US20210108198A1 - Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent and related products thereof - Google Patents

Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent and related products thereof Download PDF

Info

Publication number
US20210108198A1
US20210108198A1 US16/499,283 US201816499283A US2021108198A1 US 20210108198 A1 US20210108198 A1 US 20210108198A1 US 201816499283 A US201816499283 A US 201816499283A US 2021108198 A1 US2021108198 A1 US 2021108198A1
Authority
US
United States
Prior art keywords
lipid
lipid combination
combination
nucleic acid
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US16/499,283
Other languages
English (en)
Inventor
Chengyu Jiang
Jianchao DU
Zhu Liang
Xiaoyun Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Basic Medical Sciences of CAMS
Original Assignee
Institute of Basic Medical Sciences of CAMS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Basic Medical Sciences of CAMS filed Critical Institute of Basic Medical Sciences of CAMS
Assigned to INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES reassignment INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DU, Jianchao, JIANG, CHENGYU, Li, Xiaoyun, LIANG, ZHU
Publication of US20210108198A1 publication Critical patent/US20210108198A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542—Carboxylic acids, e.g. a fatty acid or an amino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/133—Amines having hydroxy groups, e.g. sphingosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0033—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being non-polymeric
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/14—Quaternary ammonium compounds, e.g. edrophonium, choline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/661—Phosphorus acids or esters thereof not having P—C bonds, e.g. fosfosal, dichlorvos, malathion or mevinphos
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7016—Disaccharides, e.g. lactose, lactulose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/702—Oligosaccharides, i.e. having three to five saccharide radicals attached to each other by glycosidic linkages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/14—Esters of carboxylic acids, e.g. fatty acid monoglycerides, medium-chain triglycerides, parabens or PEG fatty acid esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A61K47/544—Phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/007—Pulmonary tract; Aromatherapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C215/00—Compounds containing amino and hydroxy groups bound to the same carbon skeleton
    • C07C215/02—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton
    • C07C215/04—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being saturated
    • C07C215/06—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being saturated and acyclic
    • C07C215/10—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups and amino groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being saturated and acyclic with one amino group and at least two hydroxy groups bound to the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C219/00—Compounds containing amino and esterified hydroxy groups bound to the same carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C07C233/01—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/16—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms
    • C07C233/17—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
    • C07C233/18—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom having the carbon atom of the carboxamide group bound to a hydrogen atom or to a carbon atom of an acyclic saturated carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C57/00—Unsaturated compounds having carboxyl groups bound to acyclic carbon atoms
    • C07C57/02—Unsaturated compounds having carboxyl groups bound to acyclic carbon atoms with only carbon-to-carbon double bonds as unsaturation
    • C07C57/03—Monocarboxylic acids
    • C07C57/12—Straight chain carboxylic acids containing eighteen carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/003—Esters of saturated alcohols having the esterified hydroxy group bound to an acyclic carbon atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/02—Esters of acyclic saturated monocarboxylic acids having the carboxyl group bound to an acyclic carbon atom or to hydrogen
    • C07C69/22—Esters of acyclic saturated monocarboxylic acids having the carboxyl group bound to an acyclic carbon atom or to hydrogen having three or more carbon atoms in the acid moiety
    • C07C69/30—Esters of acyclic saturated monocarboxylic acids having the carboxyl group bound to an acyclic carbon atom or to hydrogen having three or more carbon atoms in the acid moiety esterified with trihydroxylic compounds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/52—Esters of acyclic unsaturated carboxylic acids having the esterified carboxyl group bound to an acyclic carbon atom
    • C07C69/533—Monocarboxylic acid esters having only one carbon-to-carbon double bond
    • C07C69/58—Esters of straight chain acids with eighteen carbon atoms in the acid moiety
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/52—Esters of acyclic unsaturated carboxylic acids having the esterified carboxyl group bound to an acyclic carbon atom
    • C07C69/587—Monocarboxylic acid esters having at least two carbon-to-carbon double bonds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/06—Phosphorus compounds without P—C bonds
    • C07F9/08—Esters of oxyacids of phosphorus
    • C07F9/09—Esters of phosphoric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/06—Phosphorus compounds without P—C bonds
    • C07F9/08—Esters of oxyacids of phosphorus
    • C07F9/09—Esters of phosphoric acids
    • C07F9/10—Phosphatides, e.g. lecithin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00—Indexing scheme relating to specific properties of organic compounds
    • C07B2200/07—Optical isomers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present application relates to various compounds that are extracted from traditional Chinese medicines or are synthetic and that are capable of promoting nucleic acid delivery, and use of the extracted compounds or various combinations thereof to promote the absorption and entry of nucleic acids, such as sRNA, into target cells, and to promote entry into target sites in vivo in a subject in need thereof.
  • nucleic acids such as sRNA
  • nucleic acid molecules include RNA molecules
  • nucleic acid molecules have many properties that make it a therapeutic drug. They can fold to form complex conformations that allow them to bind to proteins, small molecules or other nucleic acids, and some can even form catalytic centers.
  • Small interfering RNA siRNA
  • siRNA small interfering RNA
  • sRNA small interfering RNA
  • sRNA small nucleic acids
  • nucleic acid molecules are easily degraded and have a relatively short half-life in vivo, they are generally considered to be a poor choice as therapeutic drugs.
  • nucleic acid molecules including small RNA
  • the inventor has unexpectedly discovered some lipid components in some traditional Chinese medicines (including Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica ), and these lipids derived from the traditional Chinese medicines can promote absorption/entry of nucleic acids, such as small RNA into cells and/or target parts in a subject in need thereof.
  • the lipid component is synthetic.
  • the present application relates to a compound having the following structure extracted from a traditional Chinese medicine, and use of the compound for the manufacture of a reagent for nucleic acid delivery:
  • L 1 , L 2 or L 3 is absent, or L 1 , L 2 and L 3 are each independently selected from the group consisting of —C(O)O—CH 2 —, —CH(OH)—, —C(O)—NH—CH 2 —, —CH 2 —O—C(O)—, —CH 2 —NH—C(O)—, —C(O)O—, —C(O)NH—, —OC(O)—, —NH—C(O)—, —CH 2 —,
  • the dash “-” on the left side is linked to the central carbon atom, and the dash “-” on the right side is linked to the group Q;
  • A, B and Q are each independently selected from the group consisting of H, —OH, C 1-20 alkyl, C 1-20 alkenyl, C 1-20 heteroalkyl, C 1-20 heteroalkenyl, —NH 2 , and —NR 3 + , R is H or C 1-6 alkyl; and
  • n is an integer 0, 1, 2, 3 or 4;
  • L 1 is absent, or L 1 is selected from —C(O)O—CH 2 — and —CH(OH)—,
  • L 2 is absent, or L 2 is selected from —C(O)O— and —C(O)NH—,
  • L 3 is absent, or L 3 is selected from —C(O)O—, —CH 2 —OC(O)—, —CH 2 — and
  • A is selected from the group consisting of H, C 1-20 alkyl and C 1-20 alkenyl;
  • B is selected from the group consisting of H, —NH 2 , C 1-20 alkyl and C 1-20 alkenyl;
  • Q is selected from the group consisting of H, —OH, C 1-20 alkyl and C 1-20 alkenyl, and —NR 3 + , wherein R is H or C 1-6 alkyl.
  • the compound has the following formula:
  • A is selected from the group consisting of H, C 10-20 alkyl and C 10-20 alkenyl
  • B is selected from the group consisting of H, —NH 2 , C 10-20 alkyl and C 10-20 alkenyl;
  • Q is selected from the group consisting of H, —OH, C 10-20 alkyl and C 10-20 alkenyl, and —NR 3 + , wherein R is H or C 14 alkyl.
  • A is selected from the group consisting of H, a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group;
  • B is selected from the group consisting of H, —NH 2 , a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group;
  • Q is selected from the group consisting of H, —OH, a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group, and —NR 3 + wherein R is H or a C 14 alkyl group; and the alkenyl group in the A, B, Q has 1-5 double bonds.
  • the alkenyl group in the A, B, Q of the structure, has 1-3 double bonds and is in a Z configuration.
  • the said compound is selected from the following formulas:
  • A is selected from a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group;
  • B is selected from a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group
  • Q is selected from the group consisting of H, —OH, a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group, and —NR 3 + wherein R is H or methyl;
  • L 3 is —C(O)O—.
  • the compound is lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyl diglyceride, sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine.
  • the compound is a lipid shown in Table 1.
  • the compound is a lipid shown in Table 1 as No. 11, No. 12, No. 41, No. 71, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 or No. 62.
  • the present application relates to use of a combination comprising any one or more of the above compounds.
  • any one or more of the lipids selected Table 1 for the manufacture of a nucleic acid delivery reagent.
  • the combination comprises any one of the lipids in Table 1 as No. 11, No. 12, No. 41, No. 71, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 or No. 62, or combination thereof with any one or more of the other lipids in Table 1.
  • the present application relates to use of a traditional Chinese medicine for the manufacture of a nucleic acid delivery reagent.
  • the traditional Chinese medicine is selected from Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica Chinese medicine decoction pieces.
  • the reagent comprises a compound extracted from a traditional Chinese medicine.
  • the reagent comprises any one or more of the above compounds, preferably any one or more lipids selected from Table 1.
  • the reagent comprises any one of the lipids shown in Table 1 as No. 11, No. 12, No. 41, No. 71, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 or No. 62, or its combination with any one or more of the other lipids shown in Table 1.
  • the compound is extracted by decoction of a traditional Chinese medicine.
  • the compound is extracted by soaking the traditional Chinese medicine pieces in water, followed by performing intense heating and slow heating sequentially, and then the heated Chinese medicine soup is concentrated, and then is sequentially added with chloroform-methanol, chloroform and water for stirring, and the chloroform layer is obtained.
  • the compound has the structure shown in any one of the preceding embodiments.
  • the compound is selected from lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyldiglyceride, (neural) sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine.
  • the compound is the lipid shown in Table 1 as No. 11, No. 12, No. 41, No. 71, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 or No. 62.
  • the delivery comprises in vitro cell delivery, or in vivo gastrointestinal delivery.
  • the use includes the manufacture of lipid nucleic acid mixture.
  • the lipid nucleic acid mixture is manufactured by a boiling method, or by a reverse evaporation method, or by direct mixing.
  • temperature in said boiling method is from about 25° C. to about 100° C., preferably from about 80° C. to about 100° C.; temperature in the reverse evaporation method is from about 25° C. to about 70° C., preferably about 55° C.
  • the present application relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a compound of the structure of any one of the preceding embodiments and a nucleic acid.
  • the said pharmaceutical composition comprises any one or more of the above compounds, preferably one or more lipids selected from Table 1.
  • the pharmaceutical composition comprises any one of the lipids shown in Table 1 as No. 11, No. 12, No. 41, No. 71, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 or No. 62, or its combination with any one or more of the other lipids shown in Table 1, or its combination with any one or more lipids and other related chemicals.
  • the lipid and nucleic acid are at least partially or wholly existed in the form of lipid nucleic acid mixture.
  • the lipid nucleic acid mixture is manufactured by a boiling method, or by a reverse evaporation method, or by direct mixing.
  • temperature in the boiling method is from 25° C. to about 100° C., preferably from about 80° C. to 100° C.
  • temperature in the reverse evaporation method is from about 25° C. to about 70° C., preferably about 55° C.
  • the present application relates to a kit comprising the lipid and the nucleic acid of the preceding embodiments, wherein the lipid and nucleic acid are each independently provided in a first container and a second container, the first container and the second container are the same or different.
  • the kit comprises any one or more of the above compounds, preferably any one or more lipids selected from Table 1.
  • the kit comprises any one of the lipids shown in Table 1 as No. 11, No. 12, No. 41, No. 71, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60, or No. 62, or its combination with any one or more of the other lipids shown in Table 1, or its combination with any one or more lipids and other related chemicals.
  • the lipid and nucleic acid are at least partially or wholly manufactured into lipid nucleic acid mixture immediately prior to use.
  • the lipid nucleic acid mixture is manufactured by a boiling method, or by a reverse evaporation method, or by direct mixing.
  • temperature in the boiling method is from 25° C. to about 100° C., preferably about 100° C.
  • temperature in the reverse evaporation method is from about 25° C. to about 70° C., preferably about 55° C.
  • the present application relates to a method of delivering a nucleic acid into a target cell, comprising providing the nucleic acid in a form of the pharmaceutical composition or the kit of any one of the preceding embodiments.
  • the present application relates to a method of delivering a nucleic acid into a subject in vivo in need thereof, comprising providing the nucleic acid in a form of the pharmaceutical composition or the kit of any one of the preceding.
  • the subject in the above method, is a human or an animal, such as a mammal.
  • the nucleic acid is delivered to blood circulation or a target tissue/cell in a subject in vivo.
  • the above method comprises directly delivering the pharmaceutical composition or the kit of any one of the preceding embodiments to a subject in need thereof by digestive tract.
  • the nucleic acid and the lipid are manufactured for topical administration and/or injection.
  • nucleic acid and the lipid are manufactured for digestive administration, respiratory administration and/or injection.
  • nucleic acid and the lipid are manufactured for oral administration, inhalation administration and/or injection.
  • nucleic acid is a small RNA
  • nucleic acid has a stem-loop structure
  • the small RNA has a length of 14-32 bp or 18-24 bp, for example, a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bp.
  • the pharmaceutical composition, the kit or the compound can be orally administered.
  • the nucleic acid can be used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • lipids No. 1&2, No. 11&12 or No. 36&37 can represent lipids No. 1 and No. 2 in any ratio, lipids No. 11 or No. 12 in any ratio, lipids No. 36 and No. 37 in any ratio, respectively.
  • the present application also provides a compound having a structure of the following formula, a combination or a composition comprising the compound, and a method of using the compound, combination or composition for nucleic acid delivery, and use of the compound, combination or composition for the manufacture of a nucleic acid delivery reagent:
  • L 1 , L 2 or L 3 is absent, or L 1 , L 2 and L 3 are each independently selected from the group consisting of —C(O)O—CH 2 —, —CH(OH)—, —CH 2 —OC(O), —C(O)O—, —C(O)NH—;
  • the dash “-” on the left side is linked to the central carbon atom, and the dash “-” on the right side is linked to the group Q;
  • A, B and Q is independently selected from the group consisting of H, —OH, C 1-20 alkyl, C 1-20 alkenyl, —NH 2 , and —NR 3 + , R is H or C 1-6 alkyl.
  • the compound can have the following structure:
  • A is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C 15-20 alkyl group and a straight-chain C 15-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 15-20 alkyl group and a straight-chain C 15-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group;
  • the said compound can have the following structure:
  • A is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-22 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-22 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-22 alkenyl group;
  • A is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-22 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-22 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-22 alkenyl group;
  • A is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-20 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-20 alkenyl group.
  • the compound in another embodiment, can have the following structure:
  • A is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C 15-20 alkyl group and a straight-chain C 15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C 15-18 alkyl group and a straight-chain C 15-18 alkenyl group;
  • A is a straight-chain C 15-20 alkyl group
  • B is a straight-chain C 15-18 alkyl group
  • the compound in another embodiment, can have the following structure:
  • A is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C 10-20 alkyl group and a straight-chain C 15-18 alkenyl group;
  • A is a straight-chain C 15-20 alkyl group
  • the compound can be a compound as described above.
  • the compound, the extract or the composition can be derived synthetically, naturally or extracted from a traditional Chinese medicine.
  • nucleic acid liposome can significantly improve the high-efficiency targeted delivery of a nucleic acid, and overcome the shortcomings in the prior art of nucleic acid liposome, including low encapsulation rate, poor safety, poor stability, complicated manufacture process, heterogeneity in product, low reproducibility, and the to-be-improved targeting.
  • alkyl refers to a straight or branched saturated hydrocarbon chain.
  • an alkyl group has 1 to 20 carbon atoms (i.e., C1-20 alkyl), 1 to 8 carbon atoms (i.e., C1-8 alkyl), 1 to 6 carbon atoms (i.e., C1-6 alkyl), or 1 to 4 carbon atoms (i.e., C1-4 alkyl).
  • the alkyl group is a C10-20 alkyl group.
  • the alkyl group is a C15-20 alkyl group.
  • the alkyl group is a C15-18 alkyl group, i.e., a C15, C16, C17, C18 alkyl group.
  • alkenyl refers to an aliphatic group containing at least one carbon-carbon double bond and having 2 to 20 carbon atoms (i.e., C2-20 alkenyl), 2 to 8 carbon atoms (i.e., C2-8 alkenyl), 2 to 6 carbon atoms (i.e., C2-6 alkenyl) or 2 to 4 carbon atoms (i.e., C2-4 alkenyl).
  • the alkenyl group is a C10-20 alkenyl group.
  • the alkenyl group is a C15-20 alkenyl group.
  • the alkenyl group is a C15-18 alkenyl group, i.e. a C15, C16, C17, C18 alkenyl group.
  • heteroalkyl and “heteroalkenyl” as used herein refer to alkyl and alkenyl as defined above, respectively, wherein one or more carbon atoms are each independently substituted by the same or different heteroatom groups. For example, 1, 2 or 3 carbon atoms may be independently substituted by the same or different heteroatom groups.
  • Heteroatom groups include, but are not limited to, —NR1-, —O—, —S—, —S(O)—, —S(O)2-, and the like, wherein R1 is H, alkyl.
  • heteroalkyl groups include —OCH3, —CH2OCH3, —SCH3, —CH2SCH3, —NR1CH3 and —CH2NR1CH3, wherein R1 is hydrogen, alkyl.
  • reverse evaporation method refers to adding an aqueous solution of nucleic acid to an organic solvent solution of lipid, ultrasonicating, evaporating to remove the organic solvent, and then hydrating to obtain a lipid nucleic acid mixture.
  • boiling method refers to adding an organic solvent solution of lipid to an aqueous solution of nucleic acid and boiling at about 100° C. for 30 minutes to obtain a lipid nucleic acid mixture.
  • the method is not limited to heating by boiling, and other means of heating or raising temperature known in the art can also be used.
  • Reverse evaporation method and boiling method are carried out under controlled temperature and mixing conditions. Suitable processing times, and temperatures can be readily determined by a person skilled in the art.
  • the temperature of reverse evaporation method is ranged preferably from about 25° C. to about 70° C., more preferably from about 30° C. to about 65° C., and more preferably from about 40° C. to about 60° C., especially about 55° C.
  • the temperature of boiling method is ranged preferably from about 25° C. to about 100° C., more preferably from about 50° C. to about 100° C., and more preferably from about 95° C. to about 100° C., especially preferably from about 80° C. to 100° C.
  • the nucleic acid as described herein comprises DNA and RNA, preferably small RNA, for example, the small RNA having a length of 14-32 bp, 16-28 bp, 18-24 bp, and particularly, a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 bp.
  • FIG. 1 Effect of 12 lipids on nucleic acid (HJT-sRNA-m7) absorption and entry into cells (human gastric cancer cell line NCI-N87) (reverse evaporation method).
  • FIG. 2 27 single lipidspromote nucleic acid entry into MRC-5 cell line (reverse evaporation method).
  • FIG. 3 23 single lipids promote nucleic acid entry into MRC-5 cell line (boiling method).
  • FIG. 4 23 single lipids promote nucleic acid entry into A549 cell line (boiling method).
  • FIG. 5 Lipid combination can promote nucleic acid entry into MRC-5 cell line (reverse evaporation method).
  • FIG. 6 Lipid combination can promote nucleic acid entry into A549 cell line (reverse evaporation method).
  • FIG. 7 Lipid combination can promote nucleic acid entry into MRC-5 cell line (boiling method).
  • FIG. 8 Lipid combination can promote nucleic acid entry into A549 cell line (boiling method).
  • FIG. 9 Different types of lipid combinations promote nucleic acid entry into Caco-2 cell line (reverse evaporation method).
  • FIG. 10 Different types of lipid combinations promote nucleic acid entry into Caco-2 cell line (boiling method).
  • FIG. 11A-C Single lipids (No. 11 and No. 12) promote nucleic acids having different sequences entry into different cells.
  • FIG. 12 Fluorescence in situ hybridization experiment indicates that the nucleic acids enter into the cytoplasm with the aid of single lipid.
  • FIG. 13 Single lipids (No. 11 and No. 12) promote nucleic acid entry into cells, targeting the gene 3′UTR region.
  • FIG. 14 Single lipids (No. 11 and No. 12) promote nucleic acid entry into blood and lung by digestive tract.
  • FIG. 15 Lipid combinations prepared by reverse evaporation method and boiling method facilitate nucleic acid entry into blood and lung by digestive tract.
  • FIG. 16 Different types of lipid combinations deliver single-stranded nucleic acid into MRC-5.
  • FIG. 17A-B Lipid combinations deliver single-stranded nucleic acid into MRC-5 or Caco-2 cells.
  • FIG. 18 Lipid combinations deliver single-stranded nucleic acid into cells.
  • FIG. 19 Lipid combinations deliver single-stranded nucleic acid into cells.
  • FIG. 20 Lipid combinations deliver single-stranded nucleic acid into cells.
  • FIG. 21 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 22 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 23 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 24 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 25 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 26 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 27 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 28 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 29 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 30 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 31 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 32 Lipid combinations deliver single-stranded nucleic acid into A549 cell.
  • FIG. 33 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 34 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 35 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 36 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 37 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 38 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 39 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 40 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 41 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 42 Lipid combinations deliver double-stranded nucleic acid into A549 cell.
  • FIG. 43 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 44 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 45 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 46 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 47 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 48 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 49 Lipid combinations deliver double-stranded nucleic acid into MRC-5 cell.
  • FIG. 50 Lipid combinations promote nucleic acid entry into lung via digestive tract.
  • FIG. 76 Lipid No. 41 delivers double-stranded RNA into A549 cell by different preparation methods (boiling or reverse evaporation method).
  • FIG. 77 Lipid No. 41 delivers double-stranded RNA into MRC-5 cell by different preparation methods (boiling or reverse evaporation method).
  • FIG. 78 Lipid No. 41 delivers single-stranded RNA into A549 and MRC-5 cells by boiling method.
  • FIG. 79 Digital PCR (ddPCR) technology determines the efficiency of nucleic acid delivery by lipid.
  • FIG. 80 Flow cytometry technology determined the efficiency of nucleic acid delivery by lipid.
  • FIG. 81 Confocal fluorescence microscopy observes the localization of nucleic acid delivered by lipid in cell.
  • FIG. 82 Western Blotting assay determined the efficiency of nucleic acid delivery by lipid.
  • FIG. 83 Single lipid No. 41 mediates anti-fibrotic HJT-sRNA-m7 entry into MRC-5 cell (boiling method).
  • FIG. 91 Lipid 38 delivers double-stranded RNA into A549 and MRC-5 cells by boiling method.
  • FIG. 92 Lipid 38 delivers single-stranded RNA into A549 cells and MRC-5 cells by boiling method.
  • FIG. 93 Digital PCR (ddPCR) technology determined the efficiency of nucleic acid delivery by lipid.
  • FIG. 94 Flow cytometry technology determined the efficiency of nucleic acid delivery by lipid.
  • FIG. 95 Confocal fluorescence microscopy observes the location of nucleic acid delivered by lipid in cell.
  • FIG. 96 Lipid 64 delivers double-stranded RNA into A549 cell by different preparation methods (boiling or reverse evaporation method).
  • FIG. 97 The efficiency of nucleic acid delivery by lipid as determined by flow cytometry technology.
  • FIG. 98 The localization of nucleic acid delivered by lipid in cell as observed by confocal fluorescence microscopy.
  • FIG. 99 The efficiency of nucleic acid delivery by lipid as determined by Digital PCR (ddPCR).
  • FIG. 100 The location of nucleic acid delivered by lipid in cell as observed by confocal fluorescence microscopy.
  • FIG. 101 The efficiency of nucleic acid delivery by lipid as determined by Western Blotting assay.
  • FIG. 102 Single phosphatidylethanolamine lipid 40 mediates anti-fibrotic double-stranded RNA HJT-sRNA-m7 entry into MRC-5 cell to down-regulate fibronectin protein expression level.
  • FIG. 103 Lipid 38 prepared by boiling method delivers single-stranded RNA into A549 and MRC-5 cells.
  • FIG. 104 Lipid 39 prepared by different methods (boiling or reverse evaporation method) delivers double-stranded RNA into A549 cell.
  • FIG. 105 The efficiency of nucleic acid delivery by lipid determined by Digital PCR (ddPCR).
  • FIG. 106 Lipid 60 prepared by different methods (boiling or reverse evaporation method) delivers double-stranded RNA into A549 cell.
  • FIG. 107 Lipid 62 prepared by different methods (boiling or reverse evaporation method) delivers double-stranded RNA into A549 cell.
  • FIG. 108 Lipid No. 41 promotes small RNA entry into blood and protects it from degradation in the blood.
  • FIG. 109 Lipid No. 41 promotes small RNA entry into stomach cell and protects it from degradation in the stomach.
  • FIG. 110 Lipid No. 41 promotes small RNA entry into small intestine cell and protects it from degradation in the small intestine.
  • FIG. 111 Lipid No. 41 promotes small RNA entry into liver and protects it from degradation in the liver.
  • FIG. 112 Single PE (No. 38) effectively delivers single-stranded sRNA nucleic acid into mouse blood by oral administration.
  • FIG. 113 Single PE (No. 40) effectively delivers single-stranded sRNA nucleic acid into mouse blood by oral administration.
  • FIG. 114 Single PE (No. 64) effectively delivers single-stranded sRNA nucleic acid into mouse blood by oral administration.
  • FIG. 115 Single PE (No. 71) effectively delivers single-stranded sRNA nucleic acid into mouse blood by oral administration.
  • FIG. 116 Lipids effectively deliver single-stranded nucleic acid into MRC-5 cell at different temperature gradients.
  • lipid-soluble components were extracted from traditional Chinese medicines (including Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica ) by the Bligh&Dyer method, and the lipid components were identified by HPLC-MS/MS (a total of 138 lipid components were identified, 125 in positive mode, 13 in negative mode). 71 of them (see Table 1-1 to Table 1-3) were used for the preparation of the lipid nucleic acid mixtures, and observed for whether they could promote cellular absorption and entry of exogenous nucleic acids. It should be noted that the lipids used in the present application were commercially purchased or commercially synthesized, and were not directly extracted from traditional Chinese medicines.
  • lipid nucleic acid mixtures that effectively promote cellular absorption and entry of nucleic acid (see FIGS. 1-116 ), having the potential of increasing the efficiency of the nucleic acid drug delivery in clinical settings. Further studies have shown that the lipid nucleic acid mixture of the present application promotes the efficiency of nucleic acid absorption and entry in different cell lines, but differences were observed in different cell lines (see FIGS. 1-10 ), which opens up the possibility of targeted drug delivery. Moreover, nucleic acid delivery by such lipid nucleic acid mixture is not sequence specific, capable of delivering nucleic acid fragments having different sequences and a size corresponding to that of small RNA (e.g. about 20 bp) (see FIG. 11 ).
  • FISH fluorescence in situ hybridization
  • lipids of the present application are capable of promoting entry of nucleic acids, such as sRNA, into cells and modulating (e.g., inhibiting) the expression of their target sequences, while not exhibiting such regulatory effects on non-target sequences, suggesting a target-specific regulation, which can be used as a means for the delivery of nucleic acid drug (see FIG. 13 ).
  • the present application provides compounds extracted from traditional Chinese medicines for facilitating nucleic acid delivery, wherein the said compounds are selected from the group consisting of lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyl diglycerides, sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine, preferably selected from the lipids shown in Table 1.
  • the lipid is non-natural, e.g. synthetic, or manufactured from fermentation.
  • the lipid is used to deliver a nucleic acid into a target cell. In another embodiment, the lipid is used to deliver a nucleic acid into a subject in need thereof and into its blood circulation and/or a target site/cell.
  • the lipid is selected from phosphatidylcholine, e.g., 1-stearoyl-2-oleoyl-sn-glycerol-3-phosphocholine (PC(18:0/18:2), i.e., lipid No. 11 in Table 1), and 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (PC(16:0/18:2), i.e., lipid No. 12 in Table 1).
  • PC 1-stearoyl-2-oleoyl-sn-glycerol-3-phosphocholine
  • PC(16:0/18:2) 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine
  • the lipid may be lipid No. 41 in Table 1, i.e. sphinganine(d22:0), which is capable of efficiently encapsulating nucleic acids or promoting entry of nucleic acids into cells.
  • the present application provides pharmaceutical compositions comprising the above lipids and nucleic acids.
  • the nucleic acid is small RNA.
  • the pharmaceutical composition of the present application can be prepared for administration via non-invasive routes (e.g., topical administration) and/or injection, e.g., administration via digestive tract, respiratory tract, and/or injection, e.g., oral administration, inhalation and/or injection.
  • non-invasive routes e.g., topical administration
  • injection e.g., administration via digestive tract, respiratory tract, and/or injection, e.g., oral administration, inhalation and/or injection.
  • invasive routes are preferred (e.g., injection, including intramuscular, subcutaneous, intravenous, intraarterial, intraperitoneal, and injection into a target tissue; in other cases, non-invasive routes are preferred.
  • lipids and nucleic acids in the pharmaceutical composition of the present application, at least part of or all of the lipids and nucleic acids can be prepared into the form of lipid nucleic acid mixture.
  • lipid nucleic acid mixtures Various methods for the manufacture of lipid nucleic acid mixtures have been widely disclosed, and the suitable method for the manufacture of lipid nucleic acid mixture can be selected according to actual needs.
  • kits comprising the lipids and nucleic acids described herein, wherein the lipids and the nucleic acids are each independently provided in a first container and a second container.
  • the first container and the second container may be the same or different.
  • at least part of or all of the lipids and the nucleic acids are prepared into lipid nucleic acid mixtures immediately prior to use.
  • the present application provides methods of delivering a nucleic acid into a target tissue/cell, wherein the nucleic acid is provided in a form of the pharmaceutical composition or the kit as described herein.
  • the present application provides methods of delivering a nucleic acid into a subject in vivo in need thereof, wherein the nucleic acid is provided in a form of the pharmaceutical composition or the kit as described herein, e.g., delivering the nucleic acid into blood circulation or a target tissue/cell of the subject in vivo, e.g., wherein the lipid and the nucleic acid are administrated by non-invasive routes (e.g., topical administration) and/or injection, e.g., by digestive tract, respiratory tract and/or injection, e.g., by oral administration, inhalation and/or injection.
  • non-invasive routes e.g., topical administration
  • injection e.g., by digestive tract, respiratory tract and/or injection, e.g., by oral administration, inhalation and/or injection.
  • the present application provides methods of preventing and/or treating a disease/disorder that can be prevented and/or treated with a nucleic acid, the methods comprising providing the pharmaceutical composition or the kit described herein to a subject in need thereof, e.g., wherein the lipid and the nucleic acid are administered by non-invasive routes (e.g., topical administration) and/or by injection, e.g., by digestive tract, respiratory tract and/or injection, e.g., by oral administration, inhalation and/or injection.
  • non-invasive routes of administration e.g., by digestive tract, respiratory tract, including oral administration, gavage, inhalation and the like
  • the present application provides methods for the manufacture of the pharmaceutical composition or the kit, and use of the pharmaceutical composition and/or the kit in the methods described in the above aspects.
  • the present application also provided arelipids, pharmaceutical compositions and/or kits for use in the various methods described above.
  • the nucleic acid may be a small RNA, for example, the small RNA may have a length of 14-32 bp, 16-28 bp, 18-24 bp, in particular, a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 bp.
  • the small RNA may be single-stranded, e.g., having a stem-loop structure, or double-stranded.
  • the nucleic acid may be HJT-sRNA-m7 having the following sequence: ugagguagua gguugugugg uuguaagc (SEQ ID NO: 20).
  • the pharmaceutical compositions or the kits or the compounds of the present application can be used for treating a disease, such as cancer, e.g., gastric cancer, lung cancer, and the like.
  • a disease such as cancer, e.g., gastric cancer, lung cancer, and the like.
  • the pharmaceutical compositions or the kits or the compounds of the present application can be used for treating in vitro or in vivo, e.g., to inhibit the growth of NCI-N87 cell (gastric cancer cell), MRC-5 cell (lung fibroblast) and A549 cell (lung cancer cell).
  • NCI-N87 cell gastric cancer cell
  • MRC-5 cell lung fibroblast
  • A549 cell lung cancer cell
  • the lipid nucleic acid mixture can be obtained by a variety of methods, e.g., reverse evaporation method or boiling method.
  • reverse evaporation method an aqueous solution of nucleic acid is added to an organic solvent solution of lipid, ultrasonicated, evaporated to remove the organic solvent, and then hydrated to obtain a lipid nucleic acid mixture.
  • the boiling method described in the present application refers to adding an organic solvent solution of lipid to an aqueous solution of nucleic acid and boiling at about 100° C. for 30 minutes to obtain a lipid nucleic acid mixture.
  • the reverse evaporation method and the boiling method are carried out under controlled temperature and mixing conditions.
  • Suitable processing times and temperatures can be readily determined by a person skilled in the art.
  • the temperature of reverse evaporation method can range preferably from about 25° C. to about 70° C., more preferably from about 30° C. to about 65° C., more preferably from about 40° C. to about 60° C., especially preferably about 55° C.
  • the temperature of the boiling method (also referred to as heating) can range preferably from about 25° C. to about 100° C., more preferably from about 50° C. to about 100° C., more preferably from about 95° C. to about 100° C., especially preferably about 100° C.
  • Exemplary embodiments of the present application include, but are not limited to, the following:
  • Embodiment 1 Use of a compound derived naturally (including a traditional Chinese medicine extract) or synthetically having the following formula for the manufacture of a nucleic acid delivery reagent, wherein the extract has the structure of the following formula or comprises a compound having the structure of the following formula:
  • L1, L2, or L3 is absent, or L1, L2, and L3 are each independently selected from the group consisting of —C(O)O—CH2-, —CH(OH)—, —C(O)—NH—CH2-, —CH2-OC(O)—, —CH2-NH—C(O)—, —C(O)O—, —C(O)NH—, —OC(O)—, —NH—C(O)—, —CH2-,
  • A, B and Q are each independently selected from the group consisting of H, —OH, C1-20 alkyl, C1-20 alkenyl, C1-20 heteroalkyl, C1-20 heteroalkenyl, —NH2, and —NR3+, R is H or C1-6 alkyl; and n is an integer 0, 1, 2, 3 or 4;
  • the nucleic acid is a small nucleic acid, preferably is single stranded or double stranded, preferably the length of the small nucleic acid is 14-32 bp, 16-28 bp or 18-24 bp;
  • the traditional Chinese medicine is selected from the group consisting of decoction pieces of Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica , preferably the extract is obtained by extracting a lipid-soluble component by the Bligh & Dyer method, and more preferably by soaking the Chinese medicine decoction pieces in water, and then sequentially performing intense heating and slow heating, and the heated Chinese medicine soup is concentrated, and then is sequentially added with chloroform-methanol, chloroform and water for stirring, and the chloroform layer is obtained;
  • the reagent is an oral reagent; preferably, the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 2 The use of embodiment 1, wherein in said structure
  • L1 is absent, or L1 is selected from —C(O)O—CH2- and —CH(OH)—,
  • L2 is absent, or L2 is selected from —C(O)O— and —C(O)NH—,
  • L3 is absent, or L3 is selected from the group consisting of —C(O)O—, —CH2-OC(O)—, —CH2- and
  • A is selected from the group consisting of H, C1-20 alkyl and C1-20 alkenyl
  • B is selected from the group consisting of H, —NH2, C1-20 alkyl and C1-20 alkenyl;
  • Q is selected from the group consisting of H, —OH, C1-20 alkyl and C1-20 alkenyl, and —NR3+, wherein R is H or C1-6 alkyl.
  • Embodiment 3 The use of embodiment 1 or 2, wherein the said compound has a structure of the following formula:
  • Embodiment 4 The use of any one of preceding embodiments, wherein in the structure
  • A is selected from the group consisting of H, C10-20 alkyl and C10-20 alkenyl
  • B is selected from the group consisting of H, —NH2, C10-20 alkyl and C10-20 alkenyl;
  • Q is selected from the group consisting of H, —OH, C10-20 alkyl and C10-20 alkenyl, and —NR3+, wherein R is H or C1-4 alkyl.
  • Embodiment 5 The use of embodiment 4, wherein in said structure:
  • A is selected from the group consisting of H, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of H, —NH2, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • Q is selected from the group consisting of H, —OH, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group, and —NR3+ wherein R is H or a C1-4 alkyl group; and the alkenyl group in the A, B, Q has 1-5 double bonds.
  • Embodiment 6 The use of embodiment 5, wherein in the A, B, Q of the said structure, the alkenyl group has 1-4 double bonds and is in a Z configuration.
  • Embodiment 7 The use of embodiment 6, wherein the alkenyl group in the A, B,
  • Q has 1-3 double bonds and is in a Z configuration.
  • Embodiment 8 The use of any one of the preceding embodiments, wherein said extract is selected from the following formulas or comprises a compound selected from the following formulas:
  • A is selected from a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group
  • B is selected from a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group
  • Q is selected from the group consisting of H, —OH, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group, and —NR3+ wherein R is H or methyl;
  • L3 is —C(O)O—.
  • Embodiment 9 The use of any one of the preceding embodiments, wherein the extract is or comprises lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyl diglyceride, (neuro) sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine.
  • Embodiment 10 The use of any one of the preceding embodiments, wherein said extract is selected from lipids shown in Table 1 or comprises any one or more lipids selected from Table 1.
  • Embodiment 11 The use of any one of the preceding embodiments, wherein said extract comprises any one of the lipids shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60, No. 62, or its combination with any one or more of the other lipids in Table 1, or its combination with any one or more lipids and other related chemicals.
  • Embodiment 12 Use of a combination comprising any one or more lipids shown in Table 1 in the manufacture of a nucleic acid delivery reagent, wherein preferably, the combination comprises any one of the lipids shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 and No.
  • the said nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp, preferably the reagent is an oral reagent, preferably the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 13 Use of a traditional Chinese medicine in the manufacture of a nucleic acid delivery reagent, wherein preferably the nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp, preferably the reagent is an oral reagent, preferably the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • a disease such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 14 The use of embodiment 13, wherein said traditional Chinese medicine is selected from Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica Chinese medicine decoction pieces.
  • Embodiment 15 The use of embodiment 13 or 14, wherein the reagent comprises a compound extracted from a traditional Chinese medicine or artificially synthesized, and preferably, the compound is obtained by extracting a lipid-soluble component by the Bligh & Dyer method, or extracting by decoction of traditional Chinese medicine, more preferably, the Chinese medicine decoction pieces are soaked in water, and then performed to intense heating and slow heating, and the heated Chinese medicine soup is concentrated, and then is sequentially added with chloroform-methanol, chloroform and water for stirring, and the chloroform layer is obtained.
  • the reagent comprises a compound extracted from a traditional Chinese medicine or artificially synthesized, and preferably, the compound is obtained by extracting a lipid-soluble component by the Bligh & Dyer method, or extracting by decoction of traditional Chinese medicine, more preferably, the Chinese medicine decoction pieces are soaked in water, and then performed to intense heating and slow heating, and the heated Chinese medicine soup is concentrated, and then is sequentially added with chloro
  • Embodiment 16 The use of embodiment 15, wherein the said compound has the structure shown in any one of embodiments 1 to 11, or the reagent comprises any one or more lipids shown in Table 1, preferably any one of lipids shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 and No. 62, or its combination with any one or more of the other lipids in Table 1, or its combination with any one or more lipids and other related chemicals.
  • Embodiment 17 The use of embodiment 16, wherein the compound is selected from the group consisting of lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyldiglyceride, (neural) sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine.
  • the compound is selected from the group consisting of lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyldiglyceride, (neural) sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine.
  • Embodiment 18 The use of embodiment 17, wherein the compound is selected from Table 1.
  • Embodiment 19 The use of embodiment 18, wherein the said compound is selected from lipids shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 and No. 62.
  • Embodiment 20 The use of any one of embodiments 13-18, wherein the delivery comprises in vitro cell delivery, or in vivo gastrointestinal delivery.
  • Embodiment 21 The use of any one of embodiments 13-20, wherein the use includes the manufacture of lipid nucleic acid mixture.
  • Embodiment 22 The use of embodiment 21, wherein the lipid nucleic acid mixture is manufactured by a boiling method, or by a reverse evaporation method, or by direct mixing.
  • Embodiment 23 The use of embodiment 22, wherein temperature in the boiling method is from about 4° C. to about 100° C., from about 25° C. to about 100° C., preferably from about 80° C. to about 100° C., i.e. 4° C., 37° C., 60° C., 80° C. or 100° C.; temperature in the reverse evaporation method is from about 25° C. to about 70° C., preferably about 55° C.
  • Embodiment 24 A pharmaceutical composition comprising one or more lipid extracts of any structure of embodiments 1-11 and a nucleic acid, preferably the lipid is selected from any one or more lipids in Table 1, preferably any one lipid shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 and No.
  • the nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp, preferably, the pharmaceutical composition is an oral pharmaceutical combination, preferably the pharmaceutical composition is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 25 The pharmaceutical composition of embodiment 24, wherein at least part of or all of the lipids and the nucleic acids exist in the form of lipid nucleic acid mixture.
  • Embodiment 26 The pharmaceutical composition of embodiment 25, wherein the lipid nucleic acid mixture is prepared by a boiling method, or by a reverse evaporation method, or by direct mixing.
  • Embodiment 27 The pharmaceutical composition of embodiment 26, wherein temperature in the boiling method is from about 4° C. to about 100° C., from 25° C. to about 100° C., preferably from about 80° C. to 100° C., i.e. 4° C., 37° C., 60° C., 80° C. or 100° C.; temperature in the reverse evaporation method is from about 25° C. to about 70° C., preferably about 55° C.
  • Embodiment 28 A kit comprising one or more lipids having the structure of embodiments 1-11, preferably the lipid is selected from any one or more lipids in Table 1, preferably shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60, No.
  • nucleic acids wherein the lipid and nucleic acid are each independently provided in a first container and a second container, the first container and the second container are the same or different, wherein preferably the nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp; preferably, the kit is an oral kit, preferably the kit is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • a disease such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 29 The kit of embodiment 28, wherein at least part of or all of said lipid and nucleic acid are prepared into lipid nucleic acid mixture immediately prior to use.
  • Embodiment 30 The kit of embodiment 29, wherein the preparation method of lipid nucleic acid mixture is a boiling method, or a reverse evaporation method, or direct mixing.
  • Embodiment 31 The kit of embodiment 30, wherein temperature in said boiling method is from about 4° C. to about 100° C., from 25° C. to about 100° C., preferably from about 80° C. to about 100° C., i.e. 4° C., 37° C., 60° C., 80° C. or 100° C.; temperature in the reverse evaporation method is from about 25° C. to about 70° C., preferably about 55° C.
  • Embodiment 32 A method of delivering a nucleic acid into a target cell, wherein the nucleic acid is provided in a form of a pharmaceutical composition of any one of embodiments 24-27 or the kit of any one of embodiments 28-31, preferably the nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp; preferably, the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • a disease such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 33 A method of delivering a nucleic acid into a subject in vivo in need thereof, wherein the nucleic acid provided from the pharmaceutical composition of any one of embodiments 24-27 or the kit of any one of embodiments 28-31, wherein preferably said nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably said small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp; preferably said nucleic acid is used for treating a disease such as cancer, for example gastric cancer or lung cancer.
  • a disease such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 34 The method of embodiment 33, wherein the subject is a human or an animal, such as a mammal.
  • Embodiment 35 The method of any one of embodiments 33-34, wherein the nucleic acid is delivered to blood circulation or a target tissue/cell of the subject in vivo.
  • Embodiment 36 The method of embodiment 35, wherein the method includes directly delivering the pharmaceutical composition of any one of embodiments 24-27 or the kit of any one of embodiments 28-31 to a subject in need by digestive tract.
  • Embodiment 37 The pharmaceutical composition of any one of embodiments 24-27, or the kit of any one of embodiments 28-31, wherein the nucleic acid and the lipid are prepared for administration and/or injection.
  • Embodiment 38 The pharmaceutical composition or the kit of embodiment 37, wherein the nucleic acid and lipid are prepared for digestive administration or respiratory administration.
  • Embodiment 39 The pharmaceutical composition or the kit of embodiment 37 or 38, wherein the nucleic acid and lipid are prepared for oral administration or inhalation administration.
  • Embodiment 40 The pharmaceutical composition or the kit of any one of embodiments 37-39, wherein the nucleic acid is a small RNA.
  • Embodiment 41 The pharmaceutical composition or the kit of any one of embodiments 37-40, wherein the nucleic acid has a stem-loop structure.
  • Embodiment 42 The pharmaceutical composition, or the kit of any one of embodiments 37-41, wherein the small RNA has a length of 14-32 bp, or 18-24 bp, for example, the length is of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bp.
  • Embodiment 43 A compound extracted from a traditional Chinese medicine or artificially synthesized can be used for nucleic acid delivery, having the following structure:
  • L1, L2 or L3 is absent, or L1, L2 and L3 are each independently selected from the group consisting of —C(O)O—CH2-, —CH(OH)—, —C(O)—NH—CH2-, —CH2-OC(O)—, —CH2-NH—C(O)—, —C(O)O—, —C(O)NH—, —OC(O)—, —NH—C(O)—, —CH2-,
  • the dash “-” on the left side is linked to the groups A and B, respectively, and the dash “-” on the right side is linked to the central carbon atom;
  • A, B and Q are each independently selected from the group consisting of H, —OH, C1-20 alkyl, C1-20 alkenyl, C1-20 heteroalkyl, C1-20 heteroalkenyl, —NH2, and —NR3+, R is H or C1-6 alkyl; and
  • n is an integer of 0, 1, 2, 3 or 4, preferably the compound is an oral compound; preferably, the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 44 The compound of embodiment 43 wherein
  • L1 is absent, or L1 is selected from the group consisting of —C(O)O—CH2- and —CH(OH)—,
  • L2 is absent, or L2 is selected from the group consisting of —C(O)O— and —C(O)NH—,
  • L3 is absent, or L3 is selected from the group consisting of —C(O)O—, —CH2-OC(O)—, —CH2- and
  • A is selected from the group consisting of H, C1-20 alkyl and C1-20 alkenyl
  • B is selected from the group consisting of H, —NH2, C1-20 alkyl and C1-20 alkenyl;
  • Q is selected from the group consisting of H, —OH, C1-20 alkyl and C1-20 alkenyl, and —NR3+, wherein R is H or C1-6 alkyl, wherein preferably the traditional Chinese medicine is selected from Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica Chinese medicine decoction pieces, preferably the compound is obtained by extracting a lipid-soluble component by the Bligh & Dyer method, more preferably by soaking Chinese medicine decoction pieces in water, and then sequentially performing intense heating and slow heating, and the heated Chinese medicine soup is concentrated, and then is added with chloroform-methanol, chloroform and water for stirring, and the chloroform layer is obtained; preferably, the nucleic acid is a small nucleic acid, preferably is single or double-stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp.
  • Embodiment 45 The compound of embodiment 43 or 44, having the following formula:
  • Embodiment 46 The compound of any one of embodiments 43-45, wherein
  • A is selected from the group consisting of H, C10-20 alkyl and C10-20 alkenyl
  • B is selected from the group consisting of H, —NH2, C10-20 alkyl and C0-20 alkenyl;
  • Q is selected from the group consisting of H, —OH, C10-20 alkyl and C10-20 alkenyl, and —NR3+ wherein R is H or C1-4 alkyl.
  • Embodiment 47 The compound of any one of embodiments 43-46, wherein
  • A is selected from the group consisting of H, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of H, —NH2, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • Q is selected from the group consisting of H, —OH, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group, and —NR3+ wherein R is H or a C1-4 alkyl group;
  • the alkenyl group in the A, B, Q has 1-5 double bonds.
  • Embodiment 48 The compound of any one of embodiments 43-47, wherein in the A, B, Q of the said structure, the alkenyl group has 1-4 double bonds, and is in a Z configuration.
  • Embodiment 49 The compound of any one of embodiments 43-48, wherein in the A, B, Q of the structure, the alkenyl group has 1-3 double bonds and is in a Z configuration.
  • Embodiment 50 The compound of any one of embodiments 43-49, wherein the compound is selected from the following formulas:
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • Q is selected from the group consisting of H, —OH, a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group, and —NR3+ wherein R is H or methyl;
  • L3 is —C(O)O—.
  • Embodiment 51 The compound of any one of embodiments 43-50, wherein the compound is selected from lipids shown in Table 1.
  • Embodiment 52 The compound of any one of embodiments 43-51, wherein the compound is selected from lipids shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 or No. 62.
  • Embodiment 53 A method of facilitating nucleic acid delivery comprising heating or warming up a nucleic acid and a traditional Chinese medicine extract, any compound derived naturally or synthetically, preferably the lipid of any one of embodiments 1 to 11; temperature for heating or warming up is preferably from about 4° C. to about 100° C., from about 25° C. to about 100° C., preferably from about 50° C. to about 100° C., more preferably from about 95° C. to about 100° C., particularly preferably from about 80° C. to about 100° C., i.e. 4° C., 37° C., 60° C., 80° C.
  • the nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp; preferably, the nucleic acid delivery is by oral administration; preferably, the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • a disease such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 54 The method of embodiment 53, wherein the traditional Chinese medicine extract comprises a compound of the structure as set forth in embodiments 1-9.
  • Embodiment 55 The method of embodiment 53, wherein the traditional Chinese medicine extract comprises any one or more lipids shown in Table 1.
  • Embodiment 56 The method of embodiment 53, wherein the tradition Chinese medicine extract comprises any one of lipids shown in Table 1 as No. 41, No. 71, No. 11, No. 12, No. 38, No. 64, No. 40, No. 37, No. 39, No. 60 and No. 62, or its combination with any one or more of the other lipids in Table 1, or its combination with any one or more lipids and other related chemicals.
  • Embodiment 58 Use of a compound having the following formula for the manufacture of nucleic acid delivery reagent:
  • L1, L2 or L3 is absent, or L1, L2 and L3 are each independently selected from the group consisting of —C(O)O—CH2-, —CH(OH)—, —CH2-OC(O), —C(O)O—, —C(O)NH—;
  • the dash “-” on the left side is linked to the groups A and B, respectively, and the dash “-” on the right side is linked to the central carbon atom;
  • A, B and Q are independently selected from the group consisting of H, —OH, C1-20 alkyl, C1-20 alkenyl, —NH2, and —NR3+, R is H or C1-6 alkyl; preferably the reagent is an oral reagent; preferably, the nucleic acid is used for treating a disease, such as cancer, for example gastric cancer or lung cancer.
  • Embodiment 59 The use of embodiment 58, wherein the compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-20 alkyl group and a straight-chain C15-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-20 alkyl group and a straight-chain C15-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • Embodiment 60 The use of embodiment 58, wherein the compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-22 alkenyl group;
  • B is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-22 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-22 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-22 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-22 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-22 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-20 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-20 alkenyl group.
  • Embodiment 61 The use of embodiment 58, wherein the compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-20 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • A is a straight-chain C15-20 alkyl group
  • B is a straight-chain C15-18 alkyl group
  • Embodiment 62 The use of embodiment 58, wherein the compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C15-18 alkenyl group;
  • A is a straight-chain C15-20 alkyl group
  • Embodiment 63 The use of any one of embodiments 1-23, the pharmaceutical composition of any one of embodiments 24-27, the kit of any one of embodiments 28-31, the method of any one of embodiments 32-36 and 53-56, or the method of embodiment 43, wherein the lipid or compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-20 alkyl group and a straight-chain C15-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-20 alkyl group and a straight-chain C15-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • Embodiment 64 The use of embodiment 63, the pharmaceutical composition, the kit, or the method, wherein said compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-22 alkenyl group;
  • B is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-22 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-22 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-22 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-22 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-22 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-20 alkenyl group;
  • Q is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-20 alkenyl group.
  • Embodiment 65 The use of embodiment 63, the pharmaceutical composition, the kit, or the method, wherein the compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • B is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C15-20 alkyl group and a straight-chain C15-18 alkenyl group;
  • B is selected from the group consisting of a straight-chain C15-18 alkyl group and a straight-chain C15-18 alkenyl group;
  • A is a straight-chain C15-20 alkyl group
  • B is a straight-chain C15-18 alkyl group
  • Embodiment 66 The use of embodiment 63, the pharmaceutical composition, the kit, or the method, wherein the compound has the following structure:
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C10-20 alkenyl group;
  • A is selected from the group consisting of a straight-chain C10-20 alkyl group and a straight-chain C15-18 alkenyl group;
  • A is a straight-chain C15-20 alkyl group
  • Negative mode Heater Temp 300° C., Sheath Gas Flow rate, 45 arb, Aux Gas Flow Rate, 15 arb, Sweep Gas Flow Rate, 1 arb, spray voltage, 2.5 KV, Capillary Temp, 350° C., S-Lens RF Level, 60%. Scan ranges: 200-1500.
  • the lipid components were identified by HPLC-MS/MS, and a total of 138 lipid components derived from traditional Chinese medicines were identified, among which 125 were identified in positive mode and 13 in negative mode.
  • the following experiments were performed on compounds No. 1-32 as shown in Table 1.
  • lipid in diethyl ether solution 600 ⁇ l lipid in diethyl ether solution was prepared, and grouped according to the lipid number shown in Table 1, wherein the diethyl ether solution had a concentration of 0.017857 mg/mL for the lipid group No. 1/2/4/9/14/18/19/20/21/22/23/24/25/26/27/28/29/30/32, 0.035714 mg/mL for the lipid group No. 3/8/10/11/12/13, and 0.0035714 mg/mL for the lipid group No.
  • the lipid solution was added to 120 ⁇ l HJT-sRNA-m7 single-stranded RNA in DEPC-treated aqueous solution (15 nmol) in a volume ratio of 5:1, and sonitcated for 3 min. Diethyl ether was removed by evaporation at 55° C., and then 600 DEPC water was added for hydration to give HJT-sRNA-m7 lipid mixture.
  • lipid in chloroform solution 60 ⁇ l lipid in chloroform solution was prepared, and grouped according to the lipid numbers shown in Table 1, wherein the chloroform solution had a concentration of 5 mg/mL for the lipid group No. 1/2/4/9/14/18/19/20/21/22/23/24/25/26/27/28/29/30/32, 10 mg/mL for the lipid group No. 3/8/10/11/12/13, 1 mg/mL for the lipid groupNo. 6/15/16/17/32; the above lipid chloroform solution was mixed with 600 ⁇ l HJT-sRNA-m7 single-stranded RNA in DEPC-treated aqueous solution (15 nmol) and heated at 100° C. for 30 min to give HJT-sRNA-m7 lipid mixture.
  • NCI-N87 cell gastric cancer cell
  • MRC-5 cell lung fibroblast
  • A549 cell lung cancer cell
  • MEM Eagle's MEM medium
  • A549 cell was cultured in Ham's F-12 medium (HyClone)
  • NCI-N87 cell was cultured in RPMI-1640 medium (HyClone); followed by incubation overnight at 37° C., and the follow-up experiments were performed after the cells were attached to the walls.
  • NC group referred to untreated cells; this group served as a negative control group.
  • RNAimax treatment group 2 ⁇ l RNAimax transfection reagent and HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium respectively and then the two were mixed, allowed to stand for 15 min, added into cells and then mixed. The final concentration of HJT-sRNA-m7 was 200 nM; this group served as a positive control group.
  • HJT-sRNA-m7 solution was directly added (the final concentration was 200 nM), and the group served as a negative control group.
  • Lipid nucleic acid mixture the mixture of lipid and HJT-sRNA-m7 prepared from the step 2 were added into cells and mixed, and the final concentration of RNA was kept at 200 nM.
  • the reverse transcription system was as follows: 100 mM dNTPs (with dTTP) 0.15 ⁇ l, MultiScribeTM reverse transcriptase 50 U/ ⁇ l 1.00 ⁇ l, 10 ⁇ RT buffer 1.5 RNase inhibitor (20 U/ ⁇ 1) 0.19 ⁇ l, nuclease-free H 2 O 4.6 ⁇ l, 5 ⁇ l RNA template (200 ng/ ⁇ l) was added after mixing, 3 ⁇ l 5 ⁇ Taqman probe primer was added after mixing, brief centrifuging after mixing, and then kept on ice for 5 min before loading into a PCR reactor.
  • the reaction condition was as follows: (1) 16° C., 30 min; (2) 42° C., 30 min; (3) 85° C., 5 min; (4) 4° C., termination of reaction. 10 ⁇ l RNase-free ddH 2 O was added to make up the final volume to 25 ⁇ l after the reaction.
  • the Taqman probe primer used in the reverse transcription process was synthesized by Invitrogen (U6: 4440887, HJT-sRNA-m7: 4398987).
  • Quantitative PCR amplification reaction qPCR reaction system had a total volume of 10 ⁇ l, containing: 5 ⁇ l 2 ⁇ TaqMan® Universal Master Mix II, with UNG, 0.5 ⁇ l 20 ⁇ Taqman Primer, 1 ⁇ l cDNA by reverse transcription, 3.5 ⁇ l RNase-free dH 2 O.
  • LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 50° C. for 2 min, 95° C. for 10 min for pre-denaturation, followed by PCR amplification cycle: (1) 95° C., 15 s; (2) 60° C., 60 s; (3) 60° C., 60 s; a total of 40 cycles; 40° C. for 10 s in the end to cool down.
  • the Taqman probe for the amplification reaction was designed and synthesized by Invitrogen (U6: 4440887, HJT-sRNA-m7: 4398987).
  • RNA template 150 ng/ ⁇ l
  • 10 ⁇ RT buffer 2.0 ⁇ l
  • 25 ⁇ dNTP Mix 100 mM
  • U6 RT stem-loop primer 2.0 ⁇ l
  • HJT-sRNA-RT-m7 stem-loop primer 2.0 ⁇ l
  • MultiScribeTM reverse transcriptase 1.0 ⁇ l
  • RNase inhibitor 1.0 ⁇ l
  • nuclease-free H 2 O 1.2 ⁇ l loaded into a PCR reactor after brief centrifugation, the reaction conditions were as follows: (1) 25° C., 10 min; (2) 37° C., 120 min; (3) 85° C., 5 min; (4) 4° C
  • the stem-loop primer used in the reverse transcription process was synthesized by Beijing Tsingke Biotechnology Co., Ltd. (U6 RT primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT ATG (SEQ ID NO: 21); HJT-sRNA-m7 RT stem-loop primer: GTCGTATCCAGTGCACGCTCCGAGGTATTCGCACTGGATACGACGCTTAC AA (SEQ ID NO: 22)).
  • the qPCR reaction system has a total volume of 10 ⁇ l, containing: 5 ⁇ L 2 ⁇ SYBR Green Master Mix, 0.5 ⁇ l forward primer (10 ⁇ M), 0.5 ⁇ l reverse primer (10 ⁇ M), 1 ⁇ l cDNA by reverse transcription, 3 ⁇ l RNase-free dH 2 O.
  • LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95° C. for 5 min for pre-denaturation, followed by PCR amplification cycle: (1) 95° C., 10 s; (2) 55° C., 10 s; (3) 72° C., 20 s; a total of 40 cycles; 40° C.
  • FISH Fluorescence In situ Hybridization
  • the culture plate was placed in a hybridization cassette in hybridization buffer (50% formamide, 5 ⁇ SSC, 5 ⁇ Denharts, 250 ⁇ g/mL yeast RNA, 500 ⁇ g/mL herring sperm DNA) and pre-incubated at room temperature for 1 hour.
  • hybridization buffer 50% formamide, 5 ⁇ SSC, 5 ⁇ Denharts, 250 ⁇ g/mL yeast RNA, 500 ⁇ g/mL herring sperm DNA
  • RNA probes HJT-sRNA-m7 probe: 5′-GCTTACAACCACACAACCTACTACCTCA-3′ (SEQ ID NO: 27), Scrambled probe: 5′-CAGTACTTTTGTGTAGTACAA-3′ (SEQ ID NO: 28), U6 probe: 5′-TTTGCGTGTCATCCTTGCG-3′ (SEQ ID NO: 29)
  • the concentration of RNA probes was 0.1-0.2 ng/ ⁇ 1
  • denature 85° C. for 5 min, and quickly place it on ice.
  • Lipid nucleic acid mixtures were prepared according to the reverse evaporation method and the boiling method described in Step 2. The in vitro delivery experiment was carried out using the lipid nucleic acid mixtures according to steps 3.1-3.3, and the abundance of intracellular RNA was determined.
  • FIGS. 1-4 The experimental results were shown in FIGS. 1-4 .
  • FIGS. 1-2 indicated that the lipid nucleic acid mixtures prepared by the reverse evaporation method could successfully deliver nucleic acids to NCI-N87 and MRC-5 cells;
  • FIGS. 3-4 showed that the lipid nucleic acid mixtures prepared by the boiling method could successfully deliver nucleic acids to MRC-5 and A549 cells.
  • lipid nucleic acid mixtures 3/8/10/13, 1 mg/mL for the lipid combination of No. 5/16/17) were prepared.
  • the above lipids were mixed in equal volume to obtain the mixed lipids and to prepare the lipid nucleic acid mixtures by the reverse evaporation method and the boiling method, respectively, as described below.
  • the in vitro delivery experiment was carried out using the lipid nucleic acid mixtures according to steps 3.1-3.3, and the abundance of intracellular RNA was determined.
  • lipid combination in diethyl ether solution was added to 40 ⁇ l HJT-sRNA-m7 aqueous solution (5 ⁇ M) at a volume ratio of 5:1 between the lipid solution and the RNA, and sonicated for 3 min; diethyl ether was removed by evaporation at 55° C., and then 200 ⁇ l DEPC water was added for hydration to obtain lipid nucleic acid mixture.
  • FIGS. 5-8 The experimental results were shown in FIGS. 5-8 .
  • FIGS. 5-6 demonstrated the mixture of lipid combination and nucleic acid prepared by the reverse evaporation method could successfully facilitate nucleic acid entry into a target cell
  • FIGS. 7-8 demonstrated the mixture of lipid combination and nucleic acid by the boiling method could successfully facilitate nucleic acid entry into a target cell.
  • Combination 1 combination of lipids No. 1-32, No. 1/2/3/4/6/8/9/10/13-32 without lipids No. 5, 7, 11, and 12;
  • Combination 2 combination 1 without lipid No. 29
  • Combination 3 combination 1 without lipids No. 1, 2, 3, 19;
  • Combination 4 combination 1 without lipids No. 4, 14;
  • Combination 5 combination 1 without lipids No. 6, 9, 10, 13, 15, 16, 18, 20-28, 32;
  • Combination 6 combination 1 without lipid No. 8
  • Combination 7 combination 1 without lipids No. 17, 30, 31;
  • DG combination combination of lipids No. 1, 2, 3, 19;
  • TG combination combination of lipids No. 6, 9, 10, 13, 15, 16, 18, 20-28, 32;
  • PE combination lipid No. 8;
  • the experimental results were shown in FIGS. 9-10 .
  • the results showed that different types of lipid combination (e.g., mixture of TG, mixture of DG, etc.) by different methods (boiling or reverse evaporation) could promote nucleic acid entry into a target cell.
  • lipids No. 11 and No. 12 were selected for experiments to investigate the efficiency of the lipids to deliver nucleic acid fragments having different sequences, as well as the localization and the targeted gene regions of the nucleic acids.
  • the protocols were as follows:
  • RNAimax Lipofectamine RNAimax (transfection reagent 6 ⁇ l/well). The abundance of sRNA in the cells was detected by Taqman probe after 3 hours, and the relative expression level of sRNA was calculated by 2- ⁇ Ct method.
  • FIGS. 11-13 The experimental results were shown in FIGS. 11-13 .
  • FIGS. 11A-C showed that compared with the control, the two lipids (lipid No. 11 (18:0/18:2) and lipid No. 12 (16:0/18:2)) could effectively facilitate nucleic acid molecules of different sequences entry into various cells;
  • FIG. 12 showed that nucleic acids that were delivered by lipid No. 11(18:0/18:2) and lipid No. 12 (16:0/18:2) entered into cytoplasm and were primarily localized in cytoplasm.
  • the inventor unexpectedly found that both lipids No. 11 and No.
  • lipid nucleic acid mixture the mixture of lipid No. 11 or No. 12 with nucleic acid, and the mixture of the lipid combination of No. 1/2/4/9/14/18/19/20/21/22/23/24/25/26/27/28/29/30/32, No. 3/8/10/11/12/13, and No. 6/15/16/17/31 with nucleic acid were prepared by reverse evaporation and boiling method (refer to steps 2.1-2.2).
  • Control group no treatment or HJT-sRNA-m7 was given by gavage;
  • Lipid No. 11 (18:0/18:2) group lipid No. 11 (18:0/18:2) or a mixture of lipid No. 11 (18:0/18:2) and HJT-sRNA-m7 were given by gavage;
  • Lipid No. 12 (16:0/18:2) group lipid No. 12 (16:0/18:2) or a mixture of lipid No. 12 (16:0/18:2) and HJT-sRNA-m7 were given by gavage;
  • RNA extraction (1) Add TRIzol or TRIzol-LS lysis buffer (Sigma Corporation) to the cells, which were then left at room temperature for 5 min to be fully lysed (for mouse lung tissue, to 100 mg tissue was added 1.0 mL TRIzol lysis buffer, and the solution was ground with a homogenizer, centrifuged at 12,000 rpm, 4° C. for 10 min to remove the tissue precipitate which was not homogenized; for the mouse whole blood, to 500 ⁇ l of whole blood was added 1.5 mL TRIzol-LS lysis buffer centrifuged at 12,000 rpm, 4° C.
  • lipid No. 11 (18:0/18:2) and lipid No. 12 (16:0/18:2) could promote entry of small fragments of nucleic acids into the blood and lung by (non-invasive) gavage, which can be used as a means for the delivery of nucleic acid drug.
  • the lipid nucleic acid mixture obtained by direct boiling method achieved a significant delivery effect.
  • the mixture of lipid combination with nucleic acid obtained by direct boiling method achieved a significant delivery effect.
  • Negative mode Heater Temp 300° C., Sheath Gas Flow rate, 45 arb, Aux Gas Flow Rate, 15 arb, Sweep Gas Flow Rate, 1 arb, spray voltage, 2.5 KV, Capillary Temp, 350° C., S-Lens RF Level, 60%. Scan ranges: 200-1500.
  • the lipid components were identified by HPLC-MS/MS, and a total of 138 lipid components derived from traditional Chinese medicine were identified, among which 125 were identified in positive mode and 13 in negative mode.
  • the following experiments was performed on the compounds 1-69 shown in Table 1. It should be noted that the lipids tested below were all commercially purchased or commercially synthesized, and used as described in Table 1-1.
  • lipid in diethyl ether solution 100 ⁇ l lipid in diethyl ether solution was prepared, and grouped according to the lipid numbers shown in Table 1 (the lipid concentrations are shown in the table below).
  • nucleic acid solution HJT sRNA or siRNA
  • the diethyl ether was removed by evaporation at 55° C., and then 100 ⁇ l DEPC water was added for hydration to give nucleic acid lipid mixture.
  • nucleic acid solution HJT sRNA or siRNA
  • RT-qPCR Real-Time Quantitative PCR
  • MRC-5 cell pulmonary embryonic fibroblast
  • A549 cell human lung adenocarcinoma cell
  • Caco-2 cell human colon adenocarcinoma cell
  • MEM Eagle's MEM medium
  • A549 cells were cultured in Ham's F-12 medium (HyClone); followed by incubation overnight at 37° C., and the follow-up experiments were performed after the cells were attached to the walls.
  • naive group it referred to untreated cells, and this group served as a blank control group.
  • RNAimax treatment group 2 ⁇ l LipofectamineTMRNAimax transfection reagent (full name of Lipofectamine RNAiMAX, Invitrogen, Thermo Fisher Scientific) and HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium (purchased from Invitrogen, Thermo Fisher Scientific) respectively and then the two were mixed, allowed to stand for 15 min, added into cells and then mixed. The final concentration of HJT-sRNA-m7 was 100 nM; this group served as a positive control group.
  • HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM), and the group served as a negative control group.
  • Lipid nucleic acid mixture the mixture of lipid and HJT-sRNA-m7 prepared from the step 2 were added into cells and mixed, and the final concentration of HJT-sRNA-m7 was 100 nM.
  • RNA was reverse transcribed to cDNA: Reverse Transcription Kit High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. no. 4368813 was used to reverse transcribe sRNA to cDNA by stem-loop method (see, e.g. Real-time quantification of microRNAs by stem-loop RT-PCR, Nucleic Acids Res. 2005 Nov. 27; 33(20):e179, incorporated by reference herein).
  • the reverse transcription system was as follows: template RNA (150 ng/ ⁇ L) 10 ⁇ L, 10 ⁇ RT buffer 2.0 ⁇ L, 25 ⁇ dNTP Mix (100 mM) 0.8 ⁇ L, U6 RT stem-loop primer 2.0 ⁇ L, HJT-sRNA-m7 RT stem-Loop primer 2.0 ⁇ L, MultiScribeTM reverse transcriptase 1.0 ⁇ L, RNase inhibitor 1.0 ⁇ L, nuclease-free H 2 O 1.2 ⁇ L, loaded into a PCR reactor after brief centrifugation.
  • the reaction conditions were as follows: (1) 25° C., 10 min; (2) 37° C., 120 min; (3) 85° C., 5 min; (4) 4° C., termination of reaction.
  • the stem-loop primer used in the reverse transcription process was synthesized by Beijing Tsingke Biotechnology Co., Ltd. (U6 RT primer, because the quantification of small RNA by RT-qPCR reaction can only be relative, so U6 was used as a standard reference gene for calculating relative expression level): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT ATG (SEQ ID NO: 21); HJT-sRNA-m7 RT stem-loop primer: GTCGTATCCAGTGCACGCTCCGAGGTATTCGCACTGGATACGACGCTTAC AA (SEQ ID NO: 22)).
  • the qPCR reaction system had a total volume of 10 ⁇ l, containing: 5 ⁇ L 2 ⁇ SYBR Green Master Mix, 0.5 ⁇ l forward primer (10 ⁇ M), 0.5 ⁇ l reverse primer (10 ⁇ M), 1 ⁇ l cDNA by reverse transcription, 3 ⁇ l RNase-free dH 2 O.
  • LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95° C., pre-denaturation for 5 min, followed by PCR amplification cycle: (1) 95° C., 10 s; (2) 55° C., 10 s; (3) 72° C., 20 s; a total of 40 cycles; 40° C.
  • RT-qPCR Real-Time Quantitative PCR
  • THP-1 cell human monocyte
  • RPMI-1640 medium HyClone
  • naive group referred to untreated THP-1 cells, and this group served as a blank control group.
  • RNAiMAX treatment group 2 ⁇ l LipofectamineTMRNAimax transfection reagent (Invitrogen, Thermo Fisher Scientific) and nucleic acid solution (TNF ⁇ siRNA) were diluted in 100 ⁇ l opti-MEM medium (Invitrogen, Thermo Fisher Scientific) respectively and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of nucleic acid was 400 nM; this group served as a positive control group.
  • Lipid nucleic acid mixture the mixture of lipid and nucleic acid prepared from the step 2 were added into cells and mixed, and the final concentration of nucleic acid was to 400 nM.
  • E. coli LPS Lipopolysaccharide, LPS, Escherichia coli 0111:B4, L4391, Sigma-Aldrich
  • TRIzol lysis buffer After 9 hours of treatment, the cells were stimulated with 1 ⁇ g/mL E. coli LPS (Lipopolysaccharide, LPS, Escherichia coli 0111:B4, L4391, Sigma-Aldrich), and harvested using TRIzol lysis buffer after 9 hours to extract total RNA.
  • the mRNA expression level of TNF- ⁇ was determined by RT-qPCR (SYBR Green dye method), and the protocols were as follows:
  • the reverse transcription system was as follows: template RNA (150 ng/ ⁇ L) 10 ⁇ L, 10 ⁇ RT buffer 2.0 ⁇ L, 25 ⁇ dNTP Mix (100 mM) 0.8 ⁇ L, random primers 2.0 ⁇ L, MultiScribeTM reverse transcriptase 1.0 RNase inhibitor 1.0 ⁇ L, nuclease-free H 2 O 3.2 ⁇ L, loaded into a PCR reactor after brief centrifugation.
  • reaction conditions were as follows: (1) 25° C., 10 min; (2) 37° C., 120 min; (3) 85° C., 5 min; (4) 4° C., termination of reaction. 20 ⁇ l RNase-free dd H 2 O was added to make up the final volume to 40 ⁇ l after the reaction.
  • Quantitative PCR amplification reaction the total volume of qPCR reaction system was 10 ⁇ l, containing: 5 ⁇ L 2 ⁇ SYBR Green Master Mix, 0.5 ⁇ l forward primer (10 ⁇ M), 0.5 ⁇ l reverse primer (10 ⁇ M), 1 ⁇ l cDNA by reverse transcription, 3 ⁇ l RNase-free dH 2 O.
  • LightCycler 480 fluorescence quantitative PCR instrument was used, the PCR reaction conditions were: 95° C., pre-denaturation for 5 min, followed by PCR amplification cycle: (1) 95° C., 10 s; (2) 55° C., 10 s; (3) 72° C., 20 s; a total of 40 cycles; 40° C. for 10 s in the end to cool down.
  • Both the forward and reverse primers of the amplification reaction were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd.
  • the primer sequences were as follows: forward primer for internal reference gene UBC: CTGGAAGATGGTCGTACCCTG (SEQ ID NO: 30), reverse primer for internal reference gene UBC: GGTCTTGCCAGTGAGTGTCT (SEQ ID NO: 31); forward primer for target gene TNF- ⁇ : CTGCCCCAATCCCTTTATT (SEQ ID NO: 32): reverse primer for target gene TNF- ⁇ : CCCAATTCTCTTTTTGAGCC (SEQ ID NO: 33).
  • MRC-5 cell pulmonary embryonic fibroblast
  • A549 cell human lung adenocarcinoma cell
  • MRC-5 cells were cultured to logarithmic growth phase, and then plated into 12-well plates at a cell density of 6 ⁇ 10 5 /1 mL medium/well
  • MRC-5 cells were cultured in Eagle's MEM medium (MEM, Gibco)
  • A549 cells were cultured in Ham's F-12 medium (HyClone); followed by incubation overnight at 37° C., and the follow-up experiments were performed after the cells were attached to the walls.
  • Naive group it referred to the untreated cells, and this group served as a blank control group.
  • RNAiMAX treatment group 2 ⁇ l LipofectamineTMRNAimax transfection reagent (Invitrogen, Thermo Fisher Scientific) and nucleic acid solution were diluted in 100 ⁇ l opti-MEM medium (Invitrogen, Thermo Fisher Scientific) respectively and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of nucleic acid was 400 nM; this group served as a positive control group.
  • Lipid nucleic acid mixture the mixture of lipid and nucleic acid prepared from the step 2 were added into cells and mixed, and the final concentration of nucleic acid was 400 nM.
  • the cells were stimulated with the stimulant (1 ⁇ g/mL poly (I:C) (P1530, Sigma-Aldrich) as double-stranded RNA viruses mimetics) or 3 ng/mL transforming growth factor TGF ⁇ 1 (Pepro Tech)).
  • the stimulant (1 ⁇ g/mL poly (I:C) (P1530, Sigma-Aldrich) as double-stranded RNA viruses mimetics) or 3 ng/mL transforming growth factor TGF ⁇ 1 (Pepro Tech)).
  • the cells were harvested using strong RIPA lysis buffer, and after incubation for some time, Western blot was used to detect the protein expression level of the related genes (the types of the related gene varied case by case and were indicated in the corresponding Figures) (the protein expression level of REL-A was detected 24 hours after the A549 cells were stimulated by poly(I:C) with ⁇ -actin as the internal reference protein; the protein expression levels of fibronectin and ⁇ -SMA were detected 72 hours after MRC-5 cells were stimulated with TGF- ⁇ 1 with GAPDH as the internal reference protein; the protein expression of the corresponding knockdown genes was detected in the siRNA delivery assay with ⁇ -actin as the internal reference protein).
  • the protocols were as follows:
  • Protein electrophoresis add electrophoresis buffer and use an initial voltage of 80V for electrophoresis; when the bromophenol blue dye reach the resolving gel, increase the voltage to 120V and continue electrophoresis until the bromophenol blue dye reach the bottom or completely out of the resolving gel;
  • Blocking place the membrane in a 3% BSA blocking solution after the transfer and block at room temperature for 1 hour;
  • HJT-sRNA-m7 (5 nmol) single-stranded RNA in DEPC-treated solution was added 9 ⁇ L or 18 ⁇ L lipid combinations (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V) respectively, mixed and heated at 100° C. for 30 min.
  • lipid PE No. 38
  • LPC No. 37
  • TG No. 32
  • HJT-sRNA-m7 aqueous solution or the mixture solution of lipid and HJT-sRNA-m7 were administered using a gavage needle, 400 ⁇ L/animal (HJT)-sRNA-m7, 5 nmol/animal).
  • the groups were as follows:
  • Control group mice that did not receive any treatment
  • Negative control group lipid group: intragastric administration of 9 ⁇ L lipid combinations (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V);
  • Free uptake group direct intragastric administration of HJT-sRNA-m7 single-stranded RNA solution
  • Lipid and nucleic acid mixture group intragastric administration of the mixture of lipid combination and HJT-sRNA-m7 single-stranded RNA.
  • the single stranded HJT-sRNA-m7 solution refers to single-stranded HJT-sRNA-m7 in DEPC-treated aqueous solution.
  • the double-stranded HJT-sRNA-m7 solution refers to a double-stranded HJT-sRNA-m7 in DEPC-treated aqueous solution.
  • Example 1-1 Delivery of Single-Stranded Nucleic Acids into MRC-5 Cell by Different Types of Lipid Combination
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 in DEPC-treated aqueous solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 200 nM;
  • Lipid nucleic acid mixture mixtures of 3 ⁇ L single lipid or lipid combination and HJT-sRNA-m7 single-stranded nucleic acid solution treated by boiling method were added to the cells and mixed. The final concentration of RNA was 200 nM.
  • MG monoglyceride: 3 ⁇ L lipid No. 34;
  • DG diglyceride: 3 ⁇ L mixture of equal volume of lipids No. 1/2/3/19/35 in chloroform solution;
  • TG triglyceride: 3 ⁇ L mixture of equal volume of lipids No. 6/9/10/13/15/16/18/20/21/22/23/24/25/26/27/28/32/33 in chloroform solution;
  • LPC Lisophosphatidylcholine: 3 ⁇ L mixture of equal volume of lipids No. 36/37 in chloroform solution;
  • PC phosphatidylcholine: 3 ⁇ L mixture of equal volume of lipids No. 11/12 in chloroform solution;
  • PE phosphatidylethanolamine
  • So Sphingoshine: 3 ⁇ L mixture of equal volume of lipids No. 17/30/31 in chloroform solution;
  • Mixture 8 3 ⁇ L mixture of equal volume of lipids No. 1-36 (without No. 5/7/29) in chloroform solution;
  • Example 1-2 Delivery of Single-Stranded Nucleic Acids into MRC-5 Cell and Caco-2 Cell by Lipid Combination
  • Cells to be tested were MRC-5 cell and Caco-2 cell.
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 200 nM;
  • Treatment group with single lipid and nucleic acid a mixture of 3 ⁇ L single lipid (No. 1 or 8 or 12) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 200 nM;
  • lipid combination mixture and nucleic acid mixture Treatment group with lipid combination mixture and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (No. 1/8/12 mixed in equal volumes) and HJT-sRNA-m7 single-stranded nucleic acid solution treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 200 nM;
  • Treatment group with lipid combination and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (a mixture of 2 ⁇ L single lipid No. 1 or No. 8 or No. 12 and 1 ⁇ L of the following types of lipids (MG, DG, TG, LPC, Cer, So, or FA)) and HJT-sRNA-m7 single-stranded nucleic acid solution that were treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 200 nM.
  • the treatment groups were collectively represented as No. 1 2 ⁇ L+mix 1 ⁇ L, No. 8 2 ⁇ L+mix 1 ⁇ L, and No.
  • MG monoglyceride: 2 ⁇ L lipid No. 34;
  • DG diglyceride: 2 ⁇ L mixture of equal volume of lipids No. 1/2/3/19/35 in chloroform solution;
  • TG triglyceride: 2 ⁇ L mixture of equal volume of lipids No. 6/9/10/13/15/16/18/20/21/22/23/24/25/26/27/28/32/33 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • Cer (Ceramides) 2 ⁇ L mixture of equal volume of lipids No. 4/14 in chloroform solution;
  • FA fatty acid
  • the mixtures (No. 1/8/12 in equal volume), No. 1 2 ⁇ L+No. 8 1 ⁇ L, No. 1 2 ⁇ L+No. 12 1 ⁇ L, No. 1 2 ⁇ L+MG 1 ⁇ L, No. 8 2 ⁇ L+MG 1 ⁇ L, No. 12 2 ⁇ L+No. 8 1 ⁇ L, No. 12 2 ⁇ L+LPC 1 ⁇ L and No. 12 2 ⁇ L+So 1 ⁇ L, delivered nucleic acid more efficiently.
  • Example 1-3 Delivery of Single-Stranded Nucleic Acid into Cell by Lipid Combination
  • Cell types A549, MRC-5 and Caco-2 cells.
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • Treatment group by single lipid and nucleic acid a mixture of 3 ⁇ L single lipid (No. 8 or No. 12) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination PC No. 12
  • PE No. 8
  • nucleic acid mixture a mixture of 2.25 ⁇ L lipid combination (PC (No. 12) & PE (No. 8), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • Treatment group by lipid combination and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (mixture of 2.25 ⁇ L lipid combination PC (No. 12) & PE (No. 8) and 0.75 ⁇ L of the following types of lipid, DG, TG, LPC, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that were treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM.
  • the mixture treatment group corresponds to the treatment groups within the horizontal line above “2.25 ⁇ L+0.75 ⁇ L”.
  • DG diglyceride: 0.75 ⁇ L mixture of equal volume of lipids No. 1/2 in chloroform solution;
  • TG triglyceride: 0.75 ⁇ L lipid No. 15 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • FA fatty acid
  • Example 1-4 Delivery of Single-Stranded Nucleic Acid into Cells by Lipid Combination
  • Cell types A549, MRC-5 and Caco-2 cells.
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • Treatment group of single lipid and nucleic acid a mixture of 3 ⁇ L single lipid (No. 8 or No. 12) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination DG (No. 1) & PE (No. 8) & PC (No. 12) and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (DG (No. 1) & PE (No. 8) & PC (No. 12), 1:1:1, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • Treatment group of lipid combination and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (mixture of 2 ⁇ L lipid combination DG (No. 1) & PE (No. 8) & PC (No. 12) and 1 ⁇ L of the following types of lipids, DG, TG, LPC, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM.
  • the mixture treatment groups correspond to the treatment groups within the horizontal line above 2 ⁇ L lipid combination DG (No. 1) & PE (No. 8) & PC (No. 12))+1 ⁇ L.
  • DG diglyceride: 1 ⁇ L mixture of equal volume of lipids No. 1/2 in chloroform solution;
  • TG triglyceride: 1 ⁇ L lipid No. 15 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • FA fatty acid
  • Example 1-5 Delivery of Single-Stranded Nucleic Acid into Cell by Lipid Combination
  • Cell types A549, MRC-5 and Caco-2 cells.
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • Treatment group of single lipid and nucleic acid a mixture of 3 ⁇ L single lipid of No. 8 and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination PE (No. 8) & MG (No. 34) and nucleic acid mixture a mixture of 2.25 ⁇ L lipid combination (PE (No. 8) & MG (No. 34), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • Treatment group of lipid combination and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (mixture of 2.25 ⁇ L lipid combination PE (No. 8) & MG (No. 34) and 0.75 ⁇ L of the following types of lipid, DG, TG, LPC, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM.
  • the mixture treatment group corresponds to the treatment groups within the horizontal line above “2.25 ⁇ L [lipid combination PE (No. 8) & MG (No. 34)]+0.75 ⁇ L”.
  • DG diglyceride: 0.75 ⁇ L mixture of equal volume of lipids No. 1/2 in chloroform solution;
  • TG triglyceride: 0.75 ⁇ L lipid No. 15 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • FA fatty acid
  • Example 1-6 Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • Treatment group of single lipid and nucleic acid a mixture of 3 ⁇ L single lipid No. 38 and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cell, and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination and nucleic acid mixture Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (mixture of 2 ⁇ L, single lipid No. 38 and 1 ⁇ L, of the following types of lipid, MG, DG, TG, LPC, PC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • MG monoglyceride: 1 ⁇ L lipid No. 34;
  • DG diglyceride: 1 ⁇ L lipid No. 1 in chloroform solution;
  • TG triglyceride: 1 ⁇ L lipid No. 15 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • PE phosphatidylethanolamine
  • FA fatty acid
  • Example 1-7 Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • lipid combination DG (No. 1) & PE (No. 38) & PC (No. 12) and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (DG (No. 1) & PE (No. 38) & PC (No. 12), 1:1:1, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination and nucleic acid mixture Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (mixture of 2 ⁇ L lipid combination DG (No. 1) & PE (No. 38) & PC (No. 12) and 1 ⁇ L of the following types of lipid, MG, TG, LPC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM.
  • 3 lipid combination mixture of 3 ⁇ L lipid combination (mixture of 2 ⁇ L lipid combination DG (No. 1) & PE (No. 38) & PC (No. 12) and 1 ⁇ L of the following types of lipid, MG, TG, LPC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells
  • MG monoglyceride: 1 ⁇ L lipid No. 34;
  • TG triglyceride: 1 ⁇ L lipid No. 15 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • PE phosphatidylethanolamine
  • FA fatty acid
  • Example 1-8 Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • lipid combination PE No. 38 & MG (No. 34) and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (PE (No. 38) & MG (No. 34), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination and nucleic acid mixture Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (mixture of 2 ⁇ L lipid combination PE (No. 38) & MG (No. 34) and 1 ⁇ L of the following types of lipid, DG, TG, LPC, PC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;
  • DG diglyceride: 1 ⁇ L lipid No. 1 in chloroform solution;
  • TG triglyceride: 1 ⁇ L lipid No. 15 in chloroform solution;
  • LPC Lisophosphatidylcholine
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • FA fatty acid
  • Example 1-9 Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • lipid combination PE No. 38 & PC (No. 12) and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (PE (No. 38) & PC (No. 12), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination and nucleic acid mixture Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 ⁇ L lipid combination (mixture of 2 ⁇ L lipid combination PE (No. 38) & PC (No. 12) and 1 ⁇ L of the following types of lipid, MG, DG, TG, LPC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;
  • MG monoglyceride: 1 ⁇ L lipid No. 34;
  • DG diglyceride: 1 ⁇ L lipid No. 1 in chloroform solution;
  • TG triglyceride
  • LPC Lisophosphatidylcholine
  • PE phosphatidylethanolamine
  • FA fatty acid
  • Example 1-10 Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination
  • RNAiMAX treatment group 2 ⁇ l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 ⁇ l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;
  • lipid combination PE No. 38
  • PC No. 12
  • DG No. 1
  • TG No. 15
  • nucleic acid mixture a mixture of 3 ⁇ L lipid combination (PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15), 2:2:2:3, V/V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;
  • lipid combination and nucleic acid mixture a mixture of 3 ⁇ L lipid combination (mixture of 2.2 ⁇ L lipid combination PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15) and 0.8 ⁇ L of the following types of lipid, MG, LPC, Cer,
  • MG monoglyceride
  • LPC Lisophosphatidylcholine
  • FA fatty acid
  • Example 1-11 Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination
US16/499,283 2017-03-29 2018-03-29 Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent and related products thereof Pending US20210108198A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN2017078683 2017-03-29
CNPCT/CN2017/078683 2017-03-29
PCT/CN2018/081155 WO2018177383A1 (fr) 2017-03-29 2018-03-29 Application d'un composé ou d'un extrait de médecine chinoise traditionnelle dans la préparation d'un agent d'administration d'acide nucléique et produits apparentés correspondants

Publications (1)

Publication Number Publication Date
US20210108198A1 true US20210108198A1 (en) 2021-04-15

Family

ID=63675264

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/499,283 Pending US20210108198A1 (en) 2017-03-29 2018-03-29 Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent and related products thereof
US17/042,931 Active US11974969B2 (en) 2017-03-29 2019-03-29 Artificially synthesized sphingosine derivative lipoid monomer and use of same for delivering nucleic acid

Family Applications After (1)

Application Number Title Priority Date Filing Date
US17/042,931 Active US11974969B2 (en) 2017-03-29 2019-03-29 Artificially synthesized sphingosine derivative lipoid monomer and use of same for delivering nucleic acid

Country Status (8)

Country Link
US (2) US20210108198A1 (fr)
EP (1) EP3604269A4 (fr)
JP (1) JP7252132B2 (fr)
KR (1) KR20200002866A (fr)
CN (1) CN110520408B (fr)
CA (3) CA3058231A1 (fr)
MA (1) MA49023A (fr)
WO (1) WO2018177383A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019184991A1 (fr) * 2018-03-29 2019-10-03 中国医学科学院基础医学研究所 Utilisation d'un composé ou d'un extrait de médecine chinoise traditionnelle dans la préparation d'un agent d'administration d'acide nucléique, et produits associés
EP3777891A4 (fr) * 2018-03-29 2022-03-23 Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences Monomère lipoïde dérivé de sphingosine synthétisé artificiellement et son utilisation pour l'administration d'acide nucléique
WO2019184663A1 (fr) * 2018-03-29 2019-10-03 中国医学科学院基础医学研究所 Extraction de "soupe médicinale" de source végétale et préparation manuelle de "plante médicinale" et produits associés
CA3124730A1 (fr) * 2018-12-25 2020-07-02 Institute Of Basic Medical Sciences Chinese Academy Of Medical Sciences Petit medicament a base d'arn pour la prevention et le traitement de maladies liees a une l'inflammation et leur combinaison
CA3163934A1 (fr) * 2019-11-08 2021-05-14 Institute Of Basic Medical Sciences Chinese Academy Of Medical Sciences Utilisation de lipide dans la preparation d'un reactif d'administration d'acide nucleique et produit associe
CN115671025A (zh) * 2021-07-27 2023-02-03 中国医学科学院基础医学研究所 Fa类脂质化合物在制备核酸递送试剂中的应用及其相关产品
WO2024061211A1 (fr) * 2022-09-20 2024-03-28 中国医学科学院基础医学研究所 Composé lipidique pour l'administration d'acide nucléique, utilisation associée et médicament le comprenant

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6074667A (en) * 1996-11-20 2000-06-13 Kinnunen; Paavo Liposomal transfection method
WO2008103276A2 (fr) * 2007-02-16 2008-08-28 Merck & Co., Inc. Compositions et méthodes de potentialisation de l'activité de molécules biologiquement actives
WO2012112730A2 (fr) * 2011-02-15 2012-08-23 Merrimack Pharmaceuticals, Inc. Compositions et procédés pour délivrer un acide nucléique à une cellule
WO2016004318A1 (fr) * 2014-07-02 2016-01-07 Shire Human Genetic Therapies, Inc. Encapsulation d'arn messager
WO2017193087A1 (fr) * 2016-05-06 2017-11-09 Exicure, Inc. Constructions d'acides nucléiques sphériques liposomales (sna) présentant des oligonucléotides antisens (aso) pour l'inactivation spécifique de l'arnm du récepteur de l'interleukine 17

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9308103D0 (en) 1993-04-20 1993-06-02 Unilever Plc Cosmetic composition
EP0871758B1 (fr) 1995-11-21 2004-03-31 KINNUNEN, Paavo Kai Johannes Procede de transfection par liposomes
US6656498B1 (en) * 1998-11-25 2003-12-02 Vanderbilt University Cationic liposomes for gene transfer
KR20060015534A (ko) 2003-04-25 2006-02-17 더 펜 스테이트 리서치 파운데이션 성장 억제, 지질 유래된 생활성 화합물의 전신 전달을 위한방법 및 시스템
AU2008308679B2 (en) 2007-10-02 2015-01-29 Marina Biotech, Inc. Lipopeptides for delivery of nucleic acids
WO2009059201A2 (fr) * 2007-11-02 2009-05-07 The Board Of Regents Of The University Of Texas System Id2 en tant que cible dans le cancer colorectal
WO2009129395A1 (fr) * 2008-04-16 2009-10-22 Abbott Laboratories Lipides cationiques et utilisations de ceux-ci
WO2009129387A2 (fr) * 2008-04-16 2009-10-22 Abbott Laboratories Lipides cationiques et utilisations associees
WO2009129385A1 (fr) * 2008-04-16 2009-10-22 Abbott Laboratories Lipides cationiques et utilisations de ceux-ci
GB0910723D0 (en) * 2009-06-22 2009-08-05 Sylentis Sau Novel drugs for inhibition of gene expression
CA2792137C (fr) * 2010-03-24 2020-03-10 Medesis Pharma Systeme de micelle inverse comprenant des acides nucleiques et son utilisation
CN102409044B (zh) * 2010-09-21 2014-05-07 深圳华大基因科技服务有限公司 用于数字基因表达谱的标签及其使用方法
KR101306097B1 (ko) 2010-10-06 2013-09-09 성균관대학교산학협력단 피에이치 민감성 폴리머좀의 제조방법
JP2013245190A (ja) * 2012-05-25 2013-12-09 Biomedcore Inc 脂質膜構造体にｐＨ依存性カチオン性を付与する剤、それによりｐＨ依存性カチオン性が付与された脂質膜構造体および脂質膜構造体の製造方法
TR201908550T4 (tr) 2014-06-04 2019-07-22 Exicure Inc Profilaktik veya terapötik uygulamalar için lipozomal sferik nükleik asitler tarafından immün modülatörlerin çok değerlikli teslimi.
CN105078889B (zh) 2015-07-15 2018-10-09 魏垒 一种用于治疗软骨疾病的脂质体递送系统及其制备方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6074667A (en) * 1996-11-20 2000-06-13 Kinnunen; Paavo Liposomal transfection method
WO2008103276A2 (fr) * 2007-02-16 2008-08-28 Merck & Co., Inc. Compositions et méthodes de potentialisation de l'activité de molécules biologiquement actives
WO2012112730A2 (fr) * 2011-02-15 2012-08-23 Merrimack Pharmaceuticals, Inc. Compositions et procédés pour délivrer un acide nucléique à une cellule
WO2016004318A1 (fr) * 2014-07-02 2016-01-07 Shire Human Genetic Therapies, Inc. Encapsulation d'arn messager
WO2017193087A1 (fr) * 2016-05-06 2017-11-09 Exicure, Inc. Constructions d'acides nucléiques sphériques liposomales (sna) présentant des oligonucléotides antisens (aso) pour l'inactivation spécifique de l'arnm du récepteur de l'interleukine 17

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Allegood_Dissertation, Georgia Institute of Technology, December 2011. (Year: 2011) *
Mi et al. Scientific Reports volume 6, Article number: 38641 (2016). (Year: 2016) *
Mi et al. Supplemental Data_Scientific Reports volume 6, Article number: 38641 (2016). (Year: 2016) *

Also Published As

Publication number Publication date
CA3058231A1 (fr) 2018-10-04
CA3095753A1 (fr) 2019-10-03
US20210015767A1 (en) 2021-01-21
CN110520408B (zh) 2022-11-25
EP3604269A1 (fr) 2020-02-05
JP7252132B2 (ja) 2023-04-04
CN110520408A (zh) 2019-11-29
WO2018177383A1 (fr) 2018-10-04
MA49023A (fr) 2020-02-05
JP2020515616A (ja) 2020-05-28
KR20200002866A (ko) 2020-01-08
CA3095701A1 (fr) 2019-10-03
EP3604269A4 (fr) 2021-01-27
US11974969B2 (en) 2024-05-07
WO2018177383A9 (fr) 2019-11-28

Similar Documents

Publication Publication Date Title
US20210108198A1 (en) Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent and related products thereof
US20210100905A1 (en) Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent, and related products
US20230097090A1 (en) Improved lipid nanoparticles for delivery of nucleic acids
AU2018214137B2 (en) MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway
EP2879678B1 (fr) Enoxacin pour le traitement de la sclérose latérale amyotrophique
RU2656154C2 (ru) СВЯЗАННАЯ С РЕСПИРАТОРНЫМ ЗАБОЛЕВАНИЕМ ГЕН-СПЕЦИФИЧЕСКАЯ миРНК, ДВУСПИРАЛЬНАЯ КОНСТРУКЦИЯ ОЛИГО-РНК, СОДЕРЖАЩАЯ миРНК, И СОДЕРЖАЩАЯ ЕЕ КОМПОЗИЦИЯ ДЛЯ ПРЕДУПРЕЖДЕНИЯ ИЛИ ЛЕЧЕНИЯ РЕСПИРАТОРНОГО ЗАБОЛЕВАНИЯ
JP6818889B2 (ja) 細胞透過性が向上したペプチド核酸複合体およびそれを含む薬学的組成物
US10201556B2 (en) Combination for use in treating diseases or conditions associated with melanoma, or treating diseases or conditions associated with activated B-raf pathway
CN101448944A (zh) Cns病症的治疗
ES2631458T3 (es) Molécula de ARNmi definida por su fuente y sus usos terapéuticos en el cáncer asociado a la EMT
US20210038732A1 (en) Anticancer microrna and lipid formulations thereof
EP3750561A1 (fr) Véhicule à perméation cutanée contenant un complexe d'acide nucléique et son utilisation
WO2013056670A1 (fr) Petits arn d'interférence, leurs utilisations et procédé destiné à l'inhibition de l'expression du gène plk1
US9512425B2 (en) Inhibiting migration of cancer cells
JP2021501594A (ja) ニューロンの欠損に関連する状態及び／又は疾患を処置及び／又は診断するため、或いはニューロンの再生／発生のための、ｍｉＲＮＡ分子、等価物、アンタゴミル、又はそれらの供給源
JP2023078392A (ja) 核酸送達試薬の調製における化合物または伝統的漢方薬抽出物の応用およびその関連生成物
KR20140015863A (ko) Ｄｌｘ５ 유전자에 작용하는 마이크로 ＲＮＡ에 대한 억제제 및 이를 포함하는 비만 예방 또는 억제용 조성물
CN114958839A (zh) 抑制肌肉瘤细胞中FOXO1基因表达的siRNA序列及应用
CN110358769A (zh) 经锁核酸和硫代磷酸修饰的miRNA类似物及其在制备抗肿瘤药物中的应用
CN116271058A (zh) 化合物或中药提取物在制备核酸递送试剂中的应用及其相关产品
TW201606077A (zh) 小干擾ｒｎａ、含其之用於抑制半乳糖凝集素－１２表現及／或促進脂肪分解的醫藥組成物與其用途

Legal Events

Date Code Title Description
AS Assignment

Owner name: INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES, CHINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JIANG, CHENGYU;DU, JIANCHAO;LIANG, ZHU;AND OTHERS;REEL/FRAME:050537/0915

Effective date: 20190925

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER