923 AAAGAATCTACATTTATTGT  78 729
    1248769 8515 8534 265043 265062 AGACAACAATTAAATACAAA  77 730
    1248795 8656 8675 265184 265203 TCTTAATTAACTTCCATTCC  75 731
    1248819 V/A N/A 166998 167017 TTTTTTTAATTCTCCTTCAA  76 732
    1248845 N/A N/A 114826 114845 TCACATCCTCCTAAAATCTT  92 733
    1248871 N/A N/A 117846 117865 ACACAATCACATAATTGTAT  64 734
    1248897 N/A N/A 124805 124824 ATTATATTAATCAAAGTCTT  69 735
    1248923 N/A N/A 127539 127558 GAGTTTTTATTTTCTAGCAA  78 736
    1248948 N/A N/A 128528 128547 GAGCCATATTTTAATAATTG  63 737
    128571 128590
    1248974 N/A N/A 141865 141884 TGGCTTATTTTACTCAACCT  64 738
    1249000 N/A N/A 145209 145228 TTTTGATATTCATATAGCCA 101 739
    1249026 N/A N/A 146347 146366 CTTATATTCATTAAGGATTA  71 740
    1249052 N/A 149573 149592 GGCTTACTTTTAAAATACAA  82 741
    1249078 N/A N/A 152644 152663 GCAGATTCAATATTTTATTA  76 742
    1249104 N/A N/A 156786 156805 CTGATTTCAAATACTAAATA  74 743
    1249130 N/A N/A 162724 162743 TTTTTTCACATCAAAGATAC  94 744
    1249156 N/A N/A 167638 167657 TATTTTTTCCATCTTTTCAA  58 745
    1249182 N/A N/A 170920 170939 ACTACTCTATTTAATTTCAA  66 746
    1249208 N/A N/A 171999 172018 TGGGTTTTCTTAACTCCATC  27 747
    1249234 N/A N/A 172873 172892 AAGTTTAAAATAAAAACTTA  82 748
    1249260 N/A N/A 174428 174447 CTATGTTTTCCATTTTCCTA  44 749
    1249286 N/A N/A 175950 175969 CTATTAATTTCTTTATGCCA  20 750
    1249312 V/A N/A 176946 176965 ATAGTGGTATAATTTAGTTA  32 751
    1249338 N/A N/A 177884 177903 TGGTAGCTTTCTATTACTCT  13 752
    1249364 N/A N/A 178424 178443 ACATTGCTCAACAAACATAA  61 753
    1249390 N/A N/A 179827 179846 GTGCTCTTCATATCTTTTCT   9 754
    1249416 N/A N/A 180670 180689 AGCAACCTCATATTTAGATC  12 755
    1249442 N/A N/A 181630 181649 AAGCTCACATTAAAAATCTA  89 756
    1249468 N/A N/A 183768 183787 CTTTTACTATATCAATGGAC  29 757
    1249494 N/A N/A 184520 184539 TATTTATTCCCTCTTATGAT  73 758
    1249520 N/A N/A 185598 185617 ATTATTATACCCATTTGTCA  46 759
    1249546 N/A N/A 186363 186382 ATGTCTCCATATAAAAGCAA  45 760
    1249572 N/A N/A 188762 188781 TTCATGTAATTTAATATTTT  77 761
    1249598 N/A N/A 190665 190684 GAGAATATCATATCTATGAA  21 762
    1249624 N/A N/A 194838 194857 ATCTAGGTTTTTATATGCCT  55 763
    1249650 N/A N/A 200387 200406 ATATCAAACCCTAATTCACA  68 764
    1249676 N/A N/A 201648 201667 TGAACTCCAAATCTTAATTA  38 765
    1249702 V/A N/A 202810 202829 TAGTTATTATGCACTAGTTA  39 766
    1249728 N/A N/A 203338 203357 GCAAGATAATCTCTTCATCA  22 767
    1249754 N/A N/A 203875 203894 GGTGATCTTCTAATTAGATA  23 768
    1249780 N/A N/A 206311 206330 TTCTACTATTCCATAATTCA  64 769
    1249806 N/A N/A 207901 207920 TTCTGCAATCTTATTTATTA  39 770
    1249832 N/A N/A 209105 209124 TTTTTCCACATCCTTGATAA  56 771
    1249858 N/A N/A 210809 210828 ATATTTTTCCTATTCGGCCT  48 772
    1249884 N/A N/A 213650 213669 CTTTAGTTTTCCTTTTATAA  62 773
    1249910 N/A N/A 216608 216627 AGTGCATTATTTAATGGCAT  64 774
    1249936 N/A N/A 222244 222263 TTATATTTCTTAATTCCCCA  47 775
    1249962 N/A N/A 225297 225316 GTCAGTCTCTATACTATGAC  60 776
    1249988 N/A N/A 229313 229332 ATTCAACTTTCAAACAATAA  56 777
    1250014 N/A N/A 231811 231830 CTTCATTTTAAAAACACCCT  52 778
    1250040 N/A N/A 234397 234416 TTTATCAATTTAAAACATTT  74 779
    1250066 N/A N/A 235634 235653 TAGGCCATATGGATAATACA  35 780
    1250092 N/A N/A 237671 237690 CAGCAACCATCTAAATTTAT  44 781
    1250118 N/A N/A 241558 241577 TGGTTGGCAATAGCGAATCA  54 782
    1250144 N/A N/A 243569 243588 AGCAAAATTTCTAAATTCAT  67 783
    1250170 N/A N/A 246986 247005 AACTTATTTTCAAATATCAC  56 784
    1250196 N/A N/A 250400 250419 TTATATTCCTCTATAACATC  61 785
    1250222 N/A N/A 253512 253531 AGTGAGTTTTTAATTATCTA  40 786
    1250248 N/A N/A 255029 255048 TGTTTGACCCAATATAGCTA  43 787
    1250274 N/A N/A 256849 256868 TAGCATCTCCAATTTTCTCA  50 788
    1250299 N/A N/A 259495 259514 CAGATCTCAAATCTTATCTC  39 789
  • TABLE 12
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  23 227
    1248333   97  116 112510 112529 CATGTGCTCTATCCTCATTA  57 790
    1248359  377  396 168922 168941 CCTGTTTGGGTCTCTTAGCT  25 791
    1248385  946  965 182414 182433 TGAAATTGTTTTCAATGCTC  17 792
    1248411 1630 1649 187077 187096 TTGTTGCTTTTTCAACTGTT  58 793
    1248437 2354 2373 199911 199930 TAGGATCTTCCAATAAATCC  47 794
    1248463 2646 2665 204548 204567 AGGTTTCCAACAGACAGTAC  56 795
    1248489 3535 3554 227529 227548 GTAATCACTTTCATCCACGA  18 796
    1248515 4013 4032 243185 243204 TGTAAGTGAAAACCTTGTCA  32 797
    1248541 4547 4566 250611 250630 CATACATAATATCCATCCAT  38 798
    1248566 6248 6267 262776 262795 CTTTGTCTTCCTTTTCTGAT  57 799
    1248592 6998 7017 263526 263545 ATGGAACATTTACAGGCACA  32 800
    1248618 7283 7302 263811 263830 AATCAACTTTATAAAGTGGT  49 801
    1248643 7418 7437 263946 263965 TTTTGTTTGCTCAAACATGC  74 802
    1248668 7529 7548 264057 264076 AGCTTCAAACTATAATGGAA  28 803
    1248693 7832 7851 264360 264379 TTACAGTATTTATATTTTCT  71 804
    1248718 8029 8048 264557 264576 TGTGCAAGTTTACAGTACTA  26 805
    1248744 8379 8398 264907 264926 TATAAAGAATCTACATTTAT 100 806
    1248770 8516 8535 265044 265063 AAGACAACAATTAAATACAA  69 807
    1248796 8659 8678 265187 265206 TCTTCTTAATTAACTTCCAT  71 808
    1248820 N/A N/A 166999 167018 TTTTTTTTAATTCTCCTTCA 106 809
    1248846 N/A N/A 114827 114846 GTCACATCCTCCTAAAATCT  67 810
    1248872 N/A N/A 117883 117902 ATACATATCACACAACACAA  72 811
    1248898 N/A N/A 124812 124831 GTTAGCTATTATATTAATCA  60 812
    1248924 N/A N/A 127954 127973 ATATCAACAAATACAAACAA  81 813
    1248949 N/A N/A 128769 128788 ACTGAAATTATCATTATTAC  70 814
    1248975 N/A N/A 141917 141936 TTTTTAGATTCCATACCTAA  70 815
    1249001 N/A N/A 145228 145247 TTTGTCTTAAAATCTACTTT  74 816
    1249027 N/A N/A 146354 146373 CAGGCTTCTTATATTCATTA  68 817
    1249053 N/A N/A 149574 149593 TGGCTTACTTTTAAAATACA  76 818
    1249079 N/A N/A 152647 152666 CATGCAGATTCAATATTTTA  93 819
    1249105 N/A N/A 156789 156808 TGTCTGATTTCAAATACTAA  79 820
    1249131 N/A N/A 162726 162745 TATTTTTTCACATCAAAGAT  89 821
    1249157 N/A N/A 167676 167695 ATACAATCAACATCTTGACT  56 822
    1249183 N/A N/A 170921 170940 AACTACTCTATTTAATTTCA  71 823
    1249209 N/A N/A 172046 172065 ACAAAAGTTTTAAAACAAAA  85 824
    1249235 N/A N/A 172947 172966 ACAATAGCTCCTAATAGATA  58 825
    1249261 N/A N/A 174429 174448 CCTATGTTTTCCATTTTCCT  34 826
    1249287 N/A N/A 175957 175976 TTTTAATCTATTAATTTCTT  86 827
    1249313 N/A N/A 176957 176976 ACTTACTCTTTATAGTGGTA  11 828
    1249339 N/A N/A 177944 177963 ATTTAATCCATTCTGCATAC  46 829
    1249365 N/A N/A 178434 178453 CCATCAACAAACATTGCTCA  43 830
    1249391 N/A N/A 179935 179954 TCATATTTAATAAAAAGCAT  78 831
    1249417 N/A N/A 180686 180705 GCCATTTCTATAACTCAGCA   8 832
    1249443 N/A N/A 181633 181652 GCCAAGCTCACATTAAAAAT  46 833
    1249469 N/A N/A 183769 183788 ACTTTTACTATATCAATGGA  42 834
    1249495 N/A N/A 184524 184543 TAGGTATTTATTCCCTCTTA  17 835
    1249521 N/A N/A 185614 185633 TCATCACAAAAACCCTATTA  54 836
    1249547 N/A N/A 186364 186383 TATGTCTCCATATAAAAGCA  58 837
    1249573 N/A N/A 189437 189456 TCTAAATTTTAAAATTTCAA  79 838
    1249599 N/A N/A 190734 190753 GTGATTGCTTATAATACCCA  21 839
    1249625 N/A N/A 194853 194872 TTTATACCTACTAATATCTA  75 840
    1249651 N/A N/A 200390 200409 TTAATATCAAACCCTAATTC  71 841
    1249677 N/A N/A 201663 201682 TGGGTGCATTTATTTTGAAC  23 842
    1249703 N/A N/A 202851 202870 AAACAATAAATAATATTTGA  78 843
    1249729 N/A N/A 203339 203358 GGCAAGATAATCTCTTCATC  14 844
    1249755 N/A N/A 203876 203895 TGGTGATCTTCTAATTAGAT  22 845
    1249781 N/A N/A 206319 206338 TATGGATTTTCTACTATTCC  58 846
    1249807 N/A N/A 207983 208002 ATAGAATTTTCCTAATTTTA  76 847
    1249833 N/A N/A 209119 209138 CATAACCATTCTAATTTTTC  53 848
    1249859 N/A N/A 210859 210878 CATTTATTCATATCTAGTGA  60 849
    1249885 N/A N/A 213718 213737 TTTTCTTCCTCTAACAAATC  77 850
    1249911 N/A N/A 216782 216801 TTCTTTTTAACCTTTATATC  71 851
    1249937 N/A N/A 222245 222264 CTTATATTTCTTAATTCCCC  77 852
    1249963 N/A N/A 225443 225462 TCATGCTTCTATCATGCTAA  24 853
    1249989 N/A N/A 229453 229472 TTCTATTTTATAAATGCCGA  27 854
    1250015 N/A N/A 231813 231832 CTCTTCATTTTAAAAACACC  25 855
    1250041 N/A N/A 234398 234417 GTTTATCAATTTAAAACATT  81 856
    1250067 N/A N/A 235636 235655 TCTAGGCCATATGGATAATA  37 857
    1250093 N/A N/A 237672 237691 ACAGCAACCATCTAAATTTA  71 858
    1250119 N/A N/A 241579 241598 TCTACTTCTTATCATTCACT  20 859
    1250145 N/A N/A 243715 243734 TTTGGACTTTCAAATTTCTT  40 860
    1250171 N/A N/A 246987 247006 CAACTTATTTTCAAATATCA  56 861
    1250197 N/A N/A 250401 250420 TTTATATTCCTCTATAACAT  36 862
    1250223 N/A N/A 253875 253894 ATCTGAATTATTAATTGCTT  40 863
    1250249 N/A N/A 255071 255090 GTATTATTTCCTAAAGACTA  73 864
    1250275 N/A N/A 256949 256968 AAGAAACCTTTATTTTGCTA  78 865
    1250300 N/A N/A 259521 259540 GTAGTGTAAATAGGGAAGCT  31 866
    260898 260917
  • TABLE 13
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  15 227
    1248334   99  118 112512 112531 CACATGTGCTCTATCCTCAT  59 867
    1248360  379  398 168924 168943 TTCCTGTTTGGGTCTCTTAG  29 868
    1248386 1007 1026 183354 183373 CAGAAAGCTTCTTCACTGAC  48 869
    1248412 1711 1730 188520 188539 TGAAAAAACTCCTATCCCAC  39 870
    1248438 2355 2374 199912 199931 GTAGGATCTTCCAATAAATC  28 871
    1248464 2719 2738 215348 215367 TTGAAAGTAATAATATGGAT  77 872
    1248490 3678 3697 238143 238162 GAACTAGTTGCATTTAGCTT  25 873
    1248516 4033 4052 243205 243224 CAGCATTTCCAGAATGAATA  32 874
    1248542 4597 4616 253602 253621 GTTGTCTTCATACTTGGGTT  24 875
    1248567 6249 6268 262777 262796 CCTTTGTCTTCCTTTTCTGA  45 876
    1248593 7010 7029 263538 263557 GCTTGTGATTCTATGGAACA  19 877
    1248619 7288 7307 263816 263835 AGCAGAATCAACTTTATAAA  52 878
    1248644 7430 7449 263958 263977 TTAAATCATCATTTTTGTTT  81 879
    1248669 7530 7549 264058 264077 CAGCTTCAAACTATAATGGA  34 880
    1248694 7833 7852 264361 264380 TTTACAGTATTTATATTTTC  71 881
    1248719 8092 8111 264620 264639 GGCATTACTATTGAAAGCAA  51 882
    1248745 8380 8399 264908 264927 GTATAAAGAATCTACATTTA  73 883
    1248771 8518 8537 265046 265065 CAAAGACAACAATTAAATAC  73 884
    1248797 8660 8679 265188 265207 CTCTTCTTAATTAACTTCCA  45 885
    1248821 N/A N/A 112682 112701 GTCATTCTTAACATAGATAA  61 886
    1248847 N/A N/A 114843 114862 AAGATCTAATTTAACTGTCA  61 887
    1248873 N/A N/A 117895 117914 TGTCATTTCCCCATACATAT  79 888
    1248899 N/A N/A 124922 124941 AAATTTAGTCATAATAGTAC  79 889
    1248925 N/A N/A 127957 127976 AATATATCAACAAATACAAA  86 890
    1248950 N/A N/A 129692 129711 GAGGACACTTTAATTATGAA  61 891
    1248976 N/A N/A 141941 141960 CTTTCTGTTTCTGTGAGTTT  23 892
    249003 249022
    1249002 N/A N/A 145254 145273 GACCATTTTTATCTGTGTTA  76 893
    1249028 N/A N/A 146355 146374 TCAGGCTTCTTATATTCATT  57 894
    1249054 N/A N/A 150098 150117 ACATTATCTTTTACTAAGTA  75 895
    1249080 N/A N/A 152667 152686 CCTTCTCATTCCATTGCCAA  72 896
    1249106 N/A N/A 157633 157652 TTCTTCTTTTCATCAAAGAC  57 897
    1249132 N/A N/A 162865 162884 CCTTAACATTATATTAGTTA  70 898
    1249158 N/A N/A 167737 167756 ATCAGTCATTCCAAATGTTA  39 899
    1249184 N/A N/A 170939 170958 ATAAAATCTCTCATTTCCAA  52 900
    1249210 N/A N/A 172185 172204 CAGAATTTCTTAAACTGCCC  21 901
    1249236 N/A N/A 172956 172975 ATTTGATACACAATAGCTCC  26 902
    1249262 N/A N/A 174579 174598 TTTATCATTATTAATGTCTA  48 903
    1249288 N/A N/A 175963 175982 GATGTTTTTTAATCTATTAA  62 904
    1249314 N/A N/A 176965 176984 ACTTAAAAACTTACTCTTTA  49 905
    1249340 N/A N/A 177947 177966 TCCATTTAATCCATTCTGCA  23 906
    1249366 N/A N/A 178461 178480 CTTCTACTCTCCTCATCCTA  43 907
    1249392 N/A N/A 179936 179955 TTCATATTTAATAAAAAGCA  64 908
    1249418 N/A N/A 180689 180708 TTTGCCATTTCTATAACTCA  14 909
    1249444 N/A N/A 181938 181957 TGATAGTTCCTAATTTCTCC  17 910
    1249470 N/A N/A 183774 183793 TGAGAACTTTTACTATATCA  18 911
    1249496 N/A N/A 184558 184577 CAATTTTAACTTAATTTCCT  53 912
    1249522 N/A N/A 185619 185638 CTTCATCATCACAAAAACCC  47 913
    1249548 N/A N/A 186387 186406 ATAATTGTCATTATTATATT  70 914
    1249574 N/A N/A 189438 189457 TTCTAAATTTTAAAATTTCA  91 915
    1249600 N/A N/A 190808 190827 ACTCTATTTTTATATAGAGA  76 916
    1249626 N/A N/A 194860 194879 CCATTATTTTATACCTACTA  33 917
    1249652 N/A N/A 200393 200412 AAGTTAATATCAAACCCTAA  58 918
    1249678 N/A N/A 201716 201735 CATCCTTTCCATCCTAAGCA  48 919
    1249704 N/A N/A 202855 202874 TTGTAAACAATAAATAATAT 101 920
    1249730 N/A N/A 203354 203373 CTACCATCTTCCTTTGGCAA  33 921
    1249756 N/A N/A 203930 203949 CTAAGAACCTTAATCAGTCA  45 922
    1249782 N/A N/A 206363 206382 TAGGGAATATCCTATAGGCA  32 923
    1249808 N/A N/A 208114 208133 AATGTGCTTTCATTTATTTA  35 924
    1249834 N/A N/A 209260 209279 GTTTTTAATTCTCTTAGATA  27 925
    1249860 N/A N/A 210869 210888 TATTTACCCACATTTATTCA  65 926
    1249886 N/A N/A 213719 213738 ATTTTCTTCCTCTAACAAAT  71 927
    1249912 N/A N/A 216786 216805 AGGCTTCTTTTTAACCTTTA  22 928
    1249938 N/A N/A 222278 222297 CATAAATTAAATTCTACCCA  70 929
    1249964 N/A N/A 225468 225487 AGGATTCTACATTCTTGCTA  54 930
    1249990 N/A N/A 229454 229473 ATTCTATTTTATAAATGCCG  23 931
    1250016 N/A N/A 231814 231833 TCTCTTCATTTTAAAAACAC  43 932
    1250042 N/A N/A 234546 234565 ATCCAGTATTTATTTAGAGA  28 933
    1250068 N/A N/A 235802 235821 GCTTATCACACATCTTGAAC  34 934
    1250094 N/A N/A 237763 237782 GTTTTATTCTAAAATTGTGA  46 935
    1250120 N/A N/A 241580 241599 GTCTACTTCTTATCATTCAC  27 936
    1250146 N/A N/A 243755 243774 TTGCTTCTATATCATACAAA  10 937
    1250172 N/A N/A 247052 247071 AGTAACTATTTTCTTAGTTA  33 938
    1250198 N/A N/A 250409 250428 ACTTCAAATTTATATTCCTC  16 939
    1250224 N/A N/A 253927 253946 AAATTATGCCATATTAGTCA  27 940
    1250250 N/A N/A 255087 255106 TCTATTCATTCAAATTGTAT  70 941
    1250276 N/A N/A 256995 257014 CTCTAAAATTCCTTTTGCTT  55 942
    1250301 N/A N/A 259522 259541 AGTAGTGTAAATAGGGAAGC  33 943
    260899 260918
  • TABLE 14
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910023 4598 4617 253603 253622 GGTTGTCTTCATACTTGGGT  19  109
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  23  227
    1248335  108  127 112521 112540 GTAAAATCTCACATGTGCTC  59  944
    1248361  402  421 168947 168966 TTTTCATCATCCTCATCCTT  48  945
    1248387 1039 1058 183386 183405 GCTTAGACAGAACACAGTCA  38  946
    1248413 1712 1731 188521 188540 CTGAAAAAACTCCTATCCCA  48  947
    1248439 2384 2403 199941 199960 TGGCTATACTCATTGCTCTT  20  948
    1248465 2762 2781 215391 215410 AACTAAGGCTCACAATAAAA  54  949
    1248491 3711 3730 238176 238195 GGAGCTCCAATATCAACCGT  45  950
    1248517 4034 4053 243206 243225 GCAGCATTTCCAGAATGAAT  25  951
    1248568 6260 6279 262788 262807 TGATATCTTTCCCTTTGTCT  57  952
    1248594 7025 7044 263553 263572 AAACAACTCTTTAATGCTTG  51  953
    1248620 7298 7317 263826 263845 TGCAGGATAAAGCAGAATCA  42  954
    1248645 7431 7450 263959 263978 CTTAAATCATCATTTTTGTT  88  955
    1248670 7534 7553 264062 264081 GTGACAGCTTCAAACTATAA  64  956
    1248695 7842 7861 264370 264389 AATGAACTTTTTACAGTATT  60  957
    1248720 8101 8120 264629 264648 CAATGATAAGGCATTACTAT  69  958
    1248746 8382 8401 264910 264929 CAGTATAAAGAATCTACATT  69  959
    1248772 8529 8548 265057 265076 AAAGATAGAAACAAAGACAA  82  960
    1248798 8661 8680 265189 265208 ACTCTTCTTAATTAACTTCC  53  961
    1248822 N/A N/A 112684 112703 ATGTCATTCTTAACATAGAT  68  962
    1248848 N/A N/A 114869 114888 CTTTATTTATATCCAACTCA  84  963
    1248874 N/A N/A 118831 118850 GGCAACAAAATCATGAACAA  57  964
    1248900 N/A N/A 124931 124950 TTATATTTTAAATTTAGTCA  73  965
    1248926 N/A N/A 128080 128099 TGGTTAATTTATAATTAACC  88  966
    1248951 N/A N/A 131500 131519 CTGTTTTCCATAATTGCTGA  63  967
    1248977 N/A N/A 142005 142024 CCAACATTTTCCATTCCTCC 110  968
    1249003 N/A N/A 145369 145388 CTTTTTACTTTATTCTGCCA  86  969
    1249029 N/A N/A 146372 146391 CCCAAGAGATCATTTAGTCA  65  970
    1249055 N/A N/A 150101 150120 ATTACATTATCTTTTACTAA  88  971
    1249081 N/A N/A 153912 153931 AACTTATTAATAATTATTTA  95  972
    1249107 N/A N/A 157753 157772 ATTCTGGATTTTAATAATCA 101  973
    1249133 N/A N/A 162869 162888 GTTTCCTTAACATTATATTA  75  974
    1249159 N/A N/A 167780 167799 AATCATATTTCACCAGACTA  44  975
    1249185 N/A N/A 171260 171279 TTCAAATATTTTCTAGGCCT  26  976
    1249211 N/A N/A 172186 172205 TCAGAATTTCTTAAACTGCC  36  977
    1249237 N/A N/A 172998 173017 CATAATTTCTCATTCAGCCA  14  978
    1249263 N/A N/A 174585 174604 ATACATTTTATCATTATTAA  86  979
    1249289 N/A N/A 175992 176011 ATAAACCTTTTATAATATCA  72  980
    1249315 N/A N/A 176968 176987 GACACTTAAAAACTTACTCT  21  981
    1249341 N/A N/A 177954 177973 GTTTGGCTCCATTTAATCCA  12  982
    1249367 N/A N/A 178471 178490 ATCTACCTCTCTTCTACTCT  59  983
    1249393 N/A N/A 179939 179958 ACTTTCATATTTAATAAAAA  72  984
    1249419 N/A N/A 180715 180734 TTATTATTCTATTATTGACC  55  985
    1249445 N/A N/A 181954 181973 GCCATGTAATTTACTATGAT  20  986
    1249471 N/A N/A 183775 183794 ATGAGAACTTTTACTATATC  37  987
    1249497 N/A N/A 184633 184652 TTTCATGCAAATAAATTTTA  80  988
    1249523 N/A N/A 185621 185640 CACTTCATCATCACAAAAAC  58  989
    1249549 N/A N/A 186396 186415 CTGTGATTCATAATTGTCAT  35  990
    1249575 N/A N/A 189605 189624 ATATTGCAAATAACAACACA  59  991
    1249601 N/A N/A 190841 190860 ACTATTTCTTTATCAAGCAA  30  992
    1249627 N/A N/A 194862 194881 AACCATTATTTTATACCTAC  43  993
    1249653 N/A N/A 200422 200441 TACAAAATTTTAAACACTTT 107  994
    1249679 N/A N/A 201735 201754 ATTGCACTTATTCCTAGAAC  29  995
    1249705 N/A N/A 202858 202877 ACTTTGTAAACAATAAATAA 100  996
    1249731 N/A N/A 203355 203374 TCTACCATCTTCCTTTGGCA  35  997
    1249757 N/A N/A 203931 203950 CCTAAGAACCTTAATCAGTC  51  998
    1249783 N/A N/A 206377 206396 CCTATAACTTATCCTAGGGA  82  999
    1249809 N/A N/A 208139 208158 ATTTTCCTCTAATCTATGAA  49 1000
    1249835 N/A N/A 209449 209468 GTTCACTTAATATAATATAT  62 1001
    1249861 N/A N/A 210870 210889 GTATTTACCCACATTTATTC  70 1002
    1249887 N/A N/A 213850 213869 ATTTTTTAAACAATTATCTT  78 1003
    1249913 N/A N/A 216831 216850 ATATTATATTCAAATACAAA  86 1004
    1249939 N/A N/A 222281 222300 TTTCATAAATTAAATTCTAC  96 1005
    1249965 N/A N/A 226213 226232 TGGTTATTATACAATAATTA  76 1006
    1249991 N/A N/A 229542 229561 ACTTTTTTTACTATTAGGGA  58 1007
    1250017 N/A N/A 231902 231921 TGTGATTTCAACATTAAGAA  34 1008
    1250043 N/A N/A 234957 234976 AATATTTTCTCTTAATTGCA  84 1009
    1250069 N/A N/A 236196 236215 CAGGTCTTAATAAATTTTGC  25 1010
    1250095 N/A N/A 237827 237846 AGTCATATAATCATCTGCGA  32 1011
    1250121 N/A N/A 241678 241697 ATTATATTAATATTTTGATC  92 1012
    1250147 N/A N/A 243864 243883 GCCTCATATTCAATTATATA  28 1013
    1250173 N/A N/A 247187 247206 ACTGTTCTTTCTAATTGGTA  48 1014
    1250199 N/A N/A 250509 250528 GATCAAAATTCTATTTGACA  22 1015
    1250225 4774 4793 254142 254161 ACCCAGTTTTTTCATTGCAT  25 1016
    255535 255554
    1250251 N/A N/A 255125 255144 TACATTTTCTCATACAGTAA  59 1017
    1250277 N/A N/A 257136 257155 TTCTTTTCATATATTACTCC  37 1018
    1250302 N/A N/A 259524 259543 TAAGTAGTGTAAATAGGGAA  55 1019
    260901 260920
  • TABLE 15
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     909602 7311 7330 263839 263858 GGCTAAACAATACTGCAGGA 21 1020
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 16  227
     910391 N/A N/A 259525 259544 GTAAGTAGTGTAAATAGGGA 58  404
    260902 260921
    1248336  114  133 112527 112546 TAGAAAGTAAAATCTCACAT 60 1021
    1248362  403  422 168948 168967 ATTTTCATCATCCTCATCCT 37 1022
    1248388 1067 1086 183414 183433 ACAACTGCAATCCTATTAGC 53 1023
    1248414 1761 1780 188570 188589 AGCTCTTTTTCACTTTTGGA 19 1024
    1248440 2385 2404 199942 199961 CTGGCTATACTCATTGCTCT 22 1025
    1248466 2771 2790 215400 215419 GTTCCATTAAACTAAGGCTC 18 1026
    1248492† 3756 3775 238221 238240 TCAAGGGATTCCTCAGGTTC 36 1027
    1248518 4062 4081 243234 243253 ACTTGAAAACCATATGCAAC 34 1028
    1248543 4601 4620 253606 253625 ACAGGTTGTCTTCATACTTG 21 1029
    1248569 6261 6280 262789 262808 CTGATATCTTTCCCTTTGTC 56 1030
    1248595 7026 7045 263554 263573 AAAACAACTCTTTAATGCTT 48 1031
    1248646 7432 7451 263960 263979 GCTTAAATCATCATTTTTGT 34 1032
    1248671 7535 7554 264063 264082 AGTGACAGCTTCAAACTATA 45 1033
    1248696 7888 7907 264416 264435 CTTTTAATTTCTCATTTTAC 54 1034
    1248721 8109 8128 264637 264656 GCCTCTTTCAATGATAAGGC 43 1035
    1248747 8387 8406 264915 264934 AGCTTCAGTATAAAGAATCT 64 1036
    1248773 8538 8557 265066 265085 TGGCATTTCAAAGATAGAAA 43 1037
    1248799 8662 8681 265190 265209 CACTCTTCTTAATTAACTTC 62 1038
    1248823 N/A N/A 112776 112795 AGGAAGATTTTAAATTGCAC 61 1039
    1248849 N/A N/A 114925 114944 TTTCTTGTATTTACTTGCCT 59 1040
    1248875 N/A N/A 118847 118866 AACTTTCTAACACTTAGGCA 59 1041
    1248901 N/A N/A 124966 124985 ATGAAGGTATTTAAAATCTA 68 1042
    1248927 N/A N/A 128432 128451 GAGAACATTTTTAAATTAAC 66 1043
    1248952 N/A N/A 132130 132149 AGATGTAATTCTATTACATA 92 1044
    1248978 N/A N/A 142265 142284 TCAATTATATTTAATTGACA 97 1045
    1249004 N/A N/A 145404 145423 GATAAAATCTCTAACAATTA 83 1046
    1249030 N/A N/A 146412 146431 GCAAATTAAAATAATGGGTT 71 1047
    1249056 N/A N/A 150294 150313 TTTTTAACAATTATAAGTAA 72 1048
    1249082 N/A N/A 155779 155798 CACCATCATTCACTTAGATT 74 1049
    1249108 N/A N/A 157867 157886 CAAGAACTCATTCAACCGTC 74 1050
    1249134 N/A N/A 163446 163465 CCATTTATTCCTTATAGCAA 65 1051
    1249160 N/A N/A 167788 167807 GGTATTCAAATCATATTTCA 21 1052
    1249186 N/A N/A 171261 171280 ATTCAAATATTTTCTAGGCC 44 1053
    1249212 N/A N/A 172280 172299 CAGGAAGCAAATACAAGCCC 25 1054
    1249238 N/A N/A 173006 173025 ATCACAAGCATAATTTCTCA 36 1055
    1249264 N/A N/A 174698 174717 TTTTTGCTAATCTTACAGCA 49 1056
    1249290 N/A N/A 175997 176016 GGCAGATAAACCTTTTATAA 51 1057
    1249316 N/A N/A 176969 176988 TGACACTTAAAAACTTACTC 21 1058
    1249342 N/A N/A 178010 178029 CTAATAGTCCATCTAGATTA 44 1059
    1249368 N/A N/A 178516 178535 GTGGCATTTTTCTTTTTGAA 34 1060
    1249394 N/A N/A 179942 179961 ATGACTTTCATATTTAATAA 67 1061
    1249420 N/A N/A 180753 180772 GAAGTTTAAAACTTTAGTGC 29 1062
    1249446 N/A N/A 181986 182005 TTTATTACTTTACAGTGCTA 23 1063
    1249472 N/A N/A 183795 183814 ATAAGACAACACATTTTCAA 52 1064
    1249498 N/A N/A 184734 184753 AATATAAGCTCAAATTGCAT 62 1065
    1249524 N/A N/A 185624 185643 ATCCACTTCATCATCACAAA 39 1066
    1249550 N/A N/A 186441 186460 ATTTATATAATAACAGAATC 75 1067
    1249576 N/A N/A 189618 189637 GCTTAATGCATTAATATTGC 13 1068
    1249602 N/A N/A 191017 191036 GTTTGACATTTTCAGTATTA 14 1069
    1249628 N/A N/A 194924 194943 ACTTCATCATTTAAGTATTA 53 1070
    1249654 N/A N/A 200423 200442 CTACAAAATTTTAAACACTT 84 1071
    1249680 N/A N/A 201767 201786 AACGAAAACACTCTCAGTCT 52 1072
    1249706 N/A N/A 202859 202878 AACTTTGTAAACAATAAATA 91 1073
    1249732 N/A N/A 203360 203379 AACTGTCTACCATCTTCCTT 45 1074
    1249758 N/A N/A 204009 204028 TTGCATACACTTAAAGCTCA 69 1075
    1249784 N/A N/A 206383 206402 ACCTAACCTATAACTTATCC 79 1076
    1249810 N/A N/A 208150 208169 ATCTTAACAATATTTTCCTC 43 1077
    1249836 N/A N/A 209454 209473 GCTTTGTTCACTTAATATAA 27 1078
    1249862 N/A N/A 210961 210980 ATTTACAATTTATTTATGCA 68 1079
    1249888 N/A N/A 213855 213874 ACGAAATTTTTTAAACAATT 82 1080
    1249914 N/A N/A 216848 216867 GGCTATATTTTAAACATATA 54 1081
    1249940 N/A N/A 222282 222301 TTTTCATAAATTAAATTCTA 86 1082
    1249966 N/A N/A 226251 226270 GCTACTATAATTATACAATA 43 1083
    1249992 N/A N/A 229546 229565 ATTGACTTTTTTTACTATTA 42 1084
    1250018 N/A N/A 231976 231995 ACAAAATAATTAACATTTCT 89 1085
    1250044 N/A N/A 235015 235034 CACTAACTACTAACACTTCC 69 1086
    1250070 N/A N/A 236284 236303 TGAGGATCCATATTCAGGGT 17 1087
    1250096 N/A N/A 238319 238338 AGACATTTAAATAAATAGGA 84 1088
    1250122 N/A N/A 241687 241706 ATCATTTTCATTATATTAAT 76 1089
    1250148 N/A N/A 243917 243936 CTGCATGTAACCTTTATACA 20 1090
    1250174 N/A N/A 247339 247358 TTTCAAAAAATCATACAAAC 96 1091
    1250200 N/A N/A 250553 250572 CTTTTTTCCCAAAATTATAA 65 1092
    1250226 4775 4794 254143 254162 AACCCAGTTTTTTCATTGCA 23 1093
    255536 255555
    1250252 N/A N/A 255193 255212 CTACTACTCACTAATTCAAA 71 1094
    1250278 N/A N/A 257137 257156 GTTCTTTTCATATATTACTC 24 1095
  • TABLE 16
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  17  227
    1248337  132  151 112545 112564 TCAGAATTTTTACTGGAGTA  73 1096
    1248363  413  432 168958 168977 GCTTTGGGCCATTTTCATCA  19 1097
    1248389 1069 1088 183416 183435 GAACAACTGCAATCCTATTA  33 1098
    1248415 1767 1786 188576 188595 TTTTTCAGCTCTTTTTCACT  49 1099
    1248441 2386 2405 199943 199962 ACTGGCTATACTCATTGCTC  18 1100
    1248467 2773 2792 215402 215421 AAGTTCCATTAAACTAAGGC  28 1101
    1248493† 3814 3833 240232 240251 GCTTATCTGACAACACTTGA  10 1102
    1248519 4064 4083 243236 243255 ACACTTGAAAACCATATGCA  23 1103
    1248544 4790 4809 254158 254177 TTTGTGGTTTCTTTGAACCC  36 1104
    1248570 6275 6294 262803 262822 ACTTTTTACTTTCCCTGATA  38 1105
    1248596 7036 7055 263564 263583 ATGTAAAAATAAAACAACTC  78 1106
    1248621 7314 7333 263842 263861 GATGGCTAAACAATACTGCA  35 1107
    1248647 7434 7453 263962 263981 GTGCTTAAATCATCATTTTT  38 1108
    1248672 7554 7573 264082 264101 GGCAAGATAAACATGCAGCA  24 1109
    1248697 7890 7909 264418 264437 TACTTTTAATTTCTCATTTT  63 1110
    1248722 8118 8137 264646 264665 TTTCTTTAAGCCTCTTTCAA  64 1111
    1248748 8402 8421 264930 264949 ACACTACAAGTCAATAGCTT  64 1112
    1248774 8540 8559 265068 265087 AATGGCATTTCAAAGATAGA  55 1113
    1248800 8663 8682 265191 265210 ACACTCTTCTTAATTAACTT  75 1114
    1248824 N/A N/A 112777 112796 TAGGAAGATTTTAAATTGCA  80 1115
    1248850 N/A N/A 115244 115263 TTGTTCCCCATTAATGTTTA  76 1116
    1248876 N/A N/A 118851 118870 TTTTAACTTTCTAACACTTA 108 1117
    1248902 N/A N/A 125043 125062 ATTACTTTCACATCTAAGCT  96 1118
    1248928 N/A N/A 128487 128506 TAGAGCCATATTTTAATAAT  63 1119
    128530 128549
    128573 128592
    1248953 N/A N/A 133376 133395 CTATTCTTTTCAAAATATTA  89 1120
    1248979 N/A N/A 142299 142318 GTTAATAATCCAATATTTTA  83 1121
    1249005 N/A N/A 145407 145426 ATTGATAAAATCTCTAACAA  86 1122
    1249031 N/A N/A 146427 146446 GGCACTATAACCAATGCAAA  48 1123
    1249057 N/A N/A 150300 150319 ATTTACTTTTTAACAATTAT  58 1124
    1249083 N/A N/A 155814 155833 ACCTCCTCTACCATTAGCAC  66 1125
    1249109 N/A N/A 158023 158042 ACATCTAACTTTCCTAGGAA  57 1126
    1249135 N/A N/A 163447 163466 ACCATTTATTCCTTATAGCA  62 1127
    1249161 N/A N/A 169321 169340 TTGTCCTTCCTTAATTCCCG  17 1128
    1249187 N/A N/A 171276 171295 TCCATACCTTATCTAATTCA  22 1129
    1249213 N/A N/A 172339 172358 ACCTGCATCTCCTCAGGCCT  46 1130
    1249239 N/A N/A 173081 173100 TTTATTTAAATATCAAATAA  74 1131
    1249265 N/A N/A 174709 174728 TGAGAGTTTCCTTTTTGCTA  31 1132
    1249291 N/A N/A 176071 176090 GTACATTTTTCAAAAGAACA  20 1133
    1249317 N/A N/A 176973 176992 TTTATGACACTTAAAAACTT  69 1134
    1249343 N/A N/A 178011 178030 TCTAATAGTCCATCTAGATT  55 1135
    1249369 N/A N/A 178752 178771 ATCTATCATATATTCAGCCT  32 1136
    1249395 N/A N/A 179943 179962 AATGACTTTCATATTTAATA  52 1137
    1249421 N/A N/A 180757 180776 CCATGAAGTTTAAAACTTTA  57 1138
    1249447 N/A N/A 182021 182040 TTGTCATCAATCATAATCTC  25 1139
    1249473 N/A N/A 183813 183832 ATTACTTTCAACATGAGTAT  32 1140
    1249499 N/A N/A 184743 184762 TTCATTGCAAATATAAGCTC  36 1141
    1249525 N/A N/A 185632 185651 ATTTATTAATCCACTTCATC  61 1142
    1249551 N/A N/A 186487 186506 ATTTCTCTCACCTTACCCAG  40 1143
    1249577 N/A N/A 189660 189679 GATATTAACTAAATTAGAAC  64 1144
    1249603 N/A N/A 191114 191133 ACAATAATTCCTAATATTTT 111 1145
    1249629 N/A N/A 195681 195700 CCTGATGCAAATCTTACCAT  44 1146
    1249655 N/A N/A 200429 200448 GTAGGACTACAAAATTTTAA  29 1147
    1249681 N/A N/A 201780 201799 CTGCAGATAATAAAACGAAA  78 1148
    1249707 N/A N/A 202870 202889 CCTTAATACATAACTTTGTA  48 1149
    1249733 N/A N/A 203483 203502 CAAGAAGAATTTCAACCAAA  80 1150
    1249759 N/A N/A 204088 204107 TTCCAAGATTCTATTGGCAA  20 1151
    1249785 N/A N/A 206386 206405 ATGACCTAACCTATAACTTA  67 1152
    1249811 N/A N/A 208227 208246 CACTTTCTGCAAAATAGGTA  15 1153
    1249837 N/A N/A 209581 209600 TTGTTGCTCCCATTTACCCT  39 1154
    1249863 N/A N/A 212405 212424 GTTTTTTTTTCCTTTAGTTC  14 1155
    1249889 N/A N/A 214622 214641 ACTTTGTTTCCCTTTATCTA  52 1156
    1249915 N/A N/A 216892 216911 AGATTGTTTTAATCTAGCTA  63 1157
    1249941 N/A N/A 222289 222308 GTCAGCCTTTTCATAAATTA  41 1158
    1249967 N/A N/A 226278 226297 GTCCCAATTTTTATTAAGAC  24 1159
    1249993 N/A N/A 229592 229611 CTTAGTTTATATGACAGCCT  27 1160
    1250019 N/A N/A 231980 231999 AGTGACAAAATAATTAACAT  79 1161
    1250045 N/A N/A 235019 235038 CAACCACTAACTACTAACAC  62 1162
    1250071 N/A N/A 236527 236546 TTCTCATTTTAATATATCTA  57 1163
    1250097 N/A N/A 238394 238413 GTATAGATGATTACTAGATA  67 1164
    1250123 N/A N/A 241689 241708 ATATCATTTTCATTATATTA  82 1165
    1250149 N/A N/A 244053 244072 ATGCATAATCCCATTATACA  19 1166
    1250175 N/A N/A 247346 247365 ACATCACTTTCAAAAAATCA  66 1167
    1250201 N/A N/A 250554 250573 TCTTTTTTCCCAAAATTATA  82 1168
    1250227 4776 4795 254144 254163 GAACCCAGTTTTTTCATTGC  18 1169
    255537 255556
    1250253 N/A N/A 255196 255215 TGTCTACTACTCACTAATTC  50 1170
    1250279 N/A N/A 257139 257158 ATGTTCTTTTCATATATTAC  38 1171
    1250303 N/A N/A 259564 259583 TTGGAGAGCTGAGGTAACTT  38 1172
    260941 260960
  • TABLE 17
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  23  227
    1248338  133  152 112546 112565 TTCAGAATTTTTACTGGAGT  59 1173
    1248364  440  459 168985 169004 ATTTTCCTGCTTCCAAGTCA  48 1174
    1248390 1102 1121 183449 183468 CCATTGCAAACATTTATTTC  37 1175
    1248416 1774 1793 188583 188602 TCTTCTGTTTTTCAGCTCTT  40 1176
    1248442 2388 2407 199945 199964 ATACTGGCTATACTCATTGC  55 1177
    1248468 2777 2796 215406 215425 AACCAAGTTCCATTAAACTA  53 1178
    1248494† 3820 3839 240238 240257 TTCTATGCTTATCTGACAAC  49 1179
    1248520 4212 4231 246309 246328 GACAAAGCTCTCAGTGGCCT  63 1180
    1248545 4846 4865 259762 259781 GGTTACAAAATCAAAGACCA  33 1181
    1248571 6276 6295 262804 262823 TACTTTTTACTTTCCCTGAT  58 1182
    1248597 7039 7058 263567 263586 GTTATGTAAAAATAAAACAA 103 1183
    1248622 7315 7334 263843 263862 AGATGGCTAAACAATACTGC  62 1184
    1248648 7435 7454 263963 263982 TGTGCTTAAATCATCATTTT  55 1185
    1248673 7596 7615 264124 264143 TTAGACTTCTGAACAGTGGA  47 1186
    1248698 7891 7910 264419 264438 ATACTTTTAATTTCTCATTT  82 1187
    1248723 8196 8215 264724 264743 GACTGATGATTACTGAATAA  57 1188
    1248749 8408 8427 264936 264955 ACCAACACACTACAAGTCAA  52 1189
    1248775 8543 8562 265071 265090 TTAAATGGCATTTCAAAGAT  70 1190
    1248801 8664 8683 265192 265211 TACACTCTTCTTAATTAACT  88 1191
    1248825 N/A N/A 112974 112993 ATCTGCTTCATTATATCTCT  64 1192
    1248851 N/A N/A 115394 115413 TTTTGATATTCAATTTACCT  72 1193
    1248877 N/A N/A 118854 118873 ACATTTTAACTTTCTAACAC  82 1194
    1248903 N/A N/A 125052 125071 AGCATATTAATTACTTTCAC  64 1195
    1248929 N/A N/A 128488 128507 ATAGAGCCATATTTTAATAA  85 1196
    128531 128550
    128574 128593
    1248954 N/A N/A 134288 134307 CTTTAGAGATAATCTAGTCC  77 1197
    1248980 N/A N/A 142450 142469 GCTTAAGAACACATTAGTGA  78 1198
    1249006 N/A N/A 145828 145847 ATGTTGTATTCTAATTATCA  83 1199
    1249032 N/A N/A 146480 146499 AATTAAATCCCTACTTTATA  92 1200
    1249058 N/A N/A 150301 150320 AATTTACTTTTTAACAATTA 100 1201
    1249084 N/A N/A 155818 155837 TCTCACCTCCTCTACCATTA  64 1202
    1249110 N/A N/A 158105 158124 TGCTTTTCTTTAACAGAAAT  86 1203
    1249136 N/A N/A 163471 163490 AAGCACTATTTTAAGAGCTA  85 1204
    1249162 N/A N/A 169323 169342 TTTTGTCCTTCCTTAATTCC  51 1205
    1249188 N/A N/A 171502 171521 GAAACATAAACATCAAATAA  86 1206
    1249214 N/A N/A 172351 172370 CTTCACATTTCAACCTGCAT  40 1207
    1249240 N/A N/A 173085 173104 ATGTTTTATTTAAATATCAA  64 1208
    1249266 N/A N/A 175089 175108 GGACACTATTTAATGAATCA  20 1209
    1249292 N/A N/A 176648 176667 TTAATTTATTTCATCAGTCA  77 1210
    1249318 N/A N/A 177473 177492 ATTTTGCAATTCATTTGTTA  40 1211
    1249344 N/A N/A 178020 178039 AGCATCAAATCTAATAGTCC  22 1212
    1249370 N/A N/A 178775 178794 GCTTATCTTTCCTTTTCTTA  28 1213
    1249396 N/A N/A 179945 179964 GTAATGACTTTCATATTTAA  37 1214
    1249422 N/A N/A 180767 180786 GCCTTCACCACCATGAAGTT  36 1215
    1249448 N/A N/A 182025 182044 GGCATTGTCATCAATCATAA  19 1216
    1249474 N/A N/A 183842 183861 AAACATTTTTTAATATGGCA  43 1217
    1249500 N/A N/A 184763 184782 ATAACATTCTTATATCAGCA  31 1218
    1249526 N/A N/A 185637 185656 TATACATTTATTAATCCACT  46 1219
    1249552 N/A N/A 186521 186540 ATGTCTGTTTTATACAGGCA  58 1220
    1249578 N/A N/A 189685 189704 CTTCTCTTCACATATAAAAA  54 1221
    1249604 N/A N/A 191169 191188 TAGTTTTTCAATACAAACAC  48 1222
    1249630 N/A N/A 199983 200002 GCAGGACTTTTAACATACCT  65 1223
    1249656 N/A N/A 200498 200517 ATTCAGATAAAATCTGCAAC  77 1224
    1249682 N/A N/A 201811 201830 TTATTTCTCACAAATACACA  72 1225
    1249708 N/A N/A 202877 202896 CCATTTCCCTTAATACATAA  30 1226
    1249734 N/A N/A 203538 203557 TGACATAAAATTTTATATTA  93 1227
    1249760 N/A N/A 204253 204272 TTGGTTTAAATTAAAAGGAA  54 1228
    1249786 N/A N/A 206387 206406 TATGACCTAACCTATAACTT  64 1229
    1249812 N/A N/A 208303 208322 CTTTATTTTTTTTCTAGTTA  65 1230
    1249838 N/A N/A 209815 209834 AAGGTGATATATACAAGAAC  45 1231
    1249864 N/A N/A 212579 212598 GTTAAATTTATTACTATATT  99 1232
    1249890 N/A N/A 214990 215009 GTCTCTGATCTTTCTAGCCC  29 1233
    1249916 N/A N/A 216948 216967 ATCAACACTTAAATTACATA  53 1234
    1249942 N/A N/A 222521 222540 ATTCTCTTTTCAACTTCAAT  57 1235
    1249968 N/A N/A 226381 226400 CCAATATATTTAAATATGAT  88 1236
    1249994 N/A N/A 229604 229623 GTATAATTCATTCTTAGTTT  40 1237
    1250020 N/A N/A 231981 232000 AAGTGACAAAATAATTAACA  76 1238
    1250046 N/A N/A 235022 235041 ATCCAACCACTAACTACTAA  62 1239
    1250072 N/A N/A 236528 236547 CTTCTCATTTTAATATATCT  43 1240
    1250098 N/A N/A 238454 238473 GCATTTTTTTTCAAACAGCA  28 1241
    1250124 N/A N/A 241720 241739 ACATTTGTATCACCAATTAA  70 1242
    1250150 N/A N/A 244154 244173 CTTTTATCCTAACATAGATA  91 1243
    1250176 N/A N/A 247429 247448 GCAAATTTACCTCAAAGGAT  47 1244
    1250202 N/A N/A 250658 250677 AAACAATTTCCCTCTAACTA  80 1245
    1250228 4778 4797 254146 254165 TTGAACCCAGTTTTTTCATT  49 1246
    255539 255558
    1250254 N/A N/A 255310 255329 TCTTTTCACATTACTAGGCT  34 1247
    1250280 N/A N/A 257269 257288 AGATAATTCCAAACTTCTCA  43 1248
    1250304 N/A N/A 259587 259606 AAAATTCCTTGCAAAACCAG  62 1249
    260964 260983
  • TABLE 18
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  20  227
    1248339  139  158 112552 112571 CAATTCTTCAGAATTTTTAC  75 1250
    1248365  446  465 168991 169010 GAAGAGATTTTCCTGCTTCC  25 1251
    1248391 1103 1122 183450 183469 GCCATTGCAAACATTTATTT  26 1252
    1248417 1818 1837 188627 188646 TTTTTCTCTTCTTCTCCAGA  43 1253
    1248443 2398 2417 199955 199974 GTTGGTCAAAATACTGGCTA  23 1254
    1248469 2798 2817 215427 215446 ACAATCCTTCCACATTTGCC  31 1255
    1248495† 3821 3840 240239 240258 CTTCTATGCTTATCTGACAA  15 1256
    1248521 4213 4232 246310 246329 GGACAAAGCTCTCAGTGGCC  28 1257
    1248546 4847 4866 259763 259782 TGGTTACAAAATCAAAGACC  33 1258
    1248572 6280 6299 262808 262827 TTTTTACTTTTTACTTTCCC  44 1259
    1248598 7040 7059 263568 263587 GGTTATGTAAAAATAAAACA  86 1260
    1248623 7317 7336 263845 263864 GAAGATGGCTAAACAATACT  57 1261
    1248649 7437 7456 263965 263984 AGTGTGCTTAAATCATCATT  39 1262
    1248674 7611 7630 264139 264158 ATATGGCTTCCCATATTAGA  32 1263
    1248699 7894 7913 264422 264441 AAGATACTTTTAATTTCTCA  53 1264
    1248724 8217 8236 264745 264764 GTGTAAACAAACATTGGAAA  59 1265
    1248750 8409 8428 264937 264956 CACCAACACACTACAAGTCA  40 1266
    1248776 8552 8571 265080 265099 AATCTACCTTTAAATGGCAT  56 1267
    1248802 8665 8684 265193 265212 ATACACTCTTCTTAATTAAC  70 1268
    1248826 N/A N/A 113346 113365 GCACCTTCTATAATATCAAC  78 1269
    1248852 N/A N/A 115559 115578 TCTCATGTCCAATTTAGTCC  50 1270
    1248878 N/A N/A 118858 118877 TTTCACATTTTAACTTTCTA  67 1271
    1248904 N/A N/A 125245 125264 AAGATGCTTATTAATATCTT  84 1272
    1248930 N/A N/A 128489 128508 CATAGAGCCATATTTTAATA  80 1273
    128532 128551
    128575 128594
    1248955 N/A N/A 134475 134494 ACCTAGTATATAACTTCCCT  85 1274
    1248981 N/A N/A 142643 142662 CTAATAATCCATAAATGTAA  62 1275
    1249007 N/A N/A 145921 145940 TGAAGATAATTAAATGCTAA  83 1276
    1249033 N/A N/A 146488 146507 AGATTTAGAATTAAATCCCT  85 1277
    1249059 N/A N/A 150308 150327 GTTTCTCAATTTACTTTTTA  51 1278
    1249085 N/A N/A 155820 155839 TTTCTCACCTCCTCTACCAT  82 1279
    1249111 N/A N/A 158120 158139 TCCTAAGACACATTTTGCTT  67 1280
    1249137 N/A N/A 163508 163527 TTTTAATAAAAATCTACACA  83 1281
    1249163 N/A N/A 169407 169426 TTTTGCTTCTCAACATTATT  21 1282
    1249189 N/A N/A 171503 171522 TGAAACATAAACATCAAATA  73 1283
    1249215 N/A N/A 172357 172376 GGCTGGCTTCACATTTCAAC  33 1284
    1249241 N/A N/A 173089 173108 AATCATGTTTTATTTAAATA 116 1285
    1249267 N/A N/A 175113 175132 CCATGATATTTTATATCTCA  22 1286
    1249293 N/A N/A 176665 176684 AAGTTTCTAAATCATTGTTA  55 1287
    1249319 N/A N/A 177486 177505 ACTAATGAAATTAATTTTGC  54 1288
    1249345 N/A N/A 178124 178143 ATCTAATTAACCATCAAATA  63 1289
    1249371 N/A N/A 178812 178831 CCTTTTCCATATCATGGCCA  16 1290
    1249397 N/A N/A 179978 179997 ACTATTTAAGAAAATATTCA  74 1291
    1249423 N/A N/A 180772 180791 ACCATGCCTTCACCACCATG  28 1292
    1249449 N/A N/A 182095 182114 CTTGGTCTTTCATCAAGACC  54 1293
    1249475 N/A N/A 183843 183862 TAAACATTTTTTAATATGGC  43 1294
    1249501 N/A N/A 184814 184833 TGGTTAGCAAATCTATGTTA  22 1295
    1249527 N/A N/A 185638 185657 CTATACATTTATTAATCCAC  19 1296
    1249553 N/A N/A 186540 186559 CCTGTTTTAATATATGCCAA  33 1297
    1249579 N/A N/A 189791 189810 AGTAATGAAAATAATACTAT  73 1298
    1249605 N/A N/A 191172 191191 GTATAGTTTTTCAATACAAA  25 1299
    1249631 N/A N/A 200015 200034 TCATCATTACCAAAGCACCA  30 1300
    1249657 N/A N/A 200521 200540 GACTGCTACACATTATGTTA  25 1301
    1249683 N/A N/A 201812 201831 ATTATTTCTCACAAATACAC  49 1302
    1249709 N/A N/A 202878 202897 TCCATTTCCCTTAATACATA  28 1303
    1249735 N/A N/A 203543 203562 AAACATGACATAAAATTTTA  76 1304
    1249761 N/A N/A 204276 204295 TGCTTACTTTCTATTAAGCA  76 1305
    1249787 N/A N/A 206390 206409 TTTTATGACCTAACCTATAA  79 1306
    1249813 N/A N/A 208338 208357 GTAAGTTTTAAAATTTGGAA  75 1307
    1249839 N/A N/A 209913 209932 TGCATATCATCTAATTTTTA  34 1308
    1249865 N/A N/A 212582 212601 TTTGTTAAATTTATTACTAT  76 1309
    1249891 N/A N/A 215059 215078 GTCAATAAAATTAATATTAT  75 1310
    1249917 N/A N/A 216950 216969 ATATCAACACTTAAATTACA 110 1311
    1249943 N/A N/A 222556 222575 CTGATGTCAACCATAAGTAC  32 1312
    1249969 N/A N/A 226405 226424 TTATTCCTAAAATCAACAAT  69 1313
    1249995 N/A N/A 229683 229702 GTCAAGTTAAACATTCCTCA  21 1314
    1250021 N/A N/A 232043 232062 CTACACTTTTATATTAGTGC   8 1315
    1250047 N/A N/A 235023 235042 TATCCAACCACTAACTACTA  57 1316
    1250073 N/A N/A 236627 236646 CATGTTTTTCTAATTTCCTA  40 1317
    1250099 N/A N/A 238495 238514 ATATCTAATTACATAAATTA  74 1318
    1250125 N/A N/A 241760 241779 TAGTTATTAATTAAATTGAA 101 1319
    1250151 N/A N/A 244191 244210 AAGAGTTTCCTTATATTCAA  34 1320
    1250177 N/A N/A 247430 247449 AGCAAATTTACCTCAAAGGA  35 1321
    1250203 N/A N/A 250861 250880 GCCTTGCTAAATACTAGAAA  38 1322
    1250229 4779 4798 254147 254166 TTTGAACCCAGTTTTTTCAT  42 1323
    255540 255559
    1250255 N/A N/A 255330 255349 GTTAAACTCTCTAAAATCTT  76 1324
    1250281 N/A N/A 257335 257354 TCTCTAACTTCATCTTGGCC  52 1325
    1250305 N/A N/A 259588 259607 AAAAATTCCTTGCAAAACCA  55 1326
    260965 260984
  • TABLE 19
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  23  227
    1248340  140  159 112553 112572 GCAATTCTTCAGAATTTTTA  51 1327
    1248366  555  574 170026 170045 GCTTTCCCTTTATTCAATAC   6 1328
    1248392 1136 1155 183483 183502 TGATATTTATTTCAAAGGAA  27 1329
    1248418 1820 1839 188629 188648 CATTTTTCTCTTCTTCTCCA  47 1330
    1248444 2399 2418 199956 199975 TGTTGGTCAAAATACTGGCT  21 1331
    1248470 2799 2818 215428 215447 GACAATCCTTCCACATTTGC  34 1332
    1248496† 3828 3847 240246 240265 TTGCCTTCTTCTATGCTTAT  10 1333
    1248522 4319 4338 247753 247772 TGATACTGAATATTAGCCAA  19 1334
    1248547 4942 4961 259858 259877 GTTTGTCATTTCTTGACTCT  30 1335
    1248573 6284 6303 262812 262831 TTTCTTTTTACTTTTTACTT  60 1336
    1248599 7055 7074 263583 263602 CATGTACATTTAATGGGTTA  62 1337
    1248624 7337 7356 263865 263884 TGTCAACCTTACCAAGAGCA  25 1338
    1248650 7439 7458 263967 263986 GTAGTGTGCTTAAATCATCA  27 1339
    1248675 7613 7632 264141 264160 ATATATGGCTTCCCATATTA  46 1340
    1248700 7895 7914 264423 264442 GAAGATACTTTTAATTTCTC  43 1341
    1248725 8219 8238 264747 264766 CTGTGTAAACAAACATTGGA  30 1342
    1248751 8410 8429 264938 264957 TCACCAACACACTACAAGTC  52 1343
    1248777 8553 8572 265081 265100 AAATCTACCTTTAAATGGCA  66 1344
    1248803 8666 8685 265194 265213 AATACACTCTTCTTAATTAA  71 1345
    1248827 N/A N/A 113347 113366 AGCACCTTCTATAATATCAA  64 1346
    1248853 N/A N/A 115616 115635 TATCTCTCCTACCTTTCCCT  73 1347
    1248879 N/A N/A 119056 119075 GCATAATTTACTAACAGTTT  65 1348
    1248905 N/A N/A 125264 125283 ATACTTTTTCCAAAGTATTA 112 1349
    1248931 N/A N/A 128490 128509 CCATAGAGCCATATTTTAAT  65 1350
    128533 128552
    128576 128595
    1248956 N/A N/A 134574 134593 AGGTGATTCACCTTATTTTA  73 1351
    1248982 N/A N/A 142705 142724 TTCTTTTTCCATTTGAATAA  87 1352
    1249008 N/A N/A 145922 145941 CTGAAGATAATTAAATGCTA  59 1353
    1249034 N/A N/A 146537 146556 GAAAATATTTTTCAACATTA  76 1354
    1249060 N/A N/A 150312 150331 TATTGTTTCTCAATTTACTT  71 1355
    1249086 N/A N/A 155823 155842 TCATTTCTCACCTCCTCTAC  76 1356
    1249112 N/A N/A 158146 158165 AGATATTCCATTAAATGATT  70 1357
    1249138 N/A N/A 163512 163531 CTTTTTTTAATAAAAATCTA  80 1358
    1249164 N/A N/A 169771 169790 GCCATAGGAATTCTTAGCAA   5 1359
    1249190 N/A N/A 171560 171579 AGGTAAGAAAACATTATTGC  25 1360
    1249216 N/A N/A 172381 172400 TGGCATACCTTAATAGATTT  17 1361
    1249242 N/A N/A 173200 173219 GTGCATATATTAACTTAAAA  22 1362
    1249268 N/A N/A 175218 175237 CAGTAGATAACTAAATGATA  26 1363
    1249294 N/A N/A 176724 176743 CAAGTTTTTACGCTTGTGGT  12 1364
    1249320 N/A N/A 177528 177547 ATTATTCACCATTATAGCCT  23 1365
    1249346 N/A N/A 178128 178147 TCATATCTAATTAACCATCA  24 1366
    1249372 N/A N/A 178821 178840 CCTTATCTCCCTTTTCCATA  59 1367
    1249398 N/A N/A 179983 180002 AAACAACTATTTAAGAAAAT  97 1368
    1249424 N/A N/A 180774 180793 CTACCATGCCTTCACCACCA  23 1369
    1249450 N/A N/A 182096 182115 CCTTGGTCTTTCATCAAGAC  40 1370
    1249476 N/A N/A 183849 183868 ACCAAATAAACATTTTTTAA  90 1371
    1249502 N/A N/A 184829 184848 TTTTGATTATACAAATGGTT  28 1372
    1249528 N/A N/A 185639 185658 GCTATACATTTATTAATCCA  17 1373
    1249554 N/A N/A 186541 186560 TCCTGTTTTAATATATGCCA  21 1374
    1249580 N/A N/A 189806 189825 TAGCTTTTTCATTATAGTAA  21 1375
    1249606 N/A N/A 191229 191248 TCATATTTCCACTTACTCTA  34 1376
    1249632 N/A N/A 200022 200041 TGTTTTTTCATCATTACCAA  18 1377
    1249658 N/A N/A 200522 200541 AGACTGCTACACATTATGTT  61 1378
    1249684 N/A N/A 201831 201850 ACAGAATAAAAACTTGGCCA  37 1379
    1249710 N/A N/A 202879 202898 TTCCATTTCCCTTAATACAT  17 1380
    1249736 N/A N/A 203557 203576 ATAACTCTCATATCAAACAT  60 1381
    1249762 N/A N/A 204279 204298 AACTGCTTACTTTCTATTAA  79 1382
    1249788 N/A N/A 206493 206512 GTGATTTTCCACATTGACTT  16 1383
    1249814 N/A N/A 208371 208390 GTACCAAACTATCTTGCTTA  28 1384
    1249840 N/A N/A 209949 209968 AATCTATTAACTATGAGTCA  55 1385
    1249866 N/A N/A 212710 212729 ATTAATTTCTTAATAATATT  93 1386
    1249892 N/A N/A 215178 215197 CTGATTTTAAAAAATTGGTT  42 1387
    1249918 N/A N/A 216958 216977 TGAGAATAATATCAACACTT  22 1388
    1249944 N/A N/A 222572 222591 ACAATCTAAATTAATACTGA  73 1389
    1249970 N/A N/A 226410 226429 ATAATTTATTCCTAAAATCA  77 1390
    1249996 N/A N/A 230204 230223 TTGTTTTAATTCTCTAGTTT  45 1391
    1250022 N/A N/A 232903 232922 ATAACATTTTTAAAACCACA  60 1392
    1250048 N/A N/A 235029 235048 CTCTTTTATCCAACCACTAA  53 1393
    1250074 N/A N/A 236628 236647 ACATGTTTTTCTAATTTCCT  30 1394
    1250100 N/A N/A 238696 238715 GTACACTTATCAATTATTAC  20 1395
    1250126 N/A N/A 241798 241817 CAGTAATTCTCCTAATGAAA  37 1396
    1250152 N/A N/A 244728 244747 CTGTATTAAATAATAAGTCC  39 1397
    1250178 N/A N/A 247452 247471 CAAGAGGTAATAACACACAT  34 1398
    1250204 N/A N/A 251582 251601 TTGTTTTCCCATTTAACGCA  18 1399
    1250230 4780 4799 254148 254167 CTTTGAACCCAGTTTTTTCA  38 1400
    255541 255560
    1250256 N/A N/A 255511 255530 CCTCTTTTCCTGTGTTTCAT  26 1401
    255620 255639
    1250282 N/A N/A 257421 257440 CTGTTCTCCCATTTAAATCC  36 1402
    1250306 N/A N/A 260014 260033 AAAGCACCTCTTCTTACCTA  69 1403
  • TABLE 20
     Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  12  227
    1248342  146  165 112559 112578 TCCAATGCAATTCTTCAGAA  73 1404
    1248368  561  580 170032 170051 GAGATTGCTTTCCCTTTATT  13 1405
    1248394 1175 1194 183522 183541 TAGTACCATTCCCATCCAAT  14 1406
    1248420 1823 1842 188632 188651 TGTCATTTTTCTCTTCTTCT  22 1407
    1248446 2460 2479 204362 204381 TTAGCAAATTTATACCAGCA  17 1408
    1248472 2803 2822 215432 215451 AACTGACAATCCTTCCACAT  56 1409
    1248498† 3831 3850 240249 240268 CCTTTGCCTTCTTCTATGCT  11 1410
    1248524 4333 4352 247767 247786 GAGATTCACTCCCATGATAC  17 1411
    1248549 5004 5023 259920 259939 AGTTTCAGCACACATTCTCC  30 1412
    1248575 6290 6309 262818 262837 TCTTGGTTTCTTTTTACTTT  31 1413
    1248601 7057 7076 263585 263604 TACATGTACATTTAATGGGT  60 1414
    1248626 7342 7361 263870 263889 TACTATGTCAACCTTACCAA  77 1415
    1248652 7476 7495 264004 264023 AAACTATACTTACTGTGGTA  63 1416
    1248677 7630 7649 264158 264177 GCTTCACTTTACCACTGATA  27 1417
    1248702 7897 7916 264425 264444 CTGAAGATACTTTTAATTTC  52 1418
    1248727 8271 8290 264799 264818 CCCATATTATATCTGATACA  35 1419
    1248753 8413 8432 264941 264960 ATTTCACCAACACACTACAA  57 1420
    1248779 8560 8579 265088 265107 ATGATAGAAATCTACCTTTA  65 1421
    1248805 8668 8687 265196 265215 CCAATACACTCTTCTTAATT  58 1422
    1248829 N/A N/A 113406 113425 GAGTCATTCCACTCTTTAAC  63 1423
    1248855 N/A N/A 115837 115856 TGCTCATTATCATCAACCAC  51 1424
    1248881 N/A N/A 119211 119230 GCTAAATTCCTATCTTCTAA  59 1425
    1248907 N/A N/A 125398 125417 CATCTTAAATTTAAATGATA  72 1426
    1248933 N/A N/A 128492 128511 AACCATAGAGCCATATTTTA  98 1427
    128535 128554
    128578 128597
    1248958 N/A N/A 137451 137470 GATGGCTTTTTATTACCTTA  55 1428
    1248984 N/A N/A 142797 142816 ACACTTGATTTTAATAAACA  73 1429
    1249010 N/A N/A 145983 146002 CATAATTCCTATAATTCTCA  54 1430
    1249036 N/A N/A 146652 146671 GTTCAAATCATAATCACAAA  67 1431
    1249062 N/A N/A 150352 150371 TCAAGAATTACCATTTGCTC  59 1432
    1249088 N/A N/A 155881 155900 TATGTCATAACCTCTAGTGA  80 1433
    1249114 N/A N/A 158189 158208 GTTCCATCTTCATCTTGTTC  72 1434
    1249140 N/A N/A 163620 163639 ACAAATGATTCTAATTCAAA  69 1435
    1249166 N/A N/A 169921 169940 TTATTTATAAATATTGCCCT  32 1436
    1249192 N/A N/A 171638 171657 TTATTTATTTCTAATGCTAA 148 1437
    1249218 N/A N/A 172471 172490 AGAGACTTTTTAAAATCTAA  27 1438
    1249244 N/A N/A 173289 173308 CTTACAAGAATATCTACCAC  66 1439
    1249270 N/A N/A 175252 175271 TGTTTAATTTTAATATGAAC  51 1440
    1249296 N/A N/A 176727 176746 GGTCAAGTTTTTACGCTTGT  13 1441
    1249322 N/A N/A 177540 177559 AATCATGTCTATATTATTCA  26 1442
    1249348 N/A N/A 178230 178249 TGCTAATTACTTACTCCTTT  25 1443
    1249374 N/A N/A 179082 179101 AAACTTTTCCACATTGAGAC  43 1444
    1249400 N/A N/A 180016 180035 TTGACATTAAAAAACAGCAA  39 1445
    1249426 N/A N/A 180776 180795 CACTACCATGCCTTCACCAC  33 1446
    1249452 N/A N/A 182322 182341 GGGTTCACACACAAACACAA  17 1447
    1249478 N/A N/A 183890 183909 GACTTATTTATTAAAATGAC  55 1448
    1249504 N/A N/A 184855 184874 ATTGAACAAATATCAATATA  62 1449
    1249530 N/A N/A 185655 185674 TTGAGCGATCTAAATAGCTA  27 1450
    1249556 N/A N/A 187159 187178 CTGACCTCAACATTTAGGTT  35 1451
    1249582 N/A N/A 189873 189892 AAGATCATAATAACTTTTTC  75 1452
    1249608 N/A N/A 191236 191255 AAACAATTCATATTTCCACT  28 1453
    1249634 N/A N/A 200069 200088 AATGATACAATATCAAGTCA  34 1454
    1249660 N/A N/A 200605 200624 AACACATTTAACATATGGCA  21 1455
    1249686 N/A N/A 202206 202225 CACTACTGCTTCATTAAGCA  33 1456
    1249712 N/A N/A 202885 202904 GTTTGTTTCCATTTCCCTTA  18 1457
    1249738 N/A N/A 203592 203611 TCATGGTAAACATTTATTTA  47 1458
    1249764 N/A N/A 204785 204804 ATCTTCTAATAAATAAGCAA  26 1459
    1249790 N/A N/A 206708 206727 AAAGGAGCTTAAATTAGCAA  37 1460
    1249816 N/A N/A 208492 208511 GCTTCTTTCCTTAATAAAAT  52 1461
    1249842 N/A N/A 210037 210056 CAACATATTTACAATAGTGC  15 1462
    1249868 N/A N/A 212791 212810 GTCAGTTCATCAATTTCTAC  19 1463
    1249894 N/A N/A 215499 215518 GACTAATTAATTACAAAGTA  56 1464
    1249920 N/A N/A 217027 217046 CTCATTATTTTTAAAAGGCC  18 1465
    1249946 N/A N/A 222608 222627 ATTATTTTATAAACTATATC  76 1466
    1249972 N/A N/A 226988 227007 ACTATTATCACTATTTGCTT  25 1467
    1249998 N/A N/A 230339 230358 ATGATGTTTCTTACTACTTT  20 1468
    1250024 N/A N/A 232977 232996 GTAAAATCAAAATAATTACT  77 1469
    1250050 N/A N/A 235246 235265 ATACCTTTTTCCTAAAGCCA  18 1470
    1250076 N/A N/A 236690 236709 AAAAATAATCCTAATATCTT  77 1471
    1250102 N/A N/A 239772 239791 AAAGATTTCATAATATTTCT  52 1472
    1250128 N/A N/A 242844 242863 AGCTGCTTCTCTCTACATCA  36 1473
    1250154 N/A N/A 244835 244854 ATAAATCTCCTTTCTATTCC  80 1474
    1250180 N/A N/A 247615 247634 TACTTATTTTTAAACATTAT  75 1475
    1250206 N/A N/A 252010 252029 AAGGATTATTTAACTATTTT  64 1476
    1250232 4782 4801 254150 254169 TTCTTTGAACCCAGTTTTTT  36 1477
    255543 255562
    1250258 N/A N/A 255513 255532 TCCCTCTTTTCCTGTGTTTC  26 1478
    255622 255641
    1250284 N/A N/A 257537 257556 GGTCTTAATTTTAATATCAC  27 1479
    1250308 N/A N/A 260417 260436 TTCCAATTATTTAAGAGGTC  39 1480
  • TABLE 21
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  14 227
    1248343  155  174 112568 112587 ATAACAGTCTCCAATGCAAT  59 1481
    1248369  563  582 170034 170053 GAGAGATTGCTTTCCCTTTA   8 1482
    1248395 1176 1195 183523 183542 GTAGTACCATTCCCATCCAA  16 1483
    1248421 1824 1843 188633 188652 CTGTCATTTTTCTCTTCTTC  24 1484
    1248447 2461 2480 204363 204382 ATTAGCAAATTTATACCAGC   5 1485
    1248473 2805 2824 215434 215453 AGAACTGACAATCCTTCCAC  50 1486
    1248499† 3842 3861 240260 240279 ACCAGAGTTTCCCTTTGCCT   3 1487
    1248525 4367 4386 247801 247820 TGTAATTAATACAATGGTAA  27 1488
    1248550 5887 5906 262415 262434 TCGAAGGGCATCCATCTCTC  47 1489
    1248576 6291 6310 262819 262838 TTCTTGGTTTCTTTTTACTT  29 1490
    1248602 7185 7204 263713 263732 TATCAAAAATGTGATAGTCA  53 1491
    1248627 7352 7371 263880 263899 AATTGACATATACTATGTCA  41 1492
    1248653 7480 7499 264008 264027 TTGCAAACTATACTTACTGT  48 1493
    1248678 7631 7650 264159 264178 TGCTTCACTTTACCACTGAT  26 1494
    1248703 7908 7927 264436 264455 GTGACATCCACCTGAAGATA  71 1495
    1248728 8272 8291 264800 264819 TCCCATATTATATCTGATAC  25 1496
    1248754 8415 8434 264943 264962 GCATTTCACCAACACACTAC  26 1497
    1248780 8561 8580 265089 265108 CATGATAGAAATCTACCTTT  69 1498
    1248806 8670 8689 265198 265217 ATCCAATACACTCTTCTTAA  51 1499
    1248830 N/A N/A 113497 113516 GTTATTCTAATAATAATCAA  97 1500
    1248856 N/A N/A 115905 115924 ATACTTCATCTTACAAACAA  70 1501
    1248882 N/A N/A 121980 121999 TTTTATAACACTAATATGCA  80 1502
    1248908 N/A N/A 125404 125423 TTTGTTCATCTTAAATTTAA  82 1503
    1248934 N/A N/A 128494 128513 TAAACCATAGAGCCATATTT  71 1504
    128537 128556
    128580 128599
    1248959 N/A N/A 139041 139060 AAGTTCAAAATCATATTCTT  76 1505
    1248985 N/A N/A 143393 143412 GATACATATTTAAATTACAA  72 1506
    1249011 N/A N/A 145985 146004 ACCATAATTCCTATAATTCT  72 1507
    1249037 N/A N/A 146782 146801 ATTTTTCTCACTCCCAACCA  63 1508
    1249063 N/A N/A 150453 150472 ATTAAATATTTCCTTTGCTT  71 1509
    1249089 N/A N/A 155899 155918 CCTCTCTCTCTCATACACTA  57 1510
    1249115 N/A N/A 158194 158213 CCCTGGTTCCATCTTCATCT  72 1511
    1249141 N/A N/A 163641 163660 AGCAATATACCAACTTGTTA  69 1512
    1249167 N/A N/A 170174 170193 GCTCAATAACTTGGTCAAAG   7 1513
    1249193 N/A N/A 171686 171705 TAGATCATAATTTATAATCA  44 1514
    1249219 N/A N/A 172472 172491 TAGAGACTTTTTAAAATCTA  37 1515
    1249245 N/A N/A 173376 173395 TTCTTCTTCCAAACACACAC  25 1516
    1249271 N/A N/A 175253 175272 TTGTTTAATTTTAATATGAA  85 1517
    1249297 N/A N/A 176728 176747 GGGTCAAGTTTTTACGCTTG   6 1518
    1249323 N/A N/A 177580 177599 ATGATCTTCTCAACTACTCT  23 1519
    1249349 N/A N/A 178233 178252 TCCTGCTAATTACTTACTCC  14 1520
    1249375 N/A N/A 179155 179174 AACTTATTTTCTACTTTACA  60 1521
    1249401 N/A N/A 180073 180092 TGGTTTCACCCTATCCCACT  10 1522
    1249427 N/A N/A 180778 180797 TGCACTACCATGCCTTCACC  20 1523
    1249453 N/A N/A 183580 183599 TTACTTTTATCCTCAATATA  49 1524
    1249479 N/A N/A 183896 183915 ACTACTGACTTATTTATTAA  56 1525
    1249505 N/A N/A 184866 184885 TTTTTCACAATATTGAACAA  54 1526
    1249531 N/A N/A 185678 185697 ATAATAACAATTACAAGCAC  65 1527
    1249557 N/A N/A 187239 187258 AATAACTTCTTAATAACCAA  55 1528
    1249583 N/A N/A 189876 189895 TCAAAGATCATAATAACTTT  51 1529
    1249609 N/A N/A 191337 191356 TTTCAAAAAAATCCAGATTA  64 1530
    1249635 N/A N/A 200099 200118 ATTTTACTGTTATTTAGTAA  65 1531
    1249661 N/A N/A 200612 200631 ACAAATTAACACATTTAACA  86 1532
    1249687 N/A N/A 202217 202236 TTTTGCTTATCCACTACTGC  23 1533
    1249713 N/A N/A 202887 202906 CAGTTTGTTTCCATTTCCCT  10 1534
    1249739 N/A N/A 203609 203628 ATATAATTCATACATTTTCA  64 1535
    1249765 N/A N/A 204849 204868 AGGTTCTTAAAAATATGTCA  26 1536
    1249791 N/A N/A 206733 206752 TGCTATTCTTTATCTAGTTT  22 1537
    1249817 N/A N/A 208495 208514 AAGGCTTCTTTCCTTAATAA  21 1538
    1249843 N/A N/A 210042 210061 TTGCTCAACATATTTACAAT  29 1539
    1249869 N/A N/A 212792 212811 AGTCAGTTCATCAATTTCTA  20 1540
    1249895 N/A N/A 215502 215521 GAAGACTAATTAATTACAAA  43 1541
    1249921 N/A N/A 217110 217129 TTTTGTTTCTCCTTAAGGAA  46 1542
    1249947 N/A N/A 222612 222631 AATGATTATTTTATAAACTA  96 1543
    1249973 N/A N/A 227094 227113 GTTCTTGACACCTTATTTTA  28 1544
    1249999 N/A N/A 230394 230413 CCTCATTTTTTCTTTAATTA  34 1545
    1250025 N/A N/A 233210 233229 TAACTTCCTATTAAATTTTT  81 1546
    1250051 N/A N/A 235281 235300 TTAGTGCACTACCTTAGTTC  30 1547
    1250077 N/A N/A 236707 236726 GTATATCAAATTACTAGAAA  58 1548
    1250103 N/A N/A 239809 239828 CTATTTCCCATCTTTATTAT  53 1549
    1250129 N/A N/A 242906 242925 GTAATTTTTAAATTTTGGTC  45 1550
    1250155 N/A N/A 244845 244864 TGATCTCTAAATAAATCTCC  76 1551
    1250181 N/A N/A 247616 247635 TTACTTATTTTTAAACATTA  71 1552
    1250207 N/A N/A 252011 252030 AAAGGATTATTTAACTATTT  54 1553
    1250233 4783 4802 254151 254170 TTTCTTTGAACCCAGTTTTT  36 1554
    255544 255563
    1250259 N/A N/A 255514 255533 CTCCCTCTTTTCCTGTGTTT  37 1555
    255623 255642
    1250285 N/A N/A 257829 257848 GTTTATCTGTCTACTATTCT  50 1556
    1250309 N/A N/A 260619 260638 ATCTTTTGCATTCCTAGGAC  36 1557
  • TABLE 22
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  15  227
    1248341  145  164 112558 112577 CCAATGCAATTCTTCAGAAT  40 1558
    1248367  560  579 170031 170050 AGATTGCTTTCCCTTTATTC  16 1559
    1248393 1172 1191 183519 183538 TACCATTCCCATCCAATGAA  17 1560
    1248419 1821 1840 188630 188649 TCATTTTTCTCTTCTTCTCC  32 1561
    1248445 2459 2478 204361 204380 TAGCAAATTTATACCAGCAT   9 1562
    1248471 2801 2820 215430 215449 CTGACAATCCTTCCACATTT  39 1563
    1248497† 3830 3849 240248 240267 CTTTGCCTTCTTCTATGCTT   3 1564
    1248523 4320 4339 247754 247773 ATGATACTGAATATTAGCCA  10 1565
    1248548 4944 4963 259860 259879 ATGTTTGTCATTTCTTGACT  19 1566
    1248574 6286 6305 262814 262833 GGTTTCTTTTTACTTTTTAC  19 1567
    1248600 7056 7075 263584 263603 ACATGTACATTTAATGGGTT  63 1568
    1248625 7338 7357 263866 263885 ATGTCAACCTTACCAAGAGC  33 1569
    1248651 7440 7459 263968 263987 AGTAGTGTGCTTAAATCATC  29 1570
    1248676 7628 7647 264156 264175 TTCACTTTACCACTGATATA  52 1571
    1248701 7896 7915 264424 264443 TGAAGATACTTTTAATTTCT  40 1572
    1248726 8231 8250 264759 264778 AATAAGATCTATCTGTGTAA  40 1573
    1248752 8411 8430 264939 264958 TTCACCAACACACTACAAGT  53 1574
    1248778 8559 8578 265087 265106 TGATAGAAATCTACCTTTAA  62 1575
    1248804 8667 8686 265195 265214 CAATACACTCTTCTTAATTA  75 1576
    1248828 N/A N/A 113400 113419 TTCCACTCTTTAACACAGAT  59 1577
    1248854 N/A N/A 115793 115812 GCATTTTCAAACCTTCCTTC  61 1578
    1248880 N/A N/A 119139 119158 TAATTTGAATCCATATTTTA  89 1579
    1248906 N/A N/A 125320 125339 TGATATATTTATACTAGTTA  72 1580
    1248932 N/A N/A 128491 128510 ACCATAGAGCCATATTTTAA  67 1581
    128534 128553
    128577 128596
    1248957 N/A N/A 134774 134793 TCCTTTTTTTTAACCATCTA  62 1582
    1248983 N/A N/A 142796 142815 CACTTGATTTTAATAAACAT  63 1583
    1249009 N/A N/A 145961 145980 CTTCAGTCTACATTTTGCCC  52 1584
    1249035 N/A N/A 146646 146665 ATCATAATCACAAATTATAA  79 1585
    1249061 N/A N/A 150330 150349 ATAAGCTCTTTAACATTTTA  70 1586
    1249087 N/A N/A 155833 155852 TTGGATCCAATCATTTCTCA  75 1587
    1249113 N/A N/A 158161 158180 TGACCAACATTCTTTAGATA  79 1588
    1249139 N/A N/A 163516 163535 TCTACTTTTTTTAATAAAAA  93 1589
    1249165 N/A N/A 169893 169912 GTGTATAACATAATAATTAC  22 1590
    1249191 V/A N/A 171609 171628 ATCTTTTTCCCCACATGCTA  32 1591
    1249217 N/A N/A 172396 172415 ATCAACAGCTCAACTTGGCA  14 1592
    1249243 N/A N/A 173288 173307 TTACAAGAATATCTACCACA  96 1593
    1249269 N/A N/A 175236 175255 GAACAAACTCCTATTTGCCA  15 1594
    1249295 N/A N/A 176726 176745 GTCAAGTTTTTACGCTTGTG  15 1595
    1249321 N/A N/A 177530 177549 ATATTATTCACCATTATAGC  23 1596
    1249347 N/A N/A 178167 178186 CCTATGAGAAATCTTAGATT  24 1597
    1249373 N/A N/A 178822 178841 GCCTTATCTCCCTTTTCCAT  28 1598
    1249399 N/A N/A 179990 180009 AAAACCAAAACAACTATTTA  69 1599
    1249425 N/A N/A 180775 180794 ACTACCATGCCTTCACCACC  21 1600
    1249451 N/A N/A 182143 182162 GTAGAATTAAATCAGAGTTA  31 1601
    1249477 N/A N/A 183854 183873 TGTCTACCAAATAAACATTT  34 1602
    1249503 N/A N/A 184852 184871 GAACAAATATCAATATATAA  79 1603
    1249529 N/A N/A 185640 185659 AGCTATACATTTATTAATCC  14 1604
    1249555 N/A N/A 186607 186626 ACACTGGCTATAATTAGGTT  76 1605
    1249581 N/A N/A 189864 189883 ATAACTTTTTCTATTGCTAT  36 1606
    1249607 N/A N/A 191230 191249 TTCATATTTCCACTTACTCT  32 1607
    1249633 N/A N/A 200026 200045 GAAGTGTTTTTTCATCATTA   9 1608
    1249659 N/A N/A 200553 200572 CCAAAGTCTTTATTTTGGCA  12 1609
    1249685 N/A N/A 201862 201881 GTCAGTTTTCATTCTAGATA   7 1610
    1249711 N/A N/A 202881 202900 GTTTCCATTTCCCTTAATAC   8 1611
    1249737 N/A N/A 203585 203604 AAACATTTATTTAAATGTAT  85 1612
    1249763 N/A N/A 204697 204716 TTTTTGTTATTTAAAAGGGA  65 1613
    1249789 N/A N/A 206546 206565 TCTTATTGACTCATTGGTTA  23 1614
    1249815 N/A N/A 208460 208479 TTGTTGAAAATTAATTTAAC  68 1615
    1249841 N/A N/A 210003 210022 TTTGTTTATTCTAACAATTT  70 1616
    1249867 N/A N/A 212761 212780 TGTGACATTTTTACTGGGAT  12 1617
    1249893 N/A N/A 215215 215234 GCAACTTAATTTACTCCCAA  11 1618
    1249919 N/A N/A 217026 217045 TCATTATTTTTAAAAGGCCA  27 1619
    1249945 N/A N/A 222578 222597 TACATCACAATCTAAATTAA  85 1620
    1249971 N/A N/A 226415 226434 CACTGATAATTTATTCCTAA  42 1621
    1249997 N/A N/A 230321 230340 TTGTGATATTTAACAATGTA  12 1622
    1250023 N/A N/A 232975 232994 AAAATCAAAATAATTACTCA  73 1623
    1250049 N/A N/A 235244 235263 ACCTTTTTCCTAAAGCCAAA  27 1624
    1250075 N/A N/A 236686 236705 ATAATCCTAATATCTTTGTC  28 1625
    1250101 N/A N/A 239406 239425 GTTTGCTTTAAATCTGGCCA  16 1626
    1250127 N/A N/A 242772 242791 TGGAATGCATCCTCTAGTAA  39 1627
    1250153 N/A N/A 244751 244770 ATGTAATTCTTCAATAGCTT  19 1628
    1250179 N/A N/A 247606 247625 TTAAACATTATTAAAAGAAC 111 1629
    1250205 N/A N/A 251855 251874 CTGATGCAATTTACTAATTA  40 1630
    1250231 4781 4800 254149 254168 TCTTTGAACCCAGTTTTTTC  27 1631
    255542 255561
    1250257 N/A N/A 255512 255531 CCCTCTTTTCCTGTGTTTCA  19 1632
    255621 255640
    1250283 N/A N/A 257536 257555 GTCTTAATTTTAATATCACC  19 1633
    1250307 N/A N/A 260292 260311 GTACAAGACTATTCTACCAA  41 1634
  • TABLE 23
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  18 227
    1248344  156  175 112569 112588 TATAACAGTCTCCAATGCAA  83 1635
    1248370  564  583 170035 170054 CGAGAGATTGCTTTCCCTTT  15 1636
    1248396 1178 1197 183525 183544 AAGTAGTACCATTCCCATCC  10 1637
    1248422 1828 1847 188637 188656 GACTCTGTCATTTTTCTCTT  23 1638
    1248448 2463 2482 204365 204384 ATATTAGCAAATTTATACCA  48 1639
    1248474 3021 3040 217735 217754 GGGAGTTCACAATCATTGGA  24 1640
    1248500† 3853 3872 240271 240290 CCTCAAATTCCACCAGAGTT   7 1641
    1248526 4368 4387 247802 247821 GTGTAATTAATACAATGGTA  15 1642
    1248551 5949 5968 262477 262496 GTAATGGGCTCATAAGAGAC  55 1643
    1248577 6347 6366 262875 262894 TTGACACAAACACATCACCA  36 1644
    1248603 7189 7208 263717 263736 CACTTATCAAAAATGTGATA  61 1645
    1248628 7353 7372 263881 263900 AAATTGACATATACTATGTC 103 1646
    1248654 7483 7502 264011 264030 AGCTTGCAAACTATACTTAC  35 1647
    1248679 7632 7651 264160 264179 TTGCTTCACTTTACCACTGA  30 1648
    1248704 7929 7948 264457 264476 CAGAAACTAACAATAGTGAC  53 1649
    1248729 8273 8292 264801 264820 ATCCCATATTATATCTGATA  35 1650
    1248755 8416 8435 264944 264963 TGCATTTCACCAACACACTA  34 1651
    1248781 8570 8589 265098 265117 TTATTTTTACATGATAGAAA  71 1652
    1248807 8674 8693 265202 265221 AGTTATCCAATACACTCTTC  49 1653
    1248831 N/A N/A 113499 113518 CTGTTATTCTAATAATAATC  70 1654
    1248857 N/A N/A 116126 116145 AACCTGTTTTTAAATAGGTG  79 1655
    1248883 N/A N/A 121986 122005 GTTTGATTTTATAACACTAA  57 1656
    1248909 N/A N/A 125406 125425 GTTTTGTTCATCTTAAATTT  79 1657
    1248935 N/A N/A 128496 128515 GTTAAACCATAGAGCCATAT  61 1658
    128539 128558
    128582 128601
    1248960 N/A N/A 139439 139458 TACTCATCTTCATCTTCTTT  73 1659
    1248986 N/A N/A 143428 143447 ATTATAAATTATCAATGTTA  73 1660
    1249012 N/A N/A 146106 146125 CCAAAATGTTTATTTAGCAT  63 1661
    1249038 N/A N/A 147189 147208 TTAATATTATTAAATATCAA 107 1662
    1249064 N/A N/A 151067 151086 GTTTAAATCTCAAATACATT  63 1663
    1249090 N/A N/A 155932 155951 GGTGAAAAACCTTACAGCCA  61 1664
    1249116 N/A N/A 158348 158367 CAATTGTTCCATCTTTGTCA  78 1665
    1249142 N/A N/A 163695 163714 GTGTCAACTTCAATTATCAA  50 1666
    1249168 N/A N/A 170176 170195 TAGCTCAATAACTTGGTCAA  24 1667
    1249194 N/A N/A 171689 171708 TAATAGATCATAATTTATAA  79 1668
    1249220 N/A N/A 172505 172524 ACATCTGAAATATAACACTT  58 1669
    1249246 N/A N/A 173377 173396 TTTCTTCTTCCAAACACACA  58 1670
    1249272 N/A N/A 175319 175338 CAGTGCATATTTCTGAGCCA  15 1671
    1249298 N/A N/A 176730 176749 TAGGGTCAAGTTTTTACGCT  11 1672
    1249324 N/A N/A 177583 177602 ATGATGATCTTCTCAACTAC  29 1673
    1249350 N/A N/A 178247 178266 ATCTACCCCTCCATTCCTGC  45 1674
    1249376 N/A N/A 179219 179238 AATATTCTCCACTTTCCTCC  34 1675
    1249402 N/A N/A 180164 180183 CTCCTTCAACTTAATGGCCC  14 1676
    1249428 N/A N/A 180779 180798 ATGCACTACCATGCCTTCAC  11 1677
    1249454 N/A N/A 183583 183602 ATCTTACTTTTATCCTCAAT  30 1678
    1249480 N/A N/A 183968 183987 AACCAAATAGGGCCAAATTA  38 1679
    1249506 N/A N/A 184869 184888 AGATTTTTCACAATATTGAA  48 1680
    1249532 N/A N/A 185688 185707 CATGATCCCAATAATAACAA  33 1681
    1249558 N/A N/A 187243 187262 AAGTAATAACTTCTTAATAA  78 1682
    1249584 N/A N/A 189912 189931 ATTTGAATACCAACAACCCT  43 1683
    1249610 N/A N/A 191393 191412 CTTATCACAAATAAATAATA  82 1684
    1249636 N/A N/A 200126 200145 ATAATAGAATCCATGAGTTA  76 1685
    1249662 N/A N/A 200617 200636 AAGTCACAAATTAACACATT  70 1686
    1249688 N/A N/A 202385 202404 GGGTTATCCACATAGAATCA  31 1687
    1249714 N/A N/A 202947 202966 ATTTCCACTAAAAATAGATT  60 1688
    1249740 N/A N/A 203612 203631 TACATATAATTCATACATTT  60 1689
    1249766 N/A N/A 205035 205054 TCTAAATTTAATATTGCTAA  67 1690
    1249792 N/A N/A 206885 206904 GTGTCTTTCCTCTTTTTTTC  13 1691
    1249818 N/A N/A 208552 208571 GTTCAATTCCATTCTTTCAT  22 1692
    1249844 N/A N/A 210056 210075 TTTTTTCCTTTAAATTGCTC  49 1693
    1249870 N/A N/A 213035 213054 AAACACTTCCTTTCTTCTAT  48 1694
    1249896 N/A N/A 215503 215522 TGAAGACTAATTAATTACAA  84 1695
    1249922 N/A N/A 217302 217321 GATGAATTATTTATTTGTCA  24 1696
    1249948 N/A N/A 222759 222778 ATATATGACTACCTTAGCTA  61 1697
    1249974 N/A N/A 227123 227142 TTGCTTTCCATCATTAGTTT  43 1698
    1250000 N/A N/A 230617 230636 AAGGAATTACATTAATATAA  54 1699
    1250026 N/A N/A 233213 233232 ACATAACTTCCTATTAAATT  75 1700
    1250052 N/A N/A 235333 235352 TCTTATTTAAATCACATTAA  75 1701
    1250078 N/A N/A 236728 236747 TTTCTTATTTTAATTTATCA  79 1702
    1250104 N/A N/A 239810 239829 ACTATTTCCCATCTTTATTA  47 1703
    1250130 N/A N/A 243053 243072 ATGATTTCTTAAAAAAGGAA  70 1704
    1250156 N/A N/A 246375 246394 CTGCTCTCAATAATAATTCT  25 1705
    1250182 N/A N/A 247629 247648 CAACAACAAATATTTACTTA  62 1706
    1250208 N/A N/A 252051 252070 TTAACTTTCTCAAATAATGT  75 1707
    1250234 4784 4803 254152 254171 GTTTCTTTGAACCCAGTTTT  20 1708
    255545 255564
    1250260 N/A N/A 255515 255534 CCTCCCTCTTTTCCTGTGTT  30 1709
    255624 255643
    1250286 N/A N/A 257905 257924 CTTACTTCCACCCTCTGATA  65 1710
    1250310 N/A N/A 260671 260690 CTCATTTAATATCTTATACA  63 1711
  • TABLE 24
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  14  227
    1248345  161  180 112574 112593 TTGAATATAACAGTCTCCAA  60 1712
    1248371  565  584 170036 170055 TCGAGAGATTGCTTTCCCTT  12 1713
    1248397 1179 1198 183526 183545 AAAGTAGTACCATTCCCATC  26 1714
    1248423 1830 1849 188639 188658 CGGACTCTGTCATTTTTCTC  22 1715
    1248449 2473 2492 204375 204394 AATCAAACACATATTAGCAA  20 1716
    1248475 3292 3311 227286 227305 CTGCATCCTTCCCACAGCAA  16 1717
    1248501† 3858 3877 240276 240295 GTTTTCCTCAAATTCCACCA  10 1718
    1248527 4369 4388 247803 247822 GGTGTAATTAATACAATGGT  23 1719
    1248552 6033 6052 262561 262580 ACTTTTTGCTTCAAGAGGTA  71 1720
    1248578 6406 6425 262934 262953 CCTTAAGTATACATTTGTAA  65 1721
    1248604 7191 7210 263719 263738 GACACTTATCAAAAATGTGA  31 1722
    1248629 7357 7376 263885 263904 TTTTAAATTGACATATACTA  75 1723
    1248655 7484 7503 264012 264031 AAGCTTGCAAACTATACTTA  44 1724
    1248680 7634 7653 264162 264181 ATTTGCTTCACTTTACCACT  38 1725
    1248705 7930 7949 264458 264477 ACAGAAACTAACAATAGTGA  49 1726
    1248730 8277 8296 264805 264824 TGGGATCCCATATTATATCT  61 1727
    1248756 8417 8436 264945 264964 ATGCATTTCACCAACACACT  48 1728
    1248782 8574 8593 265102 265121 TAGATTATTTTTACATGATA  86 1729
    1248808 8675 8694 265203 265222 TAGTTATCCAATACACTCTT  66 1730
    1248832 N/A N/A 113615 113634 AGGCATTTAAAAACAATCTT  58 1731
    1248858 N/A N/A 116897 116916 TTATCTTTTCCTAATAGAAA  79 1732
    1248884 N/A N/A 122656 122675 TTGGTGATTTATATAAACTA  68 1733
    1248910 N/A N/A 125522 125541 TGCTCTTTTTTAAATAAAAA 110 1734
    1248936 N/A N/A 128497 128516 AGTTAAACCATAGAGCCATA  77 1735
    128540 128559
    1248961 N/A N/A 139746 139765 GATTTATTTTTTACCTATTA  86 1736
    1248987 N/A N/A 143434 143453 TTAAATATTATAAATTATCA  73 1737
    1249013 N/A N/A 146189 146208 TAGACTATTTTCACTAGTAC  69 1738
    1249039 N/A N/A 147200 147219 TCTTCTTTTTCTTAATATTA  79 1739
    1249065 N/A N/A 151070 151089 GCAGTTTAAATCTCAAATAC  53 1740
    1249091 N/A N/A 155966 155985 TTTATGTATTCAACAAATAA  74 1741
    1249117 N/A N/A 158526 158545 CTGAAAGTTTCCTTTTCCTA  75 1742
    1249143 N/A N/A 163721 163740 CAATATTTCATAAATCTCTA  82 1743
    1249169 N/A N/A 170177 170196 GTAGCTCAATAACTTGGTCA  16 1744
    1249195 N/A N/A 171690 171709 ATAATAGATCATAATTTATA  84 1745
    1249221 N/A N/A 172534 172553 CTTTTGTTATATCTCTGCTC  25 1746
    1249247 N/A N/A 173422 173441 GTAACACTTATCACTAGCTC  53 1747
    1249273 N/A N/A 175434 175453 GAGGAGTTTTTAACCTATAT   8 1748
    1249299 N/A N/A 176732 176751 ACTAGGGTCAAGTTTTTACG  25 1749
    1249325 N/A N/A 177584 177603 AATGATGATCTTCTCAACTA  52 1750
    1249351 N/A N/A 178255 178274 ATCTTTTAATCTACCCCTCC  44 1751
    1249377 N/A N/A 179271 179290 CTGTATTTTCCTACTAGGCT  14 1752
    1249403 N/A N/A 180170 180189 GTAAGTCTCCTTCAACTTAA  13 1753
    1249429 N/A N/A 180780 180799 TATGCACTACCATGCCTTCA  19 1754
    1249455 N/A N/A 183612 183631 ACTAAACAACTTAATGGTTT  33 1755
    1249481 N/A N/A 183970 183989 TCAACCAAATAGGGCCAAAT  26 1756
    1249507 N/A N/A 184898 184917 GATAAACTAATAAATATATA  81 1757
    1249533 N/A N/A 185689 185708 GCATGATCCCAATAATAACA  20 1758
    1249559 N/A N/A 187247 187266 AATAAAGTAATAACTTCTTA  78 1759
    1249585 N/A N/A 189967 189986 TCTTCATAGGCAACTTGATA  35 1760
    1249611 N/A N/A 191396 191415 TAGCTTATCACAAATAAATA  89 1761
    1249637 N/A N/A 200160 200179 GAGGCTAAATATAAAAAAAA  75 1762
    1249663 N/A N/A 200618 200637 AAAGTCACAAATTAACACAT  34 1763
    1249689 N/A N/A 202409 202428 GCCACATCTCCATTATTCCT  36 1764
    1249715 N/A N/A 202959 202978 ATTGTTTTTAAAATTTCCAC  42 1765
    1249741 N/A N/A 203613 203632 ATACATATAATTCATACATT  88 1766
    1249767 N/A N/A 205036 205055 TTCTAAATTTAATATTGCTA  67 1767
    1249793 N/A N/A 206901 206920 CTACTTCTAATAATTAGTGT  68 1768
    1249819 N/A N/A 208582 208601 CTTAATTTTTATATATGTTA  90 1769
    1249845 N/A N/A 210150 210169 TGTGTACTTTTCAATTATAA  36 1770
    1249871 N/A N/A 213230 213249 GTCTGTTTTCCAATAAATTT  28 1771
    1249897 N/A N/A 215560 215579 GTGTATTCAAATAATATTAT  38 1772
    1249923 N/A N/A 217353 217372 GTAATTTTATTAACAGGGCA  34 1773
    1249949 N/A N/A 222886 222905 GACACCTTTCCCATTTTTCC  35 1774
    1249975 N/A N/A 227145 227164 TCAAAACATTCTATTGCTTC  99 1775
    1250001 N/A N/A 230638 230657 AACAATCATTCAAAATCACA  87 1776
    1250027 N/A N/A 233343 233362 TTTCTGCTTTAATAATACTA  31 1777
    1250053 N/A N/A 235337 235356 TTTCTCTTATTTAAATCACA  37 1778
    1250079 N/A N/A 236729 236748 ATTTCTTATTTTAATTTATC  72 1779
    1250105 N/A N/A 239907 239926 GTTGGTATTTCCATCCTGTC  35 1780
    1250131 N/A N/A 243054 243073 GATGATTTCTTAAAAAAGGA  34 1781
    1250157 N/A N/A 246378 246397 AGTCTGCTCTCAATAATAAT  49 1782
    1250183 N/A N/A 247961 247980 AAGTGATTACTTACTACTTG  47 1783
    1250209 N/A N/A 252054 252073 TCTTTAACTTTCTCAAATAA  55 1784
    1250235 4785 4804 254153 254172 GGTTTCTTTGAACCCAGTTT  11 1785
    255546 255565
    1250261 N/A N/A 255516 255535 TCCTCCCTCTTTTCCTGTGT  37 1786
    255625 255644
    1250287 N/A N/A 258046 258065 AACTAGATTTCTATTACTCC  51 1787
    1250311 N/A N/A 260672 260691 CCTCATTTAATATCTTATAC  49 1788
  • TABLE 25
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910088 8676 8695 265204 265223 GTAGTTATCCAATACACTCT  44  120
     910184 N/A N/A 128500 128519 TGGAGTTAAACCATAGAGCC  78  136
    128543 128562
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  17  227
    1248346  164  183 112577 112596 GTGTTGAATATAACAGTCTC  62 1789
    1248372  567  586 170038 170057 AATCGAGAGATTGCTTTCCC  24 1790
    1248398 1180 1199 183527 183546 GAAAGTAGTACCATTCCCAT  17 1791
    1248424 1869 1888 188678 188697 AAACCTTTTCTTCTTATGCT  28 1792
    1248450 2474 2493 204376 204395 AAATCAAACACATATTAGCA  39 1793
    1248476 3304 3323 227298 227317 ATCGATTCCTTTCTGCATCC  17 1794
    1248502† 3859 3878 240277 240296 TGTTTTCCTCAAATTCCACC  11 1795
    1248528 4389 4408 247823 247842 ACATCAAACATCTCTCCAGT  32 1796
    1248553 6041 6060 262569 262588 CCTTTTTAACTTTTTGCTTC  53 1797
    1248579 6472 6491 263000 263019 CTATTTCTCCAGTTTACTGA  58 1798
    1248605 7192 7211 263720 263739 GGACACTTATCAAAAATGTG  40 1799
    1248630 7371 7390 263899 263918 AGCAGACTTTTATTTTTTAA  34 1800
    1248656 7505 7524 264033 264052 TTACATCATATTACCTGTTG  36 1801
    1248681 7635 7654 264163 264182 AATTTGCTTCACTTTACCAC  42 1802
    1248706 7934 7953 264462 264481 AGGAACAGAAACTAACAATA  42 1803
    1248731 8278 8297 264806 264825 CTGGGATCCCATATTATATC  40 1804
    1248757 8418 8437 264946 264965 CATGCATTTCACCAACACAC  38 1805
    1248783 8587 8606 265115 265134 TTTGTTTTTCAGATAGATTA  55 1806
    1248833 N/A N/A 113800 113819 TTTTATAAAATCATTCCCCA  71 1807
    1248859 N/A N/A 117256 117275 CTTTCCTTTTCTATTTATTT  36 1808
    1248885 N/A N/A 123302 123321 GAGAGCTATTTTAATAGGTC  65 1809
    1248911 N/A N/A 125523 125542 ATGCTCTTTTTTAAATAAAA  87 1810
    1248962 N/A N/A 139883 139902 TGTCTTGACTTCTCTTGCAA  64 1811
    1248988 N/A N/A 143940 143959 ATTGAGTTTTTAATAAGGCT  63 1812
    1249014 N/A N/A 146203 146222 ATATTAACACTATCTAGACT  59 1813
    1249040 N/A N/A 147348 147367 TTTTAATTTTTTCTCCCCTA  70 1814
    1249066 N/A N/A 151071 151090 AGCAGTTTAAATCTCAAATA  94 1815
    1249092 N/A N/A 155991 156010 AACAGATACATAACAGGACA  98 1816
    1249118 N/A N/A 158779 158798 CAGGATTTTTTAATACCACC  61 1817
    1249144 N/A N/A 163722 163741 ACAATATTTCATAAATCTCT  84 1818
    1249170 N/A N/A 170178 170197 TGTAGCTCAATAACTTGGTC  16 1819
    1249196 N/A N/A 171702 171721 GCTTGAAACATAATAATAGA  20 1820
    1249222 N/A N/A 172560 172579 GTATCTTAGACTATTAGCCT  14 1821
    1249248 N/A N/A 173442 173461 ACACTAATTTATATTTCTTA  79 1822
    1249274 N/A N/A 175517 175536 TCTTTGTTATTCTATAGGAA  15 1823
    1249300 N/A N/A 176734 176753 TAACTAGGGTCAAGTTTTTA  47 1824
    1249326 N/A N/A 177609 177628 TATTATTCCTCTAATGACAA  59 1825
    1249352 N/A N/A 178286 178305 TTTGAATTCTAAAACTGAAC 101 1826
    1249378 N/A N/A 179455 179474 TTTATTGCTATAACAAACAA  72 1827
    1249404 N/A N/A 180196 180215 TATGAAGATCAAATTTGTTA  63 1828
    1249430 N/A N/A 180782 180801 TTTATGCACTACCATGCCTT  31 1829
    1249456 N/A N/A 183619 183638 TTAGAGAACTAAACAACTTA  79 1830
    1249482 N/A N/A 183971 183990 ATCAACCAAATAGGGCCAAA  21 1831
    1249508 N/A N/A 184935 184954 GGCAAAGCTCACAAATGTTT  54 1832
    1249534 N/A N/A 185691 185710 TTGCATGATCCCAATAATAA  36 1833
    1249560 N/A N/A 187312 187331 AAAGCAATTATAATTATCCA  54 1834
    1249586 N/A N/A 189969 189988 ATTCTTCATAGGCAACTTGA  32 1835
    1249612 N/A N/A 191509 191528 CATTCATTACATAAATGCAT  32 1836
    1249638 N/A N/A 200162 200181 TGGAGGCTAAATATAAAAAA  66 1837
    1249664 N/A N/A 200620 200639 TCAAAGTCACAAATTAACAC  40 1838
    1249690 N/A N/A 202487 202506 CATTCAATTATTCATTCCAA  38 1839
    1249716 N/A N/A 202978 202997 GTAAATTAATTTATTGCTTA  61 1840
    1249742 N/A N/A 203617 203636 AAACATACATATAATTCATA  68 1841
    1249768 N/A N/A 205038 205057 ATTTCTAAATTTAATATTGC  71 1842
    1249794 N/A N/A 206911 206930 CTCTTCATTCCTACTTCTAA  80 1843
    1249820 N/A N/A 208583 208602 TCTTAATTTTTATATATGTT  79 1844
    1249846 N/A N/A 210278 210297 ATTTTTCCTTTTAATTCTCT  56 1845
    1249872 N/A N/A 213259 213278 GGACATTTAAATAATAGATA  70 1846
    1249898 N/A N/A 215561 215580 AGTGTATTCAAATAATATTA  41 1847
    1249924 N/A N/A 220524 220543 ACATACATATACACTTGCCA  32 1848
    1249950 N/A N/A 223280 223299 ATTACATATTTTAATTGTTT  84 1849
    1249976 N/A N/A 227672 227691 CCTTATTTAAACATTTTTAC  75 1850
    1250002 N/A N/A 230675 230694 GCATGGCTTCCACATTATTA  34 1851
    1250028 N/A N/A 233370 233389 TTTAGATATTATACTTCCAA  34 1852
    1250054 N/A N/A 235344 235363 CCTGTATTTTCTCTTATTTA  30 1853
    1250080 N/A N/A 236952 236971 ATAAAATATTTCCTTAGCAT  63 1854
    1250106 N/A N/A 239989 240008 TAGCACTACTATAATGGATT  51 1855
    1250132 N/A N/A 243091 243110 TTCTATTAAATTTTATGATC  76 1856
    1250158 N/A N/A 246379 246398 CAGTCTGCTCTCAATAATAA  46 1857
    1250184 N/A N/A 247996 248015 AGACTCATTTTAATTACACA  25 1858
    1250210 N/A N/A 252125 252144 ATTATCCTAAACATGTGCAT  33 1859
    1250236 4786 4805 254154 254173 TGGTTTCTTTGAACCCAGTT  19 1860
    255547 255566
    1250262 N/A N/A 255517 255536 ATCCTCCCTCTTTTCCTGTG  47 1861
    255626 255645
    1250288 N/A N/A 258110 258129 ACATCAAACACTACTTGTTC  57 1862
    1250312 N/A N/A 260697 260716 AATCTTCTTATATTTACTTC  71 1863
  • TABLE 26
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop SCN2A ID
    Number Site Site Site Site Sequence (5′ to 3′) (% control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA  26  227
    1248347  166  185 112579 112598 ATGTGTTGAATATAACAGTC  68 1864
    1248373  568  587 170039 170058 GAATCGAGAGATTGCTTTCC  30 1865
    1248399 1182 1201 183529 183548 TTGAAAGTAGTACCATTCCC  26 1866
    1248425 1895 1914 188704 188723 GCCTACTTCCTTCCAAGGAA  22 1867
    1248451 2496 2515 204398 204417 AACCATGGTTTACAACAGTC  39 1868
    1248477 3307 3326 227301 227320 AAAATCGATTCCTTTCTGCA  31 1869
    1248503† 3860 3879 240278 240297 ATGTTTTCCTCAAATTCCAC  40 1870
    1248529 4391 4410 247825 247844 TTACATCAAACATCTCTCCA  49 1871
    1248554 6042 6061 262570 262589 ACCTTTTTAACTTTTTGCTT  45 1872
    1248580 6478 6497 263006 263025 TCGATACTATTTCTCCAGTT  33 1873
    1248606 7193 7212 263721 263740 AGGACACTTATCAAAAATGT  37 1874
    1248631 7372 7391 263900 263919 AAGCAGACTTTTATTTTTTA  43 1875
    1248657 7507 7526 264035 264054 AATTACATCATATTACCTGT  37 1876
    1248682 7636 7655 264164 264183 CAATTTGCTTCACTTTACCA  63 1877
    1248707 7953 7972 264481 264500 GCTTCAATTTAAAAGTGCTA  43 1878
    1248732 8279 8298 264807 264826 GCTGGGATCCCATATTATAT  51 1879
    1248758 8419 8438 264947 264966 GCATGCATTTCACCAACACA  53 1880
    1248784 8588 8607 265116 265135 ATTTGTTTTTCAGATAGATT  71 1881
    1248809 8677 8696 265205 265224 AGTAGTTATCCAATACACTC  56 1882
    1248834 N/A N/A 113801 113820 ATTTTATAAAATCATTCCCC  79 1883
    1248860 N/A N/A 117455 117474 GTCTTCTTCCACATAAAGGT  63 1884
    1248886 N/A N/A 123365 123384 GTCTACTCAAACAAACACTA  60 1885
    1248912 N/A N/A 126286 126305 AAGAATTTCATAAACTTCAT  87 1886
    1248937 N/A N/A 128501 128520 ATGGAGTTAAACCATAGAGC  64 1887
    128544 128563
    1248963 N/A N/A 139924 139943 GTTTATTCCTCAATATTTTT  75 1888
    1248989 N/A N/A 144023 144042 GCACAGTATTTTACTTATCA  74 1889
    1249015 N/A N/A 146216 146235 ATAATTTCTATCAATATTAA  78 1890
    1249041 N/A N/A 147450 147469 CAGTCATTCCTAATACATTA  56 1891
    1249067 N/A N/A 152305 152324 GTCTTCCCTATCTCAACCAA  75 1892
    1249093 N/A N/A 156022 156041 TGCATCTTCATTACCATCAA  68 1893
    1249119 N/A N/A 161701 161720 CTTCTCTTTTTAACCTGAAT  78 1894
    1249145 N/A N/A 163896 163915 GTCACATTCTCATCATATTT  64 1895
    1249171 N/A N/A 170180 170199 TGTGTAGCTCAATAACTTGG  24 1896
    1249197 N/A N/A 171772 171791 GAACATACAATTATTTTAAA  81 1897
    1249223 N/A N/A 172625 172644 ACCTCTAACTTTACTGGGCT  24 1898
    1249249 N/A N/A 173459 173478 TGTCACTCCTCCCTTTGACA  36 1899
    1249275 N/A N/A 175540 175559 AGAGTATAAAATTATAGGAC  38 1900
    1249301 N/A N/A 176818 176837 ATCATTTTAATAAAAGTATA  91 1901
    1249327 N/A N/A 177610 177629 ATATTATTCCTCTAATGACA  57 1902
    1249353 N/A N/A 178288 178307 ATTTTGAATTCTAAAACTGA  94 1903
    1249379 N/A N/A 179465 179484 ACAATTTTTCTTTATTGCTA  41 1904
    1249405 N/A N/A 180277 180296 GCAAAATTACTTATTAAGTT  66 1905
    1249431 N/A N/A 180926 180945 ATACTTACTCCACATTCTTT  71 1906
    1249457 N/A N/A 183621 183640 ATTTAGAGAACTAAACAACT  57 1907
    1249483 N/A N/A 183972 183991 CATCAACCAAATAGGGCCAA  17 1908
    1249509 N/A N/A 185086 185105 TAGGAAGCATCACTTACCCT 109 1909
    1249535 N/A N/A 185714 185733 CCATGTTTCTTAATAGCAAA  41 1910
    1249561 N/A N/A 187364 187383 TTGTTAATCATTAATTTCCT  42 1911
    1249587 N/A N/A 189970 189989 CATTCTTCATAGGCAACTTG  36 1912
    1249613 N/A N/A 191698 191717 AGTTTATATTTTAACTGCCA  25 1913
    1249639 N/A N/A 200199 200218 GGTGTTCAAAATATACCTTA  19 1914
    1249665 N/A N/A 200622 200641 ATTCAAAGTCACAAATTAAC  65 1915
    1249691 N/A N/A 202499 202518 CTAAAATAAAATCATTCAAT  77 1916
    1249717 N/A N/A 202983 203002 CCTAAGTAAATTAATTTATT  78 1917
    1249743 N/A N/A 203657 203676 AACTCATTTATTACTGGAAA  36 1918
    1249769 N/A N/A 205059 205078 TTTAACAAAATTAAATAAAT 106 1919
    1249795 N/A N/A 206914 206933 CCTCTCTTCATTCCTACTTC  49 1920
    1249821 N/A N/A 208591 208610 ATGACCTATCTTAATTTTTA  67 1921
    1249847 N/A N/A 210310 210329 ATATTATCCCATATTATAGT  58 1922
    1249873 N/A N/A 213321 213340 CATGTGTATATTACTAGACT  34 1923
    1249899 N/A N/A 215633 215652 AGTGAACTTTATTAAAGCTA  35 1924
    1249925 N/A N/A 220797 220816 GATCAACCTTCCTATTGTAA  91 1925
    1249951 N/A N/A 224068 224087 CATCTATAAAATAAATGTAA 104 1926
    1249977 N/A N/A 227766 227785 CAGATATTTTCTATTTTCTT  48 1927
    1250003 N/A N/A 230954 230973 TGTTTTTATTTTACTGCCAA  42 1928
    1250029 N/A N/A 233409 233428 ATCTAATAAACATCAAGGTA  41 1929
    1250055 N/A N/A 235366 235385 ATTTCAAATTATAAAAGACA  81 1930
    1250081 N/A N/A 237009 237028 ATGTGGATTTTCTCTAGAAA  23 1931
    1250107 N/A N/A 239994 240013 GTTTATAGCACTACTATAAT  52 1932
    1250133 N/A N/A 243092 243111 ATTCTATTAAATTTTATGAT  73 1933
    1250159 N/A N/A 246419 246438 AAATTCTCCATAAATTTGAC  88 1934
    1250185 N/A N/A 248151 248170 CTGTTTTCCATAAAAGCTAT  37 1935
    1250211 N/A N/A 252236 252255 TTCATTTTCATCACTATATA  53 1936
    1250237 4787 4806 254155 254174 GTGGTTTCTTTGAACCCAGT  31 1937
    255548 255567
    1250263 N/A N/A 255611 255630 CTGTGTTTCATAACAGGCAA  42 1938
    1250289 N/A N/A 258117 258136 TTTTTGGACATCAAACACTA  92 1939
    1250313 N/A N/A 260701 260720 CTTAAATCTTCTTATATTTA  95 1940
  • TABLE 27
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS
    internucleoside linkages at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 24 227
    1248348 193 212 112606 112625 ATGTAAATCATAACACAGAA 90 1941
    1248374 569 588 170040 170059 TGAATCGAGAGATTGCTTTC 35 1942
    1248400 1196 1215 183543 183562 TGCTCACTGTCCTATTGAAA 27 1943
    1248426 1922 1941 188731 188750 GAGAAGAAAATCTCTTTTCA 55 1944
    1248452 2504 2523 204406 204425 TCACCTTTAACCATGGTTTA 67 1945
    1248478 3323 3342 227317 227336 GTATTTTTCTTTTAACAAAA 49 1946
    1248504† 3863 3882 240281 240300 AGCATGTTTTCCTCAAATTC 38 1947
    1248530 4392 4411 247826 247845 CTTACATCAAACATCTCTCC 41 1948
    1248555 6046 6065 262574 262593 TGATACCTTTTTAACTTTTT 61 1949
    1248581 6592 6611 263120 263139 TTACATAAAAATTTAACTTC 87 1950
    1248607 7195 7214 263723 263742 AAAGGACACTTATCAAAAAT 69 1951
    1248632 7384 7403 263912 263931 TTACTATTTACAAAGCAGAC 67 1952
    1248658 7508 7527 264036 264055 CAATTACATCATATTACCTG 58 1953
    1248683 7637 7656 264165 264184 ACAATTTGCTTCACTTTACC 52 1954
    1248708 7954 7973 264482 264501 TGCTTCAATTTAAAAGTGCT 44 1955
    1248733 8280 8299 264808 264827 AGCTGGGATCCCATATTATA 53 1956
    1248759 8420 8439 264948 264967 TGCATGCATTTCACCAACAC 45 1957
    1248785 8600 8619 265128 265147 TGTGTTCTTTACATTTGTTT 58 1958
    1248810 8678 8697 265206 265225 AAGTAGTTATCCAATACACT 60 1959
    1248835 N/A N/A 113871 113890 ATGTAGAACTACAAACTCTA 61 1960
    1248861 N/A N/A 117498 117517 ATAAGATTTTTTCATTATTA 76 1961
    1248887 N/A N/A 123399 123418 ACTATATCCATATCATTTTA 77 1962
    1248913 N/A N/A 126445 126464 CTTTATCTCTCCAAACCATC 84 1963
    1248938 N/A N/A 128503 128522 ATATGGAGTTAAACCATAGA 67 1964
    128546 128565
    1248964 N/A N/A 139945 139964 ACAGATATTTCACCTCATTA 75 1965
    1248990 N/A N/A 144248 144267 TCTTTGCTCATAATACCATT 72 1966
    1249016 N/A N/A 146217 146236 TATAATTTCTATCAATATTA 75 1967
    1249042 N/A N/A 147470 147489 CTAGCATATTCCATTACTTC 71 1968
    1249068 N/A N/A 152306 152325 TGTCTTCCCTATCTCAACCA 72 1969
    1249094 N/A N/A 156025 156044 CACTGCATCTTCATTACCAT 65 1970
    1249120 N/A N/A 161702 161721 CCTTCTCTTTTTAACCTGAA 80 1971
    1249146 N/A N/A 165017 165036 CCGTAGCTTCCCTACAGCTA 75 1972
    1249172 N/A N/A 170181 170200 ATGTGTAGCTCAATAACTTG 31 1973
    1249198 N/A N/A 171775 171794 AAGGAACATACAATTATTTT 56 1974
    1249224 N/A N/A 172632 172651 TCTATATACCTCTAACTTTA 68 1975
    1249250 N/A N/A 173610 173629 CTTCAGACTTTACCTTCATA 52 1976
    1249276 N/A N/A 175562 175581 TTACCATTAATAACTCATTT 41 1977
    1249302 N/A N/A 176821 176840 GCTATCATTTTAATAAAAGT 41 1978
    1249328 N/A N/A 177620 177639 AGCAGCCCTTATATTATTCC 15 1979
    1249354 N/A N/A 178311 178330 TACATATCTTATCAACACTT 55 1980
    1249380 N/A N/A 179595 179614 ATGAAAACACTCATAAGTAA 68 1981
    1249406 N/A N/A 180349 180368 GCTCATAAAATCCTGAACTA 23 1982
    1249432 N/A N/A 180932 180951 ATATTTATACTTACTCCACA 100 1983
    1249458 N/A N/A 183643 183662 TCCATTATATATAATATTTA 92 1984
    1249484 N/A N/A 183974 183993 TGCATCAACCAAATAGGGCC 15 1985
    1249510 N/A N/A 185226 185245 ATCTACACTTATCCTGGCTA 96 1986
    1249536 N/A N/A 185715 185734 TCCATGTTTCTTAATAGCAA 26 1987
    1249562 N/A N/A 187367 187386 CCTTTGTTAATCATTAATTT 53 1988
    1249588 N/A N/A 189971 189990 GCATTCTTCATAGGCAACTT 16 1989
    1249614 N/A N/A 191779 191798 ATACTGCTCCTCATTAGCTA 65 1990
    1249640 N/A N/A 200200 200219 TGGTGTTCAAAATATACCTT 48 1991
    1249666 N/A N/A 200631 200650 GAGACTGAAATTCAAAGTCA 45 1992
    1249692 N/A N/A 202500 202519 TCTAAAATAAAATCATTCAA 89 1993
    1249718 N/A N/A 203006 203025 AATTAATTCTATAATACTAT 79 1994
    1249744 N/A N/A 203683 203702 TTACAAATCAACATTTCACA 60 1995
    1249770 N/A N/A 205107 205126 ATACTATATTATAATATCAA 80 1996
    1249796 N/A N/A 206945 206964 CTTTTTCTTTCTAAAAGATC 73 1997
    1249822 N/A N/A 208673 208692 TCATTGCTTAATAATAGGTC 25 1998
    1249848 N/A N/A 210312 210331 TGATATTATCCCATATTATA 47 1999
    1249874 N/A N/A 213367 213386 GTGACTTTTCCAAATATTAC 46 2000
    1249900 N/A N/A 215699 215718 CTGTTTCCTCCTCTCTATTA 71 2001
    1249926 N/A N/A 220846 220865 TCTCAGTTAAATATATTTTA 69 2002
    1249952 N/A N/A 224116 224135 TTTCTGTTACCTACTAAGTA 49 2003
    1249978 N/A N/A 228224 228243 TGATTCCTCATCAATACCTT 45 2004
    1250004 N/A N/A 230955 230974 ATGTTTTTATTTTACTGCCA 36 2005
    1250030 N/A N/A 233413 233432 AATGATCTAATAAACATCAA 83 2006
    1250056 N/A N/A 235406 235425 GGTGTTTTTTTTAATTGCTT 32 2007
    1250082 N/A N/A 237351 237370 AATGCAATAAACTTTAGCCA 54 2008
    1250108 N/A N/A 240033 240052 GGCTTTTTAATCATTTGTTT 30 2009
    1250134 N/A N/A 243096 243115 AAAAATTCTATTAAATTTTA 89 2010
    1250160 N/A N/A 246422 246441 CACAAATTCTCCATAAATTT 55 2011
    1250186 N/A N/A 248152 248171 ACTGTTTTCCATAAAAGCTA 39 2012
    1250212 N/A N/A 252444 252463 CTGGAGGTAATCATTATCCT 33 2013
    1250238 4788 4807 254156 254175 TGTGGTTTCTTTGAACCCAG 16 2014
    255549 255568
    1250264 N/A N/A 255673 255692 CACAAAATATCAACTAGCTT 61 2015
    1250290 N/A N/A 258143 258162 GAGGCTTCTATTACTTCCAA 48 2016
    1250314 N/A N/A 260862 260881 ATCTTACCTCTTAATGCTAC 71 2017
  • TABLE 28
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS
    internucleoside linkages at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID ID ID ID
    NO: NO: NO: NO:
    1 1 2 2 SCN2A SEQ
    Compound Start Stop Start Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
    910092 8731 8750 265259 265278 GTAACTTTCCACTAGTCTAC 58 432
    910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 27 227
    1248349 197 216 112610 112629 AAAAATGTAAATCATAACAC 80 2018
    1248375 571 590 170042 170061 ACTGAATCGAGAGATTGCTT 27 2019
    1248401 1219 1238 183566 183585 AATATATTCATCCCAGTTAA 57 2020
    1248427 2308 2327 199865 199884 TCTCTTTCTTATTTCTGTTT 47 2021
    1248453 2505 2524 204407 204426 TTCACCTTTAACCATGGTTT 70 2022
    1248479 3363 3382 227357 227376 GCTTTCTGCTTCCTAACAAA 23 2023
    1248505† 3864 3883 240282 240301 TAGCATGTTTTCCTCAAATT 29 2024
    1248531 4398 4417 247832 247851 ACCACGCTTACATCAAACAT 44 2025
    1248556 6047 6066 262575 262594 TTGATACCTTTTTAACTTTT 54 2026
    1248582 6593 6612 263121 263140 TTTACATAAAAATTTAACTT 88 2027
    1248608 7198 7217 263726 263745 GCCAAAGGACACTTATCAAA 35 2028
    1248633 7385 7404 263913 263932 ATTACTATTTACAAAGCAGA 66 2029
    1248659 7509 7528 264037 264056 CCAATTACATCATATTACCT 47 2030
    1248684 7703 7722 264231 264250 CAAGAAGCTCTTCCTTGTTT 62 2031
    1248709 7955 7974 264483 264502 GTGCTTCAATTTAAAAGTGC 43 2032
    1248734 8317 8336 264845 264864 ATAACTTCACTACCTGGTTT 50 2033
    1248760 8421 8440 264949 264968 CTGCATGCATTTCACCAACA 40 2034
    1248786 8601 8620 265129 265148 GTGTGTTCTTTACATTTGTT 66 2035
    1248836 N/A N/A 113905 113924 CTGTAATTCTAAAAATCTCC 76 2036
    1248862 N/A N/A 117593 117612 TATCACATTCCAATAAATAA 74 2037
    1248888 N/A N/A 123415 123434 TTAAAATTTTCTATATACTA 77 2038
    1248914 N/A N/A 126502 126521 TTTATGGACATTAAACTTCA 76 2039
    1248939 N/A N/A 128505 128524 GGATATGGAGTTAAACCATA 74 2040
    128548 128567
    1248965 N/A N/A 140046 140065 TTTAAGAACATTAATTCTTT 83 2041
    1248991 N/A N/A 144249 144268 GTCTTTGCTCATAATACCAT 67 2042
    1249017 N/A N/A 146222 146241 TTAGTTATAATTTCTATCAA 86 2043
    1249043 N/A N/A 147483 147502 GTAGCTATATTCACTAGCAT 59 2044
    1249069 N/A N/A 152331 152350 TCAGTTTCTTCCATTTGAAA 82 2045
    1249095 N/A N/A 156157 156176 TCTTCTTTTTTCCTAAGTTA 65 2046
    1249121 N/A N/A 161709 161728 TATGTATCCTTCTCTTTTTA 92 2047
    1249147 N/A N/A 165658 165677 TAGAACAGTTCTAATTGTTA 95 2048
    1249173 N/A N/A 170182 170201 AATGTGTAGCTCAATAACTT 47 2049
    1249199 N/A N/A 171856 171875 TTCCCAATGTCTACTAGGAA 31 2050
    1249225 N/A N/A 172637 172656 CAGCATCTATATACCTCTAA 23 2051
    1249251 N/A N/A 174327 174346 GTCATGACTTTAAATACCAG 19 2052
    1249277 N/A N/A 175566 175585 TTTCTTACCATTAATAACTC 40 2053
    1249303 N/A N/A 176825 176844 CATGGCTATCATTTTAATAA 29 2054
    1249329 N/A N/A 177648 177667 GATTGACCTATTACCAGTTA 45 2055
    1249355 N/A N/A 178312 178331 TTACATATCTTATCAACACT 46 2056
    1249381 N/A N/A 179609 179628 GTTTTTTCATCCATATGAAA 47 2057
    1249407 N/A N/A 180430 180449 TAACATCATTCTAAAAGTTA 69 2058
    1249433 N/A N/A 180935 180954 AAAATATTTATACTTACTCC 77 2059
    1249459 N/A N/A 183649 183668 ATAATTTCCATTATATATAA 96 2060
    1249485 N/A N/A 183975 183994 TTGCATCAACCAAATAGGGC 14 2061
    1249511 N/A N/A 185231 185250 TGAGAATCTACACTTATCCT 59 2062
    1249537 N/A N/A 185740 185759 TTTTTAAATTTTCCTAGGAT 80 2063
    1249563 N/A N/A 187450 187469 TAACTGAATTCCTCTTCCCC 66 2064
    1249589 N/A N/A 189973 189992 AGGCATTCTTCATAGGCAAC 24 2065
    1249615 N/A N/A 191856 191875 TCCTTTCTCTCCTCTAACAA 65 2066
    1249641 N/A N/A 200201 200220 GTGGTGTTCAAAATATACCT 52 2067
    1249667 N/A N/A 200664 200683 CCTAAACATCATCATCCACA 47 2068
    1249693 N/A N/A 202504 202523 AAGTTCTAAAATAAAATCAT 81 2069
    1249719 N/A N/A 203014 203033 TTGCCACTAATTAATTCTAT 49 2070
    1249745 N/A N/A 203760 203779 CTACATTTCTCATTTAACTA 57 2071
    1249771 N/A N/A 205133 205152 ACCACTTTAAAATCTATCAC 48 2072
    1249797 N/A N/A 207008 207027 TTTCAATTTCACATAGGTTA 51 2073
    1249823 N/A N/A 208725 208744 CCTTTTTTTTCTTATTGCTA 42 2074
    1249849 N/A N/A 210335 210354 ATTATATAAATATTTAGACT 80 2075
    1249875 N/A N/A 213368 213387 AGTGACTTTTCCAAATATTA 42 2076
    1249901 N/A N/A 215842 215861 ATTCCATAATTCTTTAGTTC 43 2077
    1249927 N/A N/A 220875 220894 TCTTTCTTCCTACCAAGCTA 59 2078
    1249953 N/A N/A 224198 224217 CAGCATGTTTATCTTAGTTC 17 2079
    1249979 N/A N/A 228226 228245 TGTGATTCCTCATCAATACC 40 2080
    1250005 N/A N/A 231098 231117 GCATGCACTTTTACTTTTCA 25 2081
    1250031 N/A N/A 233414 233433 TAATGATCTAATAAACATCA 68 2082
    1250057 N/A N/A 235526 235545 CTGTCTGTTTTCAATAGCCT 36 2083
    1250083 N/A N/A 237406 237425 GTTAAATCAAATATCACCAA 42 2084
    1250109 N/A N/A 240123 240142 ATTTACATTATTACCTGATA 70 2085
    1250135 N/A N/A 243099 243118 TCAAAAAATTCTATTAAATT 85 2086
    1250161 N/A N/A 246430 246449 GTGTAAGACACAAATTCTCC 23 2087
    1250187 N/A N/A 249170 249189 CATATCTACTCACTTAGCTA 50 2088
    1250213 N/A N/A 252473 252492 CTTCTCAAACATAAACTCCA 61 2089
    1250239 4789 4808 254157 254176 TTGTGGTTTCTTTGAACCCA 26 2090
    255550 255569
    1250265 N/A N/A 255680 255699 ACAGTTTCACAAAATATCAA 58 2091
    1250291 N/A N/A 258473 258492 GAAATATTCAATCTTTGCCC 65 2092
    1250315 N/A N/A 260869 260888 ATCTCAAATCTTACCTCTTA 81 2093
  • TABLE 29
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with mixed PO/PS
    internucleoside linkages at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 17 227
    1248350 250 269 168795 168814 CTGCTCCTTTAATCACTGTT 20 2094
    1248376 624 643 170095 170114 GCTAATTTTCTAATAGGGTT 13 2095
    1248402 1221 1240 183568 183587 TCAATATATTCATCCCAGTT 41 2096
    1248428 2309 2328 199866 199885 GTCTCTTTCTTATTTCTGTT 32 2097
    1248454 2507 2526 204409 204428 GTTTCACCTTTAACCATGGT 41 2098
    1248480 3425 3444 227419 227438 GGTTGGAAATACAGCTGTCT 15 2099
    1248506† 3896 3915 240314 240333 AGGTTTCGAACCAATTGTGC 24 2100
    1248532 4461 4480 247895 247914 ACATTTTTCCACCTGGCAGT 24 2101
    1248557 6049 6068 262577 262596 ACTTGATACCTTTTTAACTT 55 2102
    1248583 6601 6620 263129 263148 ATGTTGAATTTACATAAAAA 77 2103
    1248609 7212 7231 263740 263759 TATTTTTATTTTATGCCAAA 79 2104
    1248634 7390 7409 263918 263937 GTAAAATTACTATTTACAAA 87 2105
    1248660 7510 7529 264038 264057 ACCAATTACATCATATTACC 37 2106
    1248685 7749 7768 264277 264296 GGCTTTTCATCATTGAGTGT 33 2107
    1248710 7984 8003 264512 264531 ATCCTAGTCCTTGCTTCTTA 46 2108
    1248735 8318 8337 264846 264865 TATAACTTCACTACCTGGTT 50 2109
    1248761 8432 8451 264960 264979 ACAGCATTTTCCTGCATGCA 41 2110
    1248787 8602 8621 265130 265149 TGTGTGTTCTTTACATTTGT 65 2111
    1248811 8733 8752 265261 265280 TTGTAACTTTCCACTAGTCT 57 2112
    1248837 N/A N/A 113946 113965 TGCTTTTCTTTAAATGATAA 73 2113
    1248863 N/A N/A 117594 117613 TTATCACATTCCAATAAATA 85 2114
    1248889 N/A N/A 123738 123757 CTACATTTTATCCTTTCCTA 74 2115
    1248915 N/A N/A 126713 126732 TCAAACATCTATACTTGATC 72 2116
    1248940 N/A N/A 128508 128527 TTAGGATATGGAGTTAAACC 89 2117
    128551 128570
    1248966 N/A N/A 140537 140556 CCTATATTTTCTTCTAGTAC 71 2118
    1248992 N/A N/A 144250 144269 GGTCTTTGCTCATAATACCA 61 2119
    1249018 N/A N/A 146235 146254 TCTAACTTATTCCTTAGTTA 87 2120
    1249044 N/A N/A 147614 147633 GTACAATTTTTAAACTAGGC 70 2121
    1249070 N/A N/A 152431 152450 GCTTTCATTTCCATCCTTTA 71 2122
    1249096 N/A N/A 156175 156194 TTCCATTTCCTTCCTTTTTC 71 2123
    1249122 N/A N/A 161817 161836 CAAGTCTATTTTCTTATCAA 75 2124
    1249148 N/A N/A 165672 165691 GTATCAATTATAATTAGAAC 114 2125
    1249174 N/A N/A 170184 170203 AAAATGTGTAGCTCAATAAC 54 2126
    1249200 N/A N/A 171870 171889 ATTTAATGAATATTTTCCCA 45 2127
    1249226 N/A N/A 172638 172657 ACAGCATCTATATACCTCTA 27 2128
    1249252 N/A N/A 174390 174409 TAGTTCAGCATTACTAGTGT 19 2129
    1249278 N/A N/A 175569 175588 TGGTTTCTTACCATTAATAA 16 2130
    1249304 N/A N/A 176837 176856 TTTTCCTTATTTCATGGCTA 22 2131
    1249330 N/A N/A 177671 177690 CCTCTCTTTTTCTTTAGTAC 22 2132
    1249356 N/A N/A 178316 178335 GTACTTACATATCTTATCAA 30 2133
    1249382 N/A N/A 179685 179704 TTTAGTCAAAACAATAATAA 94 2134
    1249408 N/A N/A 180436 180455 GTATTATAACATCATTCTAA 25 2135
    1249434 N/A N/A 181116 181135 TGCAGTAATTTACACAACTA 43 2136
    1249460 N/A N/A 183650 183669 GATAATTTCCATTATATATA 74 2137
    1249486 N/A N/A 183976 183995 GTTGCATCAACCAAATAGGG 19 2138
    1249512 N/A N/A 185318 185337 TTCTCTATTTTACATTGAAC 46 2139
    1249538 N/A N/A 185746 185765 ACTGTGTTTTTAAATTTTCC 35 2140
    1249564 N/A N/A 187569 187588 AGAGAACAAATATTGAATAA 91 2141
    1249590 N/A N/A 189974 189993 AAGGCATTCTTCATAGGCAA 26 2142
    1249616 N/A N/A 191904 191923 TAGTTATTTTTTAAAGCCTT 52 2143
    1249642 N/A N/A 200270 200289 GCATTTATCATTACACTCTT 24 2144
    1249668 N/A N/A 200669 200688 TTATGCCTAAACATCATCAT 76 2145
    1249694 N/A N/A 202506 202525 TTAAGTTCTAAAATAAAATC 78 2146
    1249720 N/A N/A 203028 203047 CTACTAATCAACATTTGCCA 40 2147
    1249746 N/A N/A 203763 203782 TCTCTACATTTCTCATTTAA 53 2148
    1249772 N/A N/A 205201 205220 TAAGCATTTTATACTTGTAT 23 2149
    1249798 N/A N/A 207009 207028 TTTTCAATTTCACATAGGTT 37 2150
    1249824 N/A N/A 208813 208832 ATGTCTTCTTCCATTCTTTA 29 2151
    1249850 N/A N/A 210346 210365 CTGATTCTCCCATTATATAA 51 2152
    1249876 N/A N/A 213417 213436 ATGGAATCTCTCTCTACCTA 50 2153
    1249902 N/A N/A 215847 215866 GAACAATTCCATAATTCTTT 35 2154
    1249928 N/A N/A 220972 220991 ACTTCATATTTAAAGCATAA 49 2155
    1249954 N/A N/A 224537 224556 GTCTTTTCTCCTAATTGTGA 38 2156
    1249980 N/A N/A 228309 228328 ATTTTACATTCTATAATGTA 101 2157
    1250006 N/A N/A 231374 231393 CCTATTCATTTACATTATTA 47 2158
    1250032 N/A N/A 233663 233682 GCCTAGTTAAAATTTAACAA 68 2159
    1250058 N/A N/A 235611 235630 ATATAGTTCAATACAAGGAA 80 2160
    1250084 N/A N/A 237423 237442 CTTTTGTTTTCCTTTAGGTT 16 2161
    1250110 N/A N/A 240470 240489 CATATTTCTTCTCATTCTTA 59 2162
    1250136 N/A N/A 243102 243121 AAGTCAAAAAATTCTATTAA 83 2163
    1250162 N/A N/A 246477 246496 CATCTGGTAAATATTATTTT 57 2164
    1250188 N/A N/A 249349 249368 CATTTTTATTTTAATTGCTT 21 2165
    1250214 N/A N/A 252565 252584 TGCATAATACATAAATGCAA 54 2166
    1250240 N/A N/A 254182 254201 TTACAGCAGGTCGAGGTATG 60 2167
    255575 255594
    1250266 N/A N/A 255756 255775 GTCTGGACATTTCATAGGCT 20 2168
    1250292 N/A N/A 258776 258795 TTTCTGACTTTATATTCTCT 59 2169
    1250316 N/A N/A 260872 260891 CAGATCTCAAATCTTACCTC 55 2170
  • TABLE 30
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with
    mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
     910064 7753 7772 264281 264300 GTCGGGCTTTTCATCATTGA 40  116
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 37  227
    1248351 264 283 168809 168828 GCCATCTTTTCATCCTGCTC 29 2171
    1248377 625 644 170096 170115 AGCTAATTTTCTAATAGGGT 20 2172
    1248403 1224 1243 183571 183590 TCCTCAATATATTCATCCCA 36 2173
    1248429 2310 2329 199867 199886 CGTCTCTTTCTTATTTCTGT 18 2174
    1248455 2510 2529 204412 204431 GGTGTTTCACCTTTAACCAT 82 2175
    1248481 3427 3446 227421 227440 ATGGTTGGAAATACAGCTGT 28 2176
    1248507 3958 3977 243130 243149 CTCAATGTATATATCTTCAA 35 2177
    1248533 4463 4482 247897 247916 TCACATTTTTCCACCTGGCA 23 2178
    1248558 6050 6069 262578 262597 TACTTGATACCTTTTTAACT 48 2179
    1248584 6628 6647 263156 263175 GTGACAATTACTATTATCAA 45 2180
    1248610 7213 7232 263741 263760 ATATTTTTATTTTATGCCAA 64 2181
    1248635 7391 7410 263919 263938 GGTAAAATTACTATTTACAA 49 2182
    1248661 7511 7530 264039 264058 AACCAATTACATCATATTAC 45 2183
    1248711 7993 8012 264521 264540 CTACACTGCATCCTAGTCCT 58 2184
    1248736 8322 8341 264850 264869 GTAATATAACTTCACTACCT 50 2185
    1248762 8435 8454 264963 264982 GTAACAGCATTTTCCTGCAT 41 2186
    1248788 8616 8635 265144 265163 ATTATAGTAATTAATGTGTG 68 2187
    1248812 8737 8756 265265 265284 ATTTTTGTAACTTTCCACTA 93 2188
    1248838 N/A N/A 113947 113966 TTGCTTTTCTTTAAATGATA 58 2189
    1248864 N/A N/A 117621 117640 TTATAGTTTTTTACCCTCAA 60 2190
    1248890 N/A N/A 123821 123840 TCAAATCATTCTACAATTCA 95 2191
    1248916 N/A N/A 127155 127174 CATTTATTTATAAATTATAA 79 2192
    1248941 N/A N/A 128512 128531 ATTGTTAGGATATGGAGTTA 62 2193
    128555 128574
    1248967 N/A N/A 140712 140731 GGAGTTTCTTACATATTTTA 84 2194
    1248993 N/A N/A 144287 144306 AATTCTCTCCAAAATAATTA 74 2195
    1249019 N/A N/A 146239 146258 ACCATCTAACTTATTCCTTA 58 2196
    1249045 N/A N/A 148464 148483 TGGAGCTTATATTCTAGGTA 54 2197
    1249071 N/A N/A 152539 152558 ATATTTTTAAAAACTTGGCT 74 2198
    1249097 N/A N/A 156183 156202 TTAAATATTTCCATTTCCTT 95 2199
    1249123 N/A N/A 161836 161855 CTTTCTTATTCCATAGGTTC 72 2200
    1249149 N/A N/A 165819 165838 TTCATTATCCTTATTTGCAA 52 2201
    1249175 N/A N/A 170220 170239 AAGAACACATAACATTGCCA 51 2202
    1249201 N/A N/A 171878 171897 ACTTATTTATTTAATGAATA 74 2203
    1249227 N/A N/A 172639 172658 TACAGCATCTATATACCTCT 31 2204
    1249253 N/A N/A 174408 174427 CCATTTTCAAATGATAGGTA 40 2205
    1249279 N/A N/A 175596 175615 GTCATTATCCACTAAGATAA 55 2206
    1249305 N/A N/A 176843 176862 CAGGCATTTTCCTTATTTCA 19 2207
    1249331 N/A N/A 177679 177698 AAATGTCACCTCTCTTTTTC 58 2208
    1249357 N/A N/A 178317 178336 TGTACTTACATATCTTATCA 47 2209
    1249383 N/A N/A 179765 179784 ATAATGAAATATCAACACTA 62 2210
    1249409 N/A N/A 180452 180471 AAGTAATTAATTAAATGTAT 97 2211
    1249435 N/A N/A 181315 181334 TTGTATTTCATAAAATATGC 44 2212
    1249461 N/A N/A 183652 183671 GAGATAATTTCCATTATATA 50 2213
    1249487 N/A N/A 183978 183997 ATGTTGCATCAACCAAATAG 40 2214
    1249513 N/A N/A 185319 185338 ATTCTCTATTTTACATTGAA 45 2215
    1249539 N/A N/A 185779 185798 TGGCTCTAAAATCTTGCTAA 26 2216
    1249565 N/A N/A 187608 187627 ATGTAACCCACAAACTTGCA 46 2217
    1249591 N/A N/A 189975 189994 AAAGGCATTCTTCATAGGCA 35 2218
    1249617 N/A N/A 191905 191924 GTAGTTATTTTTTAAAGCCT 31 2219
    1249643 N/A N/A 200273 200292 TAAGCATTTATCATTACACT 35 2220
    1249669 N/A N/A 200681 200700 CATTCAACAACCTTATGCCT 50 2221
    1249695 N/A N/A 202507 202526 TTTAAGTTCTAAAATAAAAT 65 2222
    1249721 N/A N/A 203038 203057 AATGTTTCTTCTACTAATCA 36 2223
    1249747 N/A N/A 203768 203787 CCATCTCTCTACATTTCTCA 46 2224
    1249773 N/A N/A 205479 205498 ATACAGACAATTTATAGTAA 73 2225
    1249799 N/A N/A 207015 207034 AGGAATTTTTCAATTTCACA 52 2226
    1249825 N/A N/A 208862 208881 TCCTTTACATATATTAGATA 57 2227
    1249851 N/A N/A 210347 210366 TCTGATTCTCCCATTATATA 51 2228
    1249877 N/A N/A 213484 213503 CCAAAATTCATCTTACTGCT 37 2229
    1249903 N/A N/A 215849 215868 ATGAACAATTCCATAATTCT 62 2230
    1249929 N/A N/A 220980 220999 GTGTAATTACTTCATATTTA 31 2231
    1249955 N/A N/A 224675 224694 TTATTTCTCACAACTCTATA 65 2232
    1249981 N/A N/A 228316 228335 ATTCAGAATTTTACATTCTA 45 2233
    1250007 N/A N/A 231422 231441 GCAGATAAATATTATACCCA 28 2234
    1250033 N/A N/A 233733 233752 CACTTTTTAATTACCTGTAC 45 2235
    1250059 N/A N/A 235626 235645 ATGGATAATACACCAATATA 36 2236
    1250085 N/A N/A 237498 237517 CATTTGGAAACTACTTGTTA 70 2237
    1250111 N/A N/A 241055 241074 TTGTACAAACTCATTCCTCC 34 2238
    1250137 N/A N/A 243105 243124 TGTAAGTCAAAAAATTCTAT 75 2239
    1250163 N/A N/A 246564 246583 AAGAAGTGAAAATCTAGCTA 67 2240
    1250189 N/A N/A 249785 249804 TGGAAAGTTTTCATTTGCAA 38 2241
    1250215 N/A N/A 253045 253064 TACATTTCTTTAGATAGGCA 29 2242
    1250241 N/A N/A 254208 254227 TAACAGGCAATGAAAATATG 86 2243
    255601 255620
    1250267 N/A N/A 255841 255860 TCTATTCTAATTATTTTTCA 89 2244
    1250293 N/A N/A 258834 258853 AACTAATAAATAAATACTTC 85 2245
    1250317 N/A N/A 260876 260895 AGGTCAGATCTCAAATCTTA 55 2246
  • TABLE 31
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with
    mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
     910069 7994 8013 264522 264541 CCTACACTGCATCCTAGTCC 55 39
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 34 227
    1248352 366 385 168911 168930 CTCTTAGCTTTCTCTTCTGC 22 2247
    1248378 765 784 181676 181695 TCAAAAGTATAAATTCCTGT 42 2248
    1248404 1225 1244 183572 183591 ATCCTCAATATATTCATCCC 14 2249
    1248430 2312 2331 199869 199888 ACCGTCTCTTTCTTATTTCT 17 2250
    1248456 2511 2530 204413 204432 AGGTGTTTCACCTTTAACCA 76 2251
    1248482 3428 3447 227422 227441 TATGGTTGGAAATACAGCTG 16 2252
    1248508 3975 3994 243147 243166 TTAATGGTTTTTCGCTGCTC 32 2253
    1248534 4464 4483 247898 247917 TTCACATTTTTCCACCTGGC 8 2254
    1248559 6061 6080 262589 262608 TTTCTTGTATATACTTGATA 47 2255
    1248585 6629 6648 263157 263176 GGTGACAATTACTATTATCA 25 2256
    1248611 7214 7233 263742 263761 GATATTTTTATTTTATGCCA 33 2257
    1248636 7392 7411 263920 263939 GGGTAAAATTACTATTTACA 34 2258
    1248662 7512 7531 264040 264059 GAACCAATTACATCATATTA 31 2259
    1248686 7797 7816 264325 264344 ATATATTTTAAACAGATTTA 70 2260
    1248737 8325 8344 264853 264872 CTGGTAATATAACTTCACTA 29 2261
    1248763 8451 8470 264979 264998 TTTACCGTTCTTTATGGTAA 72 2262
    1248789 8623 8642 265151 265170 AAGATGAATTATAGTAATTA 66 2263
    1248813 8740 8759 265268 265287 TTAATTTTTGTAACTTTCCA 78 2264
    1248839 N/A N/A 113966 113985 CCTTATCTCTCAATTACAAT 82 2265
    1248865 N/A N/A 117677 117696 AAGATCATTTTATCCCCCTA 67 2266
    1248891 N/A N/A 123949 123968 CTTATGGTCTTTAATAATAA 72 2267
    1248917 N/A N/A 127158 127177 TCACATTTATTTATAAATTA 105 2268
    1248942 N/A N/A 128514 128533 TAATTGTTAGGATATGGAGT 66 2269
    128557 128576
    1248968 N/A N/A 140789 140808 GAGAAATGTCCATTTAGGTC 61 2270
    1248994 N/A N/A 144315 144334 AGCACAAGTCCAATTAGGCC 58 2271
    1249020 N/A N/A 146246 146265 TTTAATCACCATCTAACTTA 79 2272
    1249046 N/A N/A 148566 148585 GCTAATCATTTAACAAAAAT 86 2273
    1249072 N/A N/A 152563 152582 ATTTTATATATAATTACTAA 66 2274
    1249098 N/A N/A 156216 156235 GAACTTATCTTCCTTAGAAA 69 2275
    1249124 N/A N/A 162088 162107 ACATAATTTTATATTAGTTT 113 2276
    1249150 N/A N/A 165938 165957 GCTAGGCTTTCAATTAATAT 77 2277
    1249176 N/A N/A 170274 170293 CCTGTGATCTCATTTTGCAA 44 2278
    1249202 N/A N/A 171885 171904 ACTAGTCACTTATTTATTTA 39 2279
    1249228 N/A N/A 172640 172659 CTACAGCATCTATATACCTC 34 2280
    1249254 N/A N/A 174412 174431 CCTACCATTTTCAAATGATA 48 2281
    1249280 N/A N/A 175597 175616 AGTCATTATCCACTAAGATA 42 2282
    1249306 N/A N/A 176844 176863 ACAGGCATTTTCCTTATTTC 10 2283
    1249332 N/A N/A 177749 177768 TACTGTAATTATTTTAGGTT 60 2284
    1249358 N/A N/A 178320 178339 ATCTGTACTTACATATCTTA 33 2285
    1249384 N/A N/A 179781 179800 ATCACATTACTTACACATAA 28 2286
    1249410 N/A N/A 180456 180475 ATTCAAGTAATTAATTAAAT 77 2287
    1249436 N/A N/A 181432 181451 ATTAATTAATTTAAAGGATC 92 2288
    1249462 N/A N/A 183672 183691 ACTTGATTCACATCTAAATT 24 2289
    1249488 N/A N/A 183997 184016 GCATATGTACTCAATACATA 34 2290
    1249514 N/A N/A 185322 185341 TTTATTCTCTATTTTACATT 71 2291
    1249540 N/A N/A 185780 185799 GTGGCTCTAAAATCTTGCTA 38 2292
    1249566 N/A N/A 187837 187856 CTTTATTACATATTTAGGAA 82 2293
    1249592 N/A N/A 189977 189996 TTAAAGGCATTCTTCATAGG 44 2294
    1249618 N/A N/A 192377 192396 GTGATTCTATTCATTATTTA 34 2295
    1249644 N/A N/A 200292 200311 CTTAGCATCATCATAAGTAT 29 2296
    1249670 N/A N/A 200689 200708 ATTTAATCCATTCAACAACC 64 2297
    1249696 N/A N/A 202508 202527 GTTTAAGTTCTAAAATAAAA 99 2298
    1249722 N/A N/A 203161 203180 TCAGTCACTTTAATACTATT 25 2299
    1249748 N/A N/A 203770 203789 TTCCATCTCTCTACATTTCT 26 2300
    1249774 N/A N/A 205535 205554 TTCAGACCTTCCATTTCTCT 27 2301
    1249800 N/A N/A 207030 207049 CGCTTGTTACTCCCTAGGAA 11 2302
    1249826 N/A N/A 208866 208885 ATAATCCTTTACATATATTA 74 2303
    1249852 N/A N/A 210369 210388 TCCATTCTTTCTATTTTCTC 18 2304
    1249878 N/A N/A 213508 213527 CCAGGCATCTCAAATTCAAC 30 2305
    1249904 N/A N/A 216015 216034 ACTTTCTTTAAAATTAACAA 90 2306
    1249930 N/A N/A 221026 221045 AGTCATTTTTCTATTCCATT 11 2307
    1249956 N/A N/A 224726 224745 CTCTTAGTAAATACCAGTTA 26 2308
    1249982 N/A N/A 228460 228479 TTTAAATTCCTCTCTTTACC 74 2309
    1250008 N/A N/A 231424 231443 AAGCAGATAAATATTATACC 47 2310
    1250034 N/A N/A 233839 233858 GTGAAATACTACATTAGTAA 21 2311
    1250060 N/A N/A 235627 235646 TATGGATAATACACCAATAT 26 2312
    235682 235701
    1250086 N/A N/A 237593 237612 TTCTAATTCCAAAAAGAGCA 46 2313
    1250112 N/A N/A 241548 241567 TAGCGAATCAGTGTGAAGAA 34 2314
    1250138 N/A N/A 243124 243143 GTATATATCTTCAAAGGCCT 16 2315
    1250164 N/A N/A 246602 246621 CTTGATTCAAATCAGCAGCA 20 2316
    1250190 N/A N/A 250030 250049 TACTGCATTTCCTTTTTTAA 28 2317
    1250216 N/A N/A 253049 253068 ATAATACATTTCTTTAGATA 72 2318
    1250242 N/A N/A 254373 254392 GTTATGCATTATATAATTTA 64 2319
    1250268 N/A N/A 255845 255864 TTTCTCTATTCTAATTATTT 65 2320
    1250294 N/A N/A 258972 258991 ACCAGGTTTTATAAACTCAC 36 2321
    1250318 N/A N/A 261001 261020 ATAATCTGATTTAATCCTCA 72 2322
  • TABLE 32
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with
    mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A ID
    Compound 1 Start 1 Stop 2 Start 2 Stop (% NO
    Number Site Site Site Site Sequence (5′ to 3′) control)
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 15 227
    1248353 369 388 168914 168933 GGTCTCTTAGCTTTCTCTTC 18 2323
    1248379 784 803 181695 181714 AAGTATTTTAATAAGTGATT 82 2324
    1248405 1227 1246 183574 183593 TTATCCTCAATATATTCATC 68 2325
    1248431 2313 2332 199870 199889 GACCGTCTCTTTCTTATTTC 29 2326
    1248457 2512 2531 204414 204433 AAGGTGTTTCACCTTTAACC 66 2327
    1248483 3429 3448 227423 227442 GTATGGTTGGAAATACAGCT 33 2328
    1248509 3985 4004 243157 243176 TAACATGGTCTTAATGGTTT 49 2329
    1248535 4468 4487 247902 247921 TACTTTCACATTTTTCCACC 29 2330
    1248560 6093 6112 262621 262640 ATGGGTGTTCCATCACATTC 38 2331
    1248586 6630 6649 263158 263177 TGGTGACAATTACTATTATC 39 2332
    1248612 7215 7234 263743 263762 GGATATTTTTATTTTATGCC 24 2333
    1248637 7393 7412 263921 263940 TGGGTAAAATTACTATTTAC 55 2334
    1248663 7515 7534 264043 264062 ATGGAACCAATTACATCATA 41 2335
    1248687 7799 7818 264327 264346 CCATATATTTTAAACAGATT 63 2336
    1248712 8000 8019 264528 264547 CAGAAACCTACACTGCATCC 62 2337
    1248738 8327 8346 264855 264874 AACTGGTAATATAACTTCAC 40 2338
    1248764 8484 8503 265012 265031 AACCTTTATTCTTTTGGCTT 52 2339
    1248790 8648 8667 265176 265195 AACTTCCATTCCATGAAAAA 63 2340
    1248814 8752 8771 265280 265299 GTCAATTTTTTATTAATTTT 82 2341
    1248840 N/A N/A 113976 113995 GGGAAATCCACCTTATCTCT 62 2342
    1248866 N/A N/A 117690 117709 GCAATTTCTTCCTAAGATCA 94 2343
    1248892 N/A N/A 123960 123979 GTTGATTACTCCTTATGGTC 53 2344
    1248918 N/A N/A 127253 127272 CAGTACTTAAAAATATATTA 90 2345
    1248943 N/A N/A 128520 128539 TTTTAATAATTGTTAGGATA 57 2346
    128563 128582
    1248969 N/A N/A 140835 140854 TGGGAATTTTATCATACACT 66 2347
    1248995 N/A N/A 144516 144535 GTCTACTTCCTATTTTCCAT 43 2348
    1249021 N/A N/A 146247 146266 CTTTAATCACCATCTAACTT 82 2349
    1249047 N/A N/A 148586 148605 CTTTCAGTATTTACAATCCA 69 2350
    1249073 N/A N/A 152567 152586 ATCTATTTTATATATAATTA 86 2351
    1249099 N/A N/A 156232 156251 GAACATTTCCAAAATTGAAC 87 2352
    1249125 N/A N/A 162139 162158 TAGAAATAAATTTATACTAA 59 2353
    1249151 N/A N/A 165997 166016 ATTTAAGTCACTAAAAAGCA 111 2354
    1249177 N/A N/A 170466 170485 GAGTTTACTCCCTTACCTAA 41 2355
    1249203 N/A N/A 171897 171916 AATCTCTGACTTACTAGTCA 39 2356
    1249229 N/A N/A 172641 172660 ACTACAGCATCTATATACCT 44 2357
    1249255 N/A N/A 174417 174436 ATTTTCCTACCATTTTCAAA 75 2358
    1249281 N/A N/A 175601 175620 ATACAGTCATTATCCACTAA 53 2359
    1249307 N/A N/A 176882 176901 TAATTATTTTCTAATTAGTC 79 2360
    1249333 N/A N/A 177770 177789 GCATTATCCCCATTTGGATA 41 2361
    1249359 N/A N/A 178353 178372 TCTGAATTCCACATACTTGA 46 2362
    1249385 N/A N/A 179785 179804 AATGATCACATTACTTACAC 47 2363
    1249411 N/A N/A 180476 180495 GGCAAAAATTCAACAAGACA 36 2364
    1249437 N/A N/A 181443 181462 GCATTTTCCACATTAATTAA 30 2365
    1249463 N/A N/A 183697 183716 AAATCATCTTAAATTAGTCT 87 2366
    1249489 N/A N/A 184042 184061 ATTCTTATTTCATCTTGATA 54 2367
    1249515 N/A N/A 185324 185343 GCTTTATTCTCTATTTTACA 25 2368
    1249541 N/A N/A 185841 185860 GGTATTAGCTACTAATGTCC 41 2369
    1249567 N/A N/A 187845 187864 ACTTTGACCTTTATTACATA 37 2370
    1249593 N/A N/A 190062 190081 TCTATATTATAAAAAGGTAA 150 2371
    1249619 N/A N/A 192381 192400 TTATGTGATTCTATTCATTA 99 2372
    1249645 N/A N/A 200310 200329 TTAATATAATCCAAATGGCT 56 2373
    1249671 N/A N/A 200697 200716 GAAGGCTTATTTAATCCATT 30 2374
    1249697 N/A N/A 202643 202662 TGCCAGCTGTCATTTAGCAA 38 2375
    1249723 N/A N/A 203163 203182 AGTCAGTCACTTTAATACTA 38 2376
    1249749 N/A N/A 203773 203792 AAGTTCCATCTCTCTACATT 33 2377
    1249775 N/A N/A 205663 205682 AAGAAATTCTTACATAGCTC 39 2378
    1249801 N/A N/A 207058 207077 GTCTATTACTTCTTGAGTCA 33 2379
    1249827 N/A N/A 208871 208890 TTATAATAATCCTTTACATA 69 2380
    1249853 N/A N/A 210376 210395 GCTCTGTTCCATTCTTTCTA 38 2381
    1249879 N/A N/A 213542 213561 GCCTATTCAATACCTACATT 72 2382
    1249905 N/A N/A 216017 216036 ATACTTTCTTTAAAATTAAC 111 2383
    1249931 N/A N/A 221909 221928 AGAGGATTTTCTCCTTGCCT 42 2384
    1249957 N/A N/A 224770 224789 CAGATCATAATAACAATAAA 94 2385
    1249983 N/A N/A 228556 228575 ATCTTTGTTTTTCCTTGTTA 27 2386
    1250009 N/A N/A 231442 231461 GCCATTTTCCCTAAAATGAA 41 2387
    1250035 N/A N/A 233992 234011 TTTAAGGTCATAATTACGAT 36 2388
    1250061 N/A N/A 235628 235647 ATATGGATAATACACCAATA 47 2389
    1250087 N/A N/A 237601 237620 CTATAATTTTCTAATTCCAA 62 2390
    1250113 N/A N/A 241550 241569 AATAGCGAATCAGTGTGAAG 42 2391
    1250139 N/A N/A 243457 243476 TATATGTATTTAAATTGGTA 94 2392
    1250165 N/A N/A 246605 246624 AATCTTGATTCAAATCAGCA 30 2393
    1250191 N/A N/A 250041 250060 ACAATATATTCTACTGCATT 48 2394
    1250217 N/A N/A 253122 253141 TTAACTATATTAACATATAA 96 2395
    1250243 N/A N/A 254524 254543 GAACATTTAATATTTTCACA 64 2396
    1250269 N/A N/A 255848 255867 TTTTTTCTCTATTCTAATTA 104 2397
    1250295 N/A N/A 259097 259116 ACAATGTTCTATTCTATTAA 64 2398
    1250319 N/A N/A 261296 261315 TTTATATGTCCAAAATACTA 89 2399
  • TABLE 33
    Reduction of SCN2A RNA by 5-10-5 MOE gapmers with
    mixed PO/PS internucleoside linkages
    at 4000 nM concentration in SH-SY5Y cells
    SEQ SEQ SEQ SEQ
    ID NO: ID NO: ID NO: ID NO: SCN2A SEQ
    Compound 1 Start 1 Stop 2 Start 2 Stop (% ID
    Number Site Site Site Site Sequence (5′ to 3′) control) NO
     910263 N/A N/A 180777 180796 GCACTACCATGCCTTCACCA 29  227
    1248354 371 390 168916 168935 TGGGTCTCTTAGCTTTCTCT 21 2400
    1248380 786 805 181697 181716 GCAAGTATTTTAATAAGTGA 30 2401
    1248406 1228 1247 183575 183594 TTTATCCTCAATATATTCAT 27 2402
    1248432 2317 2336 199874 199893 ACTGGACCGTCTCTTTCTTA 38 2403
    1248458 2513 2532 204415 204434 CAAGGTGTTTCACCTTTAAC 54 2404
    1248484 3431 3450 227425 227444 TGGTATGGTTGGAAATACAG 24 2405
    1248510 3994 4013 243166 243185 AGCATATTCTAACATGGTCT 15 2406
    1248536 4503 4522 247937 247956 AGAGACAGATATCCAAGTCC 33 2407
    1248561 6135 6154 262663 262682 GTTGAATTCTCATTCAGTTT 44 2408
    1248587 6825 6844 263353 263372 AAATATATCCAGTTATACAA 53 2409
    1248613 7216 7235 263744 263763 AGGATATTTTTATTTTATGC 29 2410
    1248638 7394 7413 263922 263941 CTGGGTAAAATTACTATTTA 51 2411
    1248664 7517 7536 264045 264064 TAATGGAACCAATTACATCA 37 2412
    1248688 7800 7819 264328 264347 ACCATATATTTTAAACAGAT 51 2413
    1248713 8002 8021 264530 264549 AGCAGAAACCTACACTGCAT 53 2414
    1248739 8328 8347 264856 264875 TAACTGGTAATATAACTTCA 43 2415
    1248765 8485 8504 265013 265032 AAACCTTTATTCTTTTGGCT 38 2416
    1248791 8650 8669 265178 265197 TTAACTTCCATTCCATGAAA 64 2417
    1248815 8754 8773 265282 265301 TAGTCAATTTTTTATTAATT 94 2418
    1248841 N/A N/A 114398 114417 ACAATCTTTTCTATTAGGTA 52 2419
    1248867 N/A N/A 117733 117752 AAACTATAAAAATAATCTAA 71 2420
    1248893 N/A N/A 123985 124004 ATTATATTAAATCATATTTT 65 2421
    1248919 N/A N/A 127286 127305 AATAAGATCCAAAATAGTAA 88 2422
    1248944 N/A N/A 128521 128540 ATTTTAATAATTGTTAGGAT 108 2423
    128564 128583
    1248970 N/A N/A 141313 141332 ATTATCTTTTTTATATGCCC 61 2424
    1248996 N/A N/A 144674 144693 TAGAAATATTCTACATCTTA 71 2425
    1249022 N/A N/A 146255 146274 ATTCAACTCTTTAATCACCA 59 2426
    1249048 N/A N/A 149090 149109 TCTTACTCTCCTACTTTCTA 62 2427
    1249074 N/A N/A 152570 152589 TCCATCTATTTTATATATAA 64 2428
    1249100 N/A N/A 156409 156428 CATCTCTCCTCATATTCATT 60 2429
    1249126 N/A N/A 162345 162364 ATACTCTTTTCCTTTAGTTT 69 2430
    1249152 N/A N/A 166019 166038 ACACCAATCTTATTTATCTC 54 2431
    1249178 N/A N/A 170511 170530 TATTTATTTTCCAAATGTAA 43 2432
    1249204 N/A N/A 171907 171926 CTGATTCTCTAATCTCTGAC 26 2433
    1249230 N/A N/A 172642 172661 AACTACAGCATCTATATACC 43 2434
    1249256 N/A N/A 174418 174437 CATTTTCCTACCATTTTCAA 66 2435
    1249282 N/A N/A 175698 175717 GATACATCCCTTACCAGCCA 27 2436
    1249308 N/A N/A 176888 176907 GAGAAATAATTATTTTCTAA 53 2437
    1249334 N/A N/A 177771 177790 TGCATTATCCCCATTTGGAT 33 2438
    1249360 N/A N/A 178407 178426 TAACCATTATATACCCACCA 48 2439
    1249386 N/A N/A 179788 179807 ATAAATGATCACATTACTTA 55 2440
    1249412 N/A N/A 180491 180510 ACATATGTAAACCCTGGCAA 50 2441
    1249438 N/A N/A 181444 181463 TGCATTTTCCACATTAATTA 24 2442
    1249464 N/A N/A 183698 183717 TAAATCATCTTAAATTAGTC 68 2443
    1249490 N/A N/A 184276 184295 TTTATATTCACATACAAACA 78 2444
    1249516 N/A N/A 185362 185381 CTTAAGAATTCTATTAAGCT 49 2445
    1249542 N/A N/A 185943 185962 ATCAATTGATTTACTTATCA 83 2446
    1249568 N/A N/A 188039 188058 GTCTGAATTATTAAATGTAA 54 2447
    1249594 N/A N/A 190063 190082 GTCTATATTATAAAAAGGTA 32 2448
    1249620 N/A N/A 192453 192472 AGCTAAAGAATTACTTTTTC 41 2449
    1249646 N/A N/A 200315 200334 AGCAGTTAATATAATCCAAA 27 2450
    1249672 N/A N/A 200750 200769 ATAATATTTATTAACTGTCT 43 2451
    1249698 N/A N/A 202720 202739 TTACAGTAAATAACAAAAAA 91 2452
    1249724 N/A N/A 203194 203213 TTCTTTTTAAATCCATGGCA 29 2453
    1249750 N/A N/A 203776 203795 ACAAAGTTCCATCTCTCTAC 39 2454
    1249776 N/A N/A 205718 205737 CTTTCTTGTTTCAATTGCCA 31 2455
    1249802 N/A N/A 207283 207302 CTGGCATTAATATCAGGGTA 15 2456
    1249828 N/A N/A 208931 208950 TATGTCTATTCAAATATTTT 65 2457
    1249854 N/A N/A 210392 210411 GTTTCTTCAAATATTTGCTC 24 2458
    1249880 N/A N/A 213546 213565 ACCTGCCTATTCAATACCTA 78 2459
    1249906 N/A N/A 216211 216230 AGGTAAATCATCTATAGGAA 27 2460
    1249932 N/A N/A 222126 222145 ATCAAATCTATAACATAATT 83 2461
    1249958 N/A N/A 224957 224976 CTGTGACATTTATATAGCCT 28 2462
    1249984 N/A N/A 229045 229064 TTAGTAATTTTATCAAATAA 65 2463
    1250010 N/A N/A 231465 231484 GGTCAACTCCTAAATAAAGC 21 2464
    1250036 N/A N/A 234115 234134 TTAAAATTACATTCTAGGCA 39 2465
    1250062 N/A N/A 235629 235648 CATATGGATAATACACCAAT 48 2466
    1250088 N/A N/A 237608 237627 ATATATTCTATAATTTTCTA 84 2467
    1250114 N/A N/A 241552 241571 GCAATAGCGAATCAGTGTGA 23 2468
    1250140 N/A N/A 243479 243498 ATTTGATTTTTATCTATGAA 69 2469
    1250166 N/A N/A 246776 246795 CTTTTTAGCCATTTCAGCCT 42 2470
    1250192 N/A N/A 250174 250193 TTATTCTTTTCTAAATGATT 53 2471
    1250218 N/A N/A 253216 253235 GTCAAAACTTTTAAGATTTA 47 2472
    1250244 N/A N/A 254626 254645 GCCTGTTTCATTAATGATTC 51 2473
    1250270 N/A N/A 256686 256705 TGATAGCTCACAAATCCATC 50 2474
    1250296 N/A N/A 259151 259170 CTTAATGCTACCTCATAGCA 53 2475
    260853 260872
    1250320 N/A N/A 261310 261329 AGTACAGAAATTAATTTATA 95 2476
    • Example 2: Effect of Modified Oligonucleotides on Human SCN2A RNA In Vitro, Multiple Doses
  • Modified oligonucleotides selected from Example 1 above were tested at various doses in SH-SY5Y cells. Cultured SH-SY5Y cells at a density of 20,000 cells perwell were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SCN2A RNA levels were measured by quantitative real-time RTPCR. Human SCN2A primer-probe set RTS36041 (described herein in Example 1) was used to measure RNA levels as described above. SCN2A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. 0.0 Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control).
  • The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel.
  • TABLE 34
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 80.0 nM 400.0 nM 2000.0 nM 10000.0 nM (μM)
    909951 126 64 30 8 0.79
    909987 141 88 40 21 1.99
    909981 136 84 50 14 1.95
    909945 109 66 32 13 0.89
    910381 145 86 46 15 1.91
    910279 95 52 31 5 0.71
    909958 92 61 34 20 1.00
    909988 115 54 22 15 0.97
    909946 99 66 46 11 1.23
    910256 77 44 25 12 0.41
    910023 97 73 47 38 2.63
    910376 100 92 70 29 4.23
    910269 54 40 34 30 0.10
    910263 78 61 42 20 0.91
    909947 68 54 27 14 0.41
    910335 84 71 36 18 1.05
    909989 91 70 39 41 1.11
    910329 88 69 49 41 2.82
    910342 78 58 39 15 0.75
  • TABLE 35
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 80.0 nM 400.0 nM 2000.0 nM 10000.0 nM (μM)
    910342 91 60 19 22 0.54
    910258 91 71 32 21 1.14
    910330 95 90 57 22 2.51
    910246 70 40 19 2 0.27
    910366 95 66 32 10 0.93
    910378 80 75 43 29 1.60
    910355 71 58 22 7 0.43
    909955 70 43 15 5 0.27
    909985 83 46 23 26 0.42
    909967 97 88 54 36 3.56
    910265 83 55 22 19 0.63
    910319 82 79 58 30 2.72
    909980 102 64 43 23 1.47
    910015 83 55 27 11 0.61
    909950 84 63 31 12 0.76
    909962 72 63 40 9 0.66
    909956 88 81 46 26 1.85
    910356 80 54 41 21 0.81
    909951 74 52 38 12 0.54
  • TABLE 36
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 99 65 38 20 0.84
    1248511 101 61 31 26 0.80
    1249205 75 60 35 10 0.45
    1248355 76 53 26 16 0.38
    1248485 71 47 27 14 0.30
    1249569 74 68 44 21 0.72
    1249335 82 61 38 20 0.64
    1249257 77 70 41 25 0.78
    1250271 98 94 84 55 >5.0
    1248512 100 83 35 18 0.95
    1249258 84 60 38 14 0.59
    1249284 77 55 33 15 0.45
    1249336 71 57 27 20 0.39
    1249726 80 60 32 23 0.57
    1248356 82 58 33 17 0.53
    1249232 69 55 32 17 0.37
    1250246 91 68 40 17 0.78
    1248486 111 67 51 29 1.35
    1250064 100 68 36 23 0.89
  • TABLE 37
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 108 65 36 22 0.89
    1249337 98 60 30 24 0.74
    1248461 68 55 23 11 0.30
    1248487 75 54 31 19 0.43
    1249675 79 53 25 12 0.39
    1248357 72 66 37 22 0.59
    1249207 79 61 34 15 0.52
    1250065 80 56 38 16 0.53
    1250117 91 79 46 19 1.02
    1249285 98 87 53 26 1.53
    1249390 70 42 34 12 0.27
    1249416 74 46 36 15 0.37
    1248462 73 38 36 12 0.29
    1249338 78 45 29 11 0.35
    1249286 78 62 33 15 0.52
    1249598 87 80 49 24 1.16
    1249728 92 54 25 10 0.49
    1249754 110 63 45 20 0.99
    1248358 115 56 33 12 0.74
  • TABLE 38
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 128 79 33 22 1.13
    1249417 65 41 15 9 0.18
    1249313 76 38 24 7 0.27
    1249729 73 47 18 9 0.28
    1248385 75 61 30 12 0.44
    1249495 92 60 33 16 0.62
    1248489 80 62 28 8 0.46
    1250119 101 81 47 23 1.23
    1249599 87 81 43 18 0.95
    1249755 100 76 48 20 1.12
    1249677 91 72 40 21 0.88
    1249963 90 80 38 24 1.00
    1248359 79 52 33 18 0.46
    1250015 92 87 52 48 3.22
    1248718 89 71 41 34 1.16
    1250146 77 50 28 20 0.40
    1249418 76 45 25 12 0.32
    1250198 115 76 42 24 1.19
    1249444 141 77 36 13 1.08
  • TABLE 39
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 108 69 35 23 0.95
    1249470 91 62 39 16 0.70
    1248593 79 69 41 26 0.82
    1249210 88 74 42 17 0.83
    1249912 89 74 43 23 0.97
    1248976 94 65 43 23 0.91
    1249990 96 65 38 15 0.75
    1249340 95 67 40 14 0.77
    1248542 100 75 53 28 1.42
    1249341 87 70 34 18 0.70
    1249237 86 59 29 18 0.55
    1249445 72 42 27 16 0.28
    1248439 79 50 29 19 0.42
    1249315 89 64 42 21 0.80
    1250199 97 69 45 21 0.97
    1250225 75 57 34 20 0.49
    1249576 107 67 37 20 0.90
    1249602 121 67 35 21 0.99
    1250070 103 64 30 22 0.80
  • TABLE 40
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 102 61 33 22 0.80
    1248466 105 53 32 10 0.62
    1248414 88 69 32 9 0.60
    1250148 89 60 34 11 0.57
    1249316 82 67 35 15 0.61
    1249160 83 66 35 15 0.61
    909602 80 54 34 27 0.56
    1248543 79 60 33 21 0.55
    1248440 83 60 32 21 0.59
    1250226 109 78 47 21 1.20
    1249863 85 61 29 9 0.50
    1249811 92 67 38 21 0.81
    1249161 85 60 42 21 0.72
    1250227 88 70 38 19 0.78
    1248441 78 60 27 16 0.45
    1250149 84 61 31 16 0.56
    1248363 89 73 32 24 0.80
    1249759 124 71 34 16 0.96
    1249291 126 80 50 22 1.38
  • TABLE 41
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 91 57 27 12 0.53
    1249187 102 78 49 19 1.15
    1248519 91 73 44 20 0.94
    1249448 91 71 37 30 0.99
    1249266 80 56 28 13 0.44
    1249344 87 58 27 24 0.59
    1249370 79 67 40 24 0.75
    1249890 80 69 36 21 0.69
    1250021 84 48 25 10 0.39
    1249371 91 77 59 20 1.27
    1249527 89 82 47 17 1.02
    1249163 102 90 61 28 1.89
    1249995 85 61 31 18 0.58
    1249267 86 59 36 21 0.65
    1249164 43 32 13 7 <0.1
    1248366 67 48 23 10 0.25
    1249294 80 53 22 13 0.39
    1249788 111 61 46 15 0.91
    1249710 97 61 47 14 0.80
  • TABLE 42
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 85 58 26 19 0.52
    1249216 99 78 43 13 0.93
    1249528 95 89 56 22 1.45
    1249632 80 82 39 18 0.85
    1250204 77 70 39 18 0.67
    1248522 110 71 43 14 0.95
    1249554 87 71 41 24 0.91
    1249580 73 61 40 20 0.55
    1248368 81 61 23 10 0.44
    1249296 88 47 21 9 0.39
    1248394 89 72 33 13 0.68
    1249842 97 85 48 23 1.28
    1248524 79 55 36 25 0.57
    1248446 90 60 30 24 0.67
    1249452 100 60 29 26 0.78
    1250050 87 54 34 20 0.58
    1249920 81 54 24 19 0.44
    1249712 140 72 37 18 1.12
    1249868 92 58 32 17 0.62
  • TABLE 43
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 96 52 36 24 0.70
    1249998 97 86 66 45 3.89
    1248447 88 63 48 25 0.96
    1249297 84 49 41 13 0.51
    1249167 82 59 30 11 0.48
    1248369 90 50 34 25 0.61
    1249713 N.D. 54 33 10 1.98
    1249401 67 57 37 27 0.47
    1249349 91 83 57 35 2.02
    1248395 97 66 36 25 0.87
    1249427 86 67 51 24 1.01
    1249869 111 103 61 36 2.63
    1249685 72 51 33 17 0.38
    1249711 97 64 51 27 1.15
    1248445 77 62 41 31 0.81
    1249633 71 50 35 16 0.36
    1248523 95 71 40 21 0.91
    1249893 137 83 50 37 1.93
    1249659 90 56 33 13 0.57
  • TABLE 44
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 126 68 29 31 1.11
    1249997 98 85 53 37 2.01
    1249867 88 63 31 18 0.63
    1249529 102 81 51 25 1.37
    1249217 103 87 54 23 1.46
    1249295 76 49 25 18 0.36
    1249269 98 58 31 12 0.62
    1248396 90 67 23 15 0.59
    1249428 87 51 32 15 0.50
    1249298 61 49 29 11 0.23
    1249792 92 53 47 21 0.78
    1249402 102 79 50 41 2.00
    1248370 98 65 25 17 0.67
    1248526 72 45 31 15 0.31
    1249272 73 63 35 14 0.48
    1250234 103 60 38 18 0.80
    1249273 80 36 17 13 0.27
    1250235 90 39 24 14 0.40
    1248371 95 40 28 17 0.47
  • TABLE 45
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 127 79 30 16 1.01
    1249403 85 47 30 17 0.45
    1249377 76 60 37 16 0.51
    1249169 89 63 32 20 0.66
    1248475 96 76 44 19 1.01
    1249429 105 80 54 30 1.60
    1249222 81 42 22 10 0.32
    1249274 76 50 26 13 0.35
    1249170 77 51 31 9 0.38
    1248476 81 67 36 15 0.62
    1248398 91 58 33 22 0.66
    1250236 94 77 44 22 1.04
    1249196 113 83 41 25 1.27
    1249482 87 51 43 23 0.66
    1248372 64 54 30 17 0.30
    1250184 69 72 24 21 0.49
    1249483 76 52 24 23 0.39
    1249639 107 60 34 11 0.71
    1248425 85 56 32 17 0.53
  • TABLE 46
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 112 79 32 9 0.86
    1250081 75 78 45 12 0.73
    1249171 84 70 35 17 0.68
    1249223 84 88 57 25 1.56
    1249613 82 57 31 12 0.47
    1248399 89 75 48 19 0.98
    1249873 80 63 37 25 0.68
    1249484 66 40 20 13 0.19
    1249328 79 72 33 17 0.63
    1250238 80 51 27 12 0.40
    1249588 55 43 14 5 0.13
    1249406 77 63 26 13 0.46
    1249822 84 67 33 14 0.60
    1249536 78 71 37 18 0.66
    1248400 71 54 22 17 0.33
    1249485 46 20 9 7 <0.1
    1249953 73 39 12 8 0.21
    1249251 106 69 29 13 0.76
    1250161 100 62 27 13 0.65
  • TABLE 47
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 93 55 22 9 0.48
    1249225 64 43 23 8 0.20
    1248479 60 48 21 11 0.19
    1249589 91 57 24 8 0.50
    1250005 80 73 38 15 0.68
    1250239 70 60 32 15 0.41
    1248375 70 47 26 7 0.27
    1248376 62 49 21 6 0.21
    1248480 94 59 31 8 0.56
    1250084 68 36 13 4 0.18
    1249278 66 38 18 6 0.18
    1249252 83 55 27 9 0.44
    1249486 77 47 22 9 0.31
    1248350 89 68 41 17 0.78
    1250266 54 35 15 6 0.10
    1250188 68 54 26 5 0.29
    1249304 88 96 23 7 0.73
    1249330 102 67 38 18 0.85
    1249772 107 67 39 16 0.87
  • TABLE 48
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 83 53 31 19 0.49
    1248532 93 94 56 23 1.59
    1249642 108 62 31 17 0.76
    1249408 91 68 31 15 0.66
    1249590 106 72 30 22 0.90
    1249226 110 63 36 14 0.80
    1248429 77 58 26 21 0.46
    1249305 55 41 18 10 0.12
    1248377 96 71 35 16 0.79
    1248533 98 64 42 14 0.79
    1249539 75 66 48 19 0.72
    1248481 77 58 26 15 0.42
    1248534 91 64 34 15 0.66
    1249306 83 59 23 11 0.45
    1249930 82 48 28 11 0.39
    1249800 62 27 16 8 0.11
    1248404 106 86 47 23 1.31
    1248482 122 44 29 9 0.65
    1250138 105 63 28 27 0.84
  • TABLE 49
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 99 61 45 22 0.92
    1248430 90 63 39 9 0.63
    1249852 93 80 48 33 1.52
    1250164 69 61 39 16 0.48
    1250034 115 99 61 51 >5.0
    1248352 96 79 54 39 2.09
    1249462 88 86 50 43 2.48
    1248585 75 55 40 29 0.60
    1249722 115 86 57 23 1.57
    1249956 72 97 58 31 2.17
    1250060 76 82 63 30 1.90
    1248353 82 62 39 29 0.81
    1248612 95 76 55 38 1.96
    1249515 94 69 48 24 1.06
    1249983 70 65 52 31 1.04
    1248431 85 77 51 20 1.04
    1248535 103 88 73 47 >5.0
    1249437 139 72 56 32 1.73
    1249671 99 59 48 24 0.95
  • TABLE 50
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    ID 78.125 nM 313.5 nM 1250.0 nM 5000.0 nM (μM)
    910263 98 55 30 16 0.62
    1250165 103 76 63 30 1.81
    1248483 70 48 31 14 0.32
    1249801 90 73 33 21 0.79
    1249749 61 71 58 27 1.05
    1248510 55 33 25 7 0.10
    1249802 56 35 21 8 0.11
    1248354 74 53 21 15 0.34
    1250010 89 64 45 27 0.96
    1250114 92 86 48 16 1.07
    1249438 79 67 28 18 0.56
    1249854 97 62 41 46 1.56
    1248484 57 39 22 9 0.13
    1249204 66 47 22 12 0.24
    1249282 74 52 28 15 0.36
    1249906 75 73 52 21 0.93
    1248406 97 91 53 26 1.56
    1249646 145 88 48 39 2.02
    910263 114 81 35 27 1.17
    • Example 3: Design of MOE Gapmer Modified Oligonucleotides Complementary to Human SCN2A Nucleic Acid
  • Modified oligonucleotides complementary to a human SCN2A nucleic acid were designed, as described in the tables below. “Start site” in the tables below indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • The modified oligonucleotides in Table 51 are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides and the 5′ and 3′ wing segments each consists of five 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • TABLE 51
    5-10-5 MOE gapmers with mixed PO/PS internucleoside
    linkages complementary to human SCN2A
    SEQ ID SEQ ID SEQ ID SEQ ID SEQ
    Compound NO: 1 NO: 1 NO: 2 NO: 2 ID
    ID SEQUENCE (5′ to 3′) Start Site Stop Site Start Site Stop Site NO.
    1348240 GACCGAATTCTATTTTATAA N/A N/A 229460 229479 2477
    1348241 ACCGAATTCTATTTTATAAA N/A N/A 229459 229478 2478
    1348242 CCGAATTCTATTTTATAAAT N/A N/A 229458 229477 2479
    1348243 CGAATTCTATTTTATAAATG N/A N/A 229457 229476 2480
    1348244 GAATTCTATTTTATAAATGC N/A N/A 229456 229475 2481
    1348245 AATTCTATTTTATAAATGCC N/A N/A 229455 229474 2482
    1348248 ATGTAACCTTTATACATTTA N/A N/A 243913 243932 2483
    1348250 ATTCTGCATGTAACCTTTAT N/A N/A 243920 243939 2484
    1348251 TTCTGCATGTAACCTTTATA N/A N/A 243919 243938 2485
    1348252 TGCATGTAACCTTTATACAT N/A N/A 243916 243935 2486
    1348253 TCTGCATGTAACCTTTATAC N/A N/A 243918 243937 2487
    1348254 CATGTAACCTTTATACATTT N/A N/A 243914 243933 2488
    1348255 GCATGTAACCTTTATACATT N/A N/A 243915 243934 2489
    1348256 TGTAACCTTTATACATTTAA N/A N/A 243912 243931 2490
    1348257 GTAACCTTTATACATTTAAT N/A N/A 243911 243930 2491
    1348258 CCAGTTTTTTCATTGCATCC N/A N/A 255533 255552 2492
    1348259 GCATAATCCCATTATACAAA N/A N/A 244051 244070 2493
    1348263 ATCATGCATAATCCCATTAT N/A N/A 244056 244075 2494
    1348264 TCATGCATAATCCCATTATA N/A N/A 244055 244074 2495
    1348265 CATAATCCCATTATACAAAT N/A N/A 244050 244069 2496
    1348266 TGCATAATCCCATTATACAA N/A N/A 244052 244071 2497
    1348267 CATGCATAATCCCATTATAC N/A N/A 244054 244073 2498
    1348328 TCTTTCTTATTTCTGTTTCA 2306 2325 199863 199882 2499
    1348343 CTCTTTCTTATTTCTGTTTC 2307 2326 199864 199883 2500
    1348378 TGGACCGTCTCTTTCTTATT 2315 2334 199872 199891 2501
    1348380 CTGGACCGTCTCTTTCTTAT 2316 2335 199873 199892 2502
    1348396 CACGCTTACATCAAACATCT 4396 4415 247830 247849 2503
    1348405 TATTTTTCTACACTGCTGCC 3513 3532 227507 227526 2504
    1348411 ATATTTTTCTACACTGCTGC 3514 3533 227508 227527 2505
    1348423 CATATTTTTCTACACTGCTG 3515 3534 227509 227528 2506
    1348439 ATGTAATCACTTTCATCCAC 3537 3556 227531 227550 2507
    1348440 AATCACTTTCATCCACGACA 3533 3552 227527 227546 2508
    1348441 TAATCACTTTCATCCACGAC 3534 3553 227528 227547 2509
    1348442 CCACGACATATTTTTCTACA 3521 3540 227515 227534 2510
    1348443 ATCACTTTCATCCACGACAT 3532 3551 227526 227545 2511
    1348444 ACGACATATTTTTCTACACT 3519 3538 227513 227532 2512
    1348446 TCCACGACATATTTTTCTAC 3522 3541 227516 227535 2513
    1348447 CACGACATATTTTTCTACAC 3520 3539 227514 227533 2514
    1348448 GCATGTTTATCTTAGTTCTA N/A N/A 224196 224215 2515
    1348449 CCATTTCTATAACTCAGCAA N/A N/A 180685 180704 2516
    1348450 TTGACCACGCTTACATCAAA 4401 4420 247835 247854 2517
    1348451 AGCATGTTTATCTTAGTTCT N/A N/A 224197 224216 2518
    1348453 CATTTCTATAACTCAGCAAC N/A N/A 180684 180703 2519
    1348455 ATTTCTATAACTCAGCAACC N/A N/A 180683 180702 2520
    1348456 CATGTAATCACTTTCATCCA 3538 3557 227532 227551 2521
  • The modified oligonucleotides in Table 52 below are 6-10-4 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, the 5′ wing segment consists of six 2′-MOE nucleosides, and the 3′ wing segment consists of four 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddddeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooooossssssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • TABLE 52
    6-10-4 MOE gapmers with mixed PO/PS internucleoside
    inkages complementary to human SCN2A
    SEQ ID SEQ ID SEQ ID SEQ ID SEQ
    Compound NO: 1 NO: 1 NO: 2 NO: 2 ID
    ID SEQUENCE (5′ to 3′) Start Site Stop Site Start Site Stop Site NO.
    1348269 CACGCTTACATCAAACATCT 4396 4415 247830 247849 2503
    1348270 TGACCACGCTTACATCAAAC 4400 4419 247834 247853 2522
    1348271 GACCACGCTTACATCAAACA 4399 4418 247833 247852 29
    1348275 ACCACGCTTACATCAAACAT 4398 4417 247832 247851 2025
    1348277 CCACGCTTACATCAAACATC 4397 4416 247831 247850 419
    1348279 GACCGTCTCTTTCTTATTTC 2313 2332 199870 199889 2326
    1348282 CTCTTTCTTATTTCTGTTTC 2307 2326 199864 199883 2500
    1348286 GTCTCTTTCTTATTTCTGTT 2309 2328 199866 199885 2097
    1348289 CACGACATATTTTTCTACAC 3520 3539 227514 227533 2514
    1348290 CCACGACATATTTTTCTACA 3521 3540 227515 227534 2510
    1348291 ACGACATATTTTTCTACACT 3519 3538 227513 227532 2512
    1348292 ACATATTTTTCTACACTGCT 3516 3535 227510 227529 643
    1348295 ATATTTTTCTACACTGCTGC 3514 3533 227508 227527 2505
    1348297 TGGACCGTCTCTTTCTTATT 2315 2334 199872 199891 2501
    1348298 AATCACTTTCATCCACGACA 3533 3552 227527 227546 2508
    1348299 CAGCATATTCTAACATGGTC 3995 4014 243167 243186 491
    1348300 ATTTCTATAACTCAGCAACC N/A N/A 180683 180702 2520
    1348302 ATGTAATCACTTTCATCCAC 3537 3556 227531 227550 2507
    1348303 CATGTAATCACTTTCATCCA 3538 3557 227532 227551 2521
    1348304 TCCACGACATATTTTTCTAC 3522 3541 227516 227535 2513
    1348306 TAATCACTTTCATCCACGAC 3534 3553 227528 227547 2509
    1348307 ATCACTTTCATCCACGACAT 3532 3551 227526 227545 2511
    1348308 CCATTTCTATAACTCAGCAA N/A N/A 180685 180704 2516
    1348309 TCAGCATGTTTATCTTAGTT N/A N/A 224199 224218 2523
    1348310 CAGCATGTTTATCTTAGTTC N/A N/A 224198 224217 2079
    1348311 AGCATGTTTATCTTAGTTCT N/A N/A 224197 224216 2518
    1348312 GCATGTTTATCTTAGTTCTA N/A N/A 224196 224215 2515
    1348313 TGCCATTTCTATAACTCAGC N/A N/A 180687 180706 2524
    1348315 CATTTCTATAACTCAGCAAC N/A N/A 180684 180703 2519
    1348316 TTTGCCATTTCTATAACTCA N/A N/A 180689 180708 909
    1348319 GTAACCTTTATACATTTAAT N/A N/A 243911 243930 2491
    1348320 GACCGAATTCTATTTTATAA N/A N/A 229460 229479 2477
    1348321 CCGAATTCTATTTTATAAAT N/A N/A 229458 229477 2479
    1348322 ACCGAATTCTATTTTATAAA N/A N/A 229459 229478 2478
    1348323 GAATTCTATTTTATAAATGC N/A N/A 229456 229475 2481
    1348324 CGAATTCTATTTTATAAATG N/A N/A 229457 229476 2480
    1348325 AATTCTATTTTATAAATGCC N/A N/A 229455 229474 2482
    1348326 TTCTATTTTATAAATGCCGA N/A N/A 229453 229472 854
    1348327 ATTCTATTTTATAAATGCCG N/A N/A 229454 229473 931
    1348329 GCATGTAACCTTTATACATT N/A N/A 243915 243934 2489
    1348331 TCTGCATGTAACCTTTATAC N/A N/A 243918 243937 2487
    1348332 TTCTGCATGTAACCTTTATA N/A N/A 243919 243938 2485
    1348333 CTGCATGTAACCTTTATACA N/A N/A 243917 243936 1090
    1348334 TGCATGTAACCTTTATACAT N/A N/A 243916 243935 2486
    1348335 ATGTAACCTTTATACATTTA N/A N/A 243913 243932 2483
    1348336 TGTAACCTTTATACATTTAA N/A N/A 243912 243931 2490
    1348337 CATGTAACCTTTATACATTT N/A N/A 243914 243933 2488
    1348338 TGCATAATCCCATTATACAA N/A N/A 244052 244071 2497
    1348340 ATCATGCATAATCCCATTAT N/A N/A 244056 244075 2494
    1348341 TCATGCATAATCCCATTATA N/A N/A 244055 244074 2495
    1348342 CATGCATAATCCCATTATAC N/A N/A 244054 244073 2498
    1348344 ATGCATAATCCCATTATACA N/A N/A 244053 244072 1166
    1348345 CATAATCCCATTATACAAAT N/A N/A 244050 244069 2496
    1348347 GCATAATCCCATTATACAAA N/A N/A 244051 244070 2493
  • The modified oligonucleotides in Table 53 below are 4-10-6 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, the 5′ wing segment consists of four 2′-MOE nucleosides, and the 3′ wing segment consists of six 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeddddddddddeeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooossssssssssoooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • TABLE 53
    4-10-6 MOE gapmers with mixed PO/PS
    internucleoside linkages
    complementary to human SCN2A
    SEQ SEQ SEQ SEQ
    ID ID ID ID
    NO: NO: NO: NO:
    1 1 2 2 SEQ
    Compound SEQUENCE Start  Stop Start  Stop ID
    ID (5′ to 3′) Site Site Site Site NO.
    1348348 CACGCTTACA 4396 4415 247830 247849 2503
    TCAAACATCT
    1348350 TTTGGGCCAT 411 430 168956 168975 2525
    TTTCATCATC
    1348353 GACCACGCTT 4399 4418 247833 247852 29
    ACATCAAACA
    1348355 CCACGCTTAC 4397 4416 247831 247850 419
    ATCAAACATC
    1348356 ACCACGCTTA 4398 4417 247832 247851 2025
    CATCAAACAT
    1348358 TCTCTTTCTT 2308 2327 199865 199884 2021
    ATTTCTGTTT
    1348360 GGACCGTCTC 2314 2333 199871 199890 2526
    TTTCTTATTT
    1348361 CTGGACCGTC 2316 2335 199873 199892 2502
    TCTTTCTTAT
    1348362 GACCGTCTCT 2313 2332 199870 199889 2326
    TTCTTATTTC
    1348364 CGTCTCTTTC 2310 2329 199867 199886 2174
    TTATTTCTGT
    1348365 CTCTTTCTTA 2307 2326 199864 199883 2500
    TTTCTGTTTC
    1348366 TCTTTCTTAT 2306 2325 199863 199882 2499
    TTCTGTTTCA
    1348367 GTCTCTTTCT 2309 2328 199866 199885 2097
    TATTTCTGTT
    1348369 CCACGACATA 3521 3540 227515 227534 2510
    TTTTTCTACA
    1348370 CACGACATAT 3520 3539 227514 227533 2514
    TTTTCTACAC
    1348371 ACGACATATT 3519 3538 227513 227532 2512
    TTTCTACACT
    1348373 GACATATTTT 3517 3536 227511 227530 720
    TCTACACTGC
    1348374 CATATTTTTC 3515 3534 227509 227528 2506
    TACACTGCTG
    1348375 TATTTTTCTA 3513 3532 227507 227526 2504
    CACTGCTGCC
    1348376 ACATATTTTT 3516 3535 227510 227529 643
    CTACACTGCT
    1348377 ATATTTTTCT 3514 3533 227508 227527 2505
    ACACTGCTGC
    1348379 GCATATTCTA 3993 4012 243165 243184 2527
    ACATGGTCTT
    1348381 TAATCACTTT 3534 3553 227528 227547 2509
    CATCCACGAC
    1348382 CATGTAATCA 3538 3557 227532 227551 2521
    CTTTCATCCA
    1348383 GTAATCACTT 3535 3554 227529 227548 796
    TCATCCACGA
    1348384 ATGTAATCAC 3537 3556 227531 227550 2507
    TTTCATCCAC
    1348385 ATCACTTTCA 3532 3551 227526 227545 2511
    TCCACGACAT
    1348386 AATCACTTTC 3533 3552 227527 227546 2508
    ATCCACGACA
    1348387 TCCACGACAT 3522 3541 227516 227535 2513
    ATTTTTCTAC
    1348388 CAGCATATTC 3995 4014 243167 243186 491
    TAACATGGTC
    1348392 CCATTTCTAT N/A N/A 180685 180704 2516
    AACTCAGCAA
    1348393 GCCATTTCTA N/A N/A 180686 180705 832
    TAACTCAGCA
    1348394 CATTTCTATA N/A N/A 180684 180703 2519
    ACTCAGCAAC
    1348395 ATTTCTATAA N/A N/A 180683 180702 2520
    CTCAGCAACC
    1348397 AGCATATTCT 3994 4013 243166 243185 2406
    AACATGGTCT
    1348399 CAGCATGTTT N/A N/A 224198 224217 2079
    ATCTTAGTTC
    1348403 TCAGCATGTT N/A N/A 224199 224218 2523
    TATCTTAGTT
    1348404 GCATGTTTAT N/A N/A 224196 224215 2515
    CTTAGTTCTA
    1348406 TATTTTATAA N/A N/A 229450 229469 2528
    ATGCCGACTT
    1348407 AGCATGTTTA N/A N/A 224197 224216 2518
    TCTTAGTTCT
    1348408 CCGAATTCTA N/A N/A 229458 229477 2479
    TTTTATAAAT
    1348410 ATTCTATTTT N/A N/A 229454 229473 931
    ATAAATGCCG
    1348412 GTAACCTTTA N/A N/A 243911 243930 2491
    TACATTTAAT
    1348413 GACCGAATTC N/A N/A 229460 229479 2477
    TATTTTATAA
    1348414 CGAATTCTAT N/A N/A 229457 229476 2480
    TTTATAAATG
    1348415 GAATTCTATT N/A N/A 229456 229475 2481
    TTATAAATGC
    1348416 AATTCTATTT N/A N/A 229455 229474 2482
    TATAAATGCC
    1348417 TTCTATTTTA N/A N/A 229453 229472 854
    TAAATGCCGA
    1348418 GCATGTAACC N/A N/A 243915 243934 2489
    TTTATACATT
    1348419 CATAATCCCA N/A N/A 244050 244069 2496
    TTATACAAAT
    1348420 TTCTGCATGT N/A N/A 243919 243938 2485
    AACCTTTATA
    1348421 TCTGCATGTA N/A N/A 243918 243937 2487
    ACCTTTATAC
    1348422 TGCATGTAAC N/A N/A 243916 243935 2486
    CTTTATACAT
    1348424 ATGTAACCTT N/A N/A 243913 243932 2483
    TATACATTTA
    1348425 CATGTAACCT N/A N/A 243914 243933 2488
    TTATACATTT
    1348426 TGTAACCTTT N/A N/A 243912 243931 2490
    ATACATTTAA
    1348427 CTGCATGTAA N/A N/A 243917 243936 1090
    CCTTTATACA
    1348428 GCATAATCCC N/A N/A 244051 244070 2493
    ATTATACAAA
    1348429 GTTTTTTCAT N/A N/A 255530 255549 2529
    TGCATCCTCC
    1348430 AGTTTTTTCA N/A N/A 255531 255550 2530
    TTGCATCCTC
    1348433 ATCATGCATA N/A N/A 244056 244075 2494
    ATCCCATTAT
    1348434 TCATGCATAA N/A N/A 244055 244074 2495
    TCCCATTATA
    1348435 TGCATAATCC N/A N/A 244052 244071 2497
    CATTATACAA
    1348436 ATGCATAATC N/A N/A 244053 244072 1166
    CCATTATACA
    1348437 CATGCATAAT N/A N/A 244054 244073 2498
    CCCATTATAC
    1348438 CCAGTTTTTT N/A N/A 255533 255552 2492
    CATTGCATCC
    1348445 CAGTTTTTTC N/A N/A 255532 255551 2531
    ATTGCATCCT
  • The modified oligonucleotides in Table 54 below are 4-8-6 MOE gapmers. The gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′-β-D-deoxynucleosides, the 5′ wing segment consists of four 2′-MOE nucleosides, and the 3′ wing segment consists of six 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeddddddddeeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soosssssssssoooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • TABLE 54
    4-8-6 MOE gapmers with mixed PO/PS
    internucleoside linkages
    complementary to human SCN2A
    SEQ SEQ SEQ SEQ
    ID ID ID ID
    NO: NO: NO: NO:
    1 1 2 2 SEQ
    Compound SEQUENCE Start Stop Start Stop ID
    ID (5′ to 3′) Site Site Site Site NO.
    1348917 CTATTTTAT N/A N/A 229453 229470 2532
    AAATGCCGA
    1348920 TCTGCATGT N/A N/A 243920 243937 2533
    AACCTTTAT
    1348922 CTGCATGTA N/A N/A 243919 243936 2534
    ACCTTTATA
    1348923 TGCATGTAA N/A N/A 243918 243935 2535
    CCTTTATAC
    1348924 TCTATTTTA N/A N/A 229454 229471 2536
    TAAATGCCG
    1348925 GCATGTAAC N/A N/A 243917 243934 2537
    CTTTATACA
    1348926 CATGTAACC N/A N/A 243916 243933 2538
    TTTATACAT
  • The modified oligonucleotides in Table 55 below are 6-8-4 MOE gapmers. The gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′-β-D-deoxynucleosides, the 5′ wing segment consists of six 2′-MOE nucleosides, and the 3′ wing segment consists of four 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddeeee; wherein ‘d’ represents a 2′-N-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooosssssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • TABLE 55 
    6-8-4 MOE gapmers with mixed PO/PS
    internucleoside linkages
    complementary to human SCN2A
    SEQ SEQ SEQ SEQ
    ID ID ID ID
    NO: NO: NO: NO:
    1 1 2 2 SEQ
    Compound SEQUENCE Start Stop Start Stop ID
    ID (5′ to 3′) Site Site Site Site NO.
    1348918 CATGTAACC N/A N/A 243916 243933 2538
    TTTATACAT
    1348919 TCTATTTTA N/A N/A 229454 229471 2536
    TAAATGCCG
    1348927 GCATGTAAC N/A N/A 243917 243934 2537
    CTTTATACA
    1348931 CTGCATGTA N/A N/A 243919 243936 2534
    ACCTTTATA
    1348934 TCTGCATGT N/A N/A 243920 243937 2533
    AACCTTTAT
    1348935 TGCATGTAA N/A N/A 243918 243935 2535
    CCTTTATAC
    1348936 ACCCAGTTT 4776 4793 254144 254161 2539
    TTTCATTGC
  • The modified oligonucleotides in Table 56 below are 5-8-5 MOE gapmers. The gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′-β-D-deoxynucleosides, the 5′ wing segment consists of five 2′-MOE nucleosides, and the 3′ wing segment consists of five 2′-MOE nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooosssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.
  • TABLE 56 
    5-8-5 MOE gapmers with mixed PO/PS
    internucleoside linkages
    complementary to human SCN2A
    SEQ SEQ SEQ SEQ
    ID ID ID ID
    NO: NO: NO: NO: SEQ
    Compound SEQUENCE Start Stop Start Stop ID
    ID (5′ to 3′) Site Site Site Site NO.
    1348928 GCATGTAAC N/A N/A 243917 243934 2537
    CTTTATACA
    1348929 TGCATGTAA N/A N/A 243918 243935 2535
    CCTTTATAC
    1348930 CATGTAACC N/A N/A 243916 243933 2538
    TTTATACAT
    1348932 TCTATTTTA N/A N/A 229454 229471 2536
    TAAATGCCG
    1348933 CTATTTTAT N/A N/A 229453 229470 2532
    AAATGCCGA
    1348937 CTGCATGTA N/A N/A 243919 243936 2534
    ACCTTTATA
    1348938 TCTGCATGT N/A N/A 243920 243937 2533
    AACCTTTAT
    1348939 ACCCAGTTT 4776 4793 254144 254161 2539
    TTTCATTGC 255537 255554
    • Example 4: Tolerability of Modified Oligonucleotides Complementary to Human SCN2A in Wild-Type Mice, 3 Hour Study
  • Modified oligonucleotides described above were tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides. Additionally, Comparator Compound No. 1506060 was tested. Wild-type female C57/B16 mice each received a single ICV dose of 700 μg of modified oligonucleotide as listed in the tables below. Each treatment group consisted of 3 mice. A group of 4 mice received PBS as a negative control for each experiment (identified in separate tables below). At 3 hours post-injection, mice were evaluated according to seven different criteria. The criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing. For each of the 7 criteria, a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group.
  • TABLE 57
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1248353 4.00
    1248354 1.33
    1248355 2.67
    1248356 3.33
    1248357 2.33
    1248358 2.67
    1248366 0.00
    1248368 1.00
    1248369 1.33
    1248396 0.00
    1248398 1.67
    1248400 4.00
    1248414 0.67
    1248425 0.33
    1248430 7.00
    1248439 1.00
    1248440 0.67
    1248441 1.33
    1248461 2.00
    1248462 1.33
    1248466 1.00
    1248476 1.00
    1248481 1.00
    1248487 0.00
  • TABLE 58
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1248429 1.00
    1249990 1.00
    1250148 0.00
    1250225 0.00
  • TABLE 59
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    910009 0.00
    1248427 0.00
    1248428 1.00
    1248431 0.00
    1248488 1.67
    1248531 0.33
    1249989 0.00
    1348240 1.00
    1348241 1.67
    1348242 0.67
    1348243 1.67
    1348244 1.00
    1348245 0.00
    1348248 0.00
    1348250 3.00
    1348251 1.00
    1348252 1.00
    1348253 0.00
    1348254 0.00
    1348255 0.00
    1348256 0.00
    1348257 0.33
    1348258 1.33
    1348259 1.00
    1348263 0.00
    1348264 0.00
    1348265 0.00
    1348266 0.00
    1348267 0.00
    1348269 0.00
    1348270 1.00
    1348271 0.00
    1348275 0.00
    1348277 0.00
    1348279 0.00
  • TABLE 60
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348282 1.00
    1348286 1.00
    1348289 1.00
    1348290 0.00
    1348291 0.00
    1348292 0.00
    1348295 2.00
    1348297 0.00
    1348298 0.00
    1348299 0.00
    1348300 1.00
    1348302 0.00
    1348303 0.00
    1348304 0.00
    1348306 0.00
    1348307 0.00
    1348308 0.00
    1348309 0.00
    1348310 0.00
    1348311 1.00
    1348312 1.67
    1348313 0.00
    1348316 0.00
    1348319 0.00
    1348320 0.00
    1348321 0.00
    1348322 1.67
    1348323 1.00
    1348324 2.33
    1348325 0.33
    1348326 3.00
    1348327 2.00
    1348376 0.33
    1348377 1.00
    1348378 1.00
    1348379 1.67
    1348380 1.00
    1348381 0.00
    1348382 0.00
    1348383 2.00
    1348384 0.33
    1348385 1.00
    1348386 0.33
    1348387 0.00
    1348388 0.00
  • TABLE 61
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348328 1.67
    1348329 0.00
    1348331 0.00
    1348332 0.00
    1348333 0.00
    1348334 0.00
    1348335 0.00
    1348336 0.00
    1348337 0.00
    1348338 0.00
    1348340 0.00
    1348341 0.00
    1348342 0.00
    1348343 0.00
    1348344 0.00
    1348345 0.00
    1348347 0.00
    1348348 0.00
    1348350 0.00
    1348353 4.00
    1348355 0.00
    1348356 0.00
    1348358 0.00
    1348360 1.00
    1348361 1.00
    1348362 0.00
  • TABLE 62
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348364 1.00
    1348365 0.00
    1348366 0.00
    1348367 0.00
    1348369 1.00
    1348370 0.00
    1348371 0.00
    1348373 1.00
    1348374 2.00
    1348375 0.00
    1348392 0.00
    1348393 0.00
    1348394 0.00
    1348395 0.00
    1348396 0.00
    1348397 0.00
    1348399 0.00
    1348424 0.00
    1348425 0.00
    1348426 0.00
    1348427 0.00
    1348428 0.00
    1348429 1.00
    1348430 3.00
    1348433 1.00
    1348434 0.00
    1348435 0.00
    1348436 0.00
    1348437 0.00
    1348438 0.00
    1348448 1.00
    1348449 0.00
    1348450 2.00
    1348451 0.00
    1348453 0.00
    1348455 0.00
    1348456 0.00
    1348917 0.00
    1348918 0.00
    1348919 1.00
    1348920 2.00
    1348922 1.00
    1348923 0.00
  • TABLE 63
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348315 0.00
    1348403 2.33
    1348404 0.00
    1348405 2.67
    1348406 2.67
    1348407 0.00
    1348408 0.00
    1348410 2.67
    1348411 1.00
    1348412 0.00
    1348413 0.00
    1348414 1.00
    1348415 0.67
    1348416 0.00
    1348417 1.00
    1348418 0.00
    1348419 0.00
    1348420 1.00
    1348421 1.00
    1348422 0.00
    1348423 2.00
    1348439 0.00
    1348440 0.00
    1348441 0.00
    1348442 0.00
    1348443 1.00
    1348444 0.00
    1348445 2.00
    1348446 1.33
    1348924 1.00
    1348925 0.00
    1348926 0.00
    1348927 0.33
    1348928 0.00
    1348929 0.00
    1348930 0.00
    1348931 0.00
    1348932 1.33
    1348933 0.00
    1348934 0.33
    1348935 0.00
    1348936 2.00
    1348937 1.00
    1348938 1.00
    1348939 1.33
  • TABLE 64
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348447 0.00
  • TABLE 65
    Tolerability scores in mice at 700 μg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348259 0.00
    1348289 0.00
    1348290 0.00
    1348331 0.00
    1348347 0.00
    1348937 0.00
  • TABLE 66
    Tolerability scores in mice at 700 μg dose
    Compound No. 3 hr. FOB
    PBS 0.00
    1506060 6.00
    • Example 5: Tolerability of Modified Oligonucleotides Complementary to Human SCN2A in Rats, 3 mg Dose
  • Modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides. Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of modified oligonucleotide listed in the tables below. Each treatment group consisted of 3-4 rats. A group of 4 rats received PBS as a negative control for each experiment (identified in separate tables below). At 3 hours post-injection, movement in 7 different parts of the body were evaluated for each rat. The 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed (the functional observational battery score or FOB). After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1. The scores were averaged for each treatment group, and presented in the tables below. Values marked with the symbol “‡” indicate groups that had 3 or fewer animals in the group.
  • TABLE 67
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1248429 2.00
    1248487 0.25
    1249990 2.00‡
    1250148 0.00‡
    1250225 0.25
  • TABLE 68
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    910009 1.00
    1248427 0.00
    1248428 1.00
    1248431 0.67
    1248488 1.33
    1248531 0.33
    1249989 1.33
    1348240 0.33
    1348241 0.00
    1348242 0.00
    1348243 3.00
    1348244 1.67
    1348245 0.67
    1348248 0.33
    1348250 3.00
    1348251 2.33
    1348252 0.33
    1348253 1.67
    1348254 0.00
    1348255 0.33
    1348256 1.00
    1348257 0.33
    1348258 1.00
    1348259 0.67
    1348263 0.00
  • TABLE 69
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348264 0.00
    1348265 0.33
    1348266 0.00
    1348267 0.00
    1348269 0.00
    1348270 2.67
    1348271 2.00
    1348275 0.00
    1348277 0.33
    1348279 0.00
    1348282 2.33
    1348286 2.33
    1348289 0.00
    1348290 0.00
    1348291 0.00
    1348292 0.00
    1348295 2.33
  • TABLE 70
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348297 0.33
    1348298 1.33
    1348299 1.33
    1348300 2.33
    1348302 0.00
    1348303 0.00
    1348304 0.33
  • TABLE 71
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348306 0.67
    1348307 3.00
    1348308 0.00
    1348309 1.00
    1348310 0.67
    1348311 2.00
    1348312 2.00
    1348313 2.00
  • TABLE 72
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348316 0.33
    1348319 1.67
    1348320 0.33
    1348321 0.00
    1348322 0.00‡
    1348323 1.33
    1348324 2.00
    1348325 0.33
    1348326 2.67
    1348327 3.00
    1348376 0.67
    1348377 0.67
    1348378 0.67
    1348379 1.33
    1348380 0.67
    1348381 0.67
    1348382 0.67
    1348383 2.00
    1348384 0.00
    1348385 0.00
    1348386 0.00
    1348387 0.00
    1348388 0.33
  • TABLE 73
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348328 2.33
    1348329 0.33
    1348331 0.33
    1348332 0.67
    1348333 0.33
    1348334 0.00
    1348335 0.33
    1348336 0.33
    1348337 0.00
    1348338 1.00
    1348340 0.00
    1348341 0.00
    1348342 0.00
    1348343 1.33
    1348344 1.00
    1348345 1.33
    1348347 0.33
  • TABLE 74
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.25
    1348348 0.67
    1348350 1.33
    1348353 1.67
    1348355 0.00
    1348356 0.00
    1348358 0.00
    1348360 2.00
    1348361 2.67
    1348362 2.00
    1348364 2.67
    1348365 1.33
    1348366 1.00
    1348367 1.67
    1348369 0.33
    1348370 0.33
    1348371 0.67
    1348373 3.00
    1348374 3.33
    1348375 0.67
    1348392 0.33
  • TABLE 75
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348393 1.33
    1348394 0.67
    1348395 0.00
    1348396 0.00
    1348397 1.33
    1348399 0.00
    1348424 2.33
    1348425 0.00
    1348426 0.00
    1348427 2.00
    1348428 0.00
    1348429 1.67
    1348430 3.00
    1348433 0.00
    1348434 0.00
    1348435 0.00
    1348436 0.00
    1348437 0.00
    1348438 0.33
    1348448 2.00
    1348449 0.00
    1348450 2.67
  • TABLE 76
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.25
    1348451 3.00
    1348453 1.33
    1348455 1.33
    1348456 0.00
    1348917 1.00
    1348918 0.00
    1348919 2.00
    1348920 3.00
    1348922 2.67
    1348923 1.67
    1348924 3.00
    1348925 3.00
    1348926 0.00
    1348927 0.33
    1348928 0.33
    1348929 0.00
    1348930 0.00
    1348931 0.00
    1348932 2.00
    1348933 2.00
    1348934 1.00
    1348935 0.00
    1348936 2.00
    1348937 0.67
    1348938 2.00
    1348939 2.00
  • TABLE 77
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.25
    1348315 1.67
    1348403 2.00
    1348404 1.00
    1348405 2.33
    1348406 4.00
    1348407 0.33
    1348408 0.00
    1348410 2.00
    1348411 2.00
    1348412 0.00
    1348413 0.67
  • TABLE 78
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348414 3.00
    1348415 2.00
    1348416 0.67
    1348417 0.67
    1348418 0.00
    1348419 0.00
    1348420 2.00
    1348421 2.00
    1348422 1.33
    1348423 3.00
  • TABLE 79
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348439 2.67
    1348440 0.33
    1348441 1.00
    1348442 0.00
    1348443 1.00
  • TABLE 80
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.00
    1348444 0.00
    1348445 3.00
    1348446 0.00
    1348447 0.67
  • TABLE 81
    Tolerability scores in rats at 3 mg dose
    Compound ID 3 hr. FOB
    PBS 0.25
    1348259 0.75
    1348289 0.50
    1348290 0.75
    1348331 1.00
    1348347 0.50
    1348937 1.25
    • Example 6: Effect of Modified Oligonucleotides on Human SCN2A RNA In Vitro, Multiple Doses
  • Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Cultured SH-SY5Y cells at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SCN2A RNA levels were measured by quantitative real-time RTPCR. Human SCN2A primer-probe set RTS36041 (described herein above) was used to measure RNA levels. SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH. Levels of GAPDH were measured using human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 7; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 8; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 9). Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control). The results for each separate experiment are presented in separate tables below.
  • The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel.
  • TABLE 82
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 39 nM 156 nM 625 nM 2500 nM 10000 nM (μM)
    910009 81 62 49 25 12 0.5
    1248427 73 74 49 31 23 0.6
    1348253 59 42 27 15 5 0.1
    1348259 89 66 33 22 11 0.4
    1348290 60 51 30 17 17 0.1
    1348291 96 71 34 24 6 0.5
    1348316 78 61 33 11 7 0.3
    1348320 90 64 53 25 18 0.6
    1348343 94 80 58 33 13 0.9
    1348371 90 70 62 34 13 0.8
    1348411 118 92 95 73 17 3.9
    1348435 82 116 76 34 11 1.5
    1348444 111 77 48 19 3 0.7
    1348935 67 60 47 35 17 0.4
  • TABLE 83
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 39 nM 156 nM 625 nM 2500 nM 10000 nM (μM)
    1248487 133 168 103 63 10 3.8
    1348266 106 100 85 40 21 2.1
    1348292 101 96 69 33 21 1.5
    1348328 72 72 63 30 12 0.6
    1348345 110 112 77 43 19 2.1
    1348347 94 73 43 17 12 0.5
    1348373 94 82 36 13 9 0.5
    1348374 106 92 63 37 23 1.5
    1348417 106 92 45 32 12 0.9
    1348420 111 106 122 120 138 >10.0
    1348436 128 120 81 45 13 2.2
    1348438 95 90 84 46 36 3.5
    1348447 169 123 98 41 13 2.4
    1348936 126 148 92 83 29 7.2
  • TABLE 84
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 39 nM 156 nM 625 nM 2500 nM 10000 nM (μM)
    1248488 133 118 57 26 11 1.4
    1249990 103 102 52 35 19 1.3
    1348271 84 106 71 36 13 1.4
    1348275 106 111 109 93 110 >10.0
    1348302 99 89 48 17 7 0.7
    1348331 111 97 62 21 9 1.0
    1348360 98 97 80 28 10 1.3
    1348376 86 80 69 39 10 1.0
    1348421 97 91 66 34 19 1.3
    1348439 93 71 42 21 19 0.6
    1348449 111 91 61 24 13 1.1
    1348456 100 83 60 31 22 1.1
    1348937 81 88 65 33 12 0.9
    1348938 93 65 56 37 26 1.0
  • TABLE 85
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 39 nM 156 nM 625 nM 2500 nM 10000 nM (μM)
    1250148 93 73 56 20 8 0.6
    1348277 80 70 59 27 13 0.6
    1348303 109 80 34 12 23 0.7
    1348304 85 74 54 28 11 0.6
    1348332 95 56 58 23 28 0.7
    1348333 75 81 48 30 14 0.6
    1348365 96 80 72 37 14 1.2
    1348366 136 84 72 39 89 >10.0
    1348383 77 75 42 21 14 0.4
    1348384 100 76 60 44 19 1.3
    1348422 94 82 72 25 11 0.9
    1348440 104 80 19 15 13 0.5
    1348923 107 89 84 46 16 2.0
    1348939 96 85 60 37 15 1.1
  • TABLE 86
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 39 nM 156 nM 625 nM 2500 nM 10000 nM (μM)
    1250225 91 119 56 32 13 1.2
    1348251 91 91 88 55 24 3.2
    1348282 117 90 52 38 15 1.2
    1348289 81 64 39 25 12 0.4
    1348306 79 75 51 22 13 0.5
    1348338 89 72 35 13 16 0.4
    1348369 107 121 124 97 139 >10.0
    1348385 108 92 75 61 27 3.1
    1348423 107 101 86 44 13 2.0
    1348427 87 68 67 42 21 1.1
    1348441 98 81 60 38 21 1.2
    1348442 114 87 95 33 25 2.2
    1348928 129 93 110 90 130 >10.0
    1348931 91 91 78 54 39 4.6
  • TABLE 87
    Dose-dependent reduction of human SCN2A RNA
    in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 39 nM 156 nM 625 nM 2500 nM 10000 nM (μM)
    1348307 82 76 67 37 14 1.0
    1348342 87 71 60 25 13 0.7
    1348386 98 91 65 37 15 1.2
    1348433 90 75 68 55 24 2.0
    1348435 94 84 60 36 23 1.2
    1348443 81 74 52 32 17 0.7
    1348934 81 66 55 32 15 0.6
    • Example 7: Effect of Modified Oligonucleotides on Human SCN2A RNA In Vitro, Multiple Doses
  • Modified oligonucleotides selected from the examples above were tested at various doses in SH-SY5Y cells. Cultured SH-SY5Y cells at a density of 35,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SCN2A RNA levels were measured by quantitative real-time RTPCR. Human SCN2A primer-probe set RTS36041 (described herein above) was used to measure RNA levels. SCN2A RNA levels were normalized to total RNA content, as measured by GAPDH. Levels of GAPDH were measured using human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 7; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 8; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 9). Reduction of SCN2A RNA is presented in the tables below as percent SCN2A RNA relative to the amount in untreated control cells (% control).
  • The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated in Graphpad Prism using log(inhibitor) vs. normalized response—Variable slope curve fitting.
  • TABLE 88
    Dose-dependent reduction of human SCN2A RNA in SH-SY5Y cells by modified oligonucleotides
    Compound SCN2A RNA (% control) IC50
    No. 0.005 nM 0.013 nM 0.032 nM 0.08 nM 0.2 nM 0.5 nM 1.28 nM 3.2 nM 8.0 nM 20.0 nM (μM)
    1348259 94 95 90 86 62 40 29 21 6 6 0.4
    1348289 91 83 85 74 58 48 26 14 7 6 0.3
    1348290 100 85 86 85 76 48 35 21 10 8 0.6
    1348331 87 100 93 82 67 48 32 22 7 11 0.5
    1348347 84 85 90 80 62 40 22 12 7 5 0.3
    1348937 94 95 92 92 78 58 48 25 16 13 1.0
    • Example 8: Effect of Modified Oligonucleotides on Human SCN2A in Transgenic Mice
  • Modified oligonucleotides described above were tested in a human SCN2A transgenic mouse model. Transgenic mice that express a human SCN2A transcript were generated in a C57Bl/6 background. Transgenic mice may be prepared and are available from commercial and academic research facilities; for examples of transgenic mice that express human neurological genes see, for example, Heintz et al., 2002, Nature reviews Neuroscience 2, 861-870.
    • Treatment
  • Human SCN2A transgenic mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 350 μg of modified oligonucleotide. A group of 4 mice received PBS as a negative control.
    • RNA Analysis
  • Two weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RTPCR analysis to measure the amount of SCN2A RNA using Human primer probe set RTS36041 (described in Example 1 above). Results are presented as percent human SCN2A RNA relative to the amount in PBS treated animals, normalized to mouse GAPDH RNA (% control). Mouse GAPDH RNA was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 13; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 14; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 15).
  • As shown in the tables below, treatment with modified oligonucleotides resulted in reduction of SCN2A RNA in comparison to the PBS control.
  • TABLE 89
    Reduction of human SCN2A RNA in transgenic mice
    SCN2A RNA (% control)
    Compound ID CORTEX SPINAL CORD
    PBS 100  100 
    1248353 58 65
    1248354 62 69
    1248357 76 84
    1248358 65 74
    1248368 109  83
    1248369 113  91
    1248396 57 70
    1248398 102  77
    1248400 59 63
    1248414 73 66
    1248425 83 71
    1248441 77 72
    1248461 87 73
    1248462 84  73‡
    1248466 58 50
    1248476 45 42
    1248481 71 66
    1248487 24 35
    1248489 36 29
    1248510 48 44
    1248526 68 62
    1248543 111  81
    1248585 73 60
    1248593 37 64
    1249160 62 82
    1249161 48 78
    1249164 46 59
    1249169 49 73
    1249170 53 80
    1249204 50 81
    1249205 43 76
    1249210 52 76
    1249222 46 61
    1249225 44 60
    1249237 43 48
    1249252 80 87
    1249266 76 85
    1249269 58 70
    1249272 74 71
    1249273 89 90
    1249274 83 84
    1249282 53 63
    1249284 69 80
    1249286 46 62
    1249295 97 100 
    1249296 121  87
    1249297 103  91
    1249298 65 76
    1249313  84‡  76‡
    1249315 57 75
    1249316 57 86
    ‡indicates groups with only 1 PCR value
  • TABLE 90
    Reduction of human SCN2A RNA in transgenic mice
    SCN2A RNA (% control)
    Compound ID CORTEX SPINAL CORD
    PBS 100  100 
    1249328 43 58
    1249337 54 53
    1249338 36 51
    1249340 35 51
    1249341 37 50
    1249377 63 66
    1249390 33 46
    1249401 43 58
    1249403 63 75
    1249406 55 65
    1249416 44 63
    1249417 30 46
    1249418 35 47
    1249428 54 54
    1249445 54 64
    1249482 81 72
    1249483 89 70
    1249484 65 60
    1249485 55 56
    1249486 71 80
    1249495 62 67
    1249536 73 83
    1249588 45 58
    1249599 50 64
    1249613 57 61
    1249633 80 88
    1249639 79 69
    1249675 54 53
    1249677 112  81
    1249685 68 67
    1249726 42 42
    1249728 66 60
    1249729 66 54
    1249800 54 45
    1249822 65 75
    1249867 70 72
    1249873 85 69
    1249953 28 39
    1249990 22 46
    1250021 86 69
    1250065 54 34
    1250070  89‡  63‡
    1250148 13 25
    1250149 26 36
    1250161 62 66
    1250164 60 64
    1250184 55 53
    1250225 16 23
    1250235 49 60
    1250238 73 93
    1250239 65 70
    1250266 53 64
    909945 40 58
    909947 40 48
    909950 62 65
    909951 62 68
    909955 58 52
    909962 66 75
    909985 46 55
    910015 38 47
    910246 57 67
    910263 38 51
    910265 54 62
    910269 35 52
    910279 48 47
    910342 42 44
    910355 72 76
    910356 69 80
    910366 51 52
    1248363 25 71
    1248429  9 21
    1248511 34 30
    1249576 60 66
    1249589 58 51
    1249811 47 63
    1250227 37 46
    1250246 37 59
    909533 59 57
    909603 55 54
    909995 36 40
    910010 41 29
    910061 78 77
    910249 58 68
    910250 81 74
    910267 81 76
    910307 72 69
    910314  46‡ 57
    910315 68 73
    910341 61 55
    910372 70 59
    1248423 63 63
    1248444 62 69
    1248474 83 81
    1248490 84 82
    1248672 59 82
    1248717 45 57
    1248728 61 70
    1249320 53 65
    1249346 63 66
    1249361 76 65
    1249501 116‡ 40
    1249533 78 65
    1249687 38 45
    1249789 71 70
    1249967 55 60
    1250101 53 52
    1248355 41 60
    1248356 43 67
    1248366 43 39
    1248430 31 28
    1248439 39 42
    1248440 36 43
    ‡indicates groups with only 1 PCR value
  • TABLE 91
    Reduction of human SCN2A RNA in transgenic mice
    SCN2A RNA (% control)
    Compound ID CORTEX SPINAL CORD
    PBS 100 100
    910009 26 38
    1248427 22 47
    1248488 26 18
    1248531 43 43
    1249989 40 55
    1348240 50 56
    1348241 75 83
    1348242 83 99
    1348243 107 109
    1348244 98 101
    1348245 82 93
    1348248 40 60
    1348250 37 45
    1348251 25 41
    1348252 39 49
    1348253 18 32
    1348254 55 74
    1348255 59 75
    1348256 45 55
    1348257 48 67
    1348258 59 59
    1348259 11 22
    1348263 47 55
    1348264 49 67
    1348265 38 43
    1348266 24 37
    1348267 45 49
    1348269 49 47
    1348270 35 38
    1348271 15 36
    1348275 24 30
    1348277 22 43
    1348279 21 37
    1348282 16 30
    1348286 23 46
    1348289 7 18
    1348290 7 18
    1348291 8 17
    1348292 14 32
    1348295 35 65
    1348297 20 34
    1348298 40 32
    1348299 38 32
    1348300 89 77
    1348302 8 16
    1348303 23 22
    1348304 12 24
    1348306 21 37
    1348307 22 37
    1348308 44 49
    1348309 18 33
    1348310 34 46
    1348311 65 70
    1348312 29 46
    1348313 31 48
    1348316 30 48
    1348319 48 60
    1348320 19 35
    1348321 76 100
    1348322 69 72
    1348323 84 96
    1348324 96 108
    1348325 76 85
    1348326 34 47
    1348327 46 56
    1348376 21 33
    1348377 31 35
    1348378 40 45
    1348379 31 33
    1348380 23 29
    1348381 42 33
    1348382 39 37
    1348383 14 26
    1348384 21 53
    1348385 14 15
    1348386 24 34
    1348387 41 38
    1348388 40 49
    1348328 21 33
    1348329 66 76
  • TABLE 92
    Reduction of human SCN2A RNA in transgenic mice
    SCN2A RNA (% control)
    Compound ID CORTEX SPINAL CORD
    PBS 100 100
    1348331 12 21
    1348332 14 27
    1348333 15 21
    1348334 49 53
    1348335 35 42
    1348336 50 46
    1348337 43 51
    1348338 17 23
    1348340 50 48
    1348341 49 48
    1348342 21 22
    1348343 27 37
    1348344 39 37
    1348345 29 32
    1348347 11 20
    1348348 33 32
    1348350 54 86
    1348353 36 39
    1348355 52 51
    1348356 46 53
    1348358 25 42
    1348360 27 40
    1348361 23 46
    1348362 33 37
    1348364 16 33
    1348365 17 35
    1348366 26 45
    1348367 16 35
    1348369 15 36
    1348370 29 39
    1348371 26 33
    1348373 15 20
    1348374 20 37
    1348375 49 49
    1348392 62 56
    1348393 33 43
    1348394 60 73
    1348395 57 69
    1348396 37 47
    1348397 41 43
  • TABLE 93
    Reduction of human SCN2A RNA in transgenic mice
    SCN2A RNA (% control)
    Compound ID CORTEX SPINAL CORD
    PBS 100 100
    1348399 86 63
    1348424 76 67
    1348425 90 89
    1348426 72 64
    1348427 36 38
    1348428 63 46
    1348429 68 73
    1348430 76 79
    1348433 49 60
    1348434 66 68
    1348435 50 47
    1348436 60 60
    1348437 78 72
    1348438 50 52
    1348448 67 73
    1348449 50 53
    1348450 54 46
    1348451 54 64
    1348453 75 74
    1348455 75 69
    1348456 42 38
    1348917 60 61
    1348918 83 81
    1348919 74 70
    1348920 47 55
    1348922 34 31
    1348923 29 36
    1348924 45 51
    1348925 57 53
    1348926 86 78
    1348927 46 48
    1348928 30 38
    1348929 48 54
    1348930 85 92
    1348931 20 35
    1348932 56 48
    1348933 71 78
    1348934 12 23
    1348935 42 40
    1348936 28 35
    1348937 11 26
    1348938 29 37
    1348939 20 25
    1348315 59 72
    1348403 88 96
    1348404 50 57
    1348405 55 70
    1348406 71 70
    1348407 50 53
    1348408 91 111
    1348410 38 54
    1348411 27 42
    1348412 56 62
    1348413 56 70
    1348414 91 98
    1348415 93 104
    1348416 95 107
    1348417 30 52
    1348418 67 77
    1348419 47 49
    1348420 38 49
    1348421 26 33
    1348422 38 48
    1348423 22 37
    1348439 12 16
    1348440 12 25
    1348441 36 54
    1348442 8 20
    1348443 21 32
    1348444 10 26
    1348445 53 80
    1348446 17 39
    1348447 14 27
    • Example 9: Potency of Modified Oligonucleotides Complementary to Human SCN2A RNA in Transgenic Mice
  • Modified oligonucleotides described above were tested in human SCN2A transgenic mice (described herein above).
    • Treatment
  • Human SCN2A transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses indicated in tables below. A group of 8 mice received PBS as a negative control.
    • RNA Analysis
  • Two weeks post treatment, mice were sacrificed, and RNA was extracted from the cortex and spinal cord for quantitative real-time RTPCR analysis of RNA expression of SCN2A using primer probe set RTS36041 (described herein in Example 1). Results are presented as percent human SCN2A RNA relative to the amount in PBS treated animals, normalized to mouse GAPDH RNA. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (described herein above). The half maximal effective dose (ED50) of each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). ED50 values were calculated from dose and individual animal SCN2A RNA levels using custom equation Motulsky: Agonist vs response—Variable slope (four parameters) Y=Bottom+(Top−Bottom)/(1+(10{circumflex over ( )}log EC50/X){circumflex over ( )}HillSlope), with the following constraints: bottom>lowest value in data set in order to compare across ASOs (4.5 and 9.4 for cortex and spinal cord, respectively), top=100, HillSlope<−1 and >−2.
  • As shown in the table below, treatment with modified oligonucleotides resulted in dose-responsive reduction of SCN2A RNA in comparison to the PBS control.
  • TABLE 94
    Reduction of human SCN2A RNA in transgenic mice
    SCN2A RNA (% control) ED50 (μg)
    Compound Dose SPINAL SPINAL
    ID (μg) CORTEX CORD CORTEX CORD
    PBS N/A 100 100 N/A N/A
    1348259 3 96 83 86 26
    10 94 84
    30 82 47
    100 49 27
    300 17 17
    700 8 16
    1348271 3 115 95 191 93
    10 99 90
    30 98 75
    100 72 51
    300 36 36
    700 21 25
    1348289 3 106 86 57 21
    10 98 71
    30 77 44
    100 31 32
    300 7 13
    700 5 11
    1348290 3 99 93 63 29
    10 81 72
    30 76 52
    100 44 33
    300 10 25
    700 9 14
    1348331 3 106 95 36 28
    10 73 78
    30 55 50
    100 34 27
    300 11 21
    700 7 16
    1348347 3 90 94 88 40
    10 100 92
    30 84 60
    100 49 31
    300 14 19
    700 9 17
    1348383 3 118 103 186 49
    10 109 81
    30 84 63
    100 70 39
    300 41 23
    700 18 20
    1348385 3 121 93 123 86
    10 95 75
    30 86 73
    100 62 34
    300 21 20
    700 13 14
    1348439 3 103 110 137 70
    10 97 106
    30 96 70
    100 70 41
    300 19 25
    700 11 20
    1348440 3 124 104 158 60
    10 105 73
    30 109 95
    100 77 38
    300 18 20
    700 13 16
    1348934 3 116 108 56 33
    10 95 92
    30 72 56
    100 31 30
    300 10 22
    700 12 19
    1348937 3 125 94 73 34
    10 109 81
    30 73 57
    100 41 43
    300 15 28
    700 9 18

Claims (149)

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 16-2531, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2532-2539, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
4. The oligomeric compound of any of claims 1 to 3, wherein the modified oligonucleotide is at least 90% complementary to an equal length portion of SEQ ID NO: 2 and is not more than 50% complementary to an equal length portion of SEQ ID NO: 1.
5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
a) the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 199863-199905, 227493-22755, 243124-243204, 247823-247921, 254142-254177, 168911-168945, 170026-170061, 183519-183562, 188630-188668, 199912-199962, 227419-227450, or 238173-238192 of SEQ ID NO: 2, provided that the modified oligonucleotide does not comprise more than six LNA nucleosides; or
b) the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 243917-244073, 170174-170200, 176724-176751, 180772-180801, 183968-184016, 202877-202906, 224198-224217, 224199-224218, or 243918-243937 of SEQ ID NO: 2,
wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
a) the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, 2527; 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 2522; 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, 2539; 18, 96, 485, 561, 638, 715, 791, 868, 2247, 2323, 2400; 174, 1328, 1405, 1482, 1559, 1636, 1713, 1790, 1865, 1942, 2019; 20, 98, 253, 332, 410, 1406, 1483, 1560, 1637, 1714, 1791, 1866, 1943; 21, 411, 1407, 1484, 1561, 1638, 1715; 24, 414, 871, 948, 1025, 1100; 25, 337, 415, 490, 566, 2099, 2176, 2252, 2328, 2405; and 182; provided that the modified oligonucleotide does not comprise more than six LNA nucleosides; or
b) wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537; 302, 1513, 1667, 1744, 1819, 1896, 1973; 148, 226, 1364, 1441, 1518, 1595, 1672, 1749; 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 1829; 228, 1679, 1756, 1831, 1908, 1985, 2061, 2138, 2214, 2290; 1226, 1303, 1380, 1457, 1534, 1611; 2079; 2523; and 2477
wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
7. The oligomeric compound of any of claims 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2487, 2493, 2510, or 2514.
8. The oligomeric compound of any of claims 1-6, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of SEQ ID NO: 2534.
9. The oligomeric compound of any of claims 1-8, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
10. The oligomeric compound of claim 9 wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to
an intronic region of the nucleobase sequence of SEQ ID NO: 2;
an untranslated region of the nucleobase sequence of SEQ ID NO: 2; or
an intron/exon junction region of the nucleobase sequence of SEQ ID NO: 2.
11. The oligomeric compound of any of claims 1-10, wherein the nucleobase sequence of the modified oligonucleotide is no more than 50%, no more than 60%, no more than 70%, no more than 80%, no more than 90%, or no more than 95% complementary to an exonic region of the nucleobase sequence of SEQ ID NO: 2.
12. The oligomeric compound of any of claims 1-11, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
13. The oligomeric compound of any of claims 1-11, wherein the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides.
14. The oligomeric compound of any of claims 1-13, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
15. The oligomeric compound of claim 14, wherein the modified oligonucleotide consists of 20 linked nucleosides.
16. The oligomeric compound of claim 14, wherein the modified oligonucleotide consists of 18 linked nucleosides.
17. The oligomeric compound of any of claims 1-16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
18. The oligomeric compound of claim 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
19. The oligomeric compound of claim 18, wherein the bicyclic sugar moiety comprises a 4′-2′ bridge, wherein the 4′-2′ bridge is selected from —CH2—O—; and —CH(CH3)—O—.
20. The oligomeric compound of any of claims 17-19, wherein the modified oligonucleotide does not comprise more than six bicyclic sugar moieties.
21. The oligomeric compound of claim 17, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.
22. The oligomeric compound of any of claims 17-20, wherein the modified oligonucleotide does not comprise more than six LNA sugar moieties.
23. The oligomeric compound of any of claims 17-21, wherein the modified oligonucleotide does not comprise a LNA sugar moiety.
24. The oligomeric compound of any of claims 17-23, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
25. The oligomeric compound of claim 24, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety or a 2′-OMe sugar moiety.
26. The oligomeric compound of any of claims 17-25, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
27. The oligomeric compound of claim 26, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.
28. The oligomeric compound of any of claims 1-27, wherein the modified oligonucleotide is a gapmer.
29. The oligomeric compound of any of claims 1-28, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 1-6 linked 5′-region nucleosides;
a central region consisting of 6-10 linked central region nucleosides; and
a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
30. The oligomeric compound of any of claims 1-28, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 1-6 linked 5′-region nucleosides;
a central region consisting of 6-10 linked central region nucleosides; and
a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
31. The oligomeric compound of claim 29, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 5 linked 5′-region nucleosides;
a central region consisting of 10 linked central region nucleosides; and
a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
32. The oligomeric compound of claim 30, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 5 linked 5′-region nucleosides;
a central region consisting of 10 linked central region nucleosides; and
a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
33. The oligomeric compound of claim 29, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 6 linked 5′-region nucleosides;
a central region consisting of 10 linked central region nucleosides; and
a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
34. The oligomeric compound of claim 30, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 6 linked 5′-region nucleosides;
a central region consisting of 10 linked central region nucleosides; and
a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
35. The oligomeric compound of claim 29, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 4 linked 5′-region nucleosides;
a central region consisting of 10 linked central region nucleosides; and
a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
36. The oligomeric compound of claim 30, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 4 linked 5′-region nucleosides;
a central region consisting of 10 linked central region nucleosides; and
a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
37. The oligomeric compound of claim 29, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 4 linked 5′-region nucleosides;
a central region consisting of 8 linked central region nucleosides; and
a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
38. The oligomeric compound of claim 30, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 4 linked 5′-region nucleosides;
a central region consisting of 8 linked central region nucleosides; and
a 3′-region consisting of 6 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
39. The oligomeric compound of claim 29, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 6 linked 5′-region nucleosides;
a central region consisting of 8 linked central region nucleosides; and
a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
40. The oligomeric compound of claim 30, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 6 linked 5′-region nucleosides;
a central region consisting of 8 linked central region nucleosides; and
a 3′-region consisting of 4 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
41. The oligomeric compound of claim 29, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 5 linked 5′-region nucleosides;
a central region consisting of 8 linked central region nucleosides; and
a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and at least six of the central region nucleosides comprise a 2′-β-D-deoxyribosyl sugar moiety.
42. The oligomeric compound of claim 30, wherein the modified oligonucleotide comprises:
a 5′-region consisting of 5 linked 5′-region nucleosides;
a central region consisting of 8 linked central region nucleosides; and
a 3′-region consisting of 5 linked 3′-region nucleosides; wherein
each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.
43. The oligomeric compound of claim 29 or claim 30, wherein the 5′-region or the 3′-region comprises at least one bicyclic nucleoside.
44. The oligomeric compound of claim 29 or claim 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a bicyclic nucleoside.
45. The oligomeric compound of claim 29 or claim 30, wherein the 5′-region or the 3′-region comprises at least one nucleoside that is not a LNA nucleoside.
46. The oligomeric compound of any of claims 1-45, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
47. The oligomeric compound of claim 46, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
48. The oligomeric compound of claim 46 or claim 47, wherein each internucleoside linkage is a modified internucleoside linkage.
49. The oligomeric compound of claim 48, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
50. The oligomeric compound of any of claims 46-47, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.
51. The oligomeric compound of any of claims 1-46, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
52. The oligomeric compound of any of claims 1-47 or 50-51, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.
53. The oligomeric compound of claim 46, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from soooossssssssssooss, sooooossssssssssoss, sooossssssssssoooss, soosssssssssoooss, soooosssssssssoss, and sooosssssssssooss,
wherein s=a phosphorothioate internucleoside linkage and o=a phosphodiester internucleoside linkage.
54. The oligomeric compound of any of claims 1-53, wherein the modified oligonucleotide comprises at least one modified nucleobase.
55. The oligomeric compound of claim 54, wherein the modified nucleobase is a 5-methyl cytosine.
56. The oligomeric compound of any of claims 1-55, wherein the oligomeric compound is capable of reducing the amount of SCN2A RNA in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay.
57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
(SEQ ID NO: 2493) Ges mCeoAeoTeoAeoAdsTds mCds mCds mCdsAds TdsTdsAdsTdsAeo mCeoAesAesAe,
wherein:
A=an adenine nucleobase,
mC=a 5-methyl cytosine nucleobase,
G=a guanine nucleobase,
T=a thymine nucleobase,
e=a 2′-MOE sugar moiety,
d=a 2′-β-D-deoxyribosyl sugar moiety,
s=a phosphorothioate internucleoside linkage, and
o=a phosphodiester internucleoside linkage.
58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
(SEQ ID NO: 2514) mCesAeo mCeoGeoAeo mCeoAdsTdsAdsTdsTds TdsTdsTds mCdsTdsAeo mCesAes mCe,
wherein:
A=an adenine nucleobase,
mC=a 5-methyl cytosine nucleobase,
G=a guanine nucleobase,
T=a thymine nucleobase,
e=a 2′-MOE sugar moiety,
d=a 2′-β-D-deoxyribosyl sugar moiety,
s=a phosphorothioate internucleoside linkage, and
o=a phosphodiester internucleoside linkage.
59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
(SEQ ID NO: 2510) mCes mCeoAeo mCeoGeoAeo mCdsAdsTdsAdsTds TdsTdsTdsTds mCdsTeoAes mCesAe,
wherein:
A=an adenine nucleobase,
mC=a 5-methyl cytosine nucleobase,
G=a guanine nucleobase,
T=a thymine nucleobase,
e=a 2′-MOE sugar moiety,
d=a 2′-β-D-deoxyribosyl sugar moiety,
s=a phosphorothioate internucleoside linkage, and
o=a phosphodiester internucleoside linkage.
60. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
(SEQ ID NO: 2487) Tes mCeoTeoGeo mCeoAeoTdsGdsTdsAdsAds mCds mCdsTdsTdsTdsAeoTesAes mCe,
wherein:
A=an adenine nucleobase,
mC=a 5-methyl cytosine nucleobase,
G=a guanine nucleobase,
T=a thymine nucleobase,
e=a 2′-MOE sugar moiety,
d=a 2′-β-D-deoxyribosyl sugar moiety,
s=a phosphorothioate internucleoside linkage, and
o=a phosphodiester internucleoside linkage.
61. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation:
(SEQ ID NO: 2493) Ges mCeoAeoTeoAeoAeoTds mCds mCds mCdsAds TdsTdsAdsTdsAds mCeoAesAesAe,
wherein:
A=an adenine nucleobase,
mC=a 5-methyl cytosine nucleobase,
G=a guanine nucleobase,
T=a thymine nucleobase,
e=a 2′-MOE sugar moiety,
d=a 2′-β-D-deoxyribosyl sugar moiety,
s=a phosphorothioate internucleoside linkage, and
o=a phosphodiester internucleoside linkage.
62. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: GT
(SEQ ID NO: 2534) mCesTeoGeo mCeoAesTdsGdsTdsAdsAds mCds mCdsTdsTeoTeoAesTesAe,
wherein:
A=an adenine nucleobase,
mC=a 5-methyl cytosine nucleobase,
G=a guanine nucleobase,
T=a thymine nucleobase,
e=a 2′-MOE sugar moiety,
d=a 2′-β-D-deoxyribosyl sugar moiety,
s=a phosphorothioate internucleoside linkage, and
o=a phosphodiester internucleoside linkage.
63. The oligomeric compound of any of claims 1-62 wherein the oligomeric compound is a singled-stranded oligomeric compound.
64. The oligomeric compound of any of claims 1-63, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.
65. The oligomeric compound of any of claims 1-64, consisting of the modified oligonucleotide.
66. The oligomeric compound of any of claims 1-62, wherein the modified oligonucleotide is an RNAi compound.
67. The oligomeric compound of any of claims 1-66, further comprising a conjugate group.
68. The oligomeric compound of claim 67, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
69. The oligomeric compound of claim 68, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
70. The oligomeric compound of claim 68, wherein the conjugate linker consists of a single bond.
71. The oligomeric compound of claim 68, wherein the conjugate linker is cleavable.
72. The oligomeric compound of claim 68, wherein the conjugate linker comprises 1-3 linker-nucleosides.
73. The oligomeric compound of any of claims 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
74. The oligomeric compound of any of claims 67-72, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
75. The oligomeric compound of any of claims 1-74 further comprising a terminal group.
76. The oligomeric compound of any of claims 1-71 or 73-75, wherein the oligomeric compound does not comprise linker-nucleosides.
77. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00031
or a salt thereof.
78. The modified oligonucleotide of claim 77, which is the sodium salt or the potassium salt.
79. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00032
80. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00033
or a salt thereof.
81. The modified oligonucleotide of claim 80, which is the sodium salt or the potassium salt.
82. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00034
83. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00035
or a salt thereof.
84. The modified oligonucleotide of claim 83, which is the sodium salt or the potassium salt.
85. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00036
86. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00037
or a salt thereof.
87. The modified oligonucleotide of claim 86, which is the sodium salt or the potassium salt.
88. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00038
89. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00039
or a salt thereof.
90. The modified oligonucleotide of claim 89, which is the sodium salt or the potassium salt.
91. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00040
92. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00041
or a salt thereof.
93. The modified oligonucleotide of claim 92, which is the sodium salt or the potassium salt.
94. A modified oligonucleotide according to the following chemical structure:
Figure US20240026353A1-20240125-C00042
95. A chirally enriched population of oligomeric compounds of any of claim 1-76 or modified oligonucleotides of any of claims 77-94, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
96. The chirally enriched population of claim 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
97. The chirally enriched population of claim 95, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.
98. The chirally enriched population of claim 95, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
99. The chirally enriched population of claim 98, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.
100. The chirally enriched population of claim 98, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
101. The chirally enriched population of claim 98, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.
102. A population of oligomeric compounds of any of claims 1-76 or modified oligonucleotides of any of claims 77-94, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
103. An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of claims 1-76.
104. The oligomeric duplex of claim 103, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
105. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound of any of claims 1-76 or a modified oligonucleotide of any of claims 77-94.
106. The antisense agent of claim 105, wherein the antisense agent is an oligomeric duplex of claim 103 or claim 104.
107. The antisense agent of claim 105 or claim 106, wherein the antisense agent is:
i. an RNase H agent capable of reducing the amount of SCN2A nucleic acid through the activation of RNase H; or
ii. an RNAi agent capable of reducing the amount of SCN2A nucleic acid through the activation of RISC/Ago2.
108. A pharmaceutical composition comprising an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, or an antisense agent of any of claims 105-107, and a pharmaceutically acceptable diluent or carrier.
109. The pharmaceutical composition of claim 108, comprising a pharmaceutically acceptable diluent and wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
110. The pharmaceutical composition of claim 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and aCSF.
111. The pharmaceutical composition of claim 109, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and PBS.
112. A pharmaceutical composition comprising a modified oligonucleotide of any of claims 77-94 and a pharmaceutically acceptable diluent.
113. The pharmaceutical composition of claim 112, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
114. The pharmaceutical composition of claim 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF.
115. The pharmaceutical composition of claim 113, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.
116. A method comprising administering to a subject an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115.
117. A method of treating a disease or disorder associated with a voltage-gated sodium channel protein, comprising administering to a subject having or at risk for developing the disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115, thereby treating the disease or disorder associated with a voltage-gated sodium channel protein.
118. A method of reducing the amount of SCN2A protein in the CSF of a subject having or at risk for developing a disease or disorder associated with a voltage-gated sodium channel protein a therapeutically effective amount of an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115, thereby reducing the amount of SCN2A protein in the CSF.
119. The method of claim 117 or claim 118, wherein the disease or disorder is a neurodevelopmental disease.
120. The method of claim 117 or claim 118, wherein the disease or disorder is associated with SCN1A or SCN2A.
121. A method of treating a disease or disorder associated with SCN2A, comprising administering to an subject having or at risk for developing a disease or disorder associated with SCN2A a therapeutically effective amount of an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115, thereby treating the disease or disorder associated with SCN2A.
122. The method of claim 121, wherein the disease or disorder associated with SCN2A is a Developmental and Epileptic Encephalopathy, an intellectual disability, or an autism spectrum disorder.
123. The method of claim 122, wherein the Developmental and Epileptic Encephalopathy is any of Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, or Benign Familial Neonatal-Infantile Seizures.
124. The method of claim 121, wherein the disease or disorder associated with SCN2A is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
125. The method of any of claims 118-120, wherein the disease or disorder is associated with SCN1A.
126. The method of claim 125, wherein the disease or disorder associated with SCN1A is a Developmental and Epileptic Encephalopathy.
127. The method of claim 125 or claim 126, wherein the Developmental and Epileptic Encephalopathy is Dravet Syndrome.
128. The method of claim 126 or claim 127, wherein the Developmental and Epileptic Encephalopathy is any of Ohtahara Syndrome, epilepsy with migrating focal seizures of infancy, West Syndrome, Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies, Temporal Lobe Epilepsy, Myoclonic Astatic Epilepsy, Migrating Partial Epilepsy of Infancy, or familial hemiplegic migraines.
129. The method of any of claims 117-128, wherein at least one symptom or hallmark of the disease or disorder is ameliorated.
130. The method of claim 129, wherein the symptom or hallmark is seizures.
131. The method of any of claim 130, wherein the seizures are any of focal, clonic, tonic, generalized tonic and clonic, convulsive, myoclonic, absence, or obtundation status.
132. The method of claim 130, wherein the seizures are any of focal, clonic, tonic, or generalized tonic.
133. The method of claim 129, wherein the symptom or hallmark is any of seizures, hypotonia, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, or sudden unexpected death in epilepsy.
134. The method of claim 129, wherein the symptom or hallmark is any of motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disoders, sleep problems, or seizures.
135. The method of any of claims 130-134, wherein the seizures are frequent or prolonged.
136. The method of any of claims 116-135 wherein administering the modified oligonucleotide reduces seizures, sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements, or sleep problems, hypotonia, nystagmus, optic atrophy, respiratory distress, motor delays, cognitive dysfunction, speech dysfunction, spasticity, ataxia, seizures, or choreiform movements, or delays death in the subject.
137. The method of any of claims 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system or systemically.
138. The method of any of claims 116-136, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered to the central nervous system and systemically.
139. The method of any of claims 116-131, wherein the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition is administered by any of intrathecally, systemically, subcutaneously, or intramuscularly.
140. The method of any of claims 116-139, wherein the subject is human.
141. A method of reducing the amount of SCN2A RNA in a cell comprising contacting the cell with an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115, thereby reducing the amount of SCN2A RNA in the cell.
142. A method of reducing the amount of SCN2A protein in a cell comprising contacting the cell with an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115, thereby reducing the amount of SCN2A protein in the cell.
143. The method of claim 141 or claim 142, wherein the cell is a cortical cell, a hippocampal cell, or a spinal cord cell.
144. The method of any of claims 141-143, wherein the cell is in an animal.
145. The method of any of claims 141-144, wherein the cell is a human cell.
146. Use of an oligomeric compound of any of claims 1-76, a modified oligonucleotide of any of claims 77-94, a population of any of claims 95-102, an oligomeric duplex of claim 103 or claim 104, an antisense agent of any of claims 105-107, or a pharmaceutical composition of any of claims 108-115 for reducing SCN2A expression in a cell.
147. The use of claim 146, wherein the level of SCN2A RNA in the cell is reduced.
148. The use of claim 146 or claim 147, wherein the level of SCN2A protein in the cell is reduced.
149. The use of any of claims 146-148, wherein the cell is a corical cell, a hippocampal cell, or a spinal cord cell.
US18/017,276 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a Abandoned US20240026353A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/017,276 US20240026353A1 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202063063120P 2020-08-07 2020-08-07
PCT/US2021/044887 WO2022032060A2 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a
US18/017,276 US20240026353A1 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/044887 A-371-Of-International WO2022032060A2 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/483,663 Continuation US20240102012A1 (en) 2020-08-07 2023-10-10 Compounds and methods for modulating scn2a

Publications (1)

Publication Number Publication Date
US20240026353A1 true US20240026353A1 (en) 2024-01-25

Family

ID=80118566

Family Applications (2)

Application Number Title Priority Date Filing Date
US18/017,276 Abandoned US20240026353A1 (en) 2020-08-07 2021-08-06 Compounds and methods for modulating scn2a
US18/483,663 Pending US20240102012A1 (en) 2020-08-07 2023-10-10 Compounds and methods for modulating scn2a

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/483,663 Pending US20240102012A1 (en) 2020-08-07 2023-10-10 Compounds and methods for modulating scn2a

Country Status (16)

Country Link
US (2) US20240026353A1 (en)
EP (1) EP4192476A2 (en)
JP (1) JP2023536994A (en)
KR (1) KR20230048052A (en)
CN (1) CN116322707A (en)
AU (1) AU2021320384A1 (en)
BR (1) BR112023002034A2 (en)
CA (1) CA3186935A1 (en)
CL (1) CL2023000393A1 (en)
CO (1) CO2023002128A2 (en)
EC (1) ECSP23008455A (en)
IL (1) IL300258A (en)
MX (1) MX2023001486A (en)
PE (1) PE20231567A1 (en)
TW (1) TW202221123A (en)
WO (1) WO2022032060A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023192885A2 (en) * 2022-03-28 2023-10-05 Praxis Precision Medicines, Inc. Methods of using oligomeric compounds to treat scn2a-related disorders

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3443001A4 (en) * 2016-04-11 2020-04-29 Obsidian Therapeutics, Inc. Regulated biocircuit systems
EP3700570A4 (en) * 2017-10-23 2021-08-04 Stoke Therapeutics, Inc. Antisense oligomers for treatment of non-sense mediated rna decay based conditions and diseases
US11713463B2 (en) * 2018-01-17 2023-08-01 The Florey Institute Of Neuroscience And Mental Health Compositions and methods for increasing expression of SCN2A
CA3110211A1 (en) * 2018-08-20 2020-02-27 Rogcon, Inc. Antisense oligonucleotides targeting scn2a for the treatment of scn1a encephalopathies

Also Published As

Publication number Publication date
PE20231567A1 (en) 2023-10-04
CA3186935A1 (en) 2022-02-10
IL300258A (en) 2023-03-01
JP2023536994A (en) 2023-08-30
MX2023001486A (en) 2023-03-27
AU2021320384A1 (en) 2023-02-16
KR20230048052A (en) 2023-04-10
TW202221123A (en) 2022-06-01
CL2023000393A1 (en) 2023-09-15
US20240102012A1 (en) 2024-03-28
ECSP23008455A (en) 2023-05-31
WO2022032060A2 (en) 2022-02-10
BR112023002034A2 (en) 2023-04-04
EP4192476A2 (en) 2023-06-14
WO2022032060A3 (en) 2022-03-17
CO2023002128A2 (en) 2023-03-07
CN116322707A (en) 2023-06-23

Similar Documents

Publication Publication Date Title
US11583548B2 (en) Compounds and methods for reducing ATXN3 expression
US11078486B2 (en) Compounds and methods for reducing ATXN2 expression
US11434488B2 (en) Compounds and methods for reducing ATXN3 expression
US20220195431A1 (en) Compounds and methods for reducing atxn3 expression
US20220025366A1 (en) Compounds and methods for reducing prion expression
US20220243203A1 (en) Compounds and methods for reducing fus expression
US20220177893A1 (en) Compounds and methods for reducing kcnt1 expression
US11261446B2 (en) Compounds and methods for modulating UBE3A-ATS
US20240102012A1 (en) Compounds and methods for modulating scn2a
US20230055405A1 (en) Compounds and methods for reducing app expression
US20230043648A1 (en) Compounds and methods for modulating scn1a expression
US11542504B2 (en) Compounds and methods for modulating ATXN1
US11732263B2 (en) Compounds and methods for modulating PLP1
US11786546B2 (en) Compounds and methods for modulating GFAP
WO2022165122A1 (en) Compounds and methods for modulating huntingtin
US20230235331A1 (en) Compounds and methods for reducing msh3 expression
US20230124616A1 (en) Compounds and methods for modulating kcnq2
WO2023164656A2 (en) Compounds and methods for modulating atn1 expression
US20240002852A1 (en) Compounds for modulating chmp7
WO2023028575A2 (en) Compounds and methods for modulating scn1a expression
WO2023122671A2 (en) Compounds and methods for reducing glycogen synthase 1

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION UNDERGOING PREEXAM PROCESSING

AS Assignment

Owner name: IONIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JAFAR-NEJAD, PAYMAAN;BUI, HUYNH-HOA;FREIER, SUSAN M.;AND OTHERS;SIGNING DATES FROM 20210817 TO 20211008;REEL/FRAME:065211/0885

STCB Information on status: application discontinuation

Free format text: ABANDONED -- INCOMPLETE APPLICATION (PRE-EXAMINATION)