US20180289792A1 - Sexually transmitted disease vaccines - Google Patents

Sexually transmitted disease vaccines Download PDF

Info

Publication number
US20180289792A1
US20180289792A1 US15/767,600 US201615767600A US2018289792A1 US 20180289792 A1 US20180289792 A1 US 20180289792A1 US 201615767600 A US201615767600 A US 201615767600A US 2018289792 A1 US2018289792 A1 US 2018289792A1
Authority
US
United States
Prior art keywords
vaccine
group
antigenic polypeptide
alkyl
hpv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US15/767,600
Other languages
English (en)
Inventor
Giuseppe Ciaramella
Sunny Himansu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ModernaTx Inc
Original Assignee
ModernaTx Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ModernaTx Inc filed Critical ModernaTx Inc
Priority to US15/767,600 priority Critical patent/US20180289792A1/en
Publication of US20180289792A1 publication Critical patent/US20180289792A1/en
Assigned to MODERNATX, INC. reassignment MODERNATX, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HIMANSU, Sunny, CIARAMELLA, GIUSEPPE
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/118—Chlamydiaceae, e.g. Chlamydia trachomatis or Chlamydia psittaci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/245—Herpetoviridae, e.g. herpes simplex virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20071—Demonstrated in vivo effect
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • STDs Sexually transmitted diseases
  • HPV Human papillomavirus
  • Chlamydia infection is caused by the Chlamydia trachomatis ( C. trachomatis ) bacterium. It is one of the most commonly sexually transmitted infections worldwide, affecting approximately 215 million people internationally. In the United States, there are around 2.8 million new cases of Chlamydia each year. Chlamydia trachomatis can also cause Chlamydia conjunctivitis or trachoma, a disease that can result in blindness. Worldwide, approximately 80 million people have active infections, resulting in impaired vision and blindness for nearly 2.2 million individuals. The international health consequences associated with Chlamydia exemplify the importance of developing effective and safe vaccine candidates against Chlamydia.
  • Herpes simplex viruses are double-stranded linear DNA viruses in the Herpesviridae family. Two members of the herpes simplex virus family infect humans—known as HSV-1 and HSV-2. Symptoms of HSV infection include the formation of blisters in the skin or mucous membranes of the mouth, lips, and/or genitals. HSV is a neuroinvasive virus that can cause sporadic recurring episodes of viral reactivation in infected individuals. HSV is transmitted by contact with an infected area of the skin during a period of viral activation.
  • Deoxyribonucleic acid (DNA) vaccination is one technique used to stimulate humoral and cellular immune responses to foreign antigens, such as HPV antigens, HSV antigens and/or Chlamydia antigens.
  • the direct injection of genetically engineered DNA e.g., naked plasmid DNA
  • this technique comes potential problems, including the possibility of insertional mutagenesis, which could lead to the activation of oncogenes or the inhibition of tumor suppressor genes.
  • RNA vaccines that build on the knowledge that RNA (e.g., messenger RNA (mRNA)) can safely direct the body's cellular machinery to produce nearly any protein of interest, from native proteins to antibodies and other entirely novel protein constructs that can have therapeutic activity inside and outside of cells.
  • RNA e.g., messenger RNA (mRNA)
  • the RNA (e.g., mRNA) vaccines of the present disclosure may be used to induce a balanced immune response against HPV, HSV and/or Chlamydia (e.g., C. trachomatis ), comprising both cellular and humoral immunity, without risking the possibility of insertional mutagenesis, for example.
  • HPV, HSV and/or Chlamydia are referred to herein as “sexually transmitted diseases (STDs).”
  • STD RNA vaccines and “HPV, HSV and/or Chlamydia ” encompasses HPV RNA vaccines, HSV RNA vaccines, Chlamydia RNA vaccines, and combination vaccines comprising: at least one HPV RNA vaccine and at least one HSV RNA vaccine; at least one HPV RNA vaccine and at least one Chlamydia RNA vaccine, at least one HSV vaccine and at least one Chlamydia RNA vaccine; and at least one HPV RNA vaccine, at least one HSV RNA vaccine and at least one Chlamydia RNA vaccine.
  • the RNA (e.g., mRNA) vaccines may be utilized in various settings depending on the prevalence of the infection or the degree or level of unmet medical need.
  • the RNA (e.g. mRNA) vaccines may be utilized to treat and/or prevent HPV, HSV and/or Chlamydia of various genotypes, strains, and isolates.
  • the RNA (e.g., mRNA) vaccines have superior properties in that they produce much larger antibody titers and produce responses earlier than commercially available anti-viral therapeutic treatments.
  • RNA (e.g., mRNA) vaccines are better designed to produce the appropriate protein conformation upon translation as the RNA (e.g., mRNA) vaccines co-opt natural cellular machinery.
  • RNA (e.g., mRNA) vaccines are presented to the cellular system in a more native fashion.
  • RNA vaccines can be significantly enhanced when combined with a flagellin adjuvant, in particular, when one or more antigen-encoding mRNAs is combined with an mRNA encoding flagellin.
  • RNA e.g., mRNA
  • vaccines combined with the flagellin adjuvant e.g., mRNA-encoded flagellin adjuvant
  • RNA vaccines that include at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to the antigenic polypeptide) and at least one RNA (e.g., mRNA polynucleotide) having an open reading frame encoding a flagellin adjuvant.
  • RNA e.g., mRNA
  • At least one flagellin polypeptide is a flagellin protein. In some embodiments, at least one flagellin polypeptide (e.g., encoded flagellin polypeptide) is an immunogenic flagellin fragment. In some embodiments, at least one flagellin polypeptide and at least one antigenic polypeptide are encoded by a single RNA (e.g., mRNA) polynucleotide. In other embodiments, at least one flagellin polypeptide and at least one antigenic polypeptide are each encoded by a different RNA polynucleotide.
  • RNA e.g., mRNA
  • At least one flagellin polypeptide has at least 80%, at least 85%, at least 90%, or at least 95% identity to a flagellin polypeptide having a sequence of SEQ ID NO: 301-303.
  • RNA ribonucleic acid
  • mRNA ribonucleic acid
  • vaccine comprising at least one (e.g., at least 2, 3, 4 or 5) RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one (e.g., at least 2, 3, 4 or 5) HPV, HSV and/or Chlamydia (e.g., C. trachomatis ) antigenic polypeptide, or any combination of two or more of the foregoing antigenic polypeptides.
  • RNA e.g., mRNA
  • HPV highV
  • HSV highV
  • Chlamydia e.g., C. trachomatis
  • antigenic polypeptide encompasses immunogenic fragments of the antigenic polypeptide (an immunogenic fragment that induces (or is capable of inducing) an immune response to HPV, HSV and/or Chlamydia (e.g., C. trachomatis ), unless otherwise stated.
  • RNA e.g., mRNA
  • RNA polynucleotide having an open reading frame encoding at least one (e.g., at least 2, 3, 4 or 5) HPV, HSV and/or Chlamydia (e.g., C. trachomatis ) antigenic polypeptide or an immunogenic fragment thereof, linked to a signal peptide.
  • Chlamydia e.g., C. trachomatis
  • nucleic acid e.g., DNA
  • at least one e.g., at least 2, 3, 4 or 5
  • HPV high vacuum
  • HSV high vacuum
  • Chlamydia e.g., C. trachomatis
  • RNA e.g., mRNA
  • RNA e.g., mRNA
  • HPV high vacuum virus
  • HSV high vacuum virus
  • Chlamydia e.g., C. trachomatis
  • a RNA (e.g., mRNA) vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one HPV antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to HPV).
  • at least one antigenic polypeptide is selected from E1, E2, E4, E5, E6, E7, L1, and L2.
  • the at least one antigenic polypeptide is selected from E1, E2, E4, E5, E6, and E7.
  • the at least one antigenic polypeptide is E6, E7, or a combination of E6 and E7.
  • the at least one antigenic polypeptide is L1, L2, or a combination of L1 and L2.
  • the at least one antigenic polypeptide is L1.
  • the L1 protein is obtained from HPV serotypes 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 or 82.
  • the at least one antigenic polypeptide is L1, L2 or a combination of L1 and L2, and E6, E7, or a combination of E6 and E7.
  • the at least one antigenic polypeptide is from HPV strain HPV type 16 (HPV16), HPV type 18 (HPV18), HPV type 26 (HPV26), HPV type 31 (HPV31), HPV type 33 (HPV33), HPV type 35 (HPV35), HPV type 45 (HPV45), HPV type 51 (HPV51), HPV type 52 (HPV52), HPV type 53 (HPV53), HPV type 56 (HPV56), HPV type 58 (HPV58), HPV type 59 (HPV59), HPV type 66 (HPV66), HPV type 68 (HPV68), HPV type 82 (HPV82), or a combination thereof.
  • the at least one antigenic polypeptide is from HPV strain HPV16, HPV18, or a combination thereof.
  • the at least one antigenic polypeptide is from HPV strain HPV type 6 (HPV6), HPV type 11 (HPV11), HPV type 13 (HPV13), HPV type 40 (HPV40), HPV type 42 (HPV42), HPV type 43 (HPV43), HPV type 44 (HPV44), HPV type 54 (HPV54), HPV type 61 (HPV61), HPV type 70 (HPV70), HPV type 72 (HPV72), HPV type 81 (HPV81), HPV type 89 (HPV89), or a combination thereof.
  • the at least one antigenic polypeptide is from HPV strain HPV type 30 (HPV30), HPV type 34 (HPV34), HPV type 55 (HPV55), HPV type 62 (HPV62), HPV type 64 (HPV64), HPV type 67 (HPV67), HPV type 69 (HPV69), HPV type 71 (HPV71), HPV type 73 (HPV73), HPV type 74 (HPV74), HPV type 83 (HPV83), HPV type 84 (HPV84), HPV type 85 (HPV85), or a combination thereof.
  • a vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one (e.g., one, two, three, four, five, six, seven, or eight) of E1, E2, E4, E5, E6, E7, L1, and L2 protein obtained from HPV, or a combination thereof.
  • a vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one (e.g., one, two, three, four, five, or six) polypeptide selected from E1, E2, E4, E5, E6, and E7 protein obtained from HPV, or a combination thereof.
  • a vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one polypeptide selected from E6 and E7 protein obtained from HPV, or a combination thereof.
  • a vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a polypeptide selected from L1 or L2 protein obtained from HPV, or a combination thereof.
  • the at least one RNA polynucleotide encodes an antigenic polypeptide that structurally modifies an infected cell.
  • the at least one RNA polynucleotide encodes an antigenic polypeptide that forms part or all of the HPV viral capsid.
  • the at least one RNA polynucleotide encodes an antigenic polypeptide that is capable of self-assembling into virus-like particles.
  • the at least one RNA polynucleotide encodes an antigenic polypeptide that is responsible for binding of the HPV to a cell being infected.
  • the at least one RNA polynucleotide encodes an antigenic polypeptide that interacts with retinoblastoma protein (pRb). In some embodiments, the at least one RNA polynucleotide encodes an antigenic polypeptide that interacts with p53.
  • At least one HPV antigenic polypeptide comprises an amino acid sequence of SEQ ID NO: 31-59 (Table 2).
  • the amino acid sequence of the HPV antigenic polypeptide is, or is a fragment of, or is a homolog or variant having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity to, the amino acid sequence of SEQ ID NO: 31-59 (Table 2).
  • At least one HPV antigenic polypeptide is encoded by a nucleic acid sequence identified by any one of SEQ ID NO: 1-28 (Table 1).
  • At least one HPV RNA (e.g., mRNA) polynucleotide is encoded by a nucleic acid sequence, or a fragment of a nucleotide sequence, identified by any one of SEQ ID NO: 1-28 (Table 1).
  • At least one HPV RNA (e.g., mRNA) polynucleotide comprises a nucleic acid sequence, or a fragment of a nucleotide sequence, identified by any one of SEQ ID NO: 431-461 (Table 1).
  • a RNA (e.g., mRNA) vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to Chlamydia , e.g., C. trachomatis ).
  • Chlamydia e.g., C. trachomatis
  • an immunogenic fragment capable of inducing an immune response to Chlamydia , e.g., C. trachomatis
  • At least one antigenic polypeptide is a major outer membrane protein (MOMP or OmpA) or an immunogenic fragment thereof.
  • MOMP may be from Chlamydia trachomatis serovar (serotype) H, F, E, D, I, G, J or K.
  • At least one antigenic polypeptide is from a virulence related outer membrane protein family (such as OmpA, OmpL, OmpF, OprF) or an immunogenic fragment thereof.
  • the OMP may be from Chlamydia trachomatis or any Gram negative bacteria (e.g., Pseudomonas aeruginosa ).
  • At least one Chlamydia antigenic polypeptide comprises an amino acid sequence identified by any one of SEQ ID NO: 65-72 or 73-183 (Tables 5 or 7).
  • the amino acid sequence of the Chlamydia antigenic polypeptide is, or is a fragment of, or is a homolog or variant having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity to, the amino acid sequence of SEQ ID NO: 65-72 or 73-183 (Tables 5 or 7).
  • At least one Chlamydia antigenic polypeptide is encoded by a nucleic acid sequence identified by any one of SEQ ID NO: 62-64 or 184-294 (Tables 4 or 8).
  • At least one Chlamydia RNA (e.g., mRNA) polynucleotide comprises a nucleic acid sequence, or a fragment of a nucleotide sequence, identified by any one of SEQ ID NO: 317-319 or 320-430 (Tables 4 or 8).
  • a RNA (e.g., mRNA) vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one herpes simplex virus (HSV) antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to HSV).
  • HSV herpes simplex virus
  • At least one antigenic polypeptide is HSV (HSV-1 or HSV-2) glycoprotein B, HSV (HSV-1 or HSV-2) glycoprotein C, HSV (HSV-1 or HSV-2) glycoprotein D, HSV (HSV-1 or HSV-2) glycoprotein E, HSV (HSV-1 or HSV-2) glycoprotein I.
  • At least one antigenic polypeptide has at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to HSV (HSV-1 or HSV-2) glycoprotein B, HSV (HSV-1 or HSV-2) glycoprotein C, HSV (HSV-1 or HSV-2) glycoprotein D, HSV (HSV-1 or HSV-2) glycoprotein E, HSV (HSV-1 or HSV-2) glycoprotein I or HSV (HSV-1 or HSV-2) ICP4 protein.
  • At least one antigen polypeptide is a non-glycogenic polypeptide, for example, not limited to, HSV (HSV-1 or HSV-2) ICP4 protein, HSV (HSV-1 or HSV-2) ICP0 protein, or an immunogenic fragment thereof.
  • At least one antigenic polypeptide has at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to HSV (HSV-1 or HSV-2) glycoprotein B, HSV (HSV-1 or HSV-2) glycoprotein C, HSV (HSV-1 or HSV-2) glycoprotein D, HSV (HSV-1 or HSV-2) glycoprotein E, HSV (HSV-1 or HSV-2) glycoprotein I or HSV (HSV-1 or HSV-2) ICP4 protein.
  • At least one antigenic polypeptide is HSV (HSV-1 or HSV-2) glycoprotein C, HSV (HSV-1 or HSV-2) glycoprotein D, a combination of HSV (HSV-1 or HSV-2) glycoprotein C and HSV (HSV-1 or HSV-2) glycoprotein D, or an immunogenic fragment thereof.
  • a HSV vaccine includes at least one RNA polynucleotide having an open reading frame encoding HSV (HSV-1 or HSV-2) glycoprotein D.
  • the HSV vaccine is formulated for intramuscular injection.
  • an open reading frame of a RNA (e.g., mRNA) vaccine is codon-optimized.
  • at least one RNA polynucleotide encodes at least one antigenic polypeptide comprising an amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6) and is codon optimized mRNA.
  • RNA e.g., mRNA
  • vaccine further comprising an adjuvant.
  • Tables 3 and 6 provide National Center for Biotechnology Information (NCBI) accession numbers of interest. It should be understood that the phrase “an amino acid sequence of Tables 3 and 6” refers to an amino acid sequence identified by one or more NCBI accession numbers listed in Tables 3 and 6. Each of the amino acid sequences, and variants having greater than 95% identity or greater than 98% identity to each of the amino acid sequences encompassed by the accession numbers of Tables 3 and 6 are included within the constructs (polynucleotides/polypeptides) of the present disclosure.
  • At least one mRNA polynucleotide is encoded by a nucleic acid comprising a sequence identified by any one of SEQ ID NO: 1-28, 62-64 or 184-294 (Tables 1, 4 and 8) and having less than 80% identity to wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid comprising a sequence identified by any one of SEQ ID NO: 1-28, 62-64 or 184-294 (Tables 1, 4 and 8) and having less than 75%, 85% or 95% identity to a wild-type mRNA sequence.
  • At least one mRNA polynucleotide is encoded by nucleic acid comprising a sequence identified by any one of SEQ ID NO: 1-28, 62-64 or 184-294 (Tables 1, 4 and 8) and having less than 50-80%, 60-80%, 40-80%, 30-80%, 70-80%, 75-80% or 78-80% identity to wild-type mRNA sequence.
  • At least one mRNA polynucleotide is encoded by a nucleic acid comprising a sequence identified by any one of SEQ ID NO: 1-28, 62-64 or 184-294 (Tables 1, 4 and 8) and having less than 40-85%, 50-85%, 60-85%, 30-85%, 70-85%, 75-85% or 80-85% identity to wild-type mRNA sequence.
  • At least one mRNA polynucleotide is encoded by a nucleic acid comprising a sequence identified by any one of SEQ ID NO: 1-28, 62-64 or 184-294 (Tables 1, 4 and 8) and having less than 40-90%, 50-90%, 60-90%, 30-90%, 70-90%, 75-90%, 80-90%, or 85-90% identity to wild-type mRNA sequence.
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide comprising an amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6) and having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity to wild-type mRNA sequence, but does not include wild-type mRNA sequence.
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide comprising an amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6) and has less than 95%, 90%, 85%, 80% or 75% identity to wild-type mRNA sequence.
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide comprising an amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6) and has 30-80%, 40-80%, 50-80%, 60-80%, 70-80%, 75-80% or 78-80%, 30-85%, 40-85%, 50-805%, 60-85%, 70-85%, 75-85% or 78-85%, 30-90%, 40-90%, 50-90%, 60-90%, 70-90%, 75-90%, 80-90% or 85-90% identity to wild-type mRNA sequence.
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to an amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6). In some embodiments, at least one RNA polynucleotide encodes at least one antigenic polypeptide having 95%-99% identity to an amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6).
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6) and having membrane fusion activity.
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide having 95%-99% identity to amino acid sequence identified by any one of SEQ ID NO: 31-59, 65-72, or 73-183 (Tables 2, 5 or 7; see also amino acid sequences of Tables 3 and 6) and having membrane fusion activity.
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide (e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide) that attaches to cell receptors.
  • at least one antigenic polypeptide e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide (e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide) that causes fusion of viral and cellular membranes.
  • at least one antigenic polypeptide e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide
  • Chlamydia e.g., C. trachomatis
  • At least one RNA polynucleotide encodes at least one antigenic polypeptide (e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide) that is responsible for binding of the virus to a cell being infected.
  • at least one antigenic polypeptide e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide
  • RNA ribonucleic acid
  • mRNA ribonucleic acid
  • an antigenic polypeptide e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide
  • at least one 5′ terminal cap e.g., C. trachomatis .
  • a 5′ terminal cap is 7mG(5′)ppp(5′)NlmpNp.
  • At least one chemical modification is selected from pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyl uridine.
  • the chemical modification is in the 5-position of the uracil. In some embodiments, the chemical modification is a N1-methylpseudouridine. In some embodiments, the chemical modification is a N1-ethylpseudouridine.
  • a lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol and a non-cationic lipid.
  • a cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is a cholesterol.
  • a cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)—N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530).
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3
  • the lipid is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the lipid is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • a lipid nanoparticle comprises compounds of Formula (I) and/or Formula (II), discussed below.
  • a lipid nanoparticle comprises Compounds 3, 18, 20, 25, 26, 29, 30, 60, 108-112, or 122, as discussed below
  • RNA e.g., mRNA
  • antigenic polypeptide e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C.
  • a lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol and a non-cationic lipid.
  • 100% of the uracil in the open reading frame have a chemical modification.
  • a chemical modification is in the 5-position of the uracil.
  • a chemical modification is a N1-methyl pseudouridine.
  • 100% of the uracil in the open reading frame have a N1-methyl pseudouridine in the 5-position of the uracil.
  • an open reading frame of a RNA (e.g., mRNA) polynucleotide encodes at least two antigenic polypeptides (e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide).
  • the open reading frame encodes at least five or at least ten antigenic polypeptides.
  • the open reading frame encodes at least 100 antigenic polypeptides.
  • the open reading frame encodes 2-100 antigenic polypeptides.
  • a vaccine comprises at least two RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigenic polypeptide (e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide).
  • the vaccine comprises at least five or at least ten RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigenic polypeptide or an immunogenic fragment thereof.
  • the vaccine comprises at least 100 RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigenic polypeptide.
  • the vaccine comprises 2-100 RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigenic polypeptide.
  • At least one antigenic polypeptide e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide
  • at least one antigenic polypeptide is fused to a signal peptide.
  • the signal peptide is selected from: a HuIgGk signal peptide (METPAQLLFLLLLWLPDTTG; SEQ ID NO: 304); IgE heavy chain epsilon-1 signal peptide (MDWTWILFLVAAATRVHS; SEQ ID NO: 305); Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS; SEQ ID NO: 306), VSVg protein signal sequence (MKCLLYLAFLFIGVNCA; SEQ ID NO: 307) and Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA; SEQ ID NO: 308).
  • a HuIgGk signal peptide METPAQLLFLLLLWLPDTTG; SEQ ID NO: 304
  • IgE heavy chain epsilon-1 signal peptide MDWTWILFLVAAATRVHS
  • SEQ ID NO: 305 Japanese encephalitis PRM signal sequence
  • VSVg protein signal sequence MK
  • the signal peptide is fused to the N-terminus of at least one antigenic polypeptide. In some embodiments, a signal peptide is fused to the C-terminus of at least one antigenic polypeptide.
  • At least one antigenic polypeptide comprises a mutated N-linked glycosylation site.
  • RNA e.g., mRNA
  • a vaccine of any one of the foregoing paragraphs (e.g., at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide), formulated in a nanoparticle (e.g., a lipid nanoparticle).
  • a nanoparticle e.g., a lipid nanoparticle
  • the nanoparticle has a mean diameter of 50-200 nm. In some embodiments, the nanoparticle is a lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol and a non-cationic lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of about 20-60% cationic lipid, 0.5-15% PEG-modified lipid, 25-55% sterol, and 25% non-cationic lipid. In some embodiments, the cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is a cholesterol.
  • the cationic lipid is selected from 2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-dimethylaminobutyrate
  • a lipid nanoparticle comprises compounds of Formula (I) and/or Formula (II), discussed below.
  • a STD RNA (e.g., mRNA) vaccine is formulated in a lipid nanoparticle that comprises a compound selected from Compounds 3, 18, 20, 25, 26, 29, 30, 60, 108-112 and 122, described below.
  • the nanoparticle has a polydispersity value of less than 0.4 (e.g., less than 0.3, 0.2 or 0.1).
  • the nanoparticle has a net neutral charge at a neutral pH value.
  • the RNA (e.g., mRNA) vaccine is multivalent.
  • RNA (e.g., mRNA) vaccine is a HPV vaccine, a HSV vaccine or a Chlamydia (e.g., C. trachomatis ) vaccine.
  • the RNA (e.g., mRNA) vaccine is a combination vaccine comprising a combination of HPV vaccine, a HSV vaccine and Chlamydia (e.g., C. trachomatis ) vaccine.
  • an antigen-specific immune response comprises a T cell response or a B cell response.
  • a method of producing an antigen-specific immune response comprises administering to a subject a single dose (no booster dose) of a RNA (e.g., mRNA) vaccine of the present disclosure.
  • a RNA (e.g., mRNA) vaccine is a HPV vaccine, a HSV vaccine and/or Chlamydia (e.g., C. trachomatis ) vaccine.
  • the RNA (e.g., mRNA) vaccine is a combination vaccine comprising a combination of any two or more of the foregoing vaccines.
  • a method further comprises administering to the subject a second (booster) dose of a RNA (e.g., mRNA) vaccine. Additional doses of a RNA (e.g., mRNA) vaccine may be administered.
  • a RNA e.g., mRNA
  • the subjects exhibit a seroconversion rate of at least 80% (e.g., at least 85%, at least 90%, or at least 95%) following the first dose or the second (booster) dose of the vaccine.
  • Seroconversion is the time period during which a specific antibody develops and becomes detectable in the blood. After seroconversion has occurred, a virus can be detected in blood tests for the antibody. During an infection or immunization, antigens enter the blood, and the immune system begins to produce antibodies in response. Before seroconversion, the antigen itself may or may not be detectable, but antibodies are considered absent. During seroconversion, antibodies are present but not yet detectable. Any time after seroconversion, the antibodies can be detected in the blood, indicating a prior or current infection.
  • RNA e.g., mRNA
  • a RNA vaccine is administered to a subject by intradermal, intramuscular injection, or by intranasal administration.
  • RNA e.g., mRNA
  • Antigen-specific immune responses in a subject may be determined, in some embodiments, by assaying for antibody titer (for titer of an antibody that binds to a HPV antigenic polypeptide, a HSV antigenic polypeptide and/or a Chlamydia (e.g., C. trachomatis ) antigenic polypeptide) following administration to the subject of any of the RNA (e.g., mRNA) vaccines of the present disclosure.
  • antibody titer for titer of an antibody that binds to a HPV antigenic polypeptide, a HSV antigenic polypeptide and/or a Chlamydia (e.g., C. trachomatis ) antigenic polypeptide
  • the anti-antigenic polypeptide antibody titer produced in the subject is increased by at least 1 log relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased by 1-3 log relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in a subject is increased at least 2 times relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased at least 5 times relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased at least 10 times relative to a control. In some embodiments, the anti-antigenic polypeptide antibody titer produced in the subject is increased 2-10 times relative to a control.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has not been administered a RNA (e.g., mRNA) vaccine of the present disclosure.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine (see, e.g., Ren J. et al. J of Gen. Virol.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a HPV, HSV and/or Chlamydia virus-like particle (VLP) vaccine (see, e.g., Cox R G et al., J Virol. 2014 June; 88(11): 6368-6379).
  • VLP Chlamydia virus-like particle
  • a RNA (e.g., mRNA) vaccine of the present disclosure is administered to a subject in an effective amount (an amount effective to induce an immune response).
  • the effective amount is a dose equivalent to an at least 2-fold, at least 4-fold, at least 10-fold, at least 100-fold, at least 1000-fold reduction in the standard of care dose of a recombinant HPV, HSV and/or Chlamydia protein vaccine, wherein the anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant HPV, HSV and/or Chlamydia protein vaccine, a purified HPV, HSV and/or Chlamydia protein vaccine, a live attenuated HPV, HSV and/or Chlamydia vaccine, an inactivated HPV, HSV and/or Chlamydia vaccine, or a HPV, HSV, H
  • the effective amount is a dose equivalent to 2-1000-fold reduction in the standard of care dose of a recombinant HPV, HSV and/or Chlamydia protein vaccine, wherein the anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant HPV, HSV and/or Chlamydia protein vaccine, a purified HPV, HSV and/or Chlamydia protein vaccine, a live attenuated HPV, HSV and/or Chlamydia vaccine, an inactivated HPV, HSV and/or Chlamydia vaccine, or a HPV, HSV and/or Chlamydia VLP vaccine.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a virus-like particle (VLP) vaccine comprising structural proteins of HPV, HSV and/or Chlamydia.
  • VLP virus-like particle
  • the RNA (e.g., mRNA) vaccine is formulated in an effective amount to produce an antigen specific immune response in a subject.
  • the effective amount is a total dose of 25 ⁇ g to 1000 ⁇ g, or 50 ⁇ g to 1000 ⁇ g. In some embodiments, the effective amount is a total dose of 100 ⁇ g. In some embodiments, the effective amount is a dose of 25 ⁇ g administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 100 ⁇ g administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 400 ⁇ g administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 500 ⁇ g administered to the subject a total of two times.
  • the efficacy (or effectiveness) of a RNA (e.g., mRNA) vaccine is greater than 60%.
  • the RNA (e.g., mRNA) polynucleotide of the vaccine at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide.
  • Vaccine efficacy may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201(11):1607-10). For example, vaccine efficacy may be measured by double-blind, randomized, clinical controlled trials. Vaccine efficacy may be expressed as a proportionate reduction in disease attack rate (AR) between the unvaccinated (ARU) and vaccinated (ARV) study cohorts and can be calculated from the relative risk (RR) of disease among the vaccinated group with use of the following formulas:
  • AR disease attack rate
  • vaccine effectiveness may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201(11):1607-10).
  • Vaccine effectiveness is an assessment of how a vaccine (which may have already proven to have high vaccine efficacy) reduces disease in a population. This measure can assess the net balance of benefits and adverse effects of a vaccination program, not just the vaccine itself, under natural field conditions rather than in a controlled clinical trial.
  • Vaccine effectiveness is proportional to vaccine efficacy (potency) but is also affected by how well target groups in the population are immunized, as well as by other non-vaccine-related factors that influence the ‘real-world’ outcomes of hospitalizations, ambulatory visits, or costs.
  • a retrospective case control analysis may be used, in which the rates of vaccination among a set of infected cases and appropriate controls are compared.
  • Vaccine effectiveness may be expressed as a rate difference, with use of the odds ratio (OR) for developing infection despite vaccination:
  • the efficacy (or effectiveness) of a RNA (e.g., mRNA) vaccine is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%.
  • the vaccine immunizes the subject against HPV, a HSV antigenic polypeptide and/or Chlamydia (e.g., C. trachomatis ) for up to 2 years. In some embodiments, the vaccine immunizes the subject against HPV, HSV and/or Chlamydia (e.g., C. trachomatis ) for more than 2 years, more than 3 years, more than 4 years, or for 5-10 years.
  • a HSV antigenic polypeptide and/or Chlamydia e.g., C. trachomatis
  • the subject is about 5 years old or younger.
  • the subject may be between the ages of about 1 year and about 5 years (e.g., about 1, 2, 3, 5 or 5 years), or between the ages of about 6 months and about 1 year (e.g., about 6, 7, 8, 9, 10, 11 or 12 months).
  • the subject is about 12 months or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 months or 1 month).
  • the subject is about 6 months or younger.
  • the subject was born full term (e.g., about 37-42 weeks). In some embodiments, the subject was born prematurely, for example, at about 36 weeks of gestation or earlier (e.g., about 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26 or 25 weeks). For example, the subject may have been born at about 32 weeks of gestation or earlier. In some embodiments, the subject was born prematurely between about 32 weeks and about 36 weeks of gestation. In such subjects, a RNA (e.g., mRNA) vaccine may be administered later in life, for example, at the age of about 6 months to about 5 years, or older.
  • a RNA e.g., mRNA
  • the subject is a young adult between the ages of about 20 years and about 50 years (e.g., about 20, 25, 30, 35, 40, 45 or 50 years old).
  • the subject is an elderly subject about 60 years old, about 70 years old, or older (e.g., about 60, 65, 70, 75, 80, 85 or 90 years old).
  • the subject has been exposed to HPV, HSV and/or Chlamydia (e.g., C. trachomatis ); the subject is infected with HPV, HSV and/or Chlamydia (e.g., C. trachomatis ); or subject is at risk of infection by HPV, HSV and/or Chlamydia (e.g., C. trachomatis ).
  • the subject is immunocompromised (has an impaired immune system, e.g., has an immune disorder or autoimmune disorder).
  • nucleic acid vaccines described herein are chemically modified. In other embodiments the nucleic acid vaccines are unmodified.
  • compositions for and methods of vaccinating a subject comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first respiratory virus antigenic polypeptide, wherein the RNA polynucleotide does not include a stabilization element, and wherein an adjuvant is not coformulated or co-administered with the vaccine.
  • the invention is a composition for or method of vaccinating a subject comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide wherein a dosage of between 10 ⁇ g/kg and 400 ⁇ g/kg of the nucleic acid vaccine is administered to the subject.
  • the dosage of the RNA polynucleotide is 1-5 ⁇ g, 5-10 ⁇ g, 10-15 ⁇ g, 15-20 ⁇ g, 10-25 ⁇ g, 20-25 ⁇ g, 20-50 ⁇ g, 30-50 ⁇ g, 40-50 ⁇ g, 40-60 ⁇ g, 60-80 ⁇ g, 60-100 ⁇ g, 50-100 ⁇ g, 80-120 ⁇ g, 40-120 ⁇ g, 40-150 ⁇ g, 50-150 ⁇ g, 50-200 ⁇ g, 80-200 ⁇ g, 100-200 ⁇ g, 120-250 ⁇ g, 150-250 ⁇ g, 180-280 ⁇ g, 200-300 ⁇ g, 50-300 ⁇ g, 80-300 ⁇ g, 100-300 ⁇ g, 40-300 ⁇ g, 50-350 ⁇ g, 100-350 ⁇ g, 200-350 ⁇ g, 300-350 ⁇ g, 320-400 ⁇ g, 40-380 ⁇ g, 40-100 ⁇ g, 100-400
  • the nucleic acid vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the nucleic acid vaccine is administered to the subject on day zero. In some embodiments, a second dose of the nucleic acid vaccine is administered to the subject on day twenty one.
  • a dosage of 25 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a dosage of 100 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a dosage of 50 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a dosage of 75 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a dosage of 150 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject.
  • a dosage of 400 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a dosage of 200 micrograms of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, the RNA polynucleotide accumulates at a 100 fold higher level in the local lymph node in comparison with the distal lymph node. In other embodiments the nucleic acid vaccine is chemically modified and in other embodiments the nucleic acid vaccine is not chemically modified.
  • nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide does not include a stabilization element, and a pharmaceutically acceptable carrier or excipient, wherein an adjuvant is not included in the vaccine.
  • the stabilization element is a histone stem-loop.
  • the stabilization element is a nucleic acid sequence having increased GC content relative to wild type sequence.
  • nucleic acid vaccines comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is present in the formulation for in vivo administration to a host, which confers an antibody titer superior to the criterion for seroprotection for the first antigen for an acceptable percentage of human subjects.
  • the antibody titer produced by the mRNA vaccines of the invention is a neutralizing antibody titer. In some embodiments the neutralizing antibody titer is greater than a protein vaccine.
  • the neutralizing antibody titer produced by the mRNA vaccines of the invention is greater than an adjuvanted protein vaccine.
  • the neutralizing antibody titer produced by the mRNA vaccines of the invention is 1,000-10,000, 1,200-10,000, 1,400-10,000, 1,500-10,000, 1,000-5,000, 1,000-4,000, 1,800-10,000, 2000-10,000, 2,000-5,000, 2,000-3,000, 2,000-4,000, 3,000-5,000, 3,000-4,000, or 2,000-2,500.
  • a neutralization titer is typically expressed as the highest serum dilution required to achieve a 50% reduction in the number of plaques.
  • nucleic acid vaccines comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is present in a formulation for in vivo administration to a host for eliciting a longer lasting high antibody titer than an antibody titer elicited by an mRNA vaccine having a stabilizing element or formulated with an adjuvant and encoding the first antigenic polypeptide.
  • the RNA polynucleotide is formulated to produce a neutralizing antibodies within one week of a single administration.
  • the adjuvant is selected from a cationic peptide and an immunostimulatory nucleic acid.
  • the cationic peptide is protamine.
  • nucleic acid vaccines comprising one or more RNA polynucleotides having an open reading frame comprising at least one chemical modification or optionally no chemical modification, the open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is present in the formulation for in vivo administration to a host such that the level of antigen expression in the host significantly exceeds a level of antigen expression produced by an mRNA vaccine having a stabilizing element or formulated with an adjuvant and encoding the first antigenic polypeptide.
  • nucleic acid vaccines comprising one or more RNA polynucleotides having an open reading frame comprising at least one chemical modification or optionally no chemical modification, the open reading frame encoding a first antigenic polypeptide, wherein the vaccine has at least 10 fold less RNA polynucleotide than is required for an unmodified mRNA vaccine to produce an equivalent antibody titer.
  • the RNA polynucleotide is present in a dosage of 25-100 micrograms.
  • aspects of the invention also provide a unit of use vaccine, comprising between 10 ug and 400 ug of one or more RNA polynucleotides having an open reading frame comprising at least one chemical modification or optionally no chemical modification, the open reading frame encoding a first antigenic polypeptide, and a pharmaceutically acceptable carrier or excipient, formulated for delivery to a human subject.
  • the vaccine further comprises a cationic lipid nanoparticle.
  • aspects of the invention provide methods of creating, maintaining or restoring antigenic memory to a respiratory virus strain in an individual or population of individuals comprising administering to said individual or population an antigenic memory booster nucleic acid vaccine comprising (a) at least one RNA polynucleotide, said polynucleotide comprising at least one chemical modification or optionally no chemical modification and two or more codon-optimized open reading frames, said open reading frames encoding a set of reference antigenic polypeptides, and (b) optionally a pharmaceutically acceptable carrier or excipient.
  • the vaccine is administered to the individual via a route selected from the group consisting of intramuscular administration, intradermal administration and subcutaneous administration.
  • the administering step comprises contacting a muscle tissue of the subject with a device suitable for injection of the composition. In some embodiments, the administering step comprises contacting a muscle tissue of the subject with a device suitable for injection of the composition in combination with electroporation.
  • aspects of the invention provide methods of vaccinating a subject comprising administering to the subject a single dosage of between 25 ug/kg and 400 ug/kg of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide in an effective amount to vaccinate the subject.
  • nucleic acid vaccines comprising one or more RNA polynucleotides having an open reading frame comprising at least one chemical modification, the open reading frame encoding a first antigenic polypeptide, wherein the vaccine has at least 10 fold less RNA polynucleotide than is required for an unmodified mRNA vaccine to produce an equivalent antibody titer.
  • the RNA polynucleotide is present in a dosage of 25-100 micrograms.
  • nucleic acid vaccines comprising an LNP formulated RNA polynucleotide having an open reading frame comprising no modifications (unmodified), the open reading frame encoding a first antigenic polypeptide, wherein the vaccine has at least 10 fold less RNA polynucleotide than is required for an unmodified mRNA vaccine not formulated in a LNP to produce an equivalent antibody titer.
  • the RNA polynucleotide is present in a dosage of 25-100 micrograms.
  • the invention encompasses a method of treating an elderly subject age 60 years or older comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide in an effective amount to vaccinate the subject.
  • the invention encompasses a method of treating a young subject age 17 years or younger comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide in an effective amount to vaccinate the subject.
  • the invention encompasses a method of treating an adult subject comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide in an effective amount to vaccinate the subject.
  • the invention is a method of vaccinating a subject with a combination vaccine including at least two nucleic acid sequences encoding respiratory antigens wherein the dosage for the vaccine is a combined therapeutic dosage wherein the dosage of each individual nucleic acid encoding an antigen is a sub therapeutic dosage.
  • the combined dosage is 25 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject.
  • the combined dosage is 100 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject.
  • the combined dosage is 50 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject.
  • the combined dosage is 75 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dosage is 150 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dosage is 400 micrograms of the RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the sub therapeutic dosage of each individual nucleic acid encoding an antigen is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 micrograms. In other embodiments the nucleic acid vaccine is chemically modified and in other embodiments the nucleic acid vaccine is not chemically modified.
  • the RNA polynucleotide is one of SEQ ID NO: 1-28, 62-64, 184-294 431-461 and includes at least one chemical modification. In other embodiments the RNA polynucleotide is one of SEQ ID NO: 1-28, 62-64, 184-294 431-461 and does not include any nucleotide modifications, or is unmodified. In yet other embodiments the at least one RNA polynucleotide encodes an antigenic protein of any of SEQ ID NO: 31-59, 65-72, or 73-183 and includes at least one chemical modification. In other embodiments the RNA polynucleotide encodes an antigenic protein of any of SEQ ID NO: 31-59, 65-72, or 73-183 and does not include any nucleotide modifications, or is unmodified.
  • vaccines of the invention produce prophylactically- and/or therapeutically-efficacious levels, concentrations and/or titers of antigen-specific antibodies in the blood or serum of a vaccinated subject.
  • antibody titer refers to the amount of antigen-specific antibody produces in s subject, e.g., a human subject.
  • antibody titer is expressed as the inverse of the greatest dilution (in a serial dilution) that still gives a positive result.
  • antibody titer is determined or measured by enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • antibody titer is determined or measured by neutralization assay, e.g., by microneutralization assay.
  • antibody titer measurement is expressed as a ratio, such as 1:40, 1:100, etc.
  • an efficacious vaccine produces an antibody titer of greater than 1:40, greater that 1:100, greater than 1:400, greater than 1:1000, greater than 1:2000, greater than 1:3000, greater than 1:4000, greater than 1:500, greater than 1:6000, greater than 1:7500, greater than 1:10000.
  • the antibody titer is produced or reached by 10 days following vaccination, by 20 days following vaccination, by 30 days following vaccination, by 40 days following vaccination, or by 50 or more days following vaccination.
  • the titer is produced or reached following a single dose of vaccine administered to the subject. In other embodiments, the titer is produced or reached following multiple doses, e.g., following a first and a second dose (e.g., a booster dose.)
  • antigen-specific antibodies are measured in units of ⁇ g/ml or are measured in units of IU/L (International Units per liter) or mIU/ml (milli International Units per ml).
  • an efficacious vaccine produces >0.5 ⁇ g/ml, >0.1 ⁇ g/ml, >0.2 ⁇ g/ml, >0.35 ⁇ g/ml, >0.5 ⁇ g/ml, >1 ⁇ g/ml, >2 ⁇ g/ml, >5 ⁇ g/ml or >10 ⁇ g/ml.
  • an efficacious vaccine produces >10 mIU/ml, >20 mIU/ml, >50 mIU/ml, >100 mIU/ml, >200 mIU/ml, >500 mIU/ml or >1000 mIU/ml.
  • the antibody level or concentration is produced or reached by 10 days following vaccination, by 20 days following vaccination, by 30 days following vaccination, by 40 days following vaccination, or by 50 or more days following vaccination.
  • the level or concentration is produced or reached following a single dose of vaccine administered to the subject.
  • the level or concentration is produced or reached following multiple doses, e.g., following a first and a second dose (e.g., a booster dose.)
  • antibody level or concentration is determined or measured by enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • neutralization assay e.g., by microneutralization assay.
  • FIGS. 1A-1B are western blot graphs showing the in vitro expression of Chlamydia trachomatis antigens (Ct089, Ct858, and Ct875) encoded by candidate mRNA vaccines.
  • FIG. 2A shows the expression of these antigens in concentrated or dilute supernatant of HEK293K cells. Expression of Ct875 and Ct089 was detected in the supernatants.
  • FIG. 2B shows the expression of these antigens in HEK293F cell lysates. Expression of Ct858 and Ct089 was detected in the cell lysates.
  • FIGS. 2A-2B are western blot graphs showing the in vitro expression of Chlamydia trachomatis antigens encoded by candidate mRNA vaccines. All antigens tested expressed in HEK293F cells.
  • FIG. 2A shows the expression of PmPG_pd, Ct460, and Ct622 in concentrated supernatant of HEK293K cells.
  • FIG. 2B shows the expression of Cta1 in HEK293F cell lysates.
  • FIG. 3 is a western blot graph showing the in vitro expression of Chlamydia trachomatis antigens (Ct 443 and Ct812pd_D) encoded by candidate mRNA vaccines. The expression of Ct443 and Ct812pd_D were detected in the cell lysates.
  • FIG. 4 shows data from an ELISA of sera collected from mice bled on day 21 (post prime; left graph) and on day 35 (post-boost, right graph), analyzed for IgG antibody titers against Ct089 using rCt089 produced in E. coli as the antigen, following administration of Ct089mRNA, Ct089NGM mRNA or rCt089.
  • RNA e.g., mRNA
  • HPV human papillomavirus
  • HSV herpes simplex virus
  • Chlamydia e.g., C. trachomatis
  • combination vaccines that comprise at least one RNA (e.g., mRNA) polynucleotide encoding at least two antigenic polypeptides selected from HPV antigenic polypeptides, HSV antigenic polypeptides, and Chlamydia (e.g., C.
  • RNA (e.g., mRNA) vaccines methods of administering the RNA (e.g., mRNA) vaccines, methods of producing the RNA (e.g., mRNA) vaccines, compositions (e.g., pharmaceutical compositions) comprising the RNA (e.g., mRNA) vaccines, and nucleic acids (e.g., DNA) encoding the RNA (e.g., mRNA) vaccines.
  • a RNA (e.g., mRNA) vaccine comprises an adjuvant, such as a flagellin adjuvant, as provided herein.
  • RNA vaccines e.g., HPV, HSV and/or Chlamydia RNA vaccines
  • HPV highV
  • HSV high-density virus
  • Chlamydia RNA vaccines may be used to induce a balanced immune response, comprising both cellular and humoral immunity, without many of the risks associated with DNA vaccination.
  • the capsid is composed of 72 pentamers linked to each other by disulfide bonds and associated with L2 proteins.
  • HPV capsid proteins bind to heparan sulfate proteoglycans on the basement membrane of target cells to provide initial virion attachment to the target cells. The basement membrane is exposed only after epithelium trauma. Additionally, the alpha6 integrin complexed with either beta1 or beta4 integrin acts as a coreceptor recognized by L1.
  • the virion Once attached, the virion enters the host cell via clathrin-mediated endocytosis, and the genomic DNA is released to the host nucleus. The virion assembly takes place within the cell nucleus.
  • L1 protein encapsulates the genomic DNA together with L2 protein.
  • a HPV vaccine may comprise, for example, at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one HPV antigenic polypeptide identified by SEQ ID NO: 35-59 (Table 2).
  • RNA e.g., mRNA
  • a HPV vaccine may comprise, for example, at least one RNA (e.g., mRNA) polynucleotide encoded by a nucleic acid (e.g., DNA) identified by SEQ ID NO: 1-28 (Table 1).
  • RNA e.g., mRNA
  • DNA nucleic acid identified by SEQ ID NO: 1-28 (Table 1).
  • the present disclosure is not limited by a particular strain of HPV.
  • the strain of HPV used in a vaccine may be any strain of HPV.
  • Non-limiting examples of strains of HPV are provided elsewhere herein.
  • HPV vaccines comprise RNA (e.g., mRNA) encoding a HPV antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with HPV L1 or HPV L2 activity and having HPV L1 or HPV L2 activity, respectively.
  • RNA e.g., mRNA
  • a protein is considered to have HPV L1 protein activity if, for example, it binds to heparan sulfate proteoglycans on the basement membrane to provide initial virion attachment to target cells.
  • Embodiments of the present disclosure provide RNA (e.g., mRNA) vaccines that include at least one polynucleotide encoding at least one Chlamydia (e.g., C. trachomatis ) antigen.
  • Chlamydia trachomatis an obligate intracellular human pathogen, is one of four bacterial species in the genus Chlamydia.
  • Chlamydia trachomatis is a Gram-negative bacterium, ovoid in shape.
  • Chlamydia trachomatis includes three human biovars (variant prokaryotic strains): (1) serovars (or serotypes) Ab, B, Ba and C, which cause trachoma infection of the eyes, which can lead to blindness; (2) serovars D-K, which cause urethritis, pelvic inflammatory disease, ectopic pregnancy, neonatal pneumonia, and neonatal conjunctivitis; and (3) serovars L1, L2 and L3, which cause lymphogranuloma venereum.
  • Major outer membrane protein (MOMP) is the dominant surface protein of the bacteria (contributing to 60% of the total protein mass in the outer membrane) and consists of four variable domains interspersed among five constant domains.
  • variable domains contain serovar-specific epitopes; the five constant domains are highly conserved among the different serovars and contain several conserved CD4 and CD8 T cell epitopes.
  • MOMP if its native trimeric structure is preserved, induces protection against Chlamydia infection in animals (Kari L et al. The Journal of Immunology 2009; 182:8063-70).
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises a RNA polynucleotide encoding any one of, or any combination of at least two of, MOMP serovar H, F, E, D, I, G, J and K.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding major outer membrane protein (MOMP), serovar H.
  • MOMP major outer membrane protein
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar F.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar E.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar D.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar I.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar G.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar J.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises at least one RNA polynucleotide encoding MOMP serovar K.
  • a Chlamydia (e.g., C. trachomatis ) vaccine may comprise, for example, at least one RNA (e.g., mRNA) encoded by a nucleic acid sequence identified by SEQ ID NO: 62-64 or 184-294 (Table 4 or 8) or a variant thereof having at least 90 identity to a nucleic acid sequence identified by SEQ ID NO: 62-64 or 184-294 (Table 4 or 8).
  • RNA e.g., mRNA
  • a Chlamydia trachomatis vaccine may comprise, for example, at least one RNA (e.g., mRNA) encoding an amino acid sequence identified by any one of SEQ ID NO: 65-183 (Tables 5 or 7) or a variant thereof having at least 90 identity to an amino acid sequence identified by any one of SEQ ID NO: 65-183 (Tables 5 or 7).
  • RNA e.g., mRNA
  • the strain or serotype of Chlamydia used, as provided herein, may be any strain or serotype of Chlamydia , including, for example, Chlamydia trachomatis.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises a RNA polynucleotide encoding a variable domain of Chlamydia (e.g., C. trachomatis ) MOMP.
  • a Chlamydia (e.g., C. trachomatis ) RNA (e.g., mRNA) vaccine of the present disclosure comprises a RNA polynucleotide encoding a serovar-specific epitope of a variable domain of Chlamydia (e.g., C. trachomatis ) MOMP.
  • Chlamydia vaccines comprise RNA (e.g., mRNA) encoding a Chlamydia (e.g., C. trachomatis ) antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with Chlamydia (e.g., C. trachomatis ) MOMP serovar H, F, E, D, I, G, J and K and having Chlamydia trachomatis MOMP serovar H, F, E, D, I, G, J and K activity, respectively.
  • RNA e.g., mRNA
  • Chlamydia antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with Chlamydia (e.g., C. trachomatis ) MOMP serovar H, F, E, D, I, G, J and K activity, respectively
  • a protein is considered to have major outer membrane protein (MOMP) activity if, for example, it facilitates porin formation and maintains the structural rigidity of the outer membrane.
  • MOMP permits the diffusion of specific solutes through the intracellular reticulate body membrane.
  • EBs elementary bodies
  • MOMP provides the structural integrity of the outer envelope through disulfide cross-links with the small cysteine-rich protein and the large cysteine-rich periplasmic protein.
  • EBs elementary bodies
  • the protein contains four symmetrically-spaced variable domains (VD I-IV). Disulfide bond interactions within and between MOMP molecules and other components form high molecular weight oligomers of the elementary shell.
  • the protein determines the different serotypes and serves as the functional equivalent of peptidoglycan.
  • HSV is a double-stranded, linear DNA virus in the Herpesviridae. Two members of the herpes simplex virus family infect humans—known as HSV-1 and HSV-2. Symptoms of HSV infection include the formation of blisters in the skin or mucous membranes of the mouth, lips and/or genitals. HSV is a neuroinvasive virus that can cause sporadic recurring episodes of viral reactivation in infected individuals. HSV is transmitted by contact with an infected area of the skin during a period of viral activation.
  • HSV most commonly infects via the oral or genital mucosa and replicates in the stratified squamous epithelium, followed by uptake into ramifying unmyelinated sensory nerve fibers within the stratified squamous epithelium.
  • the virus is then transported to the cell body of the neuron in the dorsal root ganglion, where it persists in a latent cellular infection (Cunningham A L et al. J Infect Dis. (2006) 194 (Supplement 1): S11-S18).
  • HSV-1 and HSV-2 The genome of Herpes Simplex Viruses (HSV-1 and HSV-2) contains about 85 open reading frames, such that HSV can generate at least 85 unique proteins. These genes encode 4 major classes of proteins: (1) those associated with the outermost external lipid bilayer of HSV (the envelope), (2) the internal protein coat (the capsid), (3) an intermediate complex connecting the envelope with the capsid coat (the tegument), and (4) proteins responsible for replication and infection.
  • envelope proteins examples include UL1 (gL), UL10 (gM), UL20, UL22, UL27 (gB), UL43, UL44 (gC), UL45, UL49A, UL53 (gK), US4 (gG), US5 (gJ), US6 (gD), US7 (gI), US8 (gE), and US10.
  • capsid proteins examples include UL6, UL18, UL19, UL35, and UL38. Tegument proteins include UL11, UL13, UL21, UL36, UL37, UL41, UL45, UL46, UL47, UL48, UL49, US9, and US10.
  • HSV proteins include UL2, UL3 UL4, UL5, UL7, UL8, UL9, UL12, UL14, UL15, UL16, UL17, UL23, UL24, UL25, UL26, UL26.5, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL39, UL40, UL42, UL50, UL51, UL52, UL54, UL55, UL56, US1, US2, US3, US81, US11, US12, ICP0, and ICP4.
  • the present disclosure encompasses antigenic polypeptides associated with the envelope as immunogenic agents.
  • surface and membrane proteins glycoprotein D (gD), glycoprotein B (gB), glycoprotein H (gH), glycoprotein L (gL)—as single antigens or in combination with or without adjuvants may be used as HSV vaccine antigens.
  • HSV vaccines comprise RNA (e.g., mRNA) encoding HSV (HSV-1 or HSV-2) glycoprotein D.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding HSV (HSV-1 or HSV-2) glycoprotein B.
  • HSV vaccines comprise RNA (e.g., mRNA) encoding HSV (HSV-1 or HSV-2) glycoprotein D and glycoprotein C.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding HSV (HSV-1 or HSV-2) glycoprotein D and glycoprotein E (or glycoprotein I).
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding HSV (HSV-1 or HSV-2) glycoprotein B and glycoprotein C.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding HSV (HSV-1 or HSV-2) glycoprotein B and glycoprotein E (or glycoprotein I).
  • RNA e.g., mRNA
  • HSV HSV-1 or HSV-2
  • glycoprotein B glycoprotein B
  • glycoprotein E glycoprotein I
  • HSV vaccines comprise RNA (e.g., mRNA) encoding a HSV (HSV-1 or HSV-2) antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with HSV (HSV-1 or HSV-2) glycoprotein D and has HSV (HSV-1 or HSV-2) glycoprotein D activity.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding a HSV (HSV-1 or HSV-2) antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with HSV (HSV-1 or HSV-2) glycoprotein C and has HSV (HSV-1 or HSV-2) glycoprotein C activity.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding a HSV (HSV-1 or HSV-2) antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with HSV (HSV-1 or HSV-2) glycoprotein B and has HSV (HSV-1 or HSV-2) glycoprotein B activity.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding a HSV (HSV-1 or HSV-2) antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with HSV (HSV-1 or HSV-2) glycoprotein E and has HSV (HSV-1 or HSV-2) glycoprotein E activity.
  • RNA e.g., mRNA
  • HSV vaccines comprise RNA (e.g., mRNA) encoding a HSV (HSV-1 or HSV-2) antigenic polypeptide having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with HSV (HSV-1 or HSV-2) glycoprotein I and has HSV (HSV-1 or HSV-2) glycoprotein I activity.
  • RNA e.g., mRNA
  • Glycoprotein “activity” of the present disclosure is described below.
  • Glycoprotein C is a glycoprotein involved in viral attachment to host cells; e.g., it acts as an attachment protein that mediates binding of the HSV-2 virus to host adhesion receptors, namely cell surface heparan sulfate and/or chondroitin sulfate.
  • gC plays a role in host immune evasion (aka viral immunoevasion) by inhibiting the host complement cascade activation.
  • gC binds to and/or interacts with host complement component C3b; this interaction then inhibits the host immune response by disregulating the complement cascade (e.g., binds host complement C3b to block neutralization of virus).
  • Glycoprotein D is an envelope glycoprotein that binds to cell surface receptors and/or is involved in cell attachment via poliovirus receptor-related protein and/or herpesvirus entry mediator, facilitating virus entry.
  • gD binds to the potential host cell entry receptors (tumor necrosis factor receptor superfamily, member 14(TNFRSF14)/herpesvirus entry mediator (HVEM), poliovirus receptor-related protein 1 (PVRL1) and or poliovirus receptor-related protein 2 (PVRL2) and is proposed to trigger fusion with host membrane, by recruiting the fusion machinery composed of, for example, gB and gH/gL.
  • gD interacts with host cell receptors TNFRSF14 and/or PVRL1 and/or PVRL2 and (1) interacts (via profusion domain) with gB; an interaction which can occur in the absence of related HSV glycoproteins, e.g., gH and/or gL; and (2) gD interacts (via profusion domain) with gH/gL heterodimer, an interaction which can occur in the absence of gB.
  • gD associates with the gB-gH/gL-gD complex.
  • gD also interacts (via C-terminus) with UL11 tegument protein.
  • Glycoprotein B is a viral glycoprotein involved in the viral cell activity of herpes simplex virus (HSV) and is required for the fusion of the HSV's envelope with the cellular membrane. It is the most highly conserved of all surface glycoproteins and primarily acts as a fusion protein, constituting the core fusion machinery.
  • gB a class III membrane fusion glycoprotein, is a type-1 transmembrane protein trimer of five structural domains. Domain I includes two internal fusion loops and is through to insert into the cellular membrane during virus-cell fusion. Domain II appears to interact with gH/gL during the fusion process, domain III contains an elongated alpha helix, and domain IV interacts with cellular receptors.
  • the heterodimer glycoprotein E/glycoproteinl (gE/gI) is required for the cell-to-cell spread of the virus, by sorting nascent virions to cell junctions. Once the virus reaches the cell junctions, virus particles can spread to adjacent cells extremely rapidly through interactions with cellular receptors that accumulate at these junctions. By similarity, it is implicated in basolateral spread in polarized cells. In neuronal cells, gE/gI is essential for the anterograde spread of the infection throughout the host nervous system. Together with US9, the heterodimer gE/gI is involved in the sorting and transport of viral structural components toward axon tips.
  • the heterodimer gE/gI serves as a receptor for the Fc part of host IgG. Dissociation of gE/gI from IgG occurs at acidic pH, thus may be involved in anti-HSV antibodies bipolar bridging, followed by intracellular endocytosis and degradation, thereby interfering with host IgG-mediated immune responses. gE/gI interacts (via C-terminus) with VP22 tegument protein; this interaction is necessary for the recruitment of VP22 to the Golgi and its packaging into virions.
  • Embodiments of the present disclosure also provide combination RNA (e.g., mRNA) vaccines.
  • a “combination RNA (e.g., mRNA) vaccine” of the present disclosure refers to a vaccine comprising at least one (e.g., at least 2, 3, 4, or 5) RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a combination of at least one HPV antigenic polypeptide (e.g., selected from E1, E2, E4, E5, E6, E7, L1, and L2), at least one HSV antigenic polypeptide (e.g., selected from glycoprotein D, glycoprotein B, glycoprotein C, and glycoprotein E), at least one Chlamydia antigenic polypeptide (e.g., selected from MOMP serovar H, F, E, D, I, G, J and K), or any combination of two or more of the foregoing antigenic polypeptides.
  • HPV antigenic polypeptide e.g
  • the mRNA vaccines described herein are superior to current vaccines in several ways.
  • the lipid nanoparticle (LNP) delivery is superior to other formulations including a protamine base approach described in the literature and no additional adjuvants are to be necessary.
  • LNPs lipid nanoparticles enables the effective delivery of chemically modified or unmodified mRNA vaccines.
  • both modified and unmodified LNP formulated mRNA vaccines were superior to conventional vaccines by a significant degree.
  • the mRNA vaccines of the invention are superior to conventional vaccines by a factor of at least 10 fold, 20 fold, 40 fold, 50 fold, 100 fold, 500 fold or 1,000 fold.
  • RNA vaccines including mRNA vaccines and self-replicating RNA vaccines
  • the therapeutic efficacy of these RNA vaccines have not yet been fully established.
  • the inventors have discovered, according to aspects of the invention a class of formulations for delivering mRNA vaccines in vivo that results in significantly enhanced, and in many respects synergistic, immune responses including enhanced antigen generation and functional antibody production with neutralization capability. These results can be achieved even when significantly lower doses of the mRNA are administered in comparison with mRNA doses used in other classes of lipid based formulations.
  • the formulations of the invention have demonstrated significant unexpected in vivo immune responses sufficient to establish the efficacy of functional mRNA vaccines as prophylactic and therapeutic agents.
  • RNA vaccines rely on viral replication pathways to deliver enough RNA to a cell to produce an immunogenic response.
  • the formulations of the invention do not require viral replication to produce enough protein to result in a strong immune response.
  • the mRNA of the invention are not self-replicating RNA and do not include components necessary for viral replication.
  • the invention involves, in some aspects, the surprising finding that lipid nanoparticle (LNP) formulations significantly enhance the effectiveness of mRNA vaccines, including chemically modified and unmodified mRNA vaccines.
  • LNP lipid nanoparticle
  • the formulations of the invention generate a more rapid immune response with fewer doses of antigen than other vaccines tested.
  • the mRNA-LNP formulations of the invention also produce quantitatively and qualitatively better immune responses than vaccines formulated in a different carriers.
  • LNP used in the studies described herein has been used previously to deliver siRNA in various animal models as well as in humans.
  • the fact that LNP is useful in vaccines is quite surprising. It has been observed that therapeutic delivery of siRNA formulated in LNP causes an undesirable inflammatory response associated with a transient IgM response, typically leading to a reduction in antigen production and a compromised immune response.
  • the LNP-mRNA formulations of the invention are demonstrated herein to generate enhanced IgG levels, sufficient for prophylactic and therapeutic methods rather than transient IgM responses.
  • STD vaccines comprise at least one (one or more) ribonucleic acid (RNA) (e.g., mRNA) polynucleotide having an open reading frame encoding at least one HPV antigenic polypeptide, at least one HSV antigenic polypeptide, and/or at least one Chlamydia (e.g., C. trachomatis ) antigenic polypeptide.
  • RNA ribonucleic acid
  • mRNA ribonucleic acid
  • the term “nucleic acid” includes any compound and/or substance that comprises a polymer of nucleotides (nucleotide monomer). These polymers are referred to as polynucleotides.
  • the terms “nucleic acid” and “polynucleotide” are used interchangeably.
  • Nucleic acids may be or may include, for example, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a ⁇ -D-ribo configuration, ⁇ -LNA having an ⁇ -L-ribo configuration (a diastereomer of LNA), 2′-amino-LNA having a 2′-amino functionalization, and 2′-amino- ⁇ -LNA having a 2′-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or chimeras or combinations thereof.
  • RNAs ribonucleic acids
  • DNAs deoxyribonucleic acids
  • TAAs threose nucleic acids
  • GNAs glycol nucle
  • polynucleotides of the present disclosure function as messenger RNA (mRNA).
  • “Messenger RNA” refers to any polynucleotide that encodes a (at least one) polypeptide (a naturally-occurring, non-naturally-occurring, or modified polymer of amino acids) and can be translated to produce the encoded polypeptide in vitro, in vivo, in situ or ex vivo.
  • mRNA messenger RNA
  • any of the RNA polynucleotides encoded by a DNA identified by a particular sequence identification number may also comprise the corresponding RNA (e.g., mRNA) sequence encoded by the DNA, where each “T” of the DNA sequence is substituted with “U.”
  • the basic components of an mRNA molecule typically include at least one coding region, a 5′ untranslated region (UTR), a 3′ UTR, a 5′ cap and a poly-A tail.
  • Polynucleotides of the present disclosure may function as mRNA but can be distinguished from wild-type mRNA in their functional and/or structural design features, which serve to overcome existing problems of effective polypeptide expression using nucleic-acid based therapeutics.
  • a RNA polynucleotide of an RNA (e.g., mRNA) vaccine encodes 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9 or 9-10 antigenic polypeptides.
  • a RNA (e.g., mRNA) polynucleotide of a STD vaccine encodes at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 antigenic polypeptides.
  • a RNA (e.g., mRNA) polynucleotide of a STD vaccine encodes at least 100 or at least 200 antigenic polypeptides.
  • a RNA polynucleotide of an STD vaccine encodes 1-10, 5-15, 10-20, 15-25, 20-30, 25-35, 30-40, 35-45, 40-50, 1-50, 1-100, 2-50 or 2-100 antigenic polypeptides.
  • Codon optimization methods are known in the art and may be used as provided herein. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove/add post translation modification sites in encoded protein (e.g.
  • Codon optimization tools, algorithms and services are known in the art—non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park Calif.) and/or proprietary methods.
  • the open reading frame (ORF) sequence is optimized using optimization algorithms.
  • a codon optimized sequence shares less than 95% sequence identity, less than 90% sequence identity, less than 85% sequence identity, less than 80% sequence identity, or less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or antigenic polypeptide)).
  • a naturally-occurring or wild-type sequence e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or antigenic polypeptide)
  • a codon-optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85%, or between about 67% and about 80%) sequence identity to a naturally-occurring sequence or a wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)).
  • a naturally-occurring sequence or a wild-type sequence e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)
  • a codon-optimized sequence shares between 65% and 75%, or about 80% sequence identity to a naturally-occurring sequence or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)).
  • a naturally-occurring sequence or wild-type sequence e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)
  • a codon-optimized RNA may, for instance, be one in which the levels of G/C are enhanced.
  • the G/C-content of nucleic acid molecules may influence the stability of the RNA.
  • RNA having an increased amount of guanine (G) and/or cytosine (C) residues may be functionally more stable than nucleic acids containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides.
  • WO02/098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. Due to the degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote greater RNA stability without changing the resulting amino acid. The approach is limited to coding regions of the RNA.
  • an antigenic polypeptide is longer than 25 amino acids and shorter than 50 amino acids.
  • Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer.
  • Polypeptides may also comprise single chain polypeptides or multichain polypeptides, such as antibodies or insulin, and may be associated or linked to each other. Most commonly, disulfide linkages are found in multichain polypeptides.
  • the term “polypeptide” may also apply to amino acid polymers in which at least one amino acid residue is an artificial chemical analogue of a corresponding naturally-occurring amino acid.
  • a “polypeptide variant” is a molecule that differs in its amino acid sequence relative to a native sequence or a reference sequence.
  • Amino acid sequence variants may possess substitutions, deletions, insertions, or a combination of any two or three of the foregoing, at certain positions within the amino acid sequence, as compared to a native sequence or a reference sequence.
  • variants possess at least 50% identity to a native sequence or a reference sequence.
  • variants share at least 80% identity or at least 90% identity with a native sequence or a reference sequence.
  • variant mimics are provided.
  • a “variant mimic” contains at least one amino acid that would mimic an activated sequence.
  • glutamate may serve as a mimic for phosphoro-threonine and/or phosphoro-serine.
  • variant mimics may result in deactivation or in an inactivated product containing the mimic.
  • phenylalanine may act as an inactivating substitution for tyrosine, or alanine may act as an inactivating substitution for serine.
  • orthologs refers to genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same function in the course of evolution. Identification of orthologs is important for reliable prediction of gene function in newly sequenced genomes.
  • Analogs is meant to include polypeptide variants that differ by one or more amino acid alterations, for example, substitutions, additions or deletions of amino acid residues that still maintain one or more of the properties of the parent or starting polypeptide.
  • compositions that are polynucleotide or polypeptide based, including variants and derivatives. These include, for example, substitutional, insertional, deletion and covalent variants and derivatives.
  • derivative is synonymous with the term “variant” and generally refers to a molecule that has been modified and/or changed in any way relative to a reference molecule or a starting molecule.
  • sequence tags or amino acids such as one or more lysines
  • Sequence tags can be used for peptide detection, purification or localization.
  • Lysines can be used to increase peptide solubility or to allow for biotinylation.
  • amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences.
  • Certain amino acids e.g., C-terminal residues or N-terminal residues
  • amino acids alternatively may be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence that is soluble, or linked to a solid support.
  • “Substitutional variants” when referring to polypeptides are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position. Substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more (e.g., 3, 4 or 5) amino acids have been substituted in the same molecule.
  • conservative amino acid substitution refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity.
  • conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine and leucine for another non-polar residue.
  • conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine.
  • substitution of a basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions.
  • non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and/or a polar residue for a non-polar residue.
  • polypeptide or polynucleotide are defined as distinct amino acid sequence-based or nucleotide-based components of a molecule respectively.
  • Features of the polypeptides encoded by the polynucleotides include surface manifestations, local conformational shape, folds, loops, half-loops, domains, half-domains, sites, termini and any combination(s) thereof.
  • domain refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).
  • site As used herein when referring to polypeptides the terms “site” as it pertains to amino acid based embodiments is used synonymously with “amino acid residue” and “amino acid side chain.” As used herein when referring to polynucleotides the terms “site” as it pertains to nucleotide based embodiments is used synonymously with “nucleotide.” A site represents a position within a peptide or polypeptide or polynucleotide that may be modified, manipulated, altered, derivatized or varied within the polypeptide-based or polynucleotide-based molecules.
  • terminal refers to an extremity of a polypeptide or polynucleotide respectively. Such extremity is not limited only to the first or final site of the polypeptide or polynucleotide but may include additional amino acids or nucleotides in the terminal regions.
  • Polypeptide-based molecules may be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C-terminus (terminated by an amino acid with a free carboxyl group (COOH)).
  • Proteins are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These proteins have multiple N- and C-termini. Alternatively, the termini of the polypeptides may be modified such that they begin or end, as the case may be, with a non-polypeptide based moiety such as an organic conjugate.
  • protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of polypeptides of interest.
  • any protein fragment meaning a polypeptide sequence at least one amino acid residue shorter than a reference polypeptide sequence but otherwise identical
  • a reference protein having a length of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or longer than 100 amino acids.
  • any protein that includes a stretch of 20, 30, 40, 50, or 100 (contiguous) amino acids that are 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% identical to any of the sequences described herein can be utilized in accordance with the disclosure.
  • a polypeptide includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations as shown in any of the sequences provided herein or referenced herein.
  • any protein that includes a stretch of 20, 30, 40, 50, or 100 amino acids that are greater than 80%, 90%, 95%, or 100% identical to any of the sequences described herein, wherein the protein has a stretch of 5, 10, 15, 20, 25, or 30 amino acids that are less than 80%, 75%, 70%, 65% to 60% identical to any of the sequences described herein can be utilized in accordance with the disclosure.
  • Polypeptide or polynucleotide molecules of the present disclosure may share a certain degree of sequence similarity or identity with the reference molecules (e.g., reference polypeptides or reference polynucleotides), for example, with art-described molecules (e.g., engineered or designed molecules or wild-type molecules).
  • identity refers to a relationship between the sequences of two or more polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between two sequences as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues.
  • Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related peptides can be readily calculated by known methods. “% identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for the alignment are well known in the art.
  • variants of a particular polynucleotide or polypeptide have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
  • tools for alignment include those of the BLAST suite (Stephen F. Altschul, et al.
  • FGSAA Fast Optimal Global Sequence Alignment Algorithm
  • homologous refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • Polymeric molecules e.g. nucleic acid molecules (e.g. DNA molecules and/or RNA molecules) and/or polypeptide molecules
  • homologous e.g. nucleic acid molecules (e.g. DNA molecules and/or RNA molecules) and/or polypeptide molecules) that share a threshold level of similarity or identity determined by alignment of matching residues.
  • homologous is a qualitative term that describes a relationship between molecules and can be based upon the quantitative similarity or identity. Similarity or identity is a quantitative term that defines the degree of sequence match between two compared sequences.
  • polymeric molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar.
  • the term “homologous” necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). Two polynucleotide sequences are considered homologous if the polypeptides they encode are at least 50%, 60%, 70%, 80%, 90%, 95%, or even 99% for at least one stretch of at least 20 amino acids.
  • homologous polynucleotide sequences are characterized by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. Two protein sequences are considered homologous if the proteins are at least 50%, 60%, 70%, 80%, or 90% identical for at least one stretch of at least 20 amino acids.
  • homolog refers to a first amino acid sequence or nucleic acid sequence (e.g., gene (DNA or RNA) or protein sequence) that is related to a second amino acid sequence or nucleic acid sequence by descent from a common ancestral sequence.
  • the term “homolog” may apply to the relationship between genes and/or proteins separated by the event of speciation or to the relationship between genes and/or proteins separated by the event of genetic duplication.
  • Orthologs are genes (or proteins) in different species that evolved from a common ancestral gene (or protein) by speciation. Typically, orthologs retain the same function in the course of evolution.
  • Parents are genes (or proteins) related by duplication within a genome. Orthologs retain the same function in the course of evolution, whereas paralogs evolve new functions, even if these are related to the original one.
  • identity refers to the overall relatedness between polymeric molecules, for example, between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
  • the nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M.
  • the percent identity between two nucleic acid sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two nucleic acid sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
  • Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12, 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
  • the present disclosure encompasses STD vaccines comprising multiple RNA (e.g., mRNA) polynucleotides, each encoding a single antigenic polypeptide, as well as STD vaccines comprising a single RNA polynucleotide encoding more than one antigenic polypeptide (e.g., as a fusion polypeptide).
  • RNA e.g., mRNA
  • STD vaccines comprising a single RNA polynucleotide encoding more than one antigenic polypeptide (e.g., as a fusion polypeptide).
  • a vaccine composition comprising a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a first antigenic polypeptide and a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a second antigenic polypeptide encompasses (a) vaccines that comprise a first RNA polynucleotide encoding a first antigenic polypeptide and a second RNA polynucleotide encoding a second antigenic polypeptide, and (b) vaccines that comprise a single RNA polynucleotide encoding a first and second antigenic polypeptide (e.g., as a fusion polypeptide).
  • a RNA e.g., mRNA
  • RNA (e.g., mRNA) vaccines of the present disclosure in some embodiments, comprise 2-10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10), or more, RNA polynucleotides having an open reading frame, each of which encodes a different antigenic polypeptide (or a single RNA polynucleotide encoding 2-10, or more, different antigenic polypeptides).
  • the antigenic polypeptides may be selected from HPV antigenic polypeptides, HSV antigenic polypeptides, and Chlamydia (e.g., C. trachomatis ) antigenic polypeptides.
  • a STD vaccine comprises a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a viral capsid protein, a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a viral premembrane/membrane protein, and a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a viral envelope protein.
  • a RNA e.g., mRNA
  • a STD vaccine comprises a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a viral fusion (F) protein and a RNA polynucleotide having an open reading frame encoding a viral major surface glycoprotein (G protein).
  • a vaccine comprises a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a viral F protein.
  • a vaccine comprises a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a viral G protein.
  • a vaccine comprises a RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a HN protein.
  • a multicomponent vaccine comprises at least one RNA (e.g., mRNA) polynucleotide encoding at least one antigenic polypeptide fused to a signal peptide (e.g., SEQ ID NO: 304-307).
  • the signal peptide may be fused at the N-terminus or the C-terminus of an antigenic polypeptide.
  • An antigenic polypeptide fused to a signal peptide may be selected from HPV antigenic polypeptides, HSV antigenic polypeptides, and Chlamydia (e.g., C. trachomatis ) antigenic polypeptides.
  • antigenic polypeptides encoded by STD RNA (e.g., mRNA) polynucleotides comprise a signal peptide.
  • Signal peptides comprising the N-terminal 15-60 amino acids of proteins, are typically needed for the translocation across the membrane on the secretory pathway and, thus, universally control the entry of most proteins both in eukaryotes and prokaryotes to the secretory pathway.
  • Signal peptides generally include three regions: an N-terminal region of differing length, which usually comprises positively charged amino acids; a hydrophobic region; and a short carboxy-terminal peptide region.
  • the signal peptide of a nascent precursor protein directs the ribosome to the rough endoplasmic reticulum (ER) membrane and initiates the transport of the growing peptide chain across it for processing.
  • ER processing produces mature proteins, wherein the signal peptide is cleaved from precursor proteins, typically by a ER-resident signal peptidase of the host cell, or they remain uncleaved and function as a membrane anchor.
  • a signal peptide may also facilitate the targeting of the protein to the cell membrane.
  • the signal peptide is not responsible for the final destination of the mature protein.
  • Secretory proteins devoid of additional address tags in their sequence are by default secreted to the external environment.
  • a more advanced view of signal peptides has evolved, showing that the functions and immunodominance of certain signal peptides are much more versatile than previously anticipated.
  • a Chlamydia antigenic polypeptide may be comprise a leader sequence to facilitate cell surface expression of the antigenic polypeptide.
  • a Chlamydia trachomatis MOMP antigenic polypeptide comprises a leader sequence that facilitates cell surface expression of the MOMP. See, e.g., Jones H M, et al. Gene. 2000, 258: 173-181; and Findlay H E, et al. BMC Microbiology. 2005, 5:5.
  • a Chlamydia trachomatis antigenic polypeptide (e.g., a MOMP antigenic polypeptide) comprises (is linked to) a leader sequence comprising an amino acid identified by any one of SEQ ID NO: 301-316. It should be understood that any antigenic polypeptide (e.g., HPV, HSV and/or Chlamydia antigenic polypeptide) as provided herein may comprise a leader sequence.
  • STD vaccines of the present disclosure may comprise, for example, RNA (e.g., mRNA) polynucleotides encoding an artificial signal peptide, wherein the signal peptide coding sequence is operably linked to and is in frame with the coding sequence of the antigenic polypeptide.
  • STD vaccines of the present disclosure produce an antigenic polypeptide (e.g., a HPV antigenic polypeptide, HSV antigenic polypeptides and/or a Chlamydia antigenic polypeptide) fused to a signal peptide.
  • a signal peptide is fused to the N-terminus of the antigenic polypeptide.
  • a signal peptide is fused to the C-terminus of the antigenic polypeptide.
  • the signal peptide fused to the antigenic polypeptide is an artificial signal peptide.
  • an artificial signal peptide fused to the antigenic polypeptide encoded by the RNA (e.g., mRNA) vaccine is obtained from an immunoglobulin protein, e.g., an IgE signal peptide or an IgG signal peptide.
  • a signal peptide fused to the antigenic polypeptide encoded by a RNA (e.g., mRNA) vaccine is an Ig heavy chain epsilon-1 signal peptide (IgE HC SP) having the sequence of: MDWTWILFLVAAATRVHS; SEQ ID NO: 305.
  • a signal peptide fused to the antigenic polypeptide encoded by the (e.g., mRNA) RNA (e.g., mRNA) vaccine is an IgGk chain V-III region HAH signal peptide (IgGk SP) having the sequence of METPAQLLFLLLLWLPDTTG; SEQ ID NO: 304.
  • the signal peptide is selected from: Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS; SEQ ID NO: 306), VSVg protein signal sequence (MKCLLYLAFLFIGVNCA; SEQ ID NO: 307) and Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA; SEQ ID NO: 308).
  • the antigenic polypeptide encoded by a RNA (e.g., mRNA) vaccine comprises an amino acid sequence identified by any one of 8, 12-14, 24-34, 47-50 or 54-56 (Tables 3, 6, 11, 14 or 17; see also amino acid sequences of Tables 4, 7, 12 or 15) fused to a signal peptide identified by any one of ⁇ 19 (Table 8).
  • RNA e.g., mRNA
  • the examples disclosed herein are not meant to be limiting and any signal peptide that is known in the art to facilitate targeting of a protein to ER for processing and/or targeting of a protein to the cell membrane may be used in accordance with the present disclosure.
  • a signal peptide may have a length of 15-60 amino acids.
  • a signal peptide may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids.
  • a signal peptide has a length of 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acids.
  • a signal peptide is typically cleaved from the nascent polypeptide at the cleavage junction during ER processing.
  • the mature antigenic polypeptide produce by a STD RNA (e.g., mRNA) vaccine of the present disclosure typically does not comprise a signal peptide.
  • STD vaccines of the present disclosure comprise at least RNA (e.g. mRNA) polynucleotide having an open reading frame encoding at least one antigenic polypeptide that comprises at least one chemical modification.
  • RNA e.g. mRNA
  • chemical modification and “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribonucleosides or deoxyribnucleosides in at least one of their position, pattern, percent or population. Generally, these terms do not refer to the ribonucleotide modifications in naturally occurring 5′-terminal mRNA cap moieties.
  • modification refers to a modification relative to the canonical set 20 amino acids. Polypeptides, as provided herein, are also considered “modified” of they contain amino acid substitutions, insertions or a combination of substitutions and insertions.
  • Polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • RNA polynucleotides such as mRNA polynucleotides
  • a particular region of a polynucleotide contains one, two or more (optionally different) nucleoside or nucleotide modifications.
  • a modified RNA polynucleotide e.g., a modified mRNA polynucleotide
  • introduced to a cell or organism exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified polynucleotide.
  • a modified RNA polynucleotide e.g., a modified mRNA polynucleotide
  • introduced into a cell or organism may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response).
  • Polynucleotides may comprise modifications that are naturally-occurring, non-naturally-occurring or the polynucleotide may comprise a combination of naturally-occurring and non-naturally-occurring modifications.
  • Polynucleotides may include any useful modification, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage or to the phosphodiester backbone).
  • Polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • RNA polynucleotides such as mRNA polynucleotides
  • polynucleotides in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the polynucleotides to achieve desired functions or properties.
  • the modifications may be present on an internucleotide linkages, purine or pyrimidine bases, or sugars.
  • the modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified.
  • nucleosides and nucleotides of a polynucleotide e.g., RNA polynucleotides, such as mRNA polynucleotides.
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • a nucleotide refers to a nucleoside, including a phosphate group.
  • Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Polynucleotides may comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages may be standard phosphdioester linkages, in which case the polynucleotides would comprise regions of nucleotides.
  • Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker may be incorporated into polynucleotides of the present disclosure.
  • RNA polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • modifications of polynucleotides include, but are not limited to the following: 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine; 2-methylthio-N6-methyladenosine; 2-methylthio-N6-threonyl carbamoyladenosine; N6-glycinylcarbamoyladenosine; N6-isopentenyladenosine; N6-methyladenosine; N6-threonylcarbamoyladenosine; 1,2′-O-dimethyladenosine; 1-methyladenosine; 2′-O-methyladenosine; 2′-O-ribosyladenosine (phosphate); 2-methyladenosine; 2-methylthio-N6 isopentenyladeno
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • RNA polynucleotides include a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.
  • modified nucleobases in polynucleotides are selected from the group consisting of pseudouridine ( ⁇ ), N1-methylpseudouridine (m 1 ⁇ ), N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine,
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • RNA polynucleotides include a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.
  • modified nucleobases in polynucleotides are selected from the group consisting of 1-methyl-pseudouridine (m 1 ⁇ ), 5-methoxy-uridine (mo 5 U), 5-methyl-cytidine (m 5 C), pseudouridine ( ⁇ ), ⁇ -thio-guanosine and ⁇ -thio-adenosine.
  • polynucleotides includes a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides comprise pseudouridine ( ⁇ ) and 5-methyl-cytidine (m 5 C).
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides comprise 1-methyl-pseudouridine (m 1 ⁇ ).
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides comprise 2-thiouridine (s 2 U).
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • 2-thiouridine and 5-methyl-cytidine m 5 C.
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • methoxy-uridine mithoxy-uridine
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • RNA polynucleotides comprise 5-methoxy-uridine (mo 5 U) and 5-methyl-cytidine (m 5 C).
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • polynucleotides comprise N6-methyl-adenosine (m 6 A).
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • N6-methyl-adenosine m 6 A
  • 5-methyl-cytidine m 5 C
  • polynucleotides e.g., RNA polynucleotides, such as mRNA polynucleotides
  • RNA polynucleotides are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification.
  • a polynucleotide can be uniformly modified with 5-methyl-cytidine (m 5 C), meaning that all cytosine residues in the mRNA sequence are replaced with 5-methyl-cytidine (m 5 C).
  • m 5 C 5-methyl-cytidine
  • a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.
  • nucleobases and nucleosides having a modified cytosine include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C), and 2-thio-5-methyl-cytidine.
  • a modified nucleobase is a modified uridine.
  • exemplary nucleobases and in some embodiments, a modified nucleobase is a modified cytosine.
  • nucleosides having a modified uridine include 5-cyano uridine, and 4′-thio uridine.
  • a modified nucleobase is a modified adenine.
  • exemplary nucleobases and nucleosides having a modified adenine include 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), and N6-methyl-adenosine (m6A).
  • a modified nucleobase is a modified guanine.
  • exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine.
  • the polynucleotides of the present disclosure may be partially or fully modified along the entire length of the molecule.
  • one or more or all or a given type of nucleotide e.g., purine or pyrimidine, or any one or more or all of A, G, U, C
  • nucleotides X in a polynucleotide of the present disclosure are modified nucleotides, wherein X may any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.
  • the polynucleotide may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from
  • the polynucleotides may contain at a minimum 1% and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides.
  • the polynucleotides may contain a modified pyrimidine such as a modified uracil or cytosine.
  • At least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the polynucleotide is replaced with a modified uracil (e.g., a 5-substituted uracil).
  • the modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
  • cytosine in the polynucleotide is replaced with a modified cytosine (e.g., a 5-substituted cytosine).
  • the modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
  • the RNA (e.g., mRNA) vaccines comprise a 5′UTR element, an optionally codon optimized open reading frame, and a 3′UTR element, a poly(A) sequence and/or a polyadenylation signal wherein the RNA is not chemically modified.
  • the modified nucleobase is a modified uracil.
  • Exemplary nucleobases and nucleosides having a modified uracil include pseudouridine (w), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m 3 U), 5-methoxy-uridine (mo 5 U), uridine 5-oxyacetic acid (cmo 5 U), uridine 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1-car
  • the modified nucleobase is a modified cytosine.
  • exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m 3 C), N4-acetyl-cytidine (ac 4 C), 5-formylcytidine (f 5 C), N4-methyl-cytidine (m 4 C), 5-methyl-cytidine (m 5 C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm 5 C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s 2 C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocyt
  • the modified nucleobase is a modified adenine.
  • exemplary nucleobases and nucleosides having a modified adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m 1 A), 2-methyl-adenine (m 2 A), N6-methyl-adenosine (m
  • the modified nucleobase is a modified guanine.
  • exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m 1 I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o 2 yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ 0 ), 7-aminomethyl-7-deaza-guanosine (
  • RNA e.g., mRNA
  • vaccines comprising nucleic acids (e.g., mRNA) encoding antigenic polypeptides that comprise a deletion or modification at one or more N-linked glycosylation sites.
  • RNA e.g., mRNA
  • STD vaccines of the present disclosure comprise at least one RNA polynucleotide, such as a mRNA (e.g., modified mRNA).
  • mRNA for example, is transcribed in vitro from template DNA, referred to as an “in vitro transcription template.”
  • an in vitro transcription template encodes a 5′ untranslated (UTR) region, contains an open reading frame, and encodes a 3′ UTR and a polyA tail.
  • UTR untranslated
  • a “5′ untranslated region” refers to a region of an mRNA that is directly upstream (i.e., 5′) from the start codon (i.e., the first codon of an mRNA transcript translated by a ribosome) that does not encode a polypeptide.
  • a “3′ untranslated region” refers to a region of an mRNA that is directly downstream (i.e., 3′) from the stop codon (i.e., the codon of an mRNA transcript that signals a termination of translation) that does not encode a polypeptide.
  • An “open reading frame” is a continuous stretch of DNA beginning with a start codon (e.g., methionine (ATG)), and ending with a stop codon (e.g., TAA, TAG or TGA) and encodes a polypeptide.
  • a start codon e.g., methionine (ATG)
  • a stop codon e.g., TAA, TAG or TGA
  • a “polyA tail” is a region of mRNA that is downstream, e.g., directly downstream (i.e., 3′), from the 3′ UTR that contains multiple, consecutive adenosine monophosphates.
  • a polyA tail may contain 10 to 300 adenosine monophosphates.
  • a polyA tail may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 adenosine monophosphates.
  • a polyA tail contains 50 to 250 adenosine monophosphates.
  • the poly(A) tail functions to protect mRNA from enzymatic degradation, e.g., in the cytoplasm, and aids in transcription termination, export of the mRNA from the nucleus and translation.
  • a polynucleotide includes 200 to 3,000 nucleotides.
  • a polynucleotide may include 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.
  • Flagellin is an approximately 500 amino acid monomeric protein that polymerizes to form the flagella associated with bacterial motion. Flagellin is expressed by a variety of flagellated bacteria ( Salmonella typhimurium for example) as well as non-flagellated bacteria (such as Escherichia coli ). Sensing of flagellin by cells of the innate immune system (dendritic cells, macrophages, etc.) is mediated by the Toll-like receptor 5 (TLR5) as well as by Nod-like receptors (NLRs) Ipaf and Naip5. TLRs and NLRs have been identified as playing a role in the activation of innate immune response and adaptive immune response. As such, flagellin provides an adjuvant effect in a vaccine.
  • TLR5 Toll-like receptor 5
  • NLRs Nod-like receptors
  • the nucleotide and amino acid sequences encoding known flagellin polypeptides are publicly available in the NCBI GenBank database.
  • a flagellin polypeptide refers to a full length flagellin protein, immunogenic fragments thereof, and peptides having at least 50% sequence identify to a flagellin protein or immunogenic fragments thereof.
  • Exemplary flagellin proteins include flagellin from Salmonella typhi (UniPro Entry number: Q56086), Salmonella typhimurium (A0A0C9DG09), Salmonella enteritidis (A0A0C9BAB7), and Salmonella choleraesuis (Q6V2X8), and ⁇ 56 (Table 17).
  • the flagellin polypeptide has at least 60%, 70%, 75%, 80%, 90%, 95%, 97%, 98%, or 99% sequence identify to a flagellin protein or immunogenic fragments thereof.
  • the flagellin polypeptide is an immunogenic fragment.
  • An immunogenic fragment is a portion of a flagellin protein that provokes an immune response.
  • the immune response is a TLR5 immune response.
  • An example of an immunogenic fragment is a flagellin protein in which all or a portion of a hinge region has been deleted or replaced with other amino acids.
  • an antigenic polypeptide may be inserted in the hinge region. Hinge regions are the hypervariable regions of a flagellin.
  • Hinge regions of a flagellin are also referred to as “D3 domain or region, “propeller domain or region,” “hypervariable domain or region” and “variable domain or region.” “At least a portion of a hinge region,” as used herein, refers to any part of the hinge region of the flagellin, or the entirety of the hinge region. In other embodiments an immunogenic fragment of flagellin is a 20, 25, 30, 35, or 40 amino acid C-terminal fragment of flagellin.
  • the flagellin monomer is formed by domains D0 through D3.
  • D0 and D1 which form the stem, are composed of tandem long alpha helices and are highly conserved among different bacteria.
  • the D1 domain includes several stretches of amino acids that are useful for TLR5 activation.
  • the entire D1 domain or one or more of the active regions within the domain are immunogenic fragments of flagellin. Examples of immunogenic regions within the D1 domain include residues 88-114 and residues 411-431 (in Salmonella typhimurium FliC flagellin. Within the 13 amino acids in the 88-100 region, at least 6 substitutions are permitted between Salmonella flagellin and other flagellins that still preserve TLR5 activation.
  • immunogenic fragments of flagellin include flagellin like sequences that activate TLR5 and contain a 13 amino acid motif that is 53% or more identical to the Salmonella sequence in 88-100 of FliC (LQRVRELAVQSAN; SEQ ID NO: 462).
  • the RNA (e.g., mRNA) vaccine includes an RNA that encodes a fusion protein of flagellin and one or more antigenic polypeptides.
  • a carboxy-terminus of the antigenic polypeptide is fused or linked to an amino terminus of the flagellin polypeptide.
  • an amino-terminus of the antigenic polypeptide is fused or linked to a carboxy-terminus of the flagellin polypeptide.
  • the fusion protein may include, for example, one, two, three, four, five, six or more flagellin polypeptides linked to one, two, three, four, five, six or more antigenic polypeptides.
  • flagellin polypeptides and/or two or more antigenic polypeptides are linked such a construct may be referred to as a “multimer.”
  • each of the components of a fusion protein may be directly linked to one another or they may be connected through a linker.
  • the linker may be an amino acid linker.
  • the amino acid linker encoded for by the RNA (e.g., mRNA) vaccine to link the components of the fusion protein may include, for instance, at least one member selected from the group consisting of a lysine residue, a glutamic acid residue, a serine residue and an arginine residue.
  • the linker is 1-30, 1-25, 1-25, 5-10, 5, 15, or 5-20 amino acids in length.
  • the RNA (e.g., mRNA) vaccine includes at least two separate RNA polynucleotides, one encoding one or more antigenic polypeptides and the other encoding the flagellin polypeptide.
  • the at least two RNA polynucleotides may be co-formulated in a carrier such as a lipid nanoparticle.
  • RNA e.g., mRNA
  • RNA e.g., mRNA
  • therapeutic vaccines are particularly amenable to combination vaccination approaches due to a number of factors including, but not limited to, speed of manufacture, ability to rapidly tailor vaccines to accommodate perceived geographical threat, and the like.
  • the vaccines utilize the human body to produce the antigenic protein, the vaccines are amenable to the production of larger, more complex antigenic proteins, allowing for proper folding, surface expression, antigen presentation, etc. in the human subject.
  • a combination vaccine can be administered that includes RNA (e.g., mRNA) encoding at least one antigenic polypeptide protein (or antigenic portion thereof) of a first STD virus and further includes RNA encoding at least one antigenic polypeptide protein (or antigenic portion thereof) of a second STD virus.
  • RNA e.g., mRNA
  • LNP lipid nanoparticle
  • compositions e.g., pharmaceutical compositions
  • methods, kits and reagents for prevention and/or treatment of STD s in humans and other mammals STD RNA (e.g. mRNA) vaccines can be used as therapeutic or prophylactic agents, alone or in combination with other vaccine(s). They may be used in medicine to prevent and/or treat STD.
  • the RNA (e.g., mRNA) vaccines of the present disclosure are used to provide prophylactic protection from HPV, HSV and/or Chlamydia .
  • Prophylactic protection from HPV, HSV and/or Chlamydia can be achieved following administration of a RNA (e.g., mRNA) vaccine of the present disclosure.
  • STD RNA e.g., mRNA
  • STD RNA vaccines of the present disclosure may be used to treat or prevent viral “co-infections” containing two or more STD infections.
  • Vaccines can be administered once, twice, three times, four times or more, but it is likely sufficient to administer the vaccine once (optionally followed by a single booster). It is possible, although less desirable, to administer the vaccine to an infected individual to achieve a therapeutic response. Dosing may need to be adjusted accordingly.
  • a method of eliciting an immune response in a subject against HPV, HSV and/or Chlamydia involves administering to the subject a STD RNA (e.g., mRNA) vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one HPV antigenic polypeptide, HSV antigenic polypeptide and/or at least one Chlamydia antigenic polypeptide, thereby inducing in the subject an immune response specific to HPV, HSV and/or Chlamydia antigenic polypeptide or an immunogenic fragment thereof, wherein anti-antigenic polypeptide antibody titer in the subject is increased following vaccination relative to anti-antigenic polypeptide antibody titer in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against HPV, HSV and/or Chlamydia .
  • a RNA (e.g., mRNA) vaccine e.g., a HPV RNA vaccine, a HSV RNA vaccine, or a Chlamydia RNA vaccine
  • a composition including a compound according to Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) (e.g., Compound 3, 18, 20, 25, 26, 29, 30, 60, 108-112, or 122).
  • a prophylactically effective dose is a therapeutically effective dose that prevents infection with the virus at a clinically acceptable level.
  • the therapeutically effective dose is a dose listed in a package insert for the vaccine.
  • a traditional vaccine refers to a vaccine other than the RNA (e.g., mRNA) vaccines of the present disclosure.
  • a traditional vaccine includes but is not limited to live/attenuated microorganism vaccines, killed/inactivated microorganism vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, VLP vaccines, etc.
  • a traditional vaccine is a vaccine that has achieved regulatory approval and/or is registered by a national drug regulatory body, for example the Food and Drug Administration (FDA) in the United States or the European Medicines Agency (EMA).
  • FDA Food and Drug Administration
  • EMA European Medicines Agency
  • the anti-antigenic polypeptide antibody titer in the subject is increased 1 log to 10 log following vaccination relative to anti-antigenic polypeptide antibody titer in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against HPV, HSV and/or Chlamydia.
  • the anti-antigenic polypeptide antibody titer in the subject is increased 1 log, 2 log, 3 log, 5 log or 10 log following vaccination relative to anti-antigenic polypeptide antibody titer in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against HPV, HSV and/or Chlamydia.
  • a method of eliciting an immune response in a subject against HPV, HSV and/or Chlamydia involves administering to the subject a STD RNA (e.g., mRNA) vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one HPV antigenic polypeptide, HSV antigenic polypeptide, and/or Chlamydia antigenic polypeptide or an immunogenic fragment thereof, thereby inducing in the subject an immune response specific to HPV antigenic polypeptide, HSV antigenic polypeptide, and/or Chlamydia antigenic polypeptide or an immunogenic fragment thereof, wherein the immune response in the subject is equivalent to an immune response in a subject vaccinated with a traditional vaccine against the HPV, HSV and/or Chlamydia at 2 times to 100 times the dosage level relative to the RNA (e.g., mRNA) vaccine.
  • RNA e.g.,
  • the immune response in the subject is equivalent to an immune response in a subject vaccinated with a traditional vaccine at 2, 3, 4, 5, 10, 50, 100 times the dosage level relative to the HPV, HSV and/or Chlamydia RNA (e.g., mRNA) vaccine.
  • the immune response in the subject is equivalent to an immune response in a subject vaccinated with a traditional vaccine at 10-100 times, or 100-1000 times, the dosage level relative to the HPV, HSV and/or Chlamydia RNA (e.g., mRNA) vaccine.
  • the immune response is assessed by determining [protein] antibody titer in the subject.
  • the immune response in the subject is equivalent to an immune response in a subject vaccinated with a traditional vaccine at 2, 3, 4, 5, 10, 50, 100 times the dosage level relative to the HPV, HSV and/or Chlamydia RNA (e.g., mRNA) vaccine by administering to the subject a STD RNA (e.g., mRNA) vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one HPV, HSV and/or Chlamydia antigenic polypeptide, thereby inducing in the subject an immune response specific to the antigenic polypeptide or an immunogenic fragment thereof, wherein the immune response in the subject is induced 2 days to 10 weeks earlier relative to an immune response induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine against HPV, HSV and/
  • the immune response in the subject is induced 2 days earlier, or 3 days earlier, relative to an immune response induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine.
  • the immune response in the subject is induced 1 week, 2 weeks, 3 weeks, 5 weeks, or 10 weeks earlier relative to an immune response induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine.
  • Also provided herein is a method of eliciting an immune response in a subject against HPV, HSV and/or Chlamydia by administering to the subject a STD RNA (e.g., mRNA) vaccine having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide does not include a stabilization element, and wherein an adjuvant is not co-formulated or co-administered with the vaccine.
  • STD RNA e.g., mRNA
  • compositions e.g., pharmaceutical compositions
  • methods, kits and reagents for prevention, treatment or diagnosis of HPV, HSV and/or Chlamydia in humans and other mammals for example.
  • STD RNA e.g. mRNA
  • STD RNA e.g. mRNA
  • the respiratory RNA (e.g., mRNA) vaccines of the present disclosure are used fin the priming of immune effector cells, for example, to activate peripheral blood mononuclear cells (PBMCs) ex vivo, which are then infused (re-infused) into a subject.
  • PBMCs peripheral blood mononuclear cells
  • STD vaccine containing RNA (e.g., mRNA) polynucleotides as described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA (e.g., mRNA) polynucleotides are translated in vivo to produce an antigenic polypeptide.
  • a subject e.g., a mammalian subject, such as a human subject
  • the RNA (e.g., mRNA) polynucleotides are translated in vivo to produce an antigenic polypeptide.
  • the STD RNA (e.g., mRNA) vaccines may be induced for translation of a polypeptide (e.g., antigen or immunogen) in a cell, tissue or organism.
  • a polypeptide e.g., antigen or immunogen
  • such translation occurs in vivo, although such translation may occur ex vivo, in culture or in vitro.
  • the cell, tissue or organism is contacted with an effective amount of a composition containing a STD RNA (e.g., mRNA) vaccine that contains a polynucleotide that has at least one a translatable region encoding an antigenic polypeptide.
  • an “effective amount” of an STD RNA (e.g. mRNA) vaccine is provided based, at least in part, on the target tissue, target cell type, means of administration, physical characteristics of the polynucleotide (e.g., size, and extent of modified nucleosides) and other components of the vaccine, and other determinants.
  • an effective amount of the STD RNA (e.g., mRNA) vaccine composition provides an induced or boosted immune response as a function of antigen production in the cell, preferably more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or a peptide antigen.
  • Increased antigen production may be demonstrated by increased cell transfection (the percentage of cells transfected with the RNA, e.g., mRNA, vaccine), increased protein translation from the polynucleotide, decreased nucleic acid degradation (as demonstrated, for example, by increased duration of protein translation from a modified polynucleotide), or altered antigen specific immune response of the host cell.
  • RNA e.g. mRNA
  • vaccines including polynucleotides their encoded polypeptides
  • HPV high-density virus
  • HSV high-density virus
  • Chlamydia a virus
  • Respiratory RNA (e.g. mRNA) vaccines may be administered prophylactically or therapeutically as part of an active immunization scheme to healthy individuals or early in infection during the incubation phase or during active infection after onset of symptoms.
  • the amount of RNA (e.g., mRNA) vaccine of the present disclosure provided to a cell, a tissue or a subject may be an amount effective for immune prophylaxis.
  • STD RNA e.g. mRNA
  • STD RNA e.g. mRNA
  • a prophylactic or therapeutic compound may be an adjuvant or a booster.
  • the term “booster” refers to an extra administration of the prophylactic (vaccine) composition.
  • a booster or booster vaccine may be given after an earlier administration of the prophylactic composition.
  • the time of administration between the initial administration of the prophylactic composition and the booster may be, but is not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14
  • STD RNA e.g. mRNA
  • vaccines may be administered intramuscularly, intradermally, or intranasally, similarly to the administration of inactivated vaccines known in the art.
  • RNA (e.g. mRNA) vaccines may be utilized in various settings depending on the prevalence of the infection or the degree or level of unmet medical need.
  • the RNA (e.g., mRNA) vaccines may be utilized to treat and/or prevent a variety of STDs.
  • RNA (e.g., mRNA) vaccines have superior properties in that they produce much larger antibody titers and produce responses early than commercially available anti-viral agents/compositions.
  • compositions including STD RNA (e.g. mRNA) vaccines and RNA (e.g. mRNA) vaccine compositions and/or complexes optionally in combination with one or more pharmaceutically acceptable excipients.
  • STD RNA e.g. mRNA
  • RNA e.g. mRNA
  • HPV, HSV and/or Chlamydia RNA (e.g. mRNA) vaccines may be formulated or administered alone or in conjunction with one or more other components.
  • HPV, HSV and/or Chlamydia RNA (e.g., mRNA) vaccines may comprise other components including, but not limited to, adjuvants.
  • STD e.g. mRNA
  • vaccines do not include an adjuvant (they are adjuvant free).
  • STD RNA (e.g. mRNA) vaccines may be formulated or administered in combination with one or more pharmaceutically-acceptable excipients.
  • vaccine compositions comprise at least one additional active substances, such as, for example, a therapeutically-active substance, a prophylactically-active substance, or a combination of both.
  • Vaccine compositions may be sterile, pyrogen-free or both sterile and pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents, such as vaccine compositions, may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).
  • STD RNA (e.g. mRNA) vaccines are administered to humans, human patients or subjects.
  • active ingredient generally refers to the RNA (e.g., mRNA) vaccines or the polynucleotides contained therein, for example, RNA polynucleotides (e.g., mRNA polynucleotides) encoding antigenic polypeptides.
  • Formulations of the STD vaccine compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
  • preparatory methods include the step of bringing the active ingredient (e.g., mRNA polynucleotide) into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.
  • compositions in accordance with the disclosure will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.
  • STD RNA e.g. mRNA
  • STD RNA vaccines can be formulated using one or more excipients to: increase stability; increase cell transfection; permit the sustained or delayed release (e.g., from a depot formulation); alter the biodistribution (e.g., target to specific tissues or cell types); increase the translation of encoded protein in vivo; and/or alter the release profile of encoded protein (antigen) in vivo.
  • excipients can include, without limitation, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with STD RNA (e.g. mRNA) vaccines (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics and combinations thereof.
  • STD RNA e.g. mRNA
  • hyaluronidase e.g., for transplantation into a subject
  • Naturally-occurring eukaryotic mRNA molecules have been found to contain stabilizing elements, including, but not limited to untranslated regions (UTR) at their 5′-end (5′UTR) and/or at their 3′-end (3′UTR), in addition to other structural features, such as a 5′-cap structure or a 3′-poly(A) tail.
  • UTR untranslated regions
  • 3′UTR 3′-end
  • Both the 5′UTR and the 3′UTR are typically transcribed from the genomic DNA and are elements of the premature mRNA.
  • Characteristic structural features of mature mRNA, such as the 5′-cap and the 3′-poly(A) tail are usually added to the transcribed (premature) mRNA during mRNA processing.
  • the 3′-poly(A) tail is typically a stretch of adenine nucleotides added to the 3′-end of the transcribed mRNA. It can comprise up to about 400 adenine nucleotides. In some embodiments the length of the 3′-poly(A) tail may be an essential element with respect to the stability of the individual mRNA.
  • the RNA (e.g., mRNA) vaccine may include one or more stabilizing elements.
  • Stabilizing elements may include for instance a histone stem-loop.
  • a stem-loop binding protein (SLBP) a 32 kDa protein has been identified. It is associated with the histone stem-loop at the 3′-end of the histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle; it is peaks during the S-phase, when histone mRNA levels are also elevated.
  • the protein has been shown to be essential for efficient 3′-end processing of histone pre-mRNA by the U7 snRNP.
  • SLBP continues to be associated with the stem-loop after processing, and then stimulates the translation of mature histone mRNAs into histone proteins in the cytoplasm.
  • the RNA binding domain of SLBP is conserved through metazoa and protozoa; its binding to the histone stem-loop depends on the structure of the loop.
  • the minimum binding site includes at least three nucleotides 5′ and two nucleotides 3′ relative to the stem-loop.
  • the RNA (e.g., mRNA) vaccines include a coding region, at least one histone stem-loop, and optionally, a poly(A) sequence or polyadenylation signal.
  • the poly(A) sequence or polyadenylation signal generally should enhance the expression level of the encoded protein.
  • the encoded protein in some embodiments, is not a histone protein, a reporter protein (e.g. Luciferase, GFP, EGFP, ⁇ -Galactosidase, EGFP), or a marker or selection protein (e.g. alpha-Globin, Galactokinase and Xanthine:guanine phosphoribosyl transferase (GPT)).
  • a reporter protein e.g. Luciferase, GFP, EGFP, ⁇ -Galactosidase, EGFP
  • a marker or selection protein e.g. alpha-Globin, Galactokinase and
  • the combination of a poly(A) sequence or polyadenylation signal and at least one histone stem-loop acts synergistically to increase the protein expression beyond the level observed with either of the individual elements. It has been found that the synergistic effect of the combination of poly(A) and at least one histone stem-loop does not depend on the order of the elements or the length of the poly(A) sequence.
  • the RNA (e.g., mRNA) vaccine does not comprise a histone downstream element (HDE).
  • Histone downstream element includes a purine-rich polynucleotide stretch of approximately 15 to 20 nucleotides 3′ of naturally occurring stem-loops, representing the binding site for the U7 snRNA, which is involved in processing of histone pre-mRNA into mature histone mRNA.
  • the inventive nucleic acid does not include an intron.
  • the RNA (e.g., mRNA) vaccine may or may not contain a enhancer and/or promoter sequence, which may be modified or unmodified or which may be activated or inactivated.
  • the histone stem-loop is generally derived from histone genes, and includes an intramolecular base pairing of two neighbored partially or entirely reverse complementary sequences separated by a spacer, including (e.g., consisting of) a short sequence, which forms the loop of the structure.
  • the unpaired loop region is typically unable to base pair with either of the stem loop elements. It occurs more often in RNA, as is a key component of many RNA secondary structures, but may be present in single-stranded DNA as well.
  • the Stability of the stem-loop structure generally depends on the length, number of mismatches or bulges, and base composition of the paired region.
  • wobble base pairing non-Watson-Crick base pairing
  • the at least one histone stem-loop sequence comprises a length of 15 to 45 nucleotides.
  • the RNA (e.g., mRNA) vaccine may have one or more AU-rich sequences removed. These sequences, sometimes referred to as AURES are destabilizing sequences found in the 3′UTR.
  • the AURES may be removed from the RNA (e.g., mRNA) vaccines. Alternatively the AURES may remain in the RNA (e.g., mRNA) vaccine.
  • STD RNA (e.g. mRNA) vaccines are formulated in a nanoparticle.
  • STD RNA (e.g. mRNA) vaccines are formulated in a lipid nanoparticle.
  • STD RNA (e.g. mRNA) vaccines are formulated in a lipid-polycation complex, referred to as a cationic lipid nanoparticle.
  • the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and/or polyarginine.
  • STD RNA e.g., mRNA
  • STD RNA vaccines are formulated in a lipid nanoparticle that includes a non-cationic lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • a lipid nanoparticle formulation may be influenced by, but not limited to, the selection of the cationic lipid component, the degree of cationic lipid saturation, the nature of the PEGylation, ratio of all components and biophysical parameters such as size.
  • the lipid nanoparticle formulation is composed of 57.1% cationic lipid, 7.1% dipalmitoylphosphatidylcholine, 34.3% cholesterol, and 1.4% PEG-c-DMA.
  • changing the composition of the cationic lipid can more effectively deliver siRNA to various antigen presenting cells (Basha et al. Mol Ther. 2011 19:2186-2200).
  • lipid nanoparticle formulations may comprise 35 to 45% cationic lipid, 40% to 50% cationic lipid, 50% to 60% cationic lipid and/or 55% to 65% cationic lipid.
  • the ratio of lipid to RNA (e.g., mRNA) in lipid nanoparticles may be 5:1 to 20:1, 10:1 to 25:1, 15:1 to 30:1 and/or at least 30:1.
  • the ratio of PEG in the lipid nanoparticle formulations may be increased or decreased and/or the carbon chain length of the PEG lipid may be modified from C14 to C18 to alter the pharmacokinetics and/or biodistribution of the lipid nanoparticle formulations.
  • lipid nanoparticle formulations may contain 0.5% to 3.0%, 1.0% to 3.5%, 1.5% to 4.0%, 2.0% to 4.5%, 2.5% to 5.0% and/or 3.0% to 6.0% of the lipid molar ratio of PEG-c-DOMG (R-3-[( ⁇ -methoxy-poly(ethyleneglycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG) as compared to the cationic lipid, DSPC and cholesterol.
  • PEG-c-DOMG R-3-[( ⁇ -methoxy-poly(ethyleneglycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine
  • the PEG-c-DOMG may be replaced with a PEG lipid such as, but not limited to, PEG-DSG (1,2-Distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-Dimyristoyl-sn-glycerol) and/or PEG-DPG (1,2-Dipalmitoyl-sn-glycerol, methoxypolyethylene glycol).
  • the cationic lipid may be selected from any lipid known in the art such as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200 and DLin-KC2-DMA.
  • an STD RNA (e.g. mRNA) vaccine formulation is a nanoparticle that comprises at least one lipid.
  • the lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids and amino alcohol lipids.
  • the lipid may be a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids.
  • the amino alcohol cationic lipid may be the lipids described in and/or made by the methods described in U.S. Patent Publication No. US20130150625, herein incorporated by reference in its entirety.
  • the cationic lipid may be 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2- ⁇ [(9Z,2Z)-octadeca-9,12-dien-1-yloxy]methyl ⁇ propan-1-ol (Compound 1 in US20130150625); 2-amino-3-[(9Z)-octadec-9-en-1-yloxy]-2- ⁇ [(9Z)-octadec-9-en-1-yloxy]methyl ⁇ propan-1-ol (Compound 2 in US20130150625); 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (Compound 3 in US20130150625); and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9
  • Lipid nanoparticle formulations typically comprise a lipid, in particular, an ionizable cationic lipid, for example, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), or di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), and further comprise a neutral lipid, a sterol and a molecule capable of reducing particle aggregation, for example a PEG or PEG-modified lipid.
  • an ionizable cationic lipid for example, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC
  • a lipid nanoparticle formulation consists essentially of (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE and SM; (iii) a sterol, e.g., cholesterol; and (iv) a PEG-lipid, e.g., PEG-DMG or PEG-cDMA, in a molar ratio of 20-60% cationic lipid: 5-2
  • a lipid nanoparticle formulation includes 25% to 75% on a molar basis of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., 35 to 65%, 45 to 65%, 60%, 57.5%, 50% or 40% on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-di
  • a lipid nanoparticle formulation includes 0.5% to 15% on a molar basis of the neutral lipid, e.g., 3 to 12%, 5 to 10% or 15%, 10%, or 7.5% on a molar basis.
  • neutral lipids include, without limitation, DSPC, POPC, DPPC, DOPE and SM.
  • the formulation includes 5% to 50% on a molar basis of the sterol (e.g., 15 to 45%, 20 to 40%, 40%, 38.5%, 35%, or 31% on a molar basis.
  • a non-limiting example of a sterol is cholesterol.
  • a lipid nanoparticle formulation includes 0.5% to 20% on a molar basis of the PEG or PEG-modified lipid (e.g., 0.5 to 10%, 0.5 to 5%, 1.5%, 0.5%, 1.5%, 3.5%, or 5% on a molar basis.
  • a PEG or PEG modified lipid comprises a PEG molecule of an average molecular weight of 2,000 Da.
  • a PEG or PEG modified lipid comprises a PEG molecule of an average molecular weight of less than 2,000, for example around 1,500 Da, around 1,000 Da, or around 500 Da.
  • PEG-modified lipids include PEG-distearoyl glycerol (PEG-DMG) (also referred herein as PEG-C14 or C14-PEG), PEG-cDMA (further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005) the contents of which are herein incorporated by reference in their entirety).
  • PEG-DMG PEG-distearoyl glycerol
  • PEG-cDMA further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005) the contents of which are herein incorporated by reference in their entirety.
  • lipid nanoparticle formulations include 25-75% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 0.5-15% of the neutral lipid, 5-50% of the sterol, and 0.5-20% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-di
  • lipid nanoparticle formulations include 35-65% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 3-12% of the neutral lipid, 15-45% of the sterol, and 0.5-10% of the PEG or PEG-modified lipid on a molar basis.
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-di
  • lipid nanoparticle formulations include 45-65% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 5-10% of the neutral lipid, 25-40% of the sterol, and 0.5-10% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-di
  • lipid nanoparticle formulations include 60% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 7.5% of the neutral lipid, 31% of the sterol, and 1.5% of the PEG or PEG-modified lipid on a molar basis.
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-dimethylaminobut
  • lipid nanoparticle formulations include 50% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 10% of the neutral lipid, 38.5% of the sterol, and 1.5% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobuty
  • lipid nanoparticle formulations include 50% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 10% of the neutral lipid, 35% of the sterol, 4.5% or 5% of the PEG or PEG-modified lipid, and 0.5% of the targeting lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl
  • lipid nanoparticle formulations include 40% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 15% of the neutral lipid, 40% of the sterol, and 5% of the PEG or PEG-modified lipid on a molar basis.
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-dimethylaminobutyrate
  • lipid nanoparticle formulations include 57.2% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 7.1% of the neutral lipid, 34.3% of the sterol, and 1.4% of the PEG or PEG-modified lipid on a molar basis.
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-dimethyl
  • lipid nanoparticle formulations include 57.5% of a cationic lipid selected from the PEG lipid is PEG-cDMA (PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005), the contents of which are herein incorporated by reference in their entirety), 7.5% of the neutral lipid, 31.5% of the sterol, and 3.5% of the PEG or PEG-modified lipid on a molar basis.
  • PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005), the contents of which are herein incorporated by reference in their entirety)
  • 7.5% of the neutral lipid 31.5% of the sterol
  • 3.5% of the PEG or PEG-modified lipid on a molar basis PEG-cDMA
  • lipid nanoparticle formulations consists essentially of a lipid mixture in molar ratios of 20-70% cationic lipid: 5-45% neutral lipid: 20-55% cholesterol: 0.5-15% PEG-modified lipid. In some embodiments, lipid nanoparticle formulations consists essentially of a lipid mixture in a molar ratio of 20-60% cationic lipid: 5-25% neutral lipid: 25-55% cholesterol: 0.5-15% PEG-modified lipid.
  • the molar lipid ratio is 50/10/38.5/1.5 (mol % cationic lipid/neutral lipid, e.g., DSPC/Chol/PEG-modified lipid, e.g., PEG-DMG, PEG-DSG or PEG-DPG), 57.2/7.1134.3/1.4 (mol % cationic lipid/neutral lipid, e.g., DPPC/Chol/PEG-modified lipid, e.g., PEG-cDMA), 40/15/40/5 (mol % cationic lipid/neutral lipid, e.g., DSPC/Chol/PEG-modified lipid, e.g., PEG-DMG), 50/10/35/4.5/0.5 (mol % cationic lipid/neutral lipid, e.g., DSPC/Chol/PEG-modified lipid, e.g., PEG-DSG), 50/10/35/5 (cationic lipid
  • Non-limiting examples of lipid nanoparticle compositions and methods of making them are described, for example, in Semple et al. (2010) Nat. Biotechnol. 28:172-176; Jayarama et al. (2012), Angew. Chem. Int. Ed., 51: 8529-8533; and Maier et al. (2013) Molecular Therapy 21, 1570-1578 (the contents of each of which are incorporated herein by reference in their entirety).
  • lipid nanoparticle formulations may comprise a cationic lipid, a PEG lipid and a structural lipid and optionally comprise a non-cationic lipid.
  • a lipid nanoparticle may comprise 40-60% of cationic lipid, 5-15% of a non-cationic lipid, 1-2% of a PEG lipid and 30-50% of a structural lipid.
  • the lipid nanoparticle may comprise 50% cationic lipid, 10% non-cationic lipid, 1.5% PEG lipid and 38.5% structural lipid.
  • a lipid nanoparticle may comprise 55% cationic lipid, 10% non-cationic lipid, 2.5% PEG lipid and 32.5% structural lipid.
  • the cationic lipid may be any cationic lipid described herein such as, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA and L319.
  • the lipid nanoparticle formulations described herein may be 4 component lipid nanoparticles.
  • the lipid nanoparticle may comprise a cationic lipid, a non-cationic lipid, a PEG lipid and a structural lipid.
  • the lipid nanoparticle may comprise 40-60% of cationic lipid, 5-15% of a non-cationic lipid, 1-2% of a PEG lipid and 30-50% of a structural lipid.
  • the lipid nanoparticle may comprise 50% cationic lipid, 10% non-cationic lipid, 1.5% PEG lipid and 38.5% structural lipid.
  • the lipid nanoparticle may comprise 55% cationic lipid, 10% non-cationic lipid, 2.5% PEG lipid and 32.5% structural lipid.
  • the cationic lipid may be any cationic lipid described herein such as, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA and L319.
  • the lipid nanoparticle formulations described herein may comprise a cationic lipid, a non-cationic lipid, a PEG lipid and a structural lipid.
  • the lipid nanoparticle comprise 50% of the cationic lipid DLin-KC2-DMA, 10% of the non-cationic lipid DSPC, 1.5% of the PEG lipid PEG-DOMG and 38.5% of the structural lipid cholesterol.
  • the lipid nanoparticle comprise 50% of the cationic lipid DLin-MC3-DMA, 10% of the non-cationic lipid DSPC, 1.5% of the PEG lipid PEG-DOMG and 38.5% of the structural lipid cholesterol.
  • the lipid nanoparticle comprise 50% of the cationic lipid DLin-MC3-DMA, 10% of the non-cationic lipid DSPC, 1.5% of the PEG lipid PEG-DMG and 38.5% of the structural lipid cholesterol.
  • the lipid nanoparticle comprise 55% of the cationic lipid L319, 10% of the non-cationic lipid DSPC, 2.5% of the PEG lipid PEG-DMG and 32.5% of the structural lipid cholesterol.
  • Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a vaccine composition may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and 99% (w/w) of the active ingredient.
  • the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.
  • the STD RNA (e.g. mRNA) vaccine composition may comprise the polynucleotide described herein, formulated in a lipid nanoparticle comprising MC3, Cholesterol, DSPC and PEG2000-DMG, the buffer trisodium citrate, sucrose and water for injection.
  • the composition comprises: 2.0 mg/mL of drug substance, 21.8 mg/mL of MC3, 10.1 mg/mL of cholesterol, 5.4 mg/mL of DSPC, 2.7 mg/mL of PEG2000-DMG, 5.16 mg/mL of trisodium citrate, 71 mg/mL of sucrose and 1.0 mL of water for injection.
  • a nanoparticle e.g., a lipid nanoparticle
  • a nanoparticle has a mean diameter of 10-500 nm, 20-400 nm, 30-300 nm, 40-200 nm.
  • a nanoparticle e.g., a lipid nanoparticle
  • Liposomes Liposomes, Lipoplexes, and Lipid Nanoparticles
  • RNA (e.g., mRNA) vaccines of the disclosure can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles.
  • pharmaceutical compositions of RNA (e.g., mRNA) vaccines include liposomes. Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of nutrients and pharmaceutical formulations.
  • Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter.
  • MLV multilamellar vesicle
  • SUV small unicellular vesicle
  • LUV large unilamellar vesicle
  • Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis.
  • Liposomes may contain a low or a high pH in order to improve the delivery of the pharmaceutical formulations.
  • liposomes may depend on the physicochemical characteristics such as, but not limited to, the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during the application and/or delivery of the vesicles, the optimization size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and possibility of large-scale production of safe and efficient liposomal products.
  • compositions described herein may include, without limitation, liposomes such as those formed from 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)[1,3]-dioxolane (DLin-KC2-DMA), and MC3 (US20100324120; herein incorporated by reference in its entirety) and liposomes which may deliver small molecule drugs such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).
  • DOXIL® 1,2-dioleyloxy-N,N-dimethylaminopropane
  • DiLa2 liposomes from Marina Biotech (Bothell, Wash.)
  • compositions described herein may include, without limitation, liposomes such as those formed from the synthesis of stabilized plasmid-lipid particles (SPLP) or stabilized nucleic acid lipid particle (SNALP) that have been previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo (see Wheeler et al. Gene Therapy. 1999 6:271-281; Zhang et al. Gene Therapy. 1999 6:1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et al., Nat Biotechnol. 2005 2:1002-1007; Zimmermann et al., Nature. 2006 441:111-114; Heyes et al.
  • SPLP stabilized plasmid-lipid particles
  • SNALP stabilized nucleic acid lipid particle
  • a liposome can contain, but is not limited to, 55% cholesterol, 20% disteroylphosphatidyl choline (DSPC), 10% PEG-S-DSG, and 15% 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al.
  • DSPC disteroylphosphatidyl choline
  • PEG-S-DSG 10% PEG-S-DSG
  • DODMA 1,2-dioleyloxy-N,N-dimethylaminopropane
  • certain liposome formulations may contain, but are not limited to, 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, where the cationic lipid can be 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al.
  • DSDMA 1,2-distearloxy-N,N-dimethylaminopropane
  • DODMA 1,2-dilinolenyloxy-3-dimethylaminopropane
  • liposome formulations may comprise from about 25.0% cholesterol to about 40.0% cholesterol, from about 30.0% cholesterol to about 45.0% cholesterol, from about 35.0% cholesterol to about 50.0% cholesterol and/or from about 48.5% cholesterol to about 60% cholesterol.
  • formulations may comprise a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0% and 43.5%.
  • formulations may comprise from about 5.0% to about 10.0% DSPC and/or from about 7.0% to about 15.0% DSPC.
  • the RNA (e.g., mRNA) vaccine pharmaceutical compositions may be formulated in liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, Wash.), SMARTICLES® (Marina Biotech, Bothell, Wash.), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708-1713); herein incorporated by reference in its entirety) and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).
  • liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, Wash.), SMARTICLES® (Marina Biotech, Bothell, Wash.), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phospho
  • the cationic lipid may be a low molecular weight cationic lipid such as those described in U.S. Patent Application No. 20130090372, the contents of which are herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccines may be formulated in a lipid vesicle, which may have crosslinks between functionalized lipid bilayers.
  • the RNA (e.g., mRNA) vaccines may be formulated in a lipid-polycation complex.
  • the formation of the lipid-polycation complex may be accomplished by methods known in the art and/or as described in U.S. Pub. No. 20120178702, herein incorporated by reference in its entirety.
  • the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and/or polyarginine.
  • the RNA (e.g., mRNA) vaccines may be formulated in a lipid-polycation complex, which may further include a non-cationic lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).
  • a non-cationic lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • the ratio of PEG in the lipid nanoparticle (LNP) formulations may be increased or decreased and/or the carbon chain length of the PEG lipid may be modified from C14 to C18 to alter the pharmacokinetics and/or biodistribution of the LNP formulations.
  • LNP formulations may contain from about 0.5% to about 3.0%, from about 1.0% to about 3.5%, from about 1.5% to about 4.0%, from about 2.0% to about 4.5%, from about 2.5% to about 5.0% and/or from about 3.0% to about 6.0% of the lipid molar ratio of PEG-c-DOMG (R-3-[( ⁇ -methoxy-poly(ethyleneglycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG) as compared to the cationic lipid, DSPC and cholesterol.
  • PEG-c-DOMG R-3-[( ⁇ -methoxy-poly(ethyleneglycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine
  • the PEG-c-DOMG may be replaced with a PEG lipid such as, but not limited to, PEG-DSG (1,2-Distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-Dimyristoyl-sn-glycerol) and/or PEG-DPG (1,2-Dipalmitoyl-sn-glycerol, methoxypolyethylene glycol).
  • the cationic lipid may be selected from any lipid known in the art such as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200 and DLin-KC2-DMA.
  • the RNA (e.g., mRNA) vaccines may be formulated in a lipid nanoparticle.
  • the RNA (e.g., mRNA) vaccine formulation comprising the polynucleotide is a nanoparticle which may comprise at least one lipid.
  • the lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids and amino alcohol lipids.
  • the lipid may be a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids.
  • the amino alcohol cationic lipid may be the lipids described in and/or made by the methods described in U.S. Patent Publication No. US20130150625, herein incorporated by reference in its entirety.
  • the cationic lipid may be 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2- ⁇ [(9Z,2Z)-octadeca-9,12-dien-1-yloxy]methyl ⁇ propan-1-ol (Compound 1 in US20130150625); 2-amino-3-[(9Z)-octadec-9-en-1-yloxy]-2- ⁇ [(9Z)-octadec-9-en-1-yloxy]methyl ⁇ propan-1-ol (Compound 2 in US20130150625); 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (Compound 3 in US20130150625); and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9
  • Lipid nanoparticle formulations typically comprise a lipid, in particular, an ionizable cationic lipid, for example, 2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), or di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), and further comprise a neutral lipid, a sterol and a molecule capable of reducing particle aggregation, for example a PEG or PEG-modified lipid.
  • an ionizable cationic lipid for example, 2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane (DLin-KC2-D
  • the lipid nanoparticle formulation consists essentially of (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE and SM; (iii) a sterol, e.g., cholesterol; and (iv) a PEG-lipid, e.g., PEG-DMG or PEG-cDMA, in a molar ratio of about 20-60% cationic lipid: 5-2
  • the formulation includes from about 25% to about 75% on a molar basis of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., from about 35 to about 65%, from about 45 to about 65%, about 60%, about 57.5%, about 50% or about 40% on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoley
  • the formulation includes from about 0.5% to about 15% on a molar basis of the neutral lipid e.g., from about 3 to about 12%, from about 5 to about 10% or about 15%, about 10%, or about 7.5% on a molar basis.
  • neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE and SM.
  • the formulation includes from about 5% to about 50% on a molar basis of the sterol (e.g., about 15 to about 45%, about 20 to about 40%, about 40%, about 38.5%, about 35%, or about 31% on a molar basis.
  • An exemplary sterol is cholesterol.
  • the formulation includes from about 0.5% to about 20% on a molar basis of the PEG or PEG-modified lipid (e.g., about 0.5 to about 10%, about 0.5 to about 5%, about 1.5%, about 0.5%, about 1.5%, about 3.5%, or about 5% on a molar basis.
  • the PEG or PEG modified lipid comprises a PEG molecule of an average molecular weight of 2,000 Da.
  • the PEG or PEG modified lipid comprises a PEG molecule of an average molecular weight of less than 2,000, for example around 1,500 Da, around 1,000 Da, or around 500 Da.
  • PEG-modified lipids include, but are not limited to, PEG-distearoyl glycerol (PEG-DMG) (also referred herein as PEG-C14 or C14-PEG), PEG-cDMA (further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005) the contents of which are herein incorporated by reference in their entirety)
  • PEG-DMG PEG-distearoyl glycerol
  • PEG-cDMA further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005) the contents of which are herein incorporated by reference in their entirety
  • the formulations of the present disclosure include 25-75% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 0.5-15% of the neutral lipid, 5-50% of the sterol, and 0.5-20% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-di
  • the formulations of the present disclosure include 35-65% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 3-12% of the neutral lipid, 15-45% of the sterol, and 0.5-10% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethyl
  • the formulations of the present disclosure include 45-65% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 5-10% of the neutral lipid, 25-40% of the sterol, and 0.5-10% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-di
  • the formulations of the present disclosure include about 60% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 7.5% of the neutral lipid, about 31% of the sterol, and about 1.5% of the PEG or PEG-modified lipid on a molar basis.
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-dimethyl
  • the formulations of the present disclosure include about 50% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 10% of the neutral lipid, about 38.5% of the sterol, and about 1.5% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethyla
  • the formulations of the present disclosure include about 50% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 10% of the neutral lipid, about 35% of the sterol, about 4.5% or about 5% of the PEG or PEG-modified lipid, and about 0.5% of the targeting lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dil
  • the formulations of the present disclosure include about 40% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 15% of the neutral lipid, about 40% of the sterol, and about 5% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylamino
  • the formulations of the present disclosure include about 57.2% of a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), about 7.1% of the neutral lipid, about 34.3% of the sterol, and about 1.4% of the PEG or PEG-modified lipid on a molar basis.
  • a cationic lipid selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-
  • the formulations of the present disclosure include about 57.5% of a cationic lipid selected from the PEG lipid is PEG-cDMA (PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005), the contents of which are herein incorporated by reference in their entirety), about 7.5% of the neutral lipid, about 31.5% of the sterol, and about 3.5% of the PEG or PEG-modified lipid on a molar basis.
  • PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005), the contents of which are herein incorporated by reference in their entirety)
  • about 7.5% of the neutral lipid about 31.5% of the sterol
  • about 3.5% of the PEG or PEG-modified lipid on a molar basis PEG-cDMA
  • lipid nanoparticle formulation consists essentially of a lipid mixture in molar ratios of about 20-70% cationic lipid: 5-45% neutral lipid: 20-55% cholesterol: 0.5-15% PEG-modified lipid; more preferably in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% cholesterol: 0.5-15% PEG-modified lipid.
  • the molar lipid ratio is approximately 50/10/38.5/1.5 (mol % cationic lipid/neutral lipid, e.g., DSPC/Chol/PEG-modified lipid, e.g., PEG-DMG, PEG-DSG or PEG-DPG), 57.2/7.1134.3/1.4 (mol % cationic lipid/neutral lipid, e.g., DPPC/Chol/PEG-modified lipid, e.g., PEG-cDMA), 40/15/40/5 (mol % cationic lipid/neutral lipid, e.g., DSPC/Chol/PEG-modified lipid, e.g., PEG-DMG), 50/10/35/4.5/0.5 (mol % cationic lipid/neutral lipid, e.g., DSPC/Chol/PEG-modified lipid, e.g., PEG-DSG), 50/10/35/5 (cationic cationic lipid
  • the lipid nanoparticle formulations described herein may comprise a cationic lipid, a PEG lipid and a structural lipid and optionally comprise a non-cationic lipid.
  • the lipid nanoparticle may comprise about 40-60% of cationic lipid, about 5-15% of a non-cationic lipid, about 1-2% of a PEG lipid and about 30-50% of a structural lipid.
  • the lipid nanoparticle may comprise about 50% cationic lipid, about 10% non-cationic lipid, about 1.5% PEG lipid and about 38.5% structural lipid.
  • the lipid nanoparticle may comprise about 55% cationic lipid, about 10% non-cationic lipid, about 2.5% PEG lipid and about 32.5% structural lipid.
  • the cationic lipid may be any cationic lipid described herein such as, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA and L319.
  • the lipid nanoparticle formulations described herein may be 4 component lipid nanoparticles.
  • the lipid nanoparticle may comprise a cationic lipid, a non-cationic lipid, a PEG lipid and a structural lipid.
  • the lipid nanoparticle may comprise about 40-60% of cationic lipid, about 5-15% of a non-cationic lipid, about 1-2% of a PEG lipid and about 30-50% of a structural lipid.
  • the lipid nanoparticle may comprise about 50% cationic lipid, about 10% non-cationic lipid, about 1.5% PEG lipid and about 38.5% structural lipid.
  • the lipid nanoparticle may comprise about 55% cationic lipid, about 10% non-cationic lipid, about 2.5% PEG lipid and about 32.5% structural lipid.
  • the cationic lipid may be any cationic lipid described herein such as, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA and L319.
  • the lipid nanoparticle formulations described herein may comprise a cationic lipid, a non-cationic lipid, a PEG lipid and a structural lipid.
  • the lipid nanoparticle comprise about 50% of the cationic lipid DLin-KC2-DMA, about 10% of the non-cationic lipid DSPC, about 1.5% of the PEG lipid PEG-DOMG and about 38.5% of the structural lipid cholesterol.
  • the lipid nanoparticle comprise about 50% of the cationic lipid DLin-MC3-DMA, about 10% of the non-cationic lipid DSPC, about 1.5% of the PEG lipid PEG-DOMG and about 38.5% of the structural lipid cholesterol.
  • the lipid nanoparticle comprise about 50% of the cationic lipid DLin-MC3-DMA, about 10% of the non-cationic lipid DSPC, about 1.5% of the PEG lipid PEG-DMG and about 38.5% of the structural lipid cholesterol.
  • the lipid nanoparticle comprise about 55% of the cationic lipid L319, about 10% of the non-cationic lipid DSPC, about 2.5% of the PEG lipid PEG-DMG and about 32.5% of the structural lipid cholesterol.
  • the cationic lipid may be selected from (20Z,23Z)—N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)—N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)—N5N-dimethylpentacosa-16, 19-dien-8-amine, (13Z,16Z)—N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)—N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)—N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)—N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)—N,N-dimethylheptacosa-18,21-dien-10-amine,
  • the LNP formulations of the RNA (e.g., mRNA) vaccines may contain PEG-c-DOMG at 3% lipid molar ratio. In some embodiments, the LNP formulations of the RNA (e.g., mRNA) vaccines may contain PEG-c-DOMG at 1.5% lipid molar ratio.
  • the pharmaceutical compositions of the RNA (e.g., mRNA) vaccines may include at least one of the PEGylated lipids described in International Publication No. WO2012099755, the contents of which are herein incorporated by reference in their entirety.
  • the LNP formulation may contain PEG-DMG 2000 (1,2-dimyristoyl-sn-glycero-3-phophoethanolamine-N-[methoxy(polyethylene glycol)-2000). In some embodiments, the LNP formulation may contain PEG-DMG 2000, a cationic lipid known in the art and at least one other component. In some embodiments, the LNP formulation may contain PEG-DMG 2000, a cationic lipid known in the art, DSPC and cholesterol. As a non-limiting example, the LNP formulation may contain PEG-DMG 2000, DLin-DMA, DSPC and cholesterol.
  • the LNP formulation may contain PEG-DMG 2000, DLin-DMA, DSPC and cholesterol in a molar ratio of 2:40:10:48 (see e.g., Geall et al., Nonviral delivery of self-amplifying RNA (e.g., mRNA) vaccines, PNAS 2012; PMID: 22908294, the contents of each of which are herein incorporated by reference in their entirety).
  • PEG-DMG 2000, DLin-DMA, DSPC and cholesterol in a molar ratio of 2:40:10:48 (see e.g., Geall et al., Nonviral delivery of self-amplifying RNA (e.g., mRNA) vaccines, PNAS 2012; PMID: 22908294, the contents of each of which are herein incorporated by reference in their entirety).
  • the lipid nanoparticles described herein may be made in a sterile environment.
  • the LNP formulation may be formulated in a nanoparticle such as a nucleic acid-lipid particle.
  • the lipid particle may comprise one or more active agents or therapeutic agents; one or more cationic lipids comprising from about 50 mol % to about 85 mol % of the total lipid present in the particle; one or more non-cationic lipids comprising from about 13 mol % to about 49.5 mol % of the total lipid present in the particle; and one or more conjugated lipids that inhibit aggregation of particles comprising from about 0.5 mol % to about 2 mol % of the total lipid present in the particle.
  • the nanoparticle formulations may comprise a phosphate conjugate.
  • the phosphate conjugate may increase in vivo circulation times and/or increase the targeted delivery of the nanoparticle.
  • the phosphate conjugates may include a compound of any one of the formulas described in International Application No. WO2013033438, the contents of which are herein incorporated by reference in its entirety.
  • the nanoparticle formulation may comprise a polymer conjugate.
  • the polymer conjugate may be a water soluble conjugate.
  • the polymer conjugate may have a structure as described in U.S. Patent Application No. 20130059360, the contents of which are herein incorporated by reference in its entirety.
  • polymer conjugates with the polynucleotides of the present disclosure may be made using the methods and/or segmented polymeric reagents described in U.S. Patent Application No. 20130072709, the contents of which are herein incorporated by reference in its entirety.
  • the polymer conjugate may have pendant side groups comprising ring moieties such as, but not limited to, the polymer conjugates described in U.S. Patent Publication No. US20130196948, the contents which are herein incorporated by reference in its entirety.
  • the nanoparticle formulations may comprise a conjugate to enhance the delivery of nanoparticles of the present disclosure in a subject. Further, the conjugate may inhibit phagocytic clearance of the nanoparticles in a subject.
  • the conjugate may be a “self” peptide designed from the human membrane protein CD47 (e.g., the “self” particles described by Rodriguez et al. ( Science 2013 339, 971-975), herein incorporated by reference in its entirety). As shown by Rodriguez et al., the self peptides delayed macrophage-mediated clearance of nanoparticles which enhanced delivery of the nanoparticles.
  • the conjugate may be the membrane protein CD47 (e.g., see Rodriguez et al.
  • CD47 can increase the circulating particle ratio in a subject as compared to scrambled peptides and PEG coated nanoparticles.
  • the RNA (e.g., mRNA) vaccines of the present disclosure are formulated in nanoparticles which comprise a conjugate to enhance the delivery of the nanoparticles of the present disclosure in a subject.
  • the conjugate may be the CD47 membrane or the conjugate may be derived from the CD47 membrane protein, such as the “self” peptide described previously.
  • the nanoparticle may comprise PEG and a conjugate of CD47 or a derivative thereof.
  • the nanoparticle may comprise both the “self” peptide described above and the membrane protein CD47.
  • a “self” peptide and/or CD47 protein may be conjugated to a virus-like particle or pseudovirion, as described herein for delivery of the RNA (e.g., mRNA) vaccines of the present disclosure.
  • RNA e.g., mRNA
  • RNA vaccine pharmaceutical compositions comprising the polynucleotides of the present disclosure and a conjugate that may have a degradable linkage.
  • conjugates include an aromatic moiety comprising an ionizable hydrogen atom, a spacer moiety, and a water-soluble polymer.
  • pharmaceutical compositions comprising a conjugate with a degradable linkage and methods for delivering such pharmaceutical compositions are described in U.S. Patent Publication No. US20130184443, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticle formulations may be a carbohydrate nanoparticle comprising a carbohydrate carrier and a RNA (e.g., mRNA) vaccine.
  • the carbohydrate carrier may include, but is not limited to, an anhydride-modified phytoglycogen or glycogen-type material, phtoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin. (See e.g., International Publication No. WO2012109121; the contents of which are herein incorporated by reference in their entirety).
  • Nanoparticle formulations of the present disclosure may be coated with a surfactant or polymer in order to improve the delivery of the particle.
  • the nanoparticle may be coated with a hydrophilic coating such as, but not limited to, PEG coatings and/or coatings that have a neutral surface charge.
  • the hydrophilic coatings may help to deliver nanoparticles with larger payloads such as, but not limited to, RNA (e.g., mRNA) vaccines within the central nervous system.
  • RNA e.g., mRNA
  • nanoparticles comprising a hydrophilic coating and methods of making such nanoparticles are described in U.S. Patent Publication No. US20130183244, the contents of which are herein incorporated by reference in their entirety.
  • the lipid nanoparticles of the present disclosure may be hydrophilic polymer particles.
  • hydrophilic polymer particles and methods of making hydrophilic polymer particles are described in U.S. Patent Publication No. US20130210991, the contents of which are herein incorporated by reference in their entirety.
  • the lipid nanoparticles of the present disclosure may be hydrophobic polymer particles.
  • Lipid nanoparticle formulations may be improved by replacing the cationic lipid with a biodegradable cationic lipid which is known as a rapidly eliminated lipid nanoparticle (reLNP).
  • Ionizable cationic lipids such as, but not limited to, DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and may be a potential source of toxicity.
  • the rapid metabolism of the rapidly eliminated lipids can improve the tolerability and therapeutic index of the lipid nanoparticles by an order of magnitude from a 1 mg/kg dose to a 10 mg/kg dose in rat.
  • ester linkage can improve the degradation and metabolism profile of the cationic component, while still maintaining the activity of the reLNP formulation.
  • the ester linkage can be internally located within the lipid chain or it may be terminally located at the terminal end of the lipid chain.
  • the internal ester linkage may replace any carbon in the lipid chain.
  • the internal ester linkage may be located on either side of the saturated carbon.
  • an immune response may be elicited by delivering a lipid nanoparticle which may include a nanospecies, a polymer and an immunogen.
  • a lipid nanoparticle which may include a nanospecies, a polymer and an immunogen.
  • the polymer may encapsulate the nanospecies or partially encapsulate the nanospecies.
  • the immunogen may be a recombinant protein, a modified RNA and/or a polynucleotide described herein.
  • the lipid nanoparticle may be formulated for use in a vaccine such as, but not limited to, against a pathogen.
  • Lipid nanoparticles may be engineered to alter the surface properties of particles so the lipid nanoparticles may penetrate the mucosal barrier.
  • Mucus is located on mucosal tissue such as, but not limited to, oral (e.g., the buccal and esophageal membranes and tonsil tissue), ophthalmic, gastrointestinal (e.g., stomach, small intestine, large intestine, colon, rectum), nasal, respiratory (e.g., nasal, pharyngeal, tracheal and bronchial membranes), genital (e.g., vaginal, cervical and urethral membranes).
  • oral e.g., the buccal and esophageal membranes and tonsil tissue
  • ophthalmic e.g., gastrointestinal (e.g., stomach, small intestine, large intestine, colon, rectum)
  • nasal, respiratory e.g., nasal, pharyngeal, tracheal and bronchial
  • Nanoparticles larger than 10-200 nm which are preferred for higher drug encapsulation efficiency and the ability to provide the sustained delivery of a wide array of drugs have been thought to be too large to rapidly diffuse through mucosal barriers. Mucus is continuously secreted, shed, discarded or digested and recycled so most of the trapped particles may be removed from the mucosa tissue within seconds or within a few hours. Large polymeric nanoparticles (200 nm-500 nm in diameter) which have been coated densely with a low molecular weight polyethylene glycol (PEG) diffused through mucus only 4 to 6-fold lower than the same particles diffusing in water (Lai et al. PNAS 2007 104:1482-487; Lai et al. Adv Drug Deliv Rev.
  • PEG polyethylene glycol
  • the transport of nanoparticles may be determined using rates of permeation and/or fluorescent microscopy techniques including, but not limited to, fluorescence recovery after photobleaching (FRAP) and high resolution multiple particle tracking (MPT).
  • FRAP fluorescence recovery after photobleaching
  • MPT high resolution multiple particle tracking
  • compositions which can penetrate a mucosal barrier may be made as described in U.S. Pat. No. 8,241,670 or International Patent Publication No. WO2013110028, the contents of each of which are herein incorporated by reference in its entirety.
  • the lipid nanoparticle engineered to penetrate mucus may comprise a polymeric material (i.e. a polymeric core) and/or a polymer-vitamin conjugate and/or a tri-block co-polymer.
  • the polymeric material may include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
  • the polymeric material may be biodegradable and/or biocompatible.
  • biocompatible polymers are described in International Patent Publication No. WO2013116804, the contents of which are herein incorporated by reference in their entirety.
  • the polymeric material may additionally be irradiated.
  • the polymeric material may be gamma irradiated (see e.g., International App. No. WO201282165, herein incorporated by reference in its entirety).
  • Non-limiting examples of specific polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacralate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (
  • the lipid nanoparticle may be coated or associated with a co-polymer such as, but not limited to, a block co-polymer (such as a branched polyether-polyamide block copolymer described in International Publication No. WO2013012476, herein incorporated by reference in its entirety), and (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer (see e.g., U.S. Publication 20120121718 and U.S. Publication 20100003337 and U.S. Pat. No. 8,263,665, the contents of each of which is herein incorporated by reference in their entirety).
  • a block co-polymer such as a branched polyether-polyamide block copolymer described in International Publication No. WO2013012476, herein incorporated by reference in its entirety
  • the co-polymer may be a polymer that is generally regarded as safe (GRAS) and the formation of the lipid nanoparticle may be in such a way that no new chemical entities are created.
  • the lipid nanoparticle may comprise poloxamers coating PLGA nanoparticles without forming new chemical entities which are still able to rapidly penetrate human mucus (Yang et al. Angew. Chem. Int. Ed. 2011 50:2597-2600; the contents of which are herein incorporated by reference in their entirety).
  • a non-limiting scalable method to produce nanoparticles which can penetrate human mucus is described by Xu et al. (see, e.g., J Control Release 2013, 170:279-86; the contents of which are herein incorporated by reference in their entirety).
  • the vitamin of the polymer-vitamin conjugate may be vitamin E.
  • the vitamin portion of the conjugate may be substituted with other suitable components such as, but not limited to, vitamin A, vitamin E, other vitamins, cholesterol, a hydrophobic moiety, or a hydrophobic component of other surfactants (e.g., sterol chains, fatty acids, hydrocarbon chains and alkylene oxide chains).
  • the lipid nanoparticle engineered to penetrate mucus may include surface altering agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as for example dimethyldioctadecylammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin ⁇
  • the surface altering agent may be embedded or enmeshed in the particle's surface or disposed (e.g., by coating, adsorption, covalent linkage, or other process) on the surface of the lipid nanoparticle.
  • the mucus penetrating lipid nanoparticles may comprise at least one polynucleotide described herein.
  • the polynucleotide may be encapsulated in the lipid nanoparticle and/or disposed on the surface of the particle.
  • the polynucleotide may be covalently coupled to the lipid nanoparticle.
  • Formulations of mucus penetrating lipid nanoparticles may comprise a plurality of nanoparticles. Further, the formulations may contain particles which may interact with the mucus and alter the structural and/or adhesive properties of the surrounding mucus to decrease mucoadhesion, which may increase the delivery of the mucus penetrating lipid nanoparticles to the mucosal tissue.
  • the mucus penetrating lipid nanoparticles may be a hypotonic formulation comprising a mucosal penetration enhancing coating.
  • the formulation may be hypotonic for the epithelium to which it is being delivered.
  • hypotonic formulations may be found in International Patent Publication No. WO2013110028, the contents of which are herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccine formulation may comprise or be a hypotonic solution. Hypotonic solutions were found to increase the rate at which mucoinert particles such as, but not limited to, mucus-penetrating particles, were able to reach the vaginal epithelial surface (see e.g., Ensign et al. Biomaterials 2013 34(28):6922-9, the contents of which are herein incorporated by reference in their entirety).
  • the RNA (e.g., mRNA) vaccine is formulated as a lipoplex, such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA-lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, Mass.), and polyethylenimine (PEI) or protamine-based targeted and non-targeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al.
  • a lipoplex such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA-lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, Mass.), and polyethylenimine (PEI) or protamine-based targeted and non-targeted delivery of nucleic acids (Aleku et al. Cancer Res
  • such formulations may also be constructed or compositions altered such that they passively or actively are directed to different cell types in vivo, including but not limited to hepatocytes, immune cells, tumor cells, endothelial cells, antigen presenting cells, and leukocytes (Akinc et al. Mol Ther. 2010 18:1357-1364; Song et al., Nat Biotechnol. 2005 23:709-717; Judge et al., J Clin Invest.
  • DLin-DMA DLin-KC2-DMA
  • DLin-MC3-DMA-based lipid nanoparticle formulations which have been shown to bind to apolipoprotein E and promote binding and uptake of these formulations into hepatocytes in vivo (Akinc et al. Mol Ther. 2010 18:1357-1364, the contents of which are incorporated herein by reference in their entirety).
  • Formulations can also be selectively targeted through expression of different ligands on their surface as exemplified by, but not limited by, folate, transferrin, N-acetylgalactosamine (GalNAc), and antibody targeted approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules.
  • the RNA (e.g., mRNA) vaccine is formulated as a solid lipid nanoparticle.
  • a solid lipid nanoparticle may be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and may be stabilized with surfactants and/or emulsifiers.
  • the lipid nanoparticle may be a self-assembly lipid-polymer nanoparticle (see Zhang et al., ACS Nano, 2008, 2, pp 1696-1702; the contents of which are herein incorporated by reference in their entirety).
  • the SLN may be the SLN described in International Patent Publication No. WO2013105101, the contents of which are herein incorporated by reference in their entirety.
  • the SLN may be made by the methods or processes described in International Patent Publication No. WO2013105101, the contents of which are herein incorporated by reference in their entirety.
  • Liposomes, lipoplexes, or lipid nanoparticles may be used to improve the efficacy of polynucleotides directed protein production as these formulations may be able to increase cell transfection by the RNA (e.g., mRNA) vaccine; and/or increase the translation of encoded protein.
  • RNA e.g., mRNA
  • One such example involves the use of lipid encapsulation to enable the effective systemic delivery of polyplex plasmid DNA (Heyes et al., Mol Ther. 2007 15:713-720; the contents of which are incorporated herein by reference in their entirety).
  • the liposomes, lipoplexes, or lipid nanoparticles may also be used to increase the stability of the polynucleotide.
  • the RNA (e.g., mRNA) vaccines of the present disclosure can be formulated for controlled release and/or targeted delivery.
  • controlled release refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.
  • the RNA (e.g., mRNA) vaccines may be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery.
  • the term “encapsulate” means to enclose, surround or encase. As it relates to the formulation of the compounds of the disclosure, encapsulation may be substantial, complete or partial.
  • substantially encapsulated means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.9 or greater than 99.999% of the pharmaceutical composition or compound of the disclosure may be enclosed, surrounded or encased within the delivery agent.
  • Partially encapsulation means that less than 10, 10, 20, 30, 40 50 or less of the pharmaceutical composition or compound of the disclosure may be enclosed, surrounded or encased within the delivery agent.
  • encapsulation may be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the disclosure using fluorescence and/or electron micrograph.
  • At least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or greater than 99.99% of the pharmaceutical composition or compound of the disclosure are encapsulated in the delivery agent.
  • the controlled release formulation may include, but is not limited to, tri-block co-polymers.
  • the formulation may include two different types of tri-block co-polymers (International Pub. No. WO2012131104 and WO2012131106, the contents of each of which are incorporated herein by reference in their entirety).
  • the RNA (e.g., mRNA) vaccines may be encapsulated into a lipid nanoparticle or a rapidly eliminated lipid nanoparticle and the lipid nanoparticles or a rapidly eliminated lipid nanoparticle may then be encapsulated into a polymer, hydrogel and/or surgical sealant described herein and/or known in the art.
  • the polymer, hydrogel or surgical sealant may be PLGA, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc.
  • HYLENEX® Hazyme Therapeutics, San Diego Calif.
  • surgical sealants such as fibrinogen polymers (Ethicon Inc. Cornelia, Ga.), TISSELL® (Baxter International, Inc Deerfield, Ill.), PEG-based sealants, and COSEAL® (Baxter International, Inc Deerfield, Ill.).
  • the lipid nanoparticle may be encapsulated into any polymer known in the art which may form a gel when injected into a subject.
  • the lipid nanoparticle may be encapsulated into a polymer matrix which may be biodegradable.
  • the RNA (e.g., mRNA) vaccine formulation for controlled release and/or targeted delivery may also include at least one controlled release coating.
  • Controlled release coatings include, but are not limited to, OPADRY®, polyvinylpyrrolidone/vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, EUDRAGIT RL®, EUDRAGIT RS® and cellulose derivatives such as ethylcellulose aqueous dispersions (AQUACOAT® and SURELEASE®).
  • the RNA (e.g., mRNA) vaccine controlled release and/or targeted delivery formulation may comprise at least one degradable polyester which may contain polycationic side chains.
  • Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof.
  • the degradable polyesters may include a PEG conjugation to form a PEGylated polymer.
  • the RNA (e.g., mRNA) vaccine controlled release and/or targeted delivery formulation comprising at least one polynucleotide may comprise at least one PEG and/or PEG related polymer derivatives as described in U.S. Pat. No. 8,404,222, the contents of which are incorporated herein by reference in their entirety.
  • the RNA (e.g., mRNA) vaccine controlled release delivery formulation comprising at least one polynucleotide may be the controlled release polymer system described in US20130130348, the contents of which are incorporated herein by reference in their entirety.
  • the RNA (e.g., mRNA) vaccines of the present disclosure may be encapsulated in a therapeutic nanoparticle, referred to herein as “therapeutic nanoparticle RNA (e.g., mRNA) vaccines.”
  • Therapeutic nanoparticles may be formulated by methods described herein and known in the art such as, but not limited to, International Pub Nos. WO2010005740, WO2010030763, WO2010005721, WO2010005723, WO2012054923, U.S. Publication Nos.
  • therapeutic polymer nanoparticles may be identified by the methods described in US Pub No. US20120140790, the contents of which are herein incorporated by reference in their entirety.
  • the therapeutic nanoparticle RNA (e.g., mRNA) vaccine may be formulated for sustained release.
  • sustained release refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time may include, but is not limited to, hours, days, weeks, months and years.
  • the sustained release nanoparticle may comprise a polymer and a therapeutic agent such as, but not limited to, the polynucleotides of the present disclosure (see International Pub No. 2010075072 and US Pub No. US20100216804, US20110217377 and US20120201859, the contents of each of which are incorporated herein by reference in their entirety).
  • the sustained release formulation may comprise agents which permit persistent bioavailability such as, but not limited to, crystals, macromolecular gels and/or particulate suspensions (see U.S. Patent Publication No US20130150295, the contents of each of which are incorporated herein by reference in their entirety).
  • the therapeutic nanoparticle RNA (e.g., mRNA) vaccines may be formulated to be target specific.
  • the therapeutic nanoparticles may include a corticosteroid (see International Pub. No. WO2011084518, the contents of which are incorporated herein by reference in their entirety).
  • the therapeutic nanoparticles may be formulated in nanoparticles described in International Pub No. WO2008121949, WO2010005726, WO2010005725, WO2011084521 and US Pub No. US20100069426, US20120004293 and US20100104655, the contents of each of which are incorporated herein by reference in their entirety.
  • the nanoparticles of the present disclosure may comprise a polymeric matrix.
  • the nanoparticle may comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, poly(ethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof.
  • the therapeutic nanoparticle comprises a diblock copolymer.
  • the diblock copolymer may include PEG in combination with a polymer such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, poly(ethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof.
  • the diblock copolymer may be a high-X diblock copolymer such as those described in International Patent Publication
  • the therapeutic nanoparticle comprises a PLGA-PEG block copolymer (see U.S. Publication No. US20120004293 and U.S. Pat. No. 8,236,330, each of which is herein incorporated by reference in their entirety).
  • the therapeutic nanoparticle is a stealth nanoparticle comprising a diblock copolymer of PEG and PLA or PEG and PLGA (see U.S. Pat. No. 8,246,968 and International Publication No. WO2012166923, the contents of each of which are herein incorporated by reference in their entirety).
  • the therapeutic nanoparticle is a stealth nanoparticle or a target-specific stealth nanoparticle as described in U.S. Patent Publication No. US20130172406, the contents of which are herein incorporated by reference in their entirety.
  • the therapeutic nanoparticle may comprise a multiblock copolymer (see e.g., U.S. Pat. Nos. 8,263,665 and 8,287,910 and U.S. Patent Pub. No. US20130195987, the contents of each of which are herein incorporated by reference in their entirety).
  • the lipid nanoparticle comprises the block copolymer PEG-PLGA-PEG (see e.g., the thermosensitive hydrogel (PEG-PLGA-PEG) was used as a TGF-beta1 gene delivery vehicle in Lee et al.
  • Thermosensitive Hydrogel as a TGF- ⁇ 1 Gene Delivery Vehicle Enhances Diabetic Wound Healing. Pharmaceutical Research, 2003 20(12): 1995-2000; as a controlled gene delivery system in Li et al. Controlled Gene Delivery System Based on Thermosensitive Biodegradable Hydrogel.
  • RNA vaccines of the present disclosure may be formulated in lipid nanoparticles comprising the PEG-PLGA-PEG block copolymer.
  • the therapeutic nanoparticle may comprise a multiblock copolymer (see e.g., U.S. Pat. Nos. 8,263,665 and 8,287,910 and U.S. Patent Pub. No. US20130195987, the contents of each of which are herein incorporated by reference in their entirety).
  • the block copolymers described herein may be included in a polyion complex comprising a non-polymeric micelle and the block copolymer.
  • a polyion complex comprising a non-polymeric micelle and the block copolymer.
  • the therapeutic nanoparticle may comprise at least one acrylic polymer.
  • Acrylic polymers include but are not limited to, acrylic acid, methacrylic acid, acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxyethyl methacrylates, cyanoethyl methacrylate, amino alkyl methacrylate copolymer, poly(acrylic acid), poly(methacrylic acid), polycyanoacrylates and combinations thereof.
  • the therapeutic nanoparticles may comprise at least one poly(vinyl ester) polymer.
  • the poly(vinyl ester) polymer may be a copolymer such as a random copolymer.
  • the random copolymer may have a structure such as those described in International Application No. WO2013032829 or U.S. Patent Publication No US20130121954, the contents of each of which are herein incorporated by reference in their entirety.
  • the poly(vinyl ester) polymers may be conjugated to the polynucleotides described herein.
  • the therapeutic nanoparticle may comprise at least one diblock copolymer.
  • the diblock copolymer may be, but it not limited to, a poly(lactic) acid-poly(ethylene)glycol copolymer (see, e.g., International Patent Publication No. WO2013044219, the contents of which are herein incorporated by reference in their entirety).
  • the therapeutic nanoparticle may be used to treat cancer (see International publication No. WO2013044219, the contents of which are herein incorporated by reference in their entirety).
  • the therapeutic nanoparticles may comprise at least one cationic polymer described herein and/or known in the art.
  • the therapeutic nanoparticles may comprise at least one amine-containing polymer such as, but not limited to polylysine, polyethylene imine, poly(amidoamine) dendrimers, poly(beta-amino esters) (see, e.g., U.S. Pat. No. 8,287,849, the contents of which are herein incorporated by reference in their entirety) and combinations thereof.
  • amine-containing polymer such as, but not limited to polylysine, polyethylene imine, poly(amidoamine) dendrimers, poly(beta-amino esters) (see, e.g., U.S. Pat. No. 8,287,849, the contents of which are herein incorporated by reference in their entirety) and combinations thereof.
  • the nanoparticles described herein may comprise an amine cationic lipid such as those described in International Patent Application No. WO2013059496, the contents of which are herein incorporated by reference in their entirety.
  • the cationic lipids may have an amino-amine or an amino-amide moiety.
  • the therapeutic nanoparticles may comprise at least one degradable polyester which may contain polycationic side chains.
  • Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof.
  • the degradable polyesters may include a PEG conjugation to form a PEGylated polymer.
  • the synthetic nanocarriers may contain an immunostimulatory agent to enhance the immune response from delivery of the synthetic nanocarrier.
  • the synthetic nanocarrier may comprise a Th1 immunostimulatory agent, which may enhance a Th1-based response of the immune system (see International Pub No. WO2010123569 and U.S. Publication No. US20110223201, the contents of each of which are herein incorporated by reference in their entirety).
  • the synthetic nanocarriers may be formulated for targeted release.
  • the synthetic nanocarrier is formulated to release the polynucleotides at a specified pH and/or after a desired time interval.
  • the synthetic nanoparticle may be formulated to release the RNA (e.g., mRNA) vaccines after 24 hours and/or at a pH of 4.5 (see International Publication Nos. WO2010138193 and WO2010138194 and US Pub Nos. US20110020388 and US20110027217, each of which is herein incorporated by reference in their entireties).
  • the synthetic nanocarriers may be formulated for controlled and/or sustained release of the polynucleotides described herein.
  • the synthetic nanocarriers for sustained release may be formulated by methods known in the art, described herein and/or as described in International Pub No. WO2010138192 and US Pub No. 20100303850, each of which is herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccine may be formulated for controlled and/or sustained release wherein the formulation comprises at least one polymer that is a crystalline side chain (CYSC) polymer.
  • CYSC polymers are described in U.S. Pat. No. 8,399,007, herein incorporated by reference in its entirety.
  • the synthetic nanocarrier may be formulated for use as a vaccine.
  • the synthetic nanocarrier may encapsulate at least one polynucleotide which encode at least one antigen.
  • the synthetic nanocarrier may include at least one antigen and an excipient for a vaccine dosage form (see International Publication No. WO2011150264 and U.S. Publication No. US20110293723, the contents of each of which are herein incorporated by reference in their entirety).
  • a vaccine dosage form may include at least two synthetic nanocarriers with the same or different antigens and an excipient (see International Publication No. WO2011150249 and U.S. Publication No.
  • the vaccine dosage form may be selected by methods described herein, known in the art and/or described in International Publication No. WO2011150258 and U.S. Publication No. US20120027806, the contents of each of which are herein incorporated by reference in their entirety).
  • the synthetic nanocarrier may comprise at least one polynucleotide which encodes at least one adjuvant.
  • the adjuvant may comprise dimethyldioctadecylammonium-bromide, dimethyldioctadecylammonium-chloride, dimethyldioctadecylammonium-phosphate or dimethyldioctadecylammonium-acetate (DDA) and an apolar fraction or part of said apolar fraction of a total lipid extract of a mycobacterium (see, e.g., U.S. Pat. No. 8,241,610, the content of which is herein incorporated by reference in its entirety).
  • the synthetic nanocarrier may comprise at least one polynucleotide and an adjuvant.
  • the synthetic nanocarrier comprising and adjuvant may be formulated by the methods described in International Publication No. WO2011150240 and U.S. Publication No. US20110293700, the contents of each of which are herein incorporated by reference in their entirety.
  • the synthetic nanocarrier may encapsulate at least one polynucleotide that encodes a peptide, fragment or region from a virus.
  • the synthetic nanocarrier may include, but is not limited to, any of the nanocarriers described in International Publication No. WO2012024621, WO201202629, WO2012024632 and U.S. Publication No. US20120064110, US20120058153 and US20120058154, the contents of each of which are herein incorporated by reference in their entirety.
  • the synthetic nanocarrier may be coupled to a polynucleotide which may be able to trigger a humoral and/or cytotoxic T lymphocyte (CTL) response (see, e.g., International Publication No. WO2013019669, the contents of which are herein incorporated by reference in their entirety).
  • CTL cytotoxic T lymphocyte
  • the RNA (e.g., mRNA) vaccine may be encapsulated in, linked to and/or associated with zwitterionic lipids.
  • zwitterionic lipids Non-limiting examples of zwitterionic lipids and methods of using zwitterionic lipids are described in U.S. Patent Publication No. US20130216607, the contents of which are herein incorporated by reference in their entirety.
  • the zwitterionic lipids may be used in the liposomes and lipid nanoparticles described herein.
  • the RNA (e.g., mRNA) vaccine may be formulated in colloid nanocarriers as described in U.S. Patent Publication No. US20130197100, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticle may be optimized for oral administration.
  • the nanoparticle may comprise at least one cationic biopolymer such as, but not limited to, chitosan or a derivative thereof.
  • the nanoparticle may be formulated by the methods described in U.S. Publication No. 20120282343, the contents of which are herein incorporated by reference in their entirety.
  • LNPs comprise the lipid KL52 (an amino-lipid disclosed in U.S. Application Publication No. 2012/0295832, the contents of which are herein incorporated by reference in their entirety.
  • Activity and/or safety (as measured by examining one or more of ALT/AST, white blood cell count and cytokine induction, for example) of LNP administration may be improved by incorporation of such lipids.
  • KL52 may be administered intravenously and/or in one or more doses.
  • administration of LNPs comprising KL52 results in equal or improved mRNA and/or protein expression as compared to LNPs comprising MC3.
  • RNA (e.g., mRNA) vaccine may be delivered using smaller LNPs.
  • Such particles may comprise a diameter from below 0.1 um up to 100 nm such as, but not limited to, less than 0.1 um, less than 1.0 um, less than 5 um, less than 10 um, less than 15 um, less than 20 um, less than 25 um, less than 30 um, less than 35 um, less than 40 um, less than 50 um, less than 55 um, less than 60 um, less than 65 um, less than 70 um, less than 75 um, less than 80 um, less than 85 um, less than 90 um, less than 95 um, less than 100 um, less than 125 um, less than 150 um, less than 175 um, less than 200 um, less than 225 um, less than 250 um, less than 275 um, less than 300 um, less than 325 um, less than 350 um, less than 375 um, less than 400 um, less than 425 um, less than 450 um, less than 475 um, less than 500 um, less than 525 um,
  • RNA (e.g., mRNA) vaccines may be delivered using smaller LNPs, which may comprise a diameter from about 1 nm to about 100 nm, from about 1 nm to about 10 nm, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from
  • microfluidic mixers may include, but are not limited to, a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (Zhigaltsev, I. V. et al., Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing have been published (Langmuir. 2012. 28:3633-40; Belliveau, N. M.
  • a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (Zhigaltsev, I. V. et al., Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and trigly
  • methods of LNP generation comprising SHM, further comprise the mixing of at least two input streams wherein mixing occurs by microstructure-induced chaotic advection (MICA).
  • MICA microstructure-induced chaotic advection
  • fluid streams flow through channels present in a herringbone pattern causing rotational flow and folding the fluids around each other.
  • This method may also comprise a surface for fluid mixing wherein the surface changes orientations during fluid cycling.
  • Methods of generating LNPs using SHM include those disclosed in U.S. Application Publication Nos. 2004/0262223 and 2012/0276209, the contents of each of which are herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccine of the present disclosure may be formulated in lipid nanoparticles created using a micromixer such as, but not limited to, a Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM) from the Institut für Mikrotechnik Mainz GmbH, Mainz Germany).
  • a micromixer such as, but not limited to, a Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM) from the Institut für Mikrotechnik Mainz GmbH, Mainz Germany).
  • the RNA (e.g., mRNA) vaccines of the present disclosure may be formulated in lipid nanoparticles created using microfluidic technology (see, e.g., Whitesides, George M. The Origins and the Future of Microfluidics. Nature, 2006 442: 368-373; and Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295: 647-651; each of which is herein incorporated by reference in its entirety).
  • controlled microfluidic formulation includes a passive method for mixing streams of steady pressure-driven flows in micro channels at a low Reynolds number (see, e.g., Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295: 647-651, the contents of which are herein incorporated by reference in their entirety).
  • the RNA (e.g., mRNA) vaccines of the present disclosure may be formulated in lipid nanoparticles created using a micromixer chip such as, but not limited to, those from Harvard Apparatus (Holliston, Mass.) or Dolomite Microfluidics (Royston, UK).
  • a micromixer chip can be used for rapid mixing of two or more fluid streams with a split and recombine mechanism.
  • the RNA (e.g., mRNA) vaccines of the disclosure may be formulated for delivery using the drug encapsulating microspheres described in International Patent Publication No. WO2013063468 or U.S. Pat. No. 8,440,614, the contents of each of which are herein incorporated by reference in their entirety.
  • the microspheres may comprise a compound of the formula (I), (II), (III), (IV), (V) or (VI) as described in International Patent Publication No. WO2013063468, the contents of which are herein incorporated by reference in their entirety.
  • the amino acid, peptide, polypeptide, lipids are useful in delivering the RNA (e.g., mRNA) vaccines of the disclosure to cells (see International Patent Publication No. WO2013063468, the contents of which are herein incorporated by reference in their entirety).
  • the RNA (e.g., mRNA) vaccines of the disclosure may be formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100
  • the lipid nanoparticles may have a diameter from about 10 to 500 nm.
  • the lipid nanoparticle may have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
  • the lipid nanoparticle may be a limit size lipid nanoparticle described in International Patent Publication No. WO2013059922, the contents of which are herein incorporated by reference in their entirety.
  • the limit size lipid nanoparticle may comprise a lipid bilayer surrounding an aqueous core or a hydrophobic core; where the lipid bilayer may comprise a phospholipid such as, but not limited to, diacylphosphatidylcholine, a diacylphosphatidylethanolamine, a ceramide, a sphingomyelin, a dihydrosphingomyelin, a cephalin, a cerebroside, a C8-C20 fatty acid diacylphophatidylcholine, and 1-palmitoyl-2-oleoyl phosphatidylcholine (POPC).
  • POPC 1-palmitoyl-2-oleoyl phosphatidylcholine
  • the limit size lipid nanoparticle may comprise
  • the RNA (e.g., mRNA) vaccines may be delivered, localized and/or concentrated in a specific location using the delivery methods described in International Patent Publication No. WO2013063530, the contents of which are herein incorporated by reference in their entirety.
  • a subject may be administered an empty polymeric particle prior to, simultaneously with or after delivering the RNA (e.g., mRNA) vaccines to the subject.
  • the empty polymeric particle undergoes a change in volume once in contact with the subject and becomes lodged, embedded, immobilized or entrapped at a specific location in the subject.
  • the RNA (e.g., mRNA) vaccines may be formulated in an active substance release system (see, e.g., U.S. Patent Publication No. US20130102545, the contents of which are herein incorporated by reference in their entirety).
  • the active substance release system may comprise 1) at least one nanoparticle bonded to an oligonucleotide inhibitor strand which is hybridized with a catalytically active nucleic acid and 2) a compound bonded to at least one substrate molecule bonded to a therapeutically active substance (e.g., polynucleotides described herein), where the therapeutically active substance is released by the cleavage of the substrate molecule by the catalytically active nucleic acid.
  • a therapeutically active substance e.g., polynucleotides described herein
  • the RNA (e.g., mRNA) vaccines may be formulated in a nanoparticle comprising an inner core comprising a non-cellular material and an outer surface comprising a cellular membrane.
  • the cellular membrane may be derived from a cell or a membrane derived from a virus.
  • the nanoparticle may be made by the methods described in International Patent Publication No. WO2013052167, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticle described in International Patent Publication No. WO2013052167 the contents of which are herein incorporated by reference in their entirety, may be used to deliver the RNA (e.g., mRNA) vaccines described herein.
  • the RNA (e.g., mRNA) vaccines may be formulated in porous nanoparticle-supported lipid bilayers (protocells).
  • Protocells are described in International Patent Publication No. WO2013056132, the contents of which are herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccines described herein may be formulated in polymeric nanoparticles as described in or made by the methods described in U.S. Pat. Nos. 8,420,123 and 8,518,963 and European Patent No. EP2073848B1, the contents of each of which are herein incorporated by reference in their entirety.
  • the polymeric nanoparticle may have a high glass transition temperature such as the nanoparticles described in or nanoparticles made by the methods described in U.S. Pat. No. 8,518,963, the contents of which are herein incorporated by reference in their entirety.
  • the polymer nanoparticle for oral and parenteral formulations may be made by the methods described in European Patent No. EP2073848B1, the contents of which are herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccines described herein may be formulated in nanoparticles used in imaging.
  • the nanoparticles may be liposome nanoparticles such as those described in U.S. Patent Publication No US20130129636, herein incorporated by reference in its entirety.
  • the liposome may comprise gadolinium(III)2- ⁇ 4,7-bis-carboxymethyl-10-[(N,N-distearylamidomethyl-N′-amido-methyl]-1,4,7,10-tetra-azacyclododec-1-yl ⁇ -acetic acid and a neutral, fully saturated phospholipid component (see, e.g., U.S. Patent Publication No US20130129636, the contents of which are herein incorporated by reference in their entirety).
  • the nanoparticles which may be used in the present disclosure are formed by the methods described in U.S. Patent Application No. US20130130348, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticles of the present disclosure may further include nutrients such as, but not limited to, those which deficiencies can lead to health hazards from anemia to neural tube defects (see, e.g., the nanoparticles described in International Patent Publication No WO2013072929, the contents of which are herein incorporated by reference in their entirety).
  • the nutrient may be iron in the form of ferrous, ferric salts or elemental iron, iodine, folic acid, vitamins or micronutrients.
  • the RNA (e.g., mRNA) vaccines of the present disclosure may be formulated in a swellable nanoparticle.
  • the swellable nanoparticle may be, but is not limited to, those described in U.S. Pat. No. 8,440,231, the contents of which are herein incorporated by reference in their entirety.
  • the swellable nanoparticle may be used for delivery of the RNA (e.g., mRNA) vaccines of the present disclosure to the pulmonary system (see, e.g., U.S. Pat. No. 8,440,231, the contents of which are herein incorporated by reference in their entirety).
  • RNA vaccines of the present disclosure may be formulated in polyanhydride nanoparticles such as, but not limited to, those described in U.S. Pat. No. 8,449,916, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticles and microparticles of the present disclosure may be geometrically engineered to modulate macrophage and/or the immune response.
  • the geometrically engineered particles may have varied shapes, sizes and/or surface charges in order to incorporated the polynucleotides of the present disclosure for targeted delivery such as, but not limited to, pulmonary delivery (see, e.g., International Publication No WO2013082111, the contents of which are herein incorporated by reference in their entirety).
  • Other physical features the geometrically engineering particles may have include, but are not limited to, fenestrations, angled arms, asymmetry and surface roughness, charge which can alter the interactions with cells and tissues.
  • nanoparticles of the present disclosure may be made by the methods described in International Publication No WO2013082111, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticles of the present disclosure may be water soluble nanoparticles such as, but not limited to, those described in International Publication No. WO2013090601, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticles may be inorganic nanoparticles which have a compact and zwitterionic ligand in order to exhibit good water solubility.
  • the nanoparticles may also have small hydrodynamic diameters (HD), stability with respect to time, pH, and salinity and a low level of non-specific protein binding.
  • the nanoparticles of the present disclosure may be developed by the methods described in U.S. Patent Publication No. US20130172406, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticles of the present disclosure are stealth nanoparticles or target-specific stealth nanoparticles such as, but not limited to, those described in U.S. Patent Publication No. US20130172406, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticles of the present disclosure may be made by the methods described in U.S. Patent Publication No. US20130172406, the contents of which are herein incorporated by reference in their entirety.
  • the stealth or target-specific stealth nanoparticles may comprise a polymeric matrix.
  • the polymeric matrix may comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, polycyanoacrylates or combinations thereof.
  • the nanoparticle may be a nanoparticle-nucleic acid hybrid structure having a high density nucleic acid layer.
  • the nanoparticle-nucleic acid hybrid structure may made by the methods described in U.S. Patent Publication No. US20130171646, the contents of which are herein incorporated by reference in their entirety.
  • the nanoparticle may comprise a nucleic acid such as, but not limited to, polynucleotides described herein and/or known in the art.
  • At least one of the nanoparticles of the present disclosure may be embedded in in the core a nanostructure or coated with a low density porous 3-D structure or coating which is capable of carrying or associating with at least one payload within or on the surface of the nanostructure.
  • a nanostructure or coated with a low density porous 3-D structure or coating which is capable of carrying or associating with at least one payload within or on the surface of the nanostructure.
  • Non-limiting examples of the nanostructures comprising at least one nanoparticle are described in International Patent Publication No. WO2013123523, the contents of which are herein incorporated by reference in their entirety.
  • the RNA (e.g., mRNA) vaccine may be associated with a cationic or polycationic compounds, including protamine, nucleoline, spermine or spermidine, or other cationic peptides or proteins, such as poly-L-lysine (PLL), polyarginine, basic polypeptides, cell penetrating peptides (CPPs), including HIV-binding peptides, HIV-1 Tat (HIV), Tat-derived peptides, Penetratin, VP 22 derived or analog peptides, Pestivirus Ems, HSV, VP 22 (Herpes simplex), MAP, KALA or protein transduction domains (PTDs), PpT620, prolin-rich peptides, arginine-rich peptides, lysine-rich peptides, MPG-peptide(s), Pep-1, L-oligomers, Calcitonin peptide(s), Antennapedia-derived peptide
  • PEI polyethyleneimine
  • DOTMA [1-(2,3-sioleyloxy)propyl)]-N,N,N-trimethylammonium chloride
  • DMRIE di-C14-amidine
  • DOTIM DOTIM
  • SAINT DC-Chol
  • BGTC CTAP
  • DOPC DODAP
  • DOPE Dioleyl phosphatidylethanol-amine
  • DOSPA DODAB
  • DOIC DOMEPC
  • DOGS Dioctadecylamidoglicylspermin
  • DIMRI Dimyristooxypropyl dimethyl hydroxyethyl ammonium bromide
  • DOTAP dioleoyloxy-3-(trimethylammonio)propane
  • DC-6-14 O,O-ditetradecanoyl-N-.alpha.-trimethylammonioacetyl)diethanolamine chloride
  • CLIP 1 rac-[(2,3-dioctadecyl)]-N,N,N
  • modified polyaminoacids such as beta-aminoacid-polymers or reversed polyamides, etc.
  • modified polyethylenes such as PVP (poly(N-ethyl-4-vinylpyridinium bromide)), etc.
  • modified acrylates such as pDMAEMA (poly(dimethylaminoethyl methylacrylate)), etc.
  • modified amidoamines such as pAMAM (poly(amidoamine)), etc.
  • modified polybetaminoester (PBAE) such as diamine end modified 1,4 butanediol diacrylate-co-5-amino-1-pentanol polymers, etc.
  • dendrimers such as polypropylamine dendrimers or pAMAM based dendrimers, etc.
  • polyimine(s) such as PEI: poly(ethyleneimine), poly(propyleneimine), etc.
  • polyallylamine sugar backbone based polymers, such as
  • RNA e.g., mRNA
  • the RNA vaccine is not associated with a cationic or polycationic compounds.
  • a nanoparticle comprises compounds of Formula (I):
  • R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, —R*YR′′, —YR′′, and —R′′M′R′;
  • R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, C 2-14 alkenyl, —R*YR′′, —YR′′, and —R*OR′′, or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R 4 is selected from the group consisting of a C 3-6 carbocycle, —(CH 2 ) n Q, —(CH 2 ) n CHQR, —CHQR, —CQ(R) 2 , and unsubstituted C 1-6 alkyl, where Q is selected from a carbocycle, heterocycle, —OR, —O(CH 2 ) n N(R) 2 , —C(O)OR, —OC(O)R, —CX 3 , —CX 2 H, —CXH 2 , —CN, —N(R) 2 , —C(O)N(R) 2 , —N(R)C(O)R, —N(R)S(O) 2 R, —N(R)C(O)N(R) 2 , —N(R)C(S)N(R) 2 , —N(R)R 8 , —O(CH 2 ) n OR,
  • each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—,
  • R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • R 8 is selected from the group consisting of C 3-6 carbocycle and heterocycle
  • R 9 is selected from the group consisting of H, CN, NO 2 , C 1-6 alkyl, —OR, —S(O) 2 R, —S(O) 2 N(R) 2 , C 2-6 alkenyl, C 3-6 carbocycle and heterocycle;
  • each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R′ is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, —R*YR′′, —YR′′, and H;
  • each Y is independently a C 3-6 carbocycle
  • each X is independently selected from the group consisting of F, Cl, Br, and I;
  • n is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.
  • a subset of compounds of Formula (I) includes those in which when R 4 is —(CH 2 ) n Q, —(CH 2 ) n CHQR, —CHQR, or —CQ(R) 2 , then (i) Q is not —N(R) 2 when n is 1, 2, 3, 4 or 5, or (ii) Q is not 5, 6, or 7-membered heterocycloalkyl when n is 1 or 2.
  • another subset of compounds of Formula (I) includes those in which
  • R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, —R*YR′′, —YR′′, and —R′′M′R′;
  • R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, C 2-14 alkenyl, —R*YR′′, —YR′′, and —R*OR′′, or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R 4 is selected from the group consisting of a C 3-6
  • each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O) 2 —, —S—S—, an aryl group, and a heteroaryl group;
  • R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • R 8 is selected from the group consisting of C 3-6 carbocycle and heterocycle
  • R 9 is selected from the group consisting of H, CN, NO 2 , C 1-6 alkyl, —OR, —S(O) 2 R, —S(O) 2 N(R) 2 , C 2-6 alkenyl, C 3-6 carbocycle and heterocycle;
  • each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R′ is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, —R*YR′′, —YR′′, and H;
  • each R′′ is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl
  • each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • each Y is independently a C 3-6 carbocycle
  • each X is independently selected from the group consisting of F, Cl, Br, and I;
  • n is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13,
  • another subset of compounds of Formula (I) includes those in which
  • R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, —R*YR′′, —YR′′, and —R′′M′R′;
  • R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, C 2-14 alkenyl, —R*YR′′, —YR′′, and —R*OR′′, or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R 4 is selected from the group consisting of a C 3-6
  • each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O) 2 —, —S—S—, an aryl group, and a heteroaryl group;
  • R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • R 8 is selected from the group consisting of C 3-6 carbocycle and heterocycle
  • R 9 is selected from the group consisting of H, CN, NO 2 , C 1-6 alkyl, —OR, —S(O) 2 R, —S(O) 2 N(R) 2 , C 2-6 alkenyl, C 3-6 carbocycle and heterocycle;
  • each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R′ is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, —R*YR′′, —YR′′, and H;
  • each R′′ is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl
  • each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • each Y is independently a C 3-6 carbocycle
  • each X is independently selected from the group consisting of F, Cl, Br, and I;
  • n is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13,
  • another subset of compounds of Formula (I) includes those in which
  • R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, —R*YR′′, —YR′′, and —R′′M′R′;
  • R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, C 2-14 alkenyl, —R*YR′′, —YR′′, and —R*OR′′, or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R 4 is selected from the group consisting of a C 3-6
  • each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O) 2 —, —S—S—, an aryl group, and a heteroaryl group;
  • R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • R 8 is selected from the group consisting of C 3-6 carbocycle and heterocycle
  • R 9 is selected from the group consisting of H, CN, NO 2 , C 1-6 alkyl, —OR, —S(O) 2 R, —S(O) 2 N(R) 2 , C 2-6 alkenyl, C 3-6 carbocycle and heterocycle;
  • each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R′ is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, —R*YR′′, —YR′′, and H;
  • each R′′ is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl
  • each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • each Y is independently a C 3-6 carbocycle
  • each X is independently selected from the group consisting of F, Cl, Br, and I;
  • n is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13,
  • another subset of compounds of Formula (I) includes those in which
  • R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, —R*YR′′, —YR′′, and —R′′M′R′;
  • R 2 and R 3 are independently selected from the group consisting of H, C 2-14 alkyl, C 2-14 alkenyl, —R*YR′′, —YR′′, and —R*OR′′, or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R 4 is —(CH 2 ) n Q or —(CH 2 ) n CHQR, where Q is —N(R) 2 , and n is selected from 3, 4, and 5;
  • each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O) 2 —, —S—S—, an aryl group, and a heteroaryl group;
  • R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R′ is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, —R*YR′′, —YR′′, and H;
  • each R′′ is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl
  • each R* is independently selected from the group consisting of C 1-12 alkyl and C 1-12 alkenyl;
  • each Y is independently a C 3-6 carbocycle
  • each X is independently selected from the group consisting of F, Cl, Br, and I;
  • n is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13,
  • another subset of compounds of Formula (I) includes those in which
  • R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, —R*YR′′, —YR′′, and —R′′M′R′;
  • R 2 and R 3 are independently selected from the group consisting of C 1-14 alkyl, C 2-14 alkenyl, —R*YR′′, —YR′′, and —R*OR′′, or R 2 and R 3 , together with the atom to which they are attached, form a heterocycle or carbocycle;
  • R 4 is selected from the group consisting of —(CH 2 ) n Q, —(CH 2 ) n CHQR, —CHQR, and —CQ(R) 2 , where Q is —N(R) 2 , and n is selected from 1, 2, 3, 4, and 5;
  • each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O) 2 —, —S—S—, an aryl group, and a heteroaryl group;
  • R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H;
  • each R′ is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, —R*YR′′, —YR′′, and H;
  • each R′′ is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl
  • each R* is independently selected from the group consisting of C 1-12 alkyl and C 1-12 alkenyl;
  • each Y is independently a C 3-6 carbocycle
  • each X is independently selected from the group consisting of F, Cl, Br, and I;
  • n is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13,
  • a subset of compounds of Formula (I) includes those of Formula (IA):
  • M 1 is a bond or M′;
  • R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, and C 2-14 alkenyl.
  • a subset of compounds of Formula (I) includes those of Formula (II):
  • M 1 is a bond or M′
  • a subset of compounds of Formula (I) includes those of Formula (IIa), (IIb), (IIc), or (IIe):
  • R 4 is as described herein.
  • a subset of compounds of Formula (I) includes those of Formula (IId):
  • each of R 2 and R 3 may be independently selected from the group consisting of C 5-14 alkyl and C 5-14 alkenyl.
  • the compound of Formula (I) is selected from the group consisting of:
  • the compound of Formula (I) is selected from the group consisting of:
  • the compound of Formula (I) is selected from the group consisting of:
  • a nanoparticle comprises the following compound:
  • the disclosure features a nanoparticle composition including a lipid component comprising a compound as described herein (e.g., a compound according to Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe)).
  • a compound as described herein e.g., a compound according to Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe)).
  • the disclosure features a pharmaceutical composition
  • a pharmaceutical composition comprising a nanoparticle composition according to the preceding embodiments and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition is refrigerated or frozen for storage and/or shipment (e.g., being stored at a temperature of 4° C. or lower, such as a temperature between about ⁇ 150° C. and about 0° C. or between about ⁇ 80° C. and about ⁇ 20° C.
  • the pharmaceutical composition is a solution that is refrigerated for storage and/or shipment at, for example, about ⁇ 20° C., ⁇ 30° C., ⁇ 40° C., ⁇ 50° C., ⁇ 60° C., ⁇ 70° C., ⁇ 80° C., ⁇ 90° C., ⁇ 130° C. or ⁇ 150° C.).
  • the pharmaceutical composition is a solution that is refrigerated for storage and/or shipment at, for example, about ⁇ 20° C., ⁇ 30° C., ⁇ 40° C., ⁇ 50° C., ⁇ 60° C., ⁇ 70° C., or ⁇ 80° C.
  • the disclosure provides a method of delivering a therapeutic and/or prophylactic (e.g., RNA, such as mRNA) to a cell (e.g., a mammalian cell).
  • a therapeutic and/or prophylactic e.g., RNA, such as mRNA
  • This method includes the step of administering to a subject (e.g., a mammal, such as a human) a nanoparticle composition including (i) a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) and (ii) a therapeutic and/or prophylactic, in which administering involves contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic is delivered to the cell.
  • the disclosure provides a method of producing a polypeptide of interest in a cell (e.g., a mammalian cell).
  • the method includes the step of contacting the cell with a nanoparticle composition including (i) a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) and (ii) an mRNA encoding the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide.
  • a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (
  • the disclosure provides a method of treating a disease or disorder in a mammal (e.g., a human) in need thereof.
  • the method includes the step of administering to the mammal a therapeutically effective amount of a nanoparticle composition including (i) a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) and (ii) a therapeutic and/or prophylactic (e.g., an mRNA).
  • a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) and (
  • the disease or disorder is characterized by dysfunctional or aberrant protein or polypeptide activity.
  • the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardio- and reno-vascular diseases, and metabolic diseases.
  • the disclosure provides a method of delivering (e.g., specifically delivering) a therapeutic and/or prophylactic to a mammalian organ (e.g., a liver, spleen, lung, or femur).
  • a mammalian organ e.g., a liver, spleen, lung, or femur.
  • This method includes the step of administering to a subject (e.g., a mammal) a nanoparticle composition including (i) a lipid component including a phospholipid, a PEG lipid, a structural lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) and (ii) a therapeutic and/or prophylactic (e.g., an mRNA), in which administering involves contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic is delivered to the target organ (e.g., a liver, spleen, lung, or femur).
  • a target organ e.g., a liver, spleen, lung, or femur.
  • the disclosure features a method for the enhanced delivery of a therapeutic and/or prophylactic (e.g., an mRNA) to a target tissue (e.g., a liver, spleen, lung, or femur).
  • a therapeutic and/or prophylactic e.g., an mRNA
  • a target tissue e.g., a liver, spleen, lung, or femur.
  • This method includes administering to a subject (e.g., a mammal) a nanoparticle composition, the composition including (i) a lipid component including a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe), a phospholipid, a structural lipid, and a PEG lipid; and (ii) a therapeutic and/or prophylactic, the administering including contacting the target tissue with the nanoparticle composition, whereby the therapeutic and/or prophylactic is delivered to the target tissue.
  • a subject e.g., a mammal
  • a nanoparticle composition including (i) a lipid component including a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe), a phospholipid, a structural lipid, and a PEG lipid; and (ii) a therapeutic
  • the disclosure features a method of lowering immunogenicity comprising introducing the nanoparticle composition of the disclosure into cells, wherein the nanoparticle composition reduces the induction of the cellular immune response of the cells to the nanoparticle composition, as compared to the induction of the cellular immune response in cells induced by a reference composition which comprises a reference lipid instead of a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe).
  • the cellular immune response is an innate immune response, an adaptive immune response, or both.
  • the disclosure also includes methods of synthesizing a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) and methods of making a nanoparticle composition including a lipid component comprising the compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe).
  • STD RNA (e.g. mRNA) vaccines may be administered by any route which results in a therapeutically effective outcome. These include, but are not limited, to intradermal, intramuscular, intranasal and/or subcutaneous administration.
  • the present disclosure provides methods comprising administering RNA (e.g., mRNA) vaccines to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like.
  • STD RNA (e.g., mRNA) vaccines compositions are typically formulated in dosage unit form for ease of administration and uniformity of dosage.
  • RNA e.g., mRNA
  • the specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
  • STD RNA (e.g. mRNA) vaccines compositions may be administered at dosage levels sufficient to deliver 0.0001 mg/kg to 100 mg/kg, 0.001 mg/kg to 0.05 mg/kg, 0.005 mg/kg to 0.05 mg/kg, 0.001 mg/kg to 0.005 mg/kg, 0.05 mg/kg to 0.5 mg/kg, 0.01 mg/kg to 50 mg/kg, 0.1 mg/kg to 40 mg/kg, 0.5 mg/kg to 30 mg/kg, 0.01 mg/kg to 10 mg/kg, 0.1 mg/kg to 10 mg/kg, or 1 mg/kg to 25 mg/kg, of subject body weight per day, one or more times a day, per week, per month, etc.
  • the desired dosage may be delivered three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, every four weeks, every 2 months, every three months, every 6 months, etc.
  • the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations).
  • STD RNA e.g., mRNA
  • vaccines compositions may be administered at dosage levels sufficient to deliver 0.0005 mg/kg to 0.01 mg/kg, e.g., about 0.0005 mg/kg to about 0.0075 mg/kg, e.g., about 0.0005 mg/kg, about 0.001 mg/kg, about 0.002 mg/kg, about 0.003 mg/kg, about 0.004 mg/kg or about 0.005 mg/kg.
  • STD RNA (e.g., mRNA) vaccine compositions may be administered once or twice (or more) at dosage levels sufficient to deliver 0.025 mg/kg to 0.250 mg/kg, 0.025 mg/kg to 0.500 mg/kg, 0.025 mg/kg to 0.750 mg/kg, or 0.025 mg/kg to 1.0 mg/kg.
  • STD RNA (e.g., mRNA) vaccine compositions may be administered twice (e.g., Day 0 and Day 7, Day 0 and Day 14, Day 0 and Day 21, Day 0 and Day 28, Day 0 and Day 60, Day 0 and Day 90, Day 0 and Day 120, Day 0 and Day 150, Day 0 and Day 180, Day 0 and 3 months later, Day 0 and 6 months later, Day 0 and 9 months later, Day 0 and 12 months later, Day 0 and 18 months later, Day 0 and 2 years later, Day 0 and 5 years later, or Day 0 and 10 years later) at a total dose of or at dosage levels sufficient to deliver a total dose of 0.0100 mg, 0.025 mg, 0.050 mg, 0.075 mg, 0.100 mg, 0.125 mg, 0.150 mg, 0.175 mg, 0.200 mg, 0.225 mg, 0.250 mg, 0.275 mg, 0.300 mg, 0.325 mg, 0.350 mg, 0.375 mg, 0.400 mg, 0.425 mg, 0.450
  • STD RNA (e.g., mRNA) vaccine compositions may be administered twice (e.g., Day 0 and Day 7, Day 0 and Day 14, Day 0 and Day 21, Day 0 and Day 28, Day 0 and Day 60, Day 0 and Day 90, Day 0 and Day 120, Day 0 and Day 150, Day 0 and Day 180, Day 0 and 3 months later, Day 0 and 6 months later, Day 0 and 9 months later, Day 0 and 12 months later, Day 0 and 18 months later, Day 0 and 2 years later, Day 0 and 5 years later, or Day 0 and 10 years later) at a total dose of or at dosage levels sufficient to deliver a total dose of 0.010 mg, 0.025 mg, 0.100 mg or 0.400 mg.
  • twice e.g., Day 0 and Day 7, Day 0 and Day 14, Day 0 and Day 21, Day 0 and Day 28, Day 0 and Day 60, Day 0 and Day 90, Day 0 and Day 120, Day 0 and Day 150, Day 0 and Day 180
  • the STD RNA (e.g., mRNA) vaccine for use in a method of vaccinating a subject is administered to the subject as a single dosage of between 10 ⁇ g/kg and 400 ⁇ g/kg of the nucleic acid vaccine (in an effective amount to vaccinate the subject).
  • the RNA (e.g., mRNA) vaccine for use in a method of vaccinating a subject is administered to the subject as a single dosage of between 10 ⁇ g and 400 ⁇ g of the nucleic acid vaccine (in an effective amount to vaccinate the subject).
  • a STD RNA (e.g., mRNA) vaccine for use in a method of vaccinating a subject is administered to the subject as a single dosage of 25-1000 ⁇ g (e.g., a single dosage of mRNA encoding HPV, HSV and/or Chlamydia antigen).
  • a STD RNA (e.g., mRNA) vaccine is administered to the subject as a single dosage of 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 ⁇ g.
  • a STD RNA (e.g., mRNA) vaccine may be administered to a subject as a single dose of 25-100, 25-500, 50-100, 50-500, 50-1000, 100-500, 100-1000, 250-500, 250-1000, or 500-1000 ⁇ g.
  • a STD RNA (e.g., mRNA) vaccine for use in a method of vaccinating a subject is administered to the subject as two dosages, the combination of which equals 25-1000 ⁇ g of the STD RNA (e.g., mRNA) vaccine.
  • a STD RNA (e.g. mRNA) vaccine pharmaceutical composition described herein can be formulated into a dosage form described herein, such as an intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, intranasal and subcutaneous).
  • injectable e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, intranasal and subcutaneous.
  • STD RNA e.g., mRNA
  • STD RNA e.g., mRNA
  • RNA e.g., mRNA
  • an effective amount is a dose of an RNA (e.g., mRNA) vaccine effective to produce an antigen-specific immune response.
  • methods of inducing an antigen-specific immune response in a subject are also provided herein.
  • the antigen-specific immune response is characterized by measuring an anti-HPV, anti-HSV and/or anti- Chlamydia antigenic polypeptide antibody titer produced in a subject administered a STD RNA (e.g., mRNA) vaccine as provided herein.
  • An antibody titer is a measurement of the amount of antibodies within a subject, for example, antibodies that are specific to a particular antigen (e.g., an anti-HPV, anti-HSV and/or anti- Chlamydia antigenic polypeptide) or epitope of an antigen.
  • Antibody titer is typically expressed as the inverse of the greatest dilution that provides a positive result.
  • Enzyme-linked immunosorbent assay is a common assay for determining antibody titers, for example.
  • an antibody titer is used to assess whether a subject has had an infection or to determine whether immunizations are required. In some embodiments, an antibody titer is used to determine the strength of an autoimmune response, to determine whether a booster immunization is needed, to determine whether a previous vaccine was effective, and to identify any recent or prior infections. In accordance with the present disclosure, an antibody titer may be used to determine the strength of an immune response induced in a subject by the STD RNA (e.g., mRNA) vaccine.
  • STD RNA e.g., mRNA
  • an anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject is increased by at least 1 log relative to a control.
  • anti-antigenic polypeptide antibody titer produced in a subject may be increased by at least 1.5, at least 2, at least 2.5, or at least 3 log relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in the subject is increased by 1, 1.5, 2, 2.5 or 3 log relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in the subject is increased by 1-3 log relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in a subject may be increased by 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 log relative to a control.
  • the anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject is increased at least 2 times relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in a subject may be increased at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or at least 10 times relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in the subject is increased 2, 3, 4, 5, 6, 7, 8, 9, or 10 times relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in a subject is increased 2-10 times relative to a control.
  • the anti-antigenic polypeptide antibody titer produced in a subject may be increased 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 times relative to a control.
  • a control in some embodiments, is the anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject who has not been administered a STD RNA (e.g., mRNA) vaccine of the present disclosure.
  • a control is an anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject who has been administered a live attenuated HPV, HSV and/or Chlamydia vaccine.
  • An attenuated vaccine is a vaccine produced by reducing the virulence of a viable (live).
  • a control is an anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject administered inactivated HPV, HSV and/or Chlamydia vaccine.
  • a control is an anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject administered a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine.
  • Recombinant protein vaccines typically include protein antigens that either have been produced in a heterologous expression system (e.g., bacteria or yeast) or purified from large amounts of the pathogenic organism.
  • a control is an anti-antigenic polypeptide (e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide) antibody titer produced in a subject who has been administered an HPV, HSV and/or Chlamydia virus-like particle (VLP) vaccine.
  • an anti-antigenic polypeptide e.g., an anti-HPV, HSV and/or Chlamydia antigenic polypeptide
  • an effective amount of a STD RNA (e.g., mRNA) vaccine is a dose that is reduced compared to the standard of care dose of a recombinant HPV, HSV and/or Chlamydia protein vaccine.
  • a “standard of care,” as provided herein, refers to a medical or psychological treatment guideline and can be general or specific. “Standard of care” specifies appropriate treatment based on scientific evidence and collaboration between medical professionals involved in the treatment of a given condition. It is the diagnostic and treatment process that a physician/clinician should follow for a certain type of patient, illness or clinical circumstance.
  • a “standard of care dose,” as provided herein, refers to the dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine, or a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine, that a physician/clinician or other medical professional would administer to a subject to treat or prevent HPV, HSV and/or Chlamydia , or a related condition, while following the standard of care guideline for treating or preventing HPV, HSV and/or Chlamydia , or a related condition.
  • the anti-antigenic polypeptide e.g., an anti-HPV, anti-HSV and/or anti Chlamydia antigenic polypeptide
  • a STD RNA e.g., mRNA
  • an anti-antigenic polypeptide e.g., an anti-HPV, anti-HSV and/or anti Chlamydia antigenic polypeptide
  • an anti-antigenic polypeptide e.g., an anti-HPV, anti-HSV and/or anti Chlamydia antigenic polypeptide
  • antibody titer produced in a control subject administered a standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine or a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine.
  • an effective amount of a STD RNA (e.g., mRNA) vaccine is a dose equivalent to an at least 2-fold reduction in a standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine.
  • an effective amount of a STD RNA (e.g., mRNA) vaccine may be a dose equivalent to an at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold reduction in a standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine.
  • an effective amount of a STD RNA (e.g., mRNA) vaccine is a dose equivalent to an at least at least 100-fold, at least 500-fold, or at least 1000-fold reduction in a standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine.
  • an effective amount of a STD RNA (e.g., mRNA) vaccine is a dose equivalent to a 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 20-, 50-, 100-, 250-, 500-, or 1000-fold reduction in a standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine.
  • the anti-antigenic polypeptide antibody titer produced in a subject administered an effective amount of a STD RNA (e.g., mRNA) vaccine is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant or protein HPV, HSV and/or Chlamydia protein vaccine or a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine.
  • STD RNA e.g., mRNA
  • an effective amount of a STD RNA (e.g., mRNA) vaccine is a dose equivalent to a 2-fold to 1000-fold (e.g., 2-fold to 100-fold, 10-fold to 1000-fold) reduction in the standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine, wherein the anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine or a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine.
  • a 2-fold to 1000-fold e.g., 2-fold to 100-fold, 10-fold to 1000-fold
  • the anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody t
  • the effective amount of a STD RNA (e.g., mRNA) vaccine is a dose equivalent to a 2 to 1000-, 2 to 900-, 2 to 800-, 2 to 700-, 2 to 600-, 2 to 500-, 2 to 400-, 2 to 300-, 2 to 200-, 2 to 100-, 2 to 90-, 2 to 80-, 2 to 70-, 2 to 60-, 2 to 50-, 2 to 40-, 2 to 30-, 2 to 20-, 2 to 10-, 2 to 9-, 2 to 8-, 2 to 7-, 2 to 6-, 2 to 5-, 2 to 4-, 2 to 3-, 3 to 1000-, 3 to 900-, 3 to 800-, 3 to 700-, 3 to 600-, 3 to 500-, 3 to 400-, 3 to 3 to 00-, 3 to 200-, 3 to 100-, 3 to 90-, 3 to 80-, 3 to 70-, 3 to 60-, 3 to 50-, 3 to 40-, 3 to 30-, 3 to 20-, 3 to 10-, 3
  • the anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine or a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine.
  • the effective amount is a dose equivalent to (or equivalent to an at least) 2-, 3-,4-,5-,6-, 7-, 8-, 9-, 10-, 20-, 30-, 40-, 50-, 60-, 70-, 80-, 90-, 100-, 110-, 120-, 130-, 140-, 150-, 160-, 170-, 1280-, 190-, 200-, 210-, 220-, 230-, 240-, 250-, 260-, 270-, 280-, 290-, 300-, 310-, 320-, 330-, 340-, 350-, 360-, 370-, 380-, 390-, 400-, 410-, 420-, 430-, 440-, 450-, 4360-, 470-, 480-, 490-, 500-, 510-, 520-, 530-, 540-, 550-, 560-, 5760-, 580-, 590-, 600-, 610
  • an anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant or purified HPV, HSV and/or Chlamydia protein vaccine or a live attenuated or inactivated HPV, HSV and/or Chlamydia vaccine.
  • the effective amount of a STD RNA (e.g., mRNA) vaccine is a total dose of 50-1000 ⁇ g. In some embodiments, the effective amount of a STD RNA (e.g., mRNA) vaccine is a total dose of 50-1000, 50-900, 50-800, 50-700, 50-600, 50-500, 50-400, 50-300, 50-200, 50-100, 50-90, 50-80, 50-70, 50-60, 60-1000, 60-900, 60-800, 60-700, 60-600, 60-500, 60-400, 60-300, 60-200, 60-100, 60-90, 60-80, 60-70, 70-1000, 70-900, 70-800, 70-700, 70-600, 70-500, 70-400, 70-300, 70-200, 70-100, 70-90, 70-80, 80-1000, 80-900, 80-800, 80-700, 80-600, 80-500, 80-400, 80
  • the effective amount of a STD RNA (e.g., mRNA) vaccine is a total dose of 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 ⁇ g. In some embodiments, the effective amount is a dose of 25-500 ⁇ g administered to the subject a total of two times.
  • the effective amount of a STD RNA (e.g., mRNA) vaccine is a dose of 25-500, 25-400, 25-300, 25-200, 25-100, 25-50, 50-500, 50-400, 50-300, 50-200, 50-100, 100-500, 100-400, 100-300, 100-200, 150-500, 150-400, 150-300, 150-200, 200-500, 200-400, 200-300, 250-500, 250-400, 250-300, 300-500, 300-400, 350-500, 350-400, 400-500 or 450-500 ⁇ g administered to the subject a total of two times.
  • a STD RNA e.g., mRNA
  • the effective amount of a STD RNA (e.g., mRNA) vaccine is a total dose of 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 ⁇ g administered to the subject a total of two times.
  • a sexually transmitted disease (STD) vaccine comprising:
  • RNA polynucleotide having an open reading frame encoding at least one human papillomavirus (HPV) antigenic polypeptide and at least one herpes simplex virus (HSV) antigenic polypeptide, optionally formulated in a cationic lipid nanoparticle having a molar ratio of about 20-60% cationic lipid, about 5-25% non-cationic lipid, about 25-55% sterol, and about 0.5-15% PEG-modified lipid, optionally wherein the at least one RNA polynucleotide comprises at least one chemical modification.
  • HPV human papillomavirus
  • HSV herpes simplex virus
  • a sexually transmitted disease (STD) vaccine comprising:
  • RNA polynucleotide having an open reading frame encoding at least one human papillomavirus (HPV) antigenic polypeptide and at least one Chlamydia trachomatis antigenic polypeptide, optionally formulated in a cationic lipid nanoparticle having a molar ratio of about 20-60% cationic lipid, about 5-25% non-cationic lipid, about 25-55% sterol, and about 0.5-15% PEG-modified lipid, optionally wherein the at least one RNA polynucleotide comprises at least one chemical modification.
  • HPV human papillomavirus
  • a sexually transmitted disease (STD) vaccine comprising:
  • RNA polynucleotide having an open reading frame encoding at least one herpes simplex virus (HSV) antigenic polypeptide and at least one Chlamydia trachomatis antigenic polypeptide, optionally formulated in a cationic lipid nanoparticle having a molar ratio of about 20-60% cationic lipid, about 5-25% non-cationic lipid, about 25-55% sterol, and about 0.5-15% PEG-modified lipid, optionally wherein the at least one RNA polynucleotide comprises at least one chemical modification.
  • HSV herpes simplex virus
  • the at least one antigenic polypeptide is selected from HPV E1 protein, HPV E2 protein, HPV E4 protein, HPV E5 protein, HPV E6 protein, HPV E7 protein, HPV L1 protein, and HPV L2 protein, optionally wherein the HPV serotype is selected from HPV serotypes 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 and 82. 5.
  • RNA polynucleotide having an open reading frame encoding at least two antigenic polypeptides or immunogenic fragments thereof selected from HPV E1 protein, HPV E2 protein, HPV E4 protein, HPV E5 protein, HPV E6 protein, HPV E7 protein, HPV L1 protein, and HPV L2 protein.
  • the at least one antigenic polypeptide comprises an amino acid sequence identified by any one of SEQ ID NO: 31-61.
  • the vaccine of any one of paragraphs 1, 2 or 4-11 wherein the at least one antigenic polypeptide has an amino acid sequence that has 90%-99% identity to an amino acid sequence of SEQ ID NO: 31-61 and wherein the antigenic polypeptide or immunogenic fragment thereof has membrane fusion activity, attaches to cell receptors, causes fusion of viral and cellular membranes, and/or is responsible for binding of the virus to a cell being infected.
  • the at least one antigenic polypeptide is a major outer membrane protein (MOMP) or an immunogenic fragment thereof, optionally having a Chlamydia trachomatis serovar selected serovar H, F, E, D, I, G, J and K. 14.
  • MOMP major outer membrane protein
  • the vaccine comprises at least two RNA polynucleotides, each having an open reading frame encoding at least one antigenic polypeptide or an immunogenic fragment thereof selected from a MOMP of serovar H, a MOMP of serovar F, a MOMP of serovar E, a MOMP of serovar D, a MOMP of serovar I, a MOMP of serovar G, a MOMP of serovar J, and a MOMP of serovar K, wherein the antigenic polypeptide encoded by one of the open reading frames differs from the antigenic polypeptide encoded by another of the open reading frames.
  • the vaccine of any one of paragraphs 2-17, wherein the at least one antigenic polypeptide has an amino acid sequence that has at least 95% identity to an amino acid sequence identified by any one of SEQ ID NO: 65-183. 19.
  • the vaccine of any one of paragraphs 2-20 wherein the at least one antigenic polypeptide has an amino acid sequence that has 90%-99% identity to an amino acid sequence of SEQ ID NO: 65-183 and wherein the antigenic polypeptide or immunogenic fragment thereof has membrane fusion activity, attaches to cell receptors, causes fusion of viral and cellular membranes, and/or is responsible for binding of the virus to a cell being infected. 22.
  • RNA polynucleotide has at least 80% identity to wild-type mRNA sequence, but does not include wild-type mRNA sequence.
  • the at least one antigenic polypeptide has membrane fusion activity, attaches to cell receptors, causes fusion of viral and cellular membranes, and/or is responsible for binding of the virus to a cell being infected.
  • the at least one RNA polynucleotide comprises at least one chemical modification.
  • the vaccine of paragraph 1-25 wherein the chemical modification is selected from pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyl uridine.
  • RNA polynucleotide further encodes at least one 5′ terminal cap.
  • 5′ terminal cap is 7mG(5′)ppp(5′)NlmpNp. 34.
  • a signal peptide selected from: a HuIgGk signal peptide (METPAQLLFLLLLWLPDTTG; SEQ ID NO: 304); IgE heavy chain epsilon-1 signal peptide (MDWTWILFLVAAATRVHS; SEQ ID NO: 305); Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS; SEQ ID NO: 306), VSVg protein signal sequence (MKCLLYLAFLFIGVNCA; SEQ ID NO: 307) and Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA; SEQ ID NO: 308).
  • a HuIgGk signal peptide METPAQLLFLLLLWLPDTTG; SEQ ID NO: 304
  • IgE heavy chain epsilon-1 signal peptide MDWTWILFLVAAATRVHS
  • SEQ ID NO: 305 Japanese encephalitis PRM signal sequence
  • the lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol and a non-cationic lipid.
  • the lipid nanoparticle carrier comprises a molar ratio of about 20-60% cationic lipid, 0.5-15% PEG-modified lipid, 25-55% sterol, and 25% non-cationic lipid.
  • the cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is a cholesterol.
  • cationic lipid is selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).
  • DLin-KC2-DMA 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
  • DLin-MC3-DMA dilinoleyl-methyl-4-dimethylaminobutyrate
  • the vaccine of any one of paragraphs 1-47, wherein the nanoparticle has a net neutral charge at a neutral pH value.
  • the vaccine of any one of paragraphs 1-48 further comprising an adjuvant.
  • the vaccine of paragraph 49, wherein the adjuvant is a flagellin protein or peptide.
  • the vaccine of paragraph 50 wherein the flagellin protein or peptide comprises an amino acid sequence identified by any one of SEQ ID NO: 301-303. 52.
  • the vaccine of any one of paragraphs 1-51, wherein the open reading frame is codon-optimized.
  • 53. The vaccine of any one of paragraphs 1-52, wherein the vaccine is multivalent.
  • 54. The vaccine of any one of paragraphs 1-53 formulated in an effective amount to produce an antigen-specific immune response.
  • a method of inducing an immune response in a subject comprising administering to the subject the vaccine of any one of paragraphs 1-54 in an amount effective to produce an antigen-specific immune response in the subject. 56.
  • the antigen specific immune response comprises a T cell response or a B cell response.
  • the subject is administered a single dose of the vaccine.
  • the subject is administered a booster dose of the vaccine.
  • the vaccine is administered to the subject by intradermal injection or intramuscular injection.
  • an anti-antigenic polypeptide antibody titer produced in the subject is increased by at least 1 log relative to a control. 61.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a live attenuated vaccine or an inactivated vaccine against the virus.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a recombinant protein vaccine or purified protein vaccine against the virus.
  • control is an anti-antigenic polypeptide antibody titer produced in a subject who has been administered a VLP vaccine against the virus.
  • any one of paragraphs 55-67 wherein the effective amount is a dose equivalent to an at least 2-fold reduction in the standard of care dose of a recombinant protein vaccine or a purified protein vaccine against the virus, and wherein an anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a recombinant protein vaccine or a purified protein vaccine against the virus, respectively. 69.
  • any one of paragraphs 55-67 wherein the effective amount is a dose equivalent to an at least 2-fold reduction in the standard of care dose of a live attenuated vaccine or an inactivated vaccine against the virus, and wherein an anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a live attenuated vaccine or an inactivated vaccine against the virus, respectively.
  • any one of paragraphs 55-67 wherein the effective amount is a dose equivalent to an at least 2-fold reduction in the standard of care dose of a VLP vaccine against the virus, and wherein an anti-antigenic polypeptide antibody titer produced in the subject is equivalent to an anti-antigenic polypeptide antibody titer produced in a control subject administered the standard of care dose of a VLP vaccine against the virus.
  • the effective amount is a total dose of 50 ⁇ g-1000 ⁇ g.
  • 72 The method of paragraph 55-71, wherein the effective amount is a dose of 25 ⁇ g, 100 ⁇ g, 400 ⁇ g, or 500 ⁇ g administered to the subject a total of two times.
  • a tropical disease vaccine comprising:
  • mRNA messenger ribonucleic acid
  • the vaccine of paragraph 1 wherein the at least one mRNA polynucleotide is encoded by a sequence identified by any one of SEQ ID NO: 1-28. 85. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises a sequence identified by any one of SEQ ID NO: 431-461. 86. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises a sequence identified by any one of SEQ ID NO: 31-61. 87. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence identified by any one of SEQ ID NO: 62-64. 88.
  • the vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises a sequence identified by any one of SEQ ID NO: 317-319. 89.
  • the vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises a sequence identified by any one of SEQ ID NO: 65-72.
  • the vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence identified by any one of SEQ ID NO: 184-294.
  • 91. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises a sequence identified by any one of SEQ ID NO: 320-430. 92.
  • the vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises a sequence identified by any one of SEQ ID NO: 73-183.
  • a lipid nanoparticle comprising: DLin-MC3-DMA; cholesterol; 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC); and polyethylene glycol (PEG)2000-DMG.
  • DSPC 1,2-Distearoyl-sn-glycero-3-phosphocholine
  • PEG 2000-DMG polyethylene glycol
  • a sexually transmitted disease (STD) vaccine comprising:
  • mRNA messenger ribonucleic acid
  • mRNA messenger ribonucleic acid
  • SEQ ID NO: 431-461 a sequence identified by SEQ ID NO: 431-461 and a 3′ polyA tail, wherein the uracil nucleotides of the sequence identified by SEQ ID NO: 431-461 are modified to include N1-methyl pseudouridine at the 5-position of the uracil nucleotide.
  • a sexually transmitted disease (STD) vaccine comprising:
  • mRNA messenger ribonucleic acid
  • a sexually transmitted disease (STD) vaccine comprising:
  • mRNA messenger ribonucleic acid
  • mRNA messenger ribonucleic acid
  • SEQ ID NO: 320-430 a sequence identified by SEQ ID NO: 320-430 and a 3′ polyA tail, wherein the uracil nucleotides of the sequence identified by SEQ ID NO: 320-430 are modified to include N1-methyl pseudouridine at the 5-position of the uracil nucleotide.
  • the vaccine of paragraph X formulated in a lipid nanoparticle comprising DLin-MC3-DMA, cholesterol, 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC), and polyethylene glycol (PEG)2000-DMG.
  • the manufacture of polynucleotides and/or parts or regions thereof may be accomplished utilizing the methods taught in International Publication WO2014/152027, entitled “Manufacturing Methods for Production of RNA Transcripts,” the contents of which is incorporated herein by reference in its entirety.
  • Characterization of the polynucleotides of the disclosure may be accomplished using polynucleotide mapping, reverse transcriptase sequencing, charge distribution analysis, detection of RNA impurities, or any combination of two or more of the foregoing.
  • “Characterizing” comprises determining the RNA transcript sequence, determining the purity of the RNA transcript, or determining the charge heterogeneity of the RNA transcript, for example. Such methods are taught in, for example, International Publication WO2014/144711 and International Publication WO2014/144767, the content of each of which is incorporated herein by reference in its entirety.
  • two regions or parts of a chimeric polynucleotide may be joined or ligated using triphosphate chemistry.
  • a first region or part of 100 nucleotides or less is chemically synthesized with a 5′ monophosphate and terminal 3′desOH or blocked OH, for example. If the region is longer than 80 nucleotides, it may be synthesized as two strands for ligation.
  • first region or part is synthesized as a non-positionally modified region or part using in vitro transcription (IVT)
  • IVT in vitro transcription
  • Monophosphate protecting groups may be selected from any of those known in the art.
  • the second region or part of the chimeric polynucleotide may be synthesized using either chemical synthesis or IVT methods.
  • IVT methods may include an RNA polymerase that can utilize a primer with a modified cap.
  • a cap of up to 130 nucleotides may be chemically synthesized and coupled to the IVT region or part.
  • the entire chimeric polynucleotide need not be manufactured with a phosphate-sugar backbone. If one of the regions or parts encodes a polypeptide, then such region or part may comprise a phosphate-sugar backbone.
  • Ligation is then performed using any known click chemistry, orthoclick chemistry, solulink, or other bioconjugate chemistries known to those in the art.
  • the chimeric polynucleotide may be made using a series of starting segments. Such segments include:
  • a 5′ triphosphate segment which may include the coding region of a polypeptide and a normal 3′OH (SEG. 2)
  • segment 3 (SEG. 3) may be treated with cordycepin and then with pyrophosphatase to create the 5′ monophosphate.
  • Segment 2 (SEG. 2) may then be ligated to SEG. 3 using RNA ligase.
  • the ligated polynucleotide is then purified and treated with pyrophosphatase to cleave the diphosphate.
  • the treated SEG.2-SEG. 3 construct may then be purified and SEG. 1 is ligated to the 5′ terminus.
  • a further purification step of the chimeric polynucleotide may be performed.
  • the ligated or joined segments may be represented as: 5′UTR (SEG. 1), open reading frame or ORF (SEG. 2) and 3′UTR+PolyA (SEG. 3).
  • the yields of each step may be as much as 90-95%.
  • PCR procedures for the preparation of cDNA may be performed using 2 ⁇ KAPA HIFITM HotStart ReadyMix by Kapa Biosystems (Woburn, Mass.). This system includes 2 ⁇ KAPA ReadyMix 12.5 ⁇ l; Forward Primer (10 ⁇ M) 0.75 ⁇ l; Reverse Primer (10 ⁇ M) 0.75 ⁇ l; Template cDNA 100 ng; and dH 2 O diluted to 25.0 ⁇ l.
  • the reaction conditions may be at 95° C. for 5 min.
  • the reaction may be performed for 25 cycles of 98° C. for 20 sec, then 58° C. for 15 sec, then 72° C. for 45 sec, then 72° C. for 5 min, then 4° C. to termination.
  • the reaction may be cleaned up using Invitrogen's PURELINKTM PCR Micro Kit (Carlsbad, Calif.) per manufacturer's instructions (up to 5 ⁇ g). Larger reactions may require a cleanup using a product with a larger capacity. Following the cleanup, the cDNA may be quantified using the NANODROPTM and analyzed by agarose gel electrophoresis to confirm that the cDNA is the expected size. The cDNA may then be submitted for sequencing analysis before proceeding to the in vitro transcription reaction.
  • RNA polynucleotides Such polynucleotides may comprise a region or part of the polynucleotides of the disclosure, including chemically modified RNA (e.g., mRNA) polynucleotides.
  • the chemically modified RNA polynucleotides can be uniformly modified polynucleotides.
  • the in vitro transcription reaction utilizes a custom mix of nucleotide triphosphates (NTPs).
  • the NTPs may comprise chemically modified NTPs, or a mix of natural and chemically modified NTPs, or natural NTPs.
  • a typical in vitro transcription reaction includes the following:
  • the crude IVT mix may be stored at 4° C. overnight for cleanup the next day. 1 U of RNase-free DNase may then be used to digest the original template. After 15 minutes of incubation at 37° C., the mRNA may be purified using Ambion's MEGACLEARTM Kit (Austin, Tex.) following the manufacturer's instructions. This kit can purify up to 500 ⁇ g of RNA. Following the cleanup, the RNA polynucleotide may be quantified using the NanoDrop and analyzed by agarose gel electrophoresis to confirm the RNA polynucleotide is the proper size and that no degradation of the RNA has occurred.
  • RNA polynucleotide Capping of a RNA polynucleotide is performed as follows where the mixture includes: IVT RNA 60 ⁇ g-180 ⁇ g and dH 2 O up to 72 ⁇ l. The mixture is incubated at 65° C. for 5 minutes to denature RNA, and then is transferred immediately to ice.
  • the protocol then involves the mixing of 10 ⁇ Capping Buffer (0.5 M Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl 2 ) (10.0 ⁇ l); 20 mM GTP (5.0 ⁇ l); 20 mM S-Adenosyl Methionine (2.5 ⁇ l); RNase Inhibitor (100 U); 2′-O-Methyltransferase (400U); Vaccinia capping enzyme (Guanylyl transferase) (40 U); dH 2 O (Up to 28 ⁇ l); and incubation at 37° C. for 30 minutes for 60 ⁇ g RNA or up to 2 hours for 180 ⁇ g of RNA.
  • Capping Buffer 0.5 M Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl 2
  • 20 mM GTP 5.0 ⁇ l
  • 20 mM S-Adenosyl Methionine 2.5 ⁇
  • RNA polynucleotide may then be purified using Ambion's MEGACLEARTM Kit (Austin, Tex.) following the manufacturer's instructions. Following the cleanup, the RNA may be quantified using the NANODROPTM (ThermoFisher, Waltham, Mass.) and analyzed by agarose gel electrophoresis to confirm the RNA polynucleotide is the proper size and that no degradation of the RNA has occurred. The RNA polynucleotide product may also be sequenced by running a reverse-transcription-PCR to generate the cDNA for sequencing.
  • a poly-A tailing reaction must be performed before cleaning the final product. This is done by mixing capped IVT RNA (100 ⁇ l); RNase Inhibitor (20 U); 10 ⁇ Tailing Buffer (0.5 M Tris-HCl (pH 8.0), 2.5 M NaCl, 100 mM MgCl 2 ) (12.0 ⁇ l); 20 mM ATP (6.0 ⁇ l); Poly-A Polymerase (20 U); dH 2 O up to 123.5 ⁇ l and incubation at 37° C. for 30 min.
  • Poly-A Polymerase may be a recombinant enzyme expressed in yeast.
  • polyA tails of approximately between 40-200 nucleotides, e.g., about 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 150-165, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164 or 165 are within the scope of the present disclosure.
  • 5′-capping of polynucleotides may be completed concomitantly during the in vitro-transcription reaction using the following chemical RNA cap analogs to generate the 5′-guanosine cap structure according to manufacturer protocols: 3′-O-Me-m7G(5′)ppp(5′) G [the ARCA cap]; G(5′)ppp(5′)A; G(5′)ppp(5′)G; m7G(5′)ppp(5′)A; m7G(5′)ppp(5′)G (New England BioLabs, Ipswich, Mass.).
  • 5′-capping of modified RNA may be completed post-transcriptionally using a Vaccinia Virus Capping Enzyme to generate the “Cap 0” structure: m7G(5′)ppp(5′)G (New England BioLabs, Ipswich, Mass.).
  • Cap 1 structure may be generated using both Vaccinia Virus Capping Enzyme and a 2′-O methyl-transferase to generate: m7G(5′)ppp(5′)G-2′-O-methyl.
  • Cap 2 structure may be generated from the Cap 1 structure followed by the 2′-O-methylation of the 5′-antepenultimate nucleotide using a 2′-O methyl-transferase.
  • Cap 3 structure may be generated from the Cap 2 structure followed by the 2′-O-methylation of the 5′-preantepenultimate nucleotide using a 2′-O methyl-transferase.
  • Enzymes are preferably derived from a recombinant source.
  • the modified mRNAs When transfected into mammalian cells, the modified mRNAs have a stability of between 12-18 hours or more than 18 hours, e.g., 24, 36, 48, 60, 72 or greater than 72 hours.
  • Polynucleotides encoding a polypeptide, containing any of the caps taught herein, can be transfected into cells at equal concentrations.
  • the amount of protein secreted into the culture medium can be assayed by ELISA at 6, 12, 24 and/or 36 hours post-transfection.
  • Synthetic polynucleotides that secrete higher levels of protein into the medium correspond to a synthetic polynucleotide with a higher translationally-competent cap structure.
  • RNA (e.g., mRNA) polynucleotides encoding a polypeptide, containing any of the caps taught herein can be compared for purity using denaturing Agarose-Urea gel electrophoresis or HPLC analysis.
  • RNA polynucleotides with a single, consolidated band by electrophoresis correspond to the higher purity product compared to polynucleotides with multiple bands or streaking bands.
  • Chemically modified RNA polynucleotides with a single HPLC peak also correspond to a higher purity product. The capping reaction with a higher efficiency provides a more pure polynucleotide population.
  • RNA (e.g., mRNA) polynucleotides encoding a polypeptide, containing any of the caps taught herein can be transfected into cells at multiple concentrations.
  • the amount of pro-inflammatory cytokines, such as TNF-alpha and IFN-beta, secreted into the culture medium can be assayed by ELISA at 6, 12, 24 and/or 36 hours post-transfection.
  • RNA polynucleotides resulting in the secretion of higher levels of pro-inflammatory cytokines into the medium correspond to a polynucleotides containing an immune-activating cap structure.
  • RNA (e.g., mRNA) polynucleotides encoding a polypeptide, containing any of the caps taught herein can be analyzed for capping reaction efficiency by LC-MS after nuclease treatment.
  • Nuclease treatment of capped polynucleotides yield a mixture of free nucleotides and the capped 5′-5-triphosphate cap structure detectable by LC-MS.
  • the amount of capped product on the LC-MS spectra can be expressed as a percent of total polynucleotide from the reaction and correspond to capping reaction efficiency.
  • the cap structure with a higher capping reaction efficiency has a higher amount of capped product by LC-MS.
  • Example 9 Agarose Gel Electrophoresis of Modified RNA or RT PCR Products
  • RNA polynucleotides 200-400 ng in a 20 ⁇ l volume
  • reverse transcribed PCR products 200-400 ng
  • RNA polynucleotides 200-400 ng in a 20 ⁇ l volume
  • reverse transcribed PCR products 200-400 ng
  • a well on a non-denaturing 1.2% Agarose E-Gel Invitrogen, Carlsbad, Calif.
  • RNA polynucleotides in TE buffer (1 ⁇ l) are used for Nanodrop UV absorbance readings to quantitate the yield of each polynucleotide from an chemical synthesis or in vitro transcription reaction.
  • Example 11 Formulation of Modified mRNA Using Lipidoids
  • RNA (e.g., mRNA) polynucleotides may be formulated for in vitro experiments by mixing the polynucleotides with the lipidoid at a set ratio prior to addition to cells. In vivo formulation may require the addition of extra ingredients to facilitate circulation throughout the body. To test the ability of these lipidoids to form particles suitable for in vivo work, a standard formulation process used for siRNA-lipidoid formulations may be used as a starting point. After formation of the particle, polynucleotide is added and allowed to integrate with the complex. The encapsulation efficiency is determined using a standard dye exclusion assays.
  • the instant study is designed to test the immunogenicity in mice of candidate HPV vaccines comprising a chemically modified or unmodified mRNA polynucleotide encoding HPV L1 protein obtained from HPV serotypes 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 or 82.
  • mice are immunized intravenously (IV), intramuscularly (IM), or intradermally (ID) with candidate vaccines. Up to three immunizations are given at 3-week intervals (i.e., at weeks 0, 3, 6, and 9), and sera are collected after each immunization until weeks 33-51. Serum antibody titers against HPV L1 protein are determined by ELISA.
  • the instant study is designed to test the efficacy in guinea pig of candidate HPV vaccines against a lethal challenge using a HPV vaccine comprising a chemically modified or unmodified mRNA encoding HPV L1 protein obtained from HPV serotypes 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 or 82. Animals are challenged with a lethal dose of the HPV.
  • Animals are immunized intravenously (IV), intramuscularly (IM), or intradermally (ID) at week 0 and week 3 with candidate HPV vaccines with and without adjuvant.
  • the animals are then challenged with a lethal dose of HPV on week 7 via IV, IM or ID. Endpoint is day 13 post infection, death or euthanasia. Animals displaying severe illness as determined by >30% weight loss, extreme lethargy or paralysis are euthanized. Body temperature and weight are assessed and recorded daily.
  • the formulation may include a cationic lipid, non-cationic lipid, PEG lipid and structural lipid in the ratios 50:10:1.5:38.5.
  • the cationic lipid is DLin-KC2-DMA (50 mol %) or DLin-MC3-DMA (50 mol %)
  • the non-cationic lipid is DSPC (10 mol %)
  • the PEG lipid is PEG-DOMG (1.5 mol %)
  • the structural lipid is cholesterol (38.5 mol %), for example.
  • Efficacy of HPV vaccine candidates against HPV challenge are compared to efficacy of vaccination of animals with Gardasil® (Human Papillomavirus Quadrivalent (Types 6, 11, 16, and 18) Vaccine, Recombinant, Merck).
  • Gardasil® Human Papillomavirus Quadrivalent (Types 6, 11, 16, and 18) Vaccine, Recombinant, Merck).
  • mice were immunized intramuscularly (IM) with candidate vaccines designated Ct089mRNA, Ct089NGM mRNA (N-glycosylated) or rCt089 protein (in Addvax). 2 ⁇ g or 10 ⁇ g doses in a 50 ⁇ l volume were administered to mice on day 0 and on day 21 (boost). The MC3/mRNA concentration used was 0.2 mg/ml for 10 ⁇ g dose, or 0.04 mg/ml for 2 ⁇ g dose. Mice were bled for serum preparation on day ⁇ 3, 21 and 35. Anti-Ct089 antibody titers in serum were measured using rCt089 produced in E. coli as the antigen. FIG. 4 shows antibody titers measured on day 21 and on day 35.
  • Ct089NGM N-glycosylation mutant Ct089
  • Ct089 is a promising Ct vaccine antigen candidate.
  • Ct089 displayed both N- and O-glycosylation when expressed in mammalian cells. Given the extensive glycosylation observed with Ct089, mammalian glycosylation of mRNA encoded bacterial proteins in mammalian cells does not appear to mask immune epitopes or impede immunogenicity.
  • the instant study is designed to test the efficacy in Guinea pigs of candidate Chlamydia vaccines against a lethal challenge using a Chlamydia vaccine comprising chemically modified or unmodified mRNA encoding MOMP obtained from Chlamydia trachomatis serovar H, F, E, D, I, G, J or K. Mice are challenged with a lethal dose of the Chlamydia trachomatis.
  • IG intravaginally
  • IM intramuscularly
  • ID intradermally
  • the animals are then challenged with a lethal dose of Chlamydia trachomatis on week 7 via an IG, IM or ID route. Endpoint is day 13 post infection, death or euthanasia. Animals displaying severe illness as determined by >30% weight loss, extreme lethargy or paralysis are euthanized. Body temperature and weight are assessed and recorded daily.
  • the formulation may include a cationic lipid, non-cationic lipid, PEG lipid and structural lipid in the ratios 50:10:1.5:38.5.
  • the cationic lipid is DLin-KC2-DMA (50 mol %)
  • the non-cationic lipid is DSPC (10 mol %)
  • the PEG lipid is PEG-DOMG (1.5 mol %)
  • the structural lipid is cholesterol (38.5 mol %), for example.
  • Example 16 In Vitro Expression of Chlamydia trachomatis Antigens from Candidate mRNA Vaccines
  • the mRNA vaccine constructs encoding Ct875, Ct858, Ct089, PmPG_pd, Ct460, Ct622, Cta1, Ct443, or Ct812pd_D were transfected into HEK293F cells. Twenty hours post transfection, the cell culture supernatant (concentrated or dilute) or HEK293F cell lysates were collected and the expression of the antigens were analyzed by Western blot. The Chlamydia trachomatis antigens were tagged with a HisX6 tag. Mouse anti-6 ⁇ His antibodies were used as the primary antibody, and anti-mouse A1647 antibodies were used as the secondary antibody. The cellular GAPDH was also detected as control.
  • FIGS. 1A-1B Rabbit anti-GAPDH antibodies were used as the primary antibody, and anti-rabbit Cy3 antibodies were used as the secondary antibody.
  • the results of the Western blot are shown in FIGS. 1A-1B , FIGS. 2A-2B , FIG. 3 and Table 14.
  • AAAACUGAUGUGAAUAAAGAAUUUCAGAUGGGAGCGG EU040363 CGCCUACUACCAGCGAUGUAGUAGGCUUACAAAACGA UCCAACAACAAACGUUGCUCGUCCAAAUCCCGCUUAUG GCAAACACAUGCAAGAUGCUGAAAUGUUUACGAACGC UGCUUACAUGGCAUUAAAUAUCUGGGAUCGUUUUGAU GUAUUUUGUACAUUGGGAGCAACUACCGGUUAUUUAA AAGGAAACUCUGCUUCCUUCAACUUAGUUGGAUUAUU CGGAACAAAAACACAAUCUUCUAGCUUUAAUACAGCG AAGCUUAUUCCUAACACUGCUUUGAAUGAAGCUGUGG UUGAGCUUUAUAUAAACACUACCUUUGCUUGGAGCGU AGGUGCUCGUGCAGCUCUCUCUCUGGGAAUGUGGGUGUGUGCA ACGUUAGGAGCUUCUUUCCAAUAUGCUCAAUCUAAACCUACCUU
  • AAAACUGAUGUGAAUAAAGAAUUUCAGAUGGGAGCGG EU040364 CGCCUACUACCAGCGAUGUAGCAGGCUUACAAAACGA UCCAACAACAAACGUUGCUCGUCCAAAUCCCGCUUAUG GCAAACACAUGCAAGAUGCUGAAAUGUUUACGAACGC UGCUUACAUGGCAUUAAAUAUCUGGGAUCGUUUUGAU GUAUUUUGUACAUUGGGAGCAACUACCGGUUAUUUAA AAGGAAACUCUGCUUCCUUCAACUUAGUUGGAUUAUU CGGAACAAAAACACAAUCUUCUAGCUUUAAUACAGCG AAGCUUAUUCCUAACACUGCUUUGAAUGAAGCUGUGG UUGAGCUUUAUAUAAACACUACCUUUGCUUGGAGCGU AGGUGCUCGUGCAGCUCUCUCUGGGAAUGUGGGUGUGCA ACGUUAGGAGCUUCUUUCCAAUAUGCUCAAUCUAAACCUACCUUUGCU
  • AAAACUGAUGUGAAUAAAGAAUUUCAGAUGGGAGCGG EU040365 CGCCUACUACCAGCGAUGUAGUAGGCUUACAAAACGA UCCAACAACAAACGUUGCUCGUCCAAAUCCCGCUUAUG GCAAACACAUGCAAGAUGCUGAAAUGUUUACGAACGC UGCUUACAUGGCAUUAAAUAUCUGGGAUCGUUUUGAU GUAUUUUGUACAUUGGGAGCAACUACCGGUUAUUUAA AAGGAAACUCUGCUUCCUUCAACUUAGUUGGAUUAUU CGGAACAAAAACACAAUCUUCUAGCUUUAAUACAGCG AAGCUUAUUCCUAACACUGCUUUGAAUGAAGCUGUGG UUGAGCUUUAUAUAAACACUACCUUUGCUUGGAGCGU AGGUGCUCGUGCAGCUCUCUCUGGGAAUGUGGGUGUGCA ACGUUAGGAGCUUCUUUCCAAUAUGCUCAAUCUAAACCUACCUUUGCU
  • Chlamydia _Ct089_nIgk_cHis yes (L, S, cS) high expression, evidence of glycosylation Chlamydia _Ct460_serovarD_nIgk_cHis yes (L, cS) medium expression, likely glycosylated Chlamydia _Ct622_serovarE_nIgk_cHis yes (cS only), low expression secreted, evidence of Glycosylation Chlamydia _Ct858_nIgk_cHis yes, (L only by WB and LCMS -exp4, 7).
US15/767,600 2015-10-22 2016-10-21 Sexually transmitted disease vaccines Pending US20180289792A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/767,600 US20180289792A1 (en) 2015-10-22 2016-10-21 Sexually transmitted disease vaccines

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US201562244822P 2015-10-22 2015-10-22
US201562245031P 2015-10-22 2015-10-22
US201562244884P 2015-10-22 2015-10-22
US201562247374P 2015-10-28 2015-10-28
US201562247418P 2015-10-28 2015-10-28
US15/767,600 US20180289792A1 (en) 2015-10-22 2016-10-21 Sexually transmitted disease vaccines
PCT/US2016/058314 WO2017070616A2 (fr) 2015-10-22 2016-10-21 Vaccins contre les maladies sexuellement transmissibles

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/058314 A-371-Of-International WO2017070616A2 (fr) 2015-10-22 2016-10-21 Vaccins contre les maladies sexuellement transmissibles

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/023,013 Continuation US10493143B2 (en) 2015-10-22 2018-06-29 Sexually transmitted disease vaccines
US18/306,082 Division US20230346907A1 (en) 2015-10-22 2023-04-24 Sexually transmitted disease vaccines

Publications (1)

Publication Number Publication Date
US20180289792A1 true US20180289792A1 (en) 2018-10-11

Family

ID=58558174

Family Applications (3)

Application Number Title Priority Date Filing Date
US15/767,600 Pending US20180289792A1 (en) 2015-10-22 2016-10-21 Sexually transmitted disease vaccines
US16/023,013 Active US10493143B2 (en) 2015-10-22 2018-06-29 Sexually transmitted disease vaccines
US18/306,082 Pending US20230346907A1 (en) 2015-10-22 2023-04-24 Sexually transmitted disease vaccines

Family Applications After (2)

Application Number Title Priority Date Filing Date
US16/023,013 Active US10493143B2 (en) 2015-10-22 2018-06-29 Sexually transmitted disease vaccines
US18/306,082 Pending US20230346907A1 (en) 2015-10-22 2023-04-24 Sexually transmitted disease vaccines

Country Status (7)

Country Link
US (3) US20180289792A1 (fr)
EP (1) EP3364982A4 (fr)
JP (1) JP2018531290A (fr)
AU (1) AU2016342376A1 (fr)
CA (1) CA3002819A1 (fr)
MA (1) MA45209A (fr)
WO (1) WO2017070616A2 (fr)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10383937B2 (en) 2015-10-22 2019-08-20 Modernatx, Inc. Human cytomegalovirus RNA vaccines
US10449244B2 (en) 2015-07-21 2019-10-22 Modernatx, Inc. Zika RNA vaccines
US10465190B1 (en) 2015-12-23 2019-11-05 Modernatx, Inc. In vitro transcription methods and constructs
US10485885B2 (en) 2015-12-10 2019-11-26 Modernatx, Inc. Compositions and methods for delivery of agents
US10493143B2 (en) 2015-10-22 2019-12-03 Modernatx, Inc. Sexually transmitted disease vaccines
US10517940B2 (en) 2015-10-22 2019-12-31 Modernatx, Inc. Zika virus RNA vaccines
US10526629B2 (en) 2017-08-18 2020-01-07 Modernatx, Inc. RNA polymerase variants
US10543269B2 (en) 2015-10-22 2020-01-28 Modernatx, Inc. hMPV RNA vaccines
US20200054737A1 (en) * 2017-04-26 2020-02-20 Modema TX, Inc. Herpes simplex virus vaccine
US10653767B2 (en) 2017-09-14 2020-05-19 Modernatx, Inc. Zika virus MRNA vaccines
US10653712B2 (en) 2016-09-14 2020-05-19 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
US10695419B2 (en) 2016-10-21 2020-06-30 Modernatx, Inc. Human cytomegalovirus vaccine
US10709779B2 (en) 2014-04-23 2020-07-14 Modernatx, Inc. Nucleic acid vaccines
WO2020163853A1 (fr) * 2019-02-08 2020-08-13 Rensselaer Polytechnic Institute Vaccin contraceptif basé sur le catsper de protéine associée au sperme
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10925958B2 (en) 2016-11-11 2021-02-23 Modernatx, Inc. Influenza vaccine
US11045540B2 (en) 2017-03-15 2021-06-29 Modernatx, Inc. Varicella zoster virus (VZV) vaccine
US20210252138A1 (en) * 2020-02-14 2021-08-19 Merck Sharp & Dohme Corp. Hpv vaccine
US11103578B2 (en) 2016-12-08 2021-08-31 Modernatx, Inc. Respiratory virus nucleic acid vaccines
CN114502204A (zh) * 2019-08-14 2022-05-13 库尔维科公司 具有降低的免疫刺激性质的rna组合和组合物
US11351242B1 (en) 2019-02-12 2022-06-07 Modernatx, Inc. HMPV/hPIV3 mRNA vaccine composition
US11364292B2 (en) 2015-07-21 2022-06-21 Modernatx, Inc. CHIKV RNA vaccines
US11406703B2 (en) 2020-08-25 2022-08-09 Modernatx, Inc. Human cytomegalovirus vaccine
US11464848B2 (en) * 2017-03-15 2022-10-11 Modernatx, Inc. Respiratory syncytial virus vaccine
US11485960B2 (en) 2019-02-20 2022-11-01 Modernatx, Inc. RNA polymerase variants for co-transcriptional capping
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US11576961B2 (en) 2017-03-15 2023-02-14 Modernatx, Inc. Broad spectrum influenza virus vaccine
US11643441B1 (en) 2015-10-22 2023-05-09 Modernatx, Inc. Nucleic acid vaccines for varicella zoster virus (VZV)
US11752206B2 (en) * 2017-03-15 2023-09-12 Modernatx, Inc. Herpes simplex virus vaccine
US11851694B1 (en) 2019-02-20 2023-12-26 Modernatx, Inc. High fidelity in vitro transcription

Families Citing this family (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017031232A1 (fr) 2015-08-17 2017-02-23 Modernatx, Inc. Procédés de préparation de particules et compositions associées
PT3350157T (pt) 2015-09-17 2022-03-18 Modernatx Inc Compostos e composições para administração intracelular de agentes terapêuticos
PL3368507T3 (pl) 2015-10-28 2023-03-27 Acuitas Therapeutics Inc. Nowe preparaty lipidów i nanocząstek lipidowych do dostarczania kwasów nukleinowych
US20190298657A1 (en) * 2016-05-18 2019-10-03 Modernatx, Inc. Polynucleotides Encoding Acyl-CoA Dehydrogenase, Very Long-Chain for the Treatment of Very Long-Chain Acyl-CoA Dehydrogenase Deficiency
KR102533456B1 (ko) 2016-05-18 2023-05-17 모더나티엑스, 인크. 릴랙신을 인코딩하는 폴리뉴클레오타이드
MA45052A (fr) * 2016-05-18 2019-03-27 Modernatx Inc Polynucléotides codant pour jagged1 pour le traitement du syndrome d'alagille
WO2017201347A1 (fr) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucléotides codant pour un régulateur de conductance transmembranaire de fibrose kystique pour le traitement de la fibrose kystique
US11384352B2 (en) 2016-12-13 2022-07-12 Modernatx, Inc. RNA affinity purification
WO2018151816A1 (fr) 2017-02-16 2018-08-23 Modernatx, Inc. Compositions immunogènes très puissantes
ES2911186T3 (es) 2017-03-15 2022-05-18 Modernatx Inc Formas cristalinas de aminolípidos
US11969506B2 (en) 2017-03-15 2024-04-30 Modernatx, Inc. Lipid nanoparticle formulation
MA47790A (fr) 2017-03-17 2021-05-05 Modernatx Inc Vaccins à base d'arn contre des maladies zoonotiques
US11905525B2 (en) 2017-04-05 2024-02-20 Modernatx, Inc. Reduction of elimination of immune responses to non-intravenous, e.g., subcutaneously administered therapeutic proteins
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations
CA3073020A1 (fr) 2017-08-16 2019-02-21 Acuitas Therapeutics, Inc. Lipides destines a etre utilises dans des formulations nanoparticulaires lipidiques
EP3668520A4 (fr) * 2017-08-17 2021-05-12 The Trustees Of The University Of Pennsylvania Vaccins à arnm modifiés codant pour des glycoprotéines du virus de l'herpès simplex et leurs utilisations
EP3668979A4 (fr) 2017-08-18 2021-06-02 Modernatx, Inc. Procédés pour analyse par clhp
EP3668977A4 (fr) 2017-08-18 2021-04-21 Modernatx, Inc. Procédés analytiques par hplc
EP3668522A4 (fr) * 2017-08-18 2021-04-21 Modernatx, Inc. Vaccins à base d'arnm efficaces
WO2019046809A1 (fr) 2017-08-31 2019-03-07 Modernatx, Inc. Procédés de fabrication de nanoparticules lipidiques
CA3079543A1 (fr) * 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides codant pour des sous-unites alpha et beta de propionyl-coa carboxylase pour le traitement de l'acidemie propionique
MA54676A (fr) 2018-01-29 2021-11-17 Modernatx Inc Vaccins à base d'arn contre le vrs
AR120080A1 (es) 2019-09-19 2022-02-02 Modernatx Inc Compuestos lipídicos de cola ramificada y composiciones para la administración intracelular de agentes terapéuticos
GB2594365B (en) 2020-04-22 2023-07-05 BioNTech SE Coronavirus vaccine
KR20230035576A (ko) * 2020-07-07 2023-03-14 비온테크 에스이 Hpv 양성 암 치료용 rna
TW202228769A (zh) 2020-11-24 2022-08-01 佳揚生物科技股份有限公司 用於人類乳突病毒的ｄｎａ疫苗及其使用方法
WO2022244815A1 (fr) * 2021-05-19 2022-11-24 第一三共株式会社 Vaccin contre des maladies infectieuses causées par le vph
CA3230031A1 (fr) 2021-09-03 2023-03-09 Patrick Baumhof Nouvelles nanoparticules lipidiques pour l'administration d'acides nucleiques
WO2023073228A1 (fr) 2021-10-29 2023-05-04 CureVac SE Arn circulaire amélioré pour exprimer des protéines thérapeutiques
WO2023144330A1 (fr) 2022-01-28 2023-08-03 CureVac SE Inhibiteurs de facteurs de transcription codés par un acide nucleique
GB2615784A (en) * 2022-02-18 2023-08-23 Phion Therapeutics Ltd mRNA vaccine
WO2023227608A1 (fr) 2022-05-25 2023-11-30 Glaxosmithkline Biologicals Sa Vaccin à base d'acide nucléique codant pour un polypeptide antigénique fimh d'escherichia coli
US11878055B1 (en) 2022-06-26 2024-01-23 BioNTech SE Coronavirus vaccine
WO2024089638A1 (fr) 2022-10-28 2024-05-02 Glaxosmithkline Biologicals Sa Vaccin à base d'acide nucléique

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010037539A1 (fr) * 2008-09-30 2010-04-08 Curevac Gmbh Composition comprenant un arn(m) complexé et un arnm nu destinée à fournir ou à améliorer une réponse immunostimulatrice chez un mammifère et ses utilisations
US20130156849A1 (en) * 2011-12-16 2013-06-20 modeRNA Therapeutics Modified nucleoside, nucleotide, and nucleic acid compositions
US10022435B2 (en) * 2014-04-23 2018-07-17 Modernatx, Inc. Nucleic acid vaccines

Family Cites Families (152)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990011092A1 (fr) 1989-03-21 1990-10-04 Vical, Inc. Expression de sequences de polynucleotides exogenes chez un vertebre
US6867195B1 (en) 1989-03-21 2005-03-15 Vical Incorporated Lipid-mediated polynucleotide administration to reduce likelihood of subject's becoming infected
FR2676072B1 (fr) 1991-05-03 1994-11-18 Transgene Sa Vecteur de delivrance d'arn.
EP0855184A1 (fr) 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Composition pharmaceutique comprenant un polynucléotide et un antigène notamment pour la vaccination
US6251665B1 (en) 1997-02-07 2001-06-26 Cem Cezayirli Directed maturation of stem cells and production of programmable antigen presenting dentritic cells therefrom
US6261281B1 (en) 1997-04-03 2001-07-17 Electrofect As Method for genetic immunization and introduction of molecules into skeletal muscle and immune cells
CA2305785A1 (fr) 1997-10-07 1999-04-15 University Of Maryland Biotechnology Institute Procede d'introduction et d'expression d'arn dans des cellules animales
US6432925B1 (en) 1998-04-16 2002-08-13 John Wayne Cancer Institute RNA cancer vaccine and methods for its use
CA2689696C (fr) 1999-02-26 2013-08-06 Novartis Vaccines And Diagnostics, Inc. Microemulsions a macromolecules et microparticules adsorbees
US6514948B1 (en) 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
EP1541690A3 (fr) 1999-09-09 2005-07-27 CureVac GmbH Transfer de mARN à l'aide de composés polycationiques
WO2001021810A1 (fr) 1999-09-17 2001-03-29 Aventis Pasteur Limited Antigenes de chlamydia, fragments d'adn correspondants et leurs utilisations
US7060291B1 (en) 1999-11-24 2006-06-13 Transave, Inc. Modular targeted liposomal delivery system
GB2367249B (en) * 2000-07-18 2004-06-23 Robert Patrick Hart Underwater breathing device
WO2002008435A1 (fr) 2000-07-21 2002-01-31 Glaxo Group Limited Sequences de papillomavirus a codon optimise
ATE376434T1 (de) 2001-04-21 2007-11-15 Curevac Gmbh Injektionsgerät für mrna applikation
EP2305699B1 (fr) 2001-06-05 2014-08-13 CureVac GmbH ARNm stabilisée avec un contenu augmenté en G/C et optimisée pour la translation dans ses zones codées pour la vaccination contre la trypanosomiase, la leishmaniose et la toxoplasmose
DE10162480A1 (de) 2001-12-19 2003-08-07 Ingmar Hoerr Die Applikation von mRNA für den Einsatz als Therapeutikum gegen Tumorerkrankungen
NZ573064A (en) 2002-04-04 2011-02-25 Coley Pharm Gmbh Immunostimulatory G,U-containing oligoribonucleotides
DE10229872A1 (de) 2002-07-03 2004-01-29 Curevac Gmbh Immunstimulation durch chemisch modifizierte RNA
DE60333035D1 (de) 2002-12-23 2010-07-29 Vical Inc Impfstoffe gegen infektionen mit dem humanen zytomegalivirus auf grundlage von codonoptimierten polynukleotiden
AU2004257214B2 (en) 2003-07-11 2010-04-22 Alphavax, Inc. Alphavirus-based cytomegalovirus vaccines
DE10347710B4 (de) 2003-10-14 2006-03-30 Johannes-Gutenberg-Universität Mainz Rekombinante Impfstoffe und deren Verwendung
DE102006007433A1 (de) 2006-02-17 2007-08-23 Curevac Gmbh Adjuvanz in Form einer Lipid-modifizierten Nukleinsäure
AU2007280690C1 (en) 2006-07-31 2012-08-23 Curevac Gmbh Nucleic acid of formula (I): GIXmGn, or (II): CIXmCn, in particular as an immune-stimulating agent/adjuvant
CN101148661B (zh) * 2006-09-18 2013-01-02 中国医学科学院基础医学研究所 人乳头瘤病毒16型外壳蛋白病毒样颗粒及其制备方法和用途
DE102006051516A1 (de) 2006-10-31 2008-05-08 Curevac Gmbh (Basen-)modifizierte RNA zur Expressionssteigerung eines Proteins
DE102007001370A1 (de) 2007-01-09 2008-07-10 Curevac Gmbh RNA-kodierte Antikörper
DK2154149T3 (da) * 2007-05-29 2019-10-14 Univ Xiamen En trunkeret l1-protein af human papillomavirus 6
WO2009030254A1 (fr) 2007-09-04 2009-03-12 Curevac Gmbh Complexes d'arn et de peptides cationiques pour transfection et immunostimulation
JP2011500569A (ja) 2007-10-12 2011-01-06 マサチューセッツ インスティテュート オブ テクノロジー ワクチンナノテクノロジー
WO2009127060A1 (fr) 2008-04-15 2009-10-22 Protiva Biotherapeutics, Inc. Nouvelles formulations lipidiques pour l'administration d'acides nucléiques
JP2012501965A (ja) 2008-06-16 2012-01-26 バインド バイオサイエンシズ インコーポレイテッド 薬剤を装填したポリマーナノ粒子及びその製造方法と使用方法
US9139554B2 (en) 2008-10-09 2015-09-22 Tekmira Pharmaceuticals Corporation Amino lipids and methods for the delivery of nucleic acids
EP3238738B1 (fr) 2008-11-10 2020-09-23 Arbutus Biopharma Corporation Nouveaux lipides et compositions d'administration d'agents thérapeutiques
WO2010057203A2 (fr) 2008-11-17 2010-05-20 The Board Of Regents Of The University Of Texas System Particules de hdl pour administration d'acides nucléiques
WO2010088927A1 (fr) 2009-02-09 2010-08-12 Curevac Gmbh Utilisation de pei pour l'amélioration de la libération endosomale et de l'expression d'acides nucléiques transfectés, complexés par des composés cationiques ou polycationiques
RU2600798C2 (ru) 2009-04-01 2016-10-27 Юниверсити Оф Майами Композиции вакцин и способы их применения
US8569256B2 (en) 2009-07-01 2013-10-29 Protiva Biotherapeutics, Inc. Cationic lipids and methods for the delivery of therapeutic agents
EP2451475A2 (fr) 2009-07-06 2012-05-16 Novartis AG Molécules d'arn autorépliquantes et leurs utilisations
WO2011069529A1 (fr) 2009-12-09 2011-06-16 Curevac Gmbh Solution contenant du mannose pour la lyophilisation, la transfection et/ou l'injection d'acides nucléiques
EP2387999A1 (fr) 2010-05-21 2011-11-23 CureVac GmbH Solution contenant de l'histidine pour la transfection et/ou l'injection d'acides nucléiques et utilisations associées
CA2804494A1 (fr) 2010-07-06 2012-01-12 Novartis Ag Particules d'administration de type virion pour des molecules d'arn auto-repliquant
US9192661B2 (en) 2010-07-06 2015-11-24 Novartis Ag Delivery of self-replicating RNA using biodegradable polymer particles
PL2590626T3 (pl) 2010-07-06 2016-04-29 Glaxosmithkline Biologicals Sa Liposomy z lipidami o korzystnej wartości pka do dostarczania rna
MX343410B (es) 2010-07-06 2016-11-04 Novartis Ag * Emulsiones cationicas de agua en aceite.
WO2012006369A2 (fr) 2010-07-06 2012-01-12 Novartis Ag Immunisation de grands mammifères à l'aide de faibles doses d'arn
SG186706A1 (en) 2010-07-30 2013-02-28 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
EP2600901B1 (fr) 2010-08-06 2019-03-27 ModernaTX, Inc. Compositions pharmaceutiques a base d'acides nucléiques modifiés et leur utilisation medicale
WO2012019630A1 (fr) 2010-08-13 2012-02-16 Curevac Gmbh Acide nucléique comprenant ou codant pour une tige-boucle d'histone et une séquence poly(a) ou un signal de polyadénylation pour augmenter l'expression d'une protéine codée
HRP20221048T1 (hr) 2010-08-31 2022-11-11 Glaxosmithkline Biologicals Sa Mali liposomi za isporuku rna koja kodira imunogen
LT3981427T (lt) 2010-08-31 2022-08-10 Glaxosmithkline Biologicals S.A. Pegilintos liposomos, skirtos imunogeną koduojančios rnr pristatymui
ES2727583T3 (es) 2010-08-31 2019-10-17 Glaxosmithkline Biologicals Sa Lípidos adecuados para la administración liposómica de ARN que codifica proteínas
ES2737960T3 (es) 2010-10-01 2020-01-17 Modernatx Inc Nucleósidos, nucleótidos y ácidos nucleicos modificados y sus usos
WO2012075040A2 (fr) 2010-11-30 2012-06-07 Shire Human Genetic Therapies, Inc. Arnm pour l'utilisation dans le traitement de maladies génétiques humaines
WO2012089225A1 (fr) 2010-12-29 2012-07-05 Curevac Gmbh Combinaison de vaccination et d'inhibition de la présentation des antigènes restreinte par le cmh de classe i
US20120189700A1 (en) 2011-01-19 2012-07-26 Zoraida Aguilar Nanoparticle Based Immunological Stimulation
WO2012116715A1 (fr) 2011-03-02 2012-09-07 Curevac Gmbh Vaccination chez des nouveaux-nés et des enfants en bas âge
WO2012113413A1 (fr) 2011-02-21 2012-08-30 Curevac Gmbh Composition de vaccin comprenant des acides nucléiques immunostimulateurs complexés et des antigènes emballés avec des conjugués de polyéthylèneglycol/peptide à liaison disulfure
WO2012116714A1 (fr) * 2011-03-02 2012-09-07 Curevac Gmbh Vaccination chez des patients âgés
AU2012236099A1 (en) 2011-03-31 2013-10-03 Moderna Therapeutics, Inc. Delivery and formulation of engineered nucleic acids
WO2012158736A1 (fr) 2011-05-17 2012-11-22 modeRNA Therapeutics Acides nucléiques manipulés et leurs procédés d'utilisation pour des vertébrés non humains
CN103857387B (zh) 2011-06-02 2017-03-15 加利福尼亚大学董事会 膜包封的纳米颗粒及使用方法
US11058762B2 (en) 2011-07-06 2021-07-13 Glaxosmithkline Biologicals Sa Immunogenic compositions and uses thereof
WO2013006837A1 (fr) 2011-07-06 2013-01-10 Novartis Ag Emulsions huile dans eau cationiques
CA2840989A1 (fr) 2011-07-06 2013-01-10 Novartis Ag Compositions de combinaisons immunogenes et utilisations de celles-ci
EP2729126B1 (fr) * 2011-07-06 2020-12-23 GlaxoSmithKline Biologicals SA Liposomes ayant un rapport n:p utile pour délivrance de molécules d'arn
CA3185394A1 (fr) 2011-09-02 2013-03-07 Arrowhead Pharmaceuticals, Inc. Compositions organiques de traitement de maladies associees a hsf1
EP3384938A1 (fr) 2011-09-12 2018-10-10 Moderna Therapeutics, Inc. Acides nucléiques techniques et leurs procédés d'utilisation
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
EP3682905B1 (fr) * 2011-10-03 2021-12-01 ModernaTX, Inc. Nucléosides, nucléotides et acides nucléiques modifiés et leurs utilisations
BR112014008694A2 (pt) 2011-10-11 2017-06-20 Novartis Ag moléculas de ácido nucleico policistrônico recombinante
SG11201401499XA (en) 2011-10-14 2014-09-26 Stc Unm Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery including transdermal delivery of cargo and methods thereof
EP3960726A1 (fr) 2011-10-18 2022-03-02 Dicerna Pharmaceuticals, Inc. Lipides cationiques aminés et utilisations associées
WO2013130161A1 (fr) 2011-12-14 2013-09-06 modeRNA Therapeutics Procédés de réponse à une menace biologique
WO2013113325A1 (fr) 2012-01-31 2013-08-08 Curevac Gmbh Complexes chargés négativement comprenant des acides nucléiques pour l'immunostimulation
US10501513B2 (en) 2012-04-02 2019-12-10 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9303079B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
AU2013243948A1 (en) 2012-04-02 2014-10-30 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with human disease
ES2719598T3 (es) 2012-05-25 2019-07-11 Curevac Ag Inmovilización reversible y/o liberación controlada de ácidos nucleicos contenidos en nanopartículas mediante revestimientos poliméricos (biodegradables)
MX2014015041A (es) * 2012-06-08 2015-06-17 Shire Human Genetic Therapies Administración pulmonar de arnm a células objetivo no pulmonares.
US9512456B2 (en) 2012-08-14 2016-12-06 Modernatx, Inc. Enzymes and polymerases for the synthesis of RNA
WO2014071963A1 (fr) 2012-11-09 2014-05-15 Biontech Ag Procédé pour l'expression d'arn cellulaire
JP6353846B2 (ja) 2012-11-09 2018-07-04 バイオエヌテック アーゲーＢｉｏＮＴｅｃｈ ＡＧ 細胞のｒｎａ発現方法
EP4074834A1 (fr) 2012-11-26 2022-10-19 ModernaTX, Inc. Arn à terminaison modifiée
EP2931319B1 (fr) 2012-12-13 2019-08-21 ModernaTX, Inc. Molécules d'acide nucléique modifiées et leurs utilisations
WO2014093574A1 (fr) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Polynucléotides modifiés pour modifier le phénotype cellulaire
RU2684211C2 (ru) * 2013-02-21 2019-04-04 Тёрнстоун Лимитед Партнершип Композиция вакцины
BR112015018989B1 (pt) 2013-02-22 2023-11-14 Curevac Ag Combinação de vacina/inibidor da via de pd-1, inibidor da via de pd-1 e vacina de rna
LT2970456T (lt) * 2013-03-14 2021-08-10 Translate Bio, Inc. Būdai ir kompozicijos, skirti mrnr koduojamų antikūnų pristatymui
WO2014160243A1 (fr) 2013-03-14 2014-10-02 The Trustees Of The University Of Pennsylvania Purification et évaluation de la pureté de molécules d'arn synthétisées comprenant des nucléosides modifiés
US10258698B2 (en) 2013-03-14 2019-04-16 Modernatx, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
EP2983804A4 (fr) 2013-03-15 2017-03-01 Moderna Therapeutics, Inc. Purification d'arnm par échange d'ions
ES2967701T3 (es) * 2013-03-15 2024-05-03 Translate Bio Inc Mejora sinergística de la entrega de ácidos nucleicos mediante formulaciones mezcladas
WO2014144039A1 (fr) 2013-03-15 2014-09-18 Moderna Therapeutics, Inc. Caractérisation de molécules d'arnm
WO2015013551A1 (fr) 2013-07-25 2015-01-29 Marshall Christopher Patrick Protéines f de pré-fusion rsv a stabilisation conformationnelle
AU2014310934B2 (en) 2013-08-21 2019-09-12 CureVac SE Respiratory syncytial virus (RSV) vaccine
WO2015024667A1 (fr) 2013-08-21 2015-02-26 Curevac Gmbh Procédé pour augmenter l'expression de protéines codées par l'arn
WO2015130584A2 (fr) * 2014-02-25 2015-09-03 Merck Sharp & Dohme Corp. Adjuvants de vaccins sous forme de nanoparticules lipidiques et systèmes d'administration d'antigènes
EP3888676A1 (fr) 2014-06-13 2021-10-06 GlaxoSmithKline Biologicals S.A. Combinaisons immunogènes
JP2017523777A (ja) 2014-07-17 2017-08-24 モデルナティエックス インコーポレイテッドＭｏｄｅｒｎａＴＸ，Ｉｎｃ． ポリヌクレオチドの末端修飾
WO2016164762A1 (fr) 2015-04-08 2016-10-13 Moderna Therapeutics, Inc. Polynucléotides codant pour des mutants, au niveau des domaines egf-a et intracellulaire, du récepteur des lipoprotéines basse densité et et leurs procédés d'utilisation
ES2746340T3 (es) 2015-04-22 2020-03-05 Curevac Ag Composición que contiene ARN para el tratamiento de enfermedades tumorales
JP2018526321A (ja) * 2015-04-27 2018-09-13 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 適応免疫応答を誘導するためのヌクレオシド修飾ｒｎａ
WO2016201377A1 (fr) 2015-06-10 2016-12-15 Moderna Therapeutics, Inc. Vaccins adaptatifs ciblés
JP7098330B2 (ja) * 2015-06-10 2022-07-11 ホオキパ バイオテック ジーエムビーエイチ Ｈｐｖワクチン
EP3310384A1 (fr) 2015-06-17 2018-04-25 CureVac AG Composition de vaccin
EP3324979B1 (fr) 2015-07-21 2022-10-12 ModernaTX, Inc. Vaccins contre une maladie infectieuse
WO2017015457A1 (fr) 2015-07-21 2017-01-26 Modernatx, Inc. Vaccin contre le virus ebola
US20190008938A1 (en) 2015-07-30 2019-01-10 Modernatx, Inc. Concatemeric peptide epitope rnas
WO2017019935A1 (fr) 2015-07-30 2017-02-02 Modernatx, Inc. Arnm multimérique
US20180237849A1 (en) 2015-08-17 2018-08-23 Modernatx, Inc. Rna mapping/fingerprinting
WO2017031232A1 (fr) 2015-08-17 2017-02-23 Modernatx, Inc. Procédés de préparation de particules et compositions associées
PT3350157T (pt) 2015-09-17 2022-03-18 Modernatx Inc Compostos e composições para administração intracelular de agentes terapêuticos
US10849920B2 (en) 2015-10-05 2020-12-01 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
WO2017066789A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm avec sucre modifié
EP4011451A1 (fr) 2015-10-22 2022-06-15 ModernaTX, Inc. Vaccins contre le virus respiratoire
EP3365007A4 (fr) 2015-10-22 2019-07-03 ModernaTX, Inc. Vaccin contre le virus de la grippe à large spectre
CA3002819A1 (fr) 2015-10-22 2017-04-27 Modernatx, Inc. Vaccins contre les maladies sexuellement transmissibles
SG10201914006UA (en) 2015-10-22 2020-03-30 Modernatx Inc Respiratory syncytial virus vaccine
EP3364981A4 (fr) 2015-10-22 2019-08-07 ModernaTX, Inc. Vaccin contre le cytomégalovirus humain
CA3002912A1 (fr) 2015-10-22 2017-04-27 Modernatx, Inc. Vaccins a base d'acide nucleique contre le virus varicelle-zona (vzv)
EP3364950A4 (fr) 2015-10-22 2019-10-23 ModernaTX, Inc. Vaccins contre des maladies tropicales
US20180303929A1 (en) 2015-10-22 2018-10-25 Moderna TX, Inc. Herpes simplex virus vaccine
CA3003090A1 (fr) 2015-10-22 2017-04-27 Modernatx, Inc. Vaccins anticancereux
EP3964200A1 (fr) 2015-12-10 2022-03-09 ModernaTX, Inc. Compositions et procédés permettant d'administrer des agents thérapeutiques
EP3458106A4 (fr) 2016-05-18 2020-03-18 Modernatx, Inc. Polynucléotides codant pour la lipoprotéine lipase destinés au traitement de l'hyperlipidémie
WO2017201347A1 (fr) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucléotides codant pour un régulateur de conductance transmembranaire de fibrose kystique pour le traitement de la fibrose kystique
MA45052A (fr) 2016-05-18 2019-03-27 Modernatx Inc Polynucléotides codant pour jagged1 pour le traitement du syndrome d'alagille
KR102533456B1 (ko) 2016-05-18 2023-05-17 모더나티엑스, 인크. 릴랙신을 인코딩하는 폴리뉴클레오타이드
CN116837052A (zh) 2016-09-14 2023-10-03 摩登纳特斯有限公司 高纯度rna组合物及其制备方法
JP6980780B2 (ja) 2016-10-21 2021-12-15 モデルナティーエックス， インコーポレイテッド ヒトサイトメガロウイルスワクチン
JP2019532657A (ja) 2016-10-26 2019-11-14 モデルナティーエックス， インコーポレイテッド 免疫応答を増強するためのメッセンジャーリボ核酸及びその使用方法
EP3532613A4 (fr) 2016-10-26 2020-05-06 ModernaTX, Inc. Méthodes et compositions pour le mappage d'arn
AU2017350488B2 (en) 2016-10-26 2022-06-23 Acuitas Therapeutics Inc. Lipid nanoparticle mRNA vaccines
US10925958B2 (en) 2016-11-11 2021-02-23 Modernatx, Inc. Influenza vaccine
US11103578B2 (en) 2016-12-08 2021-08-31 Modernatx, Inc. Respiratory virus nucleic acid vaccines
US11384352B2 (en) 2016-12-13 2022-07-12 Modernatx, Inc. RNA affinity purification
US20180243225A1 (en) 2017-01-25 2018-08-30 Modernatx, Inc. Ebola/marburg vaccines
WO2018144082A1 (fr) 2017-02-01 2018-08-09 Modernatx, Inc. Vaccins anticancéreux à arn
EP3577221A4 (fr) 2017-02-01 2020-12-23 ModernaTX, Inc. Structure secondaire de polynucléotide
WO2018151816A1 (fr) 2017-02-16 2018-08-23 Modernatx, Inc. Compositions immunogènes très puissantes
MA47787A (fr) 2017-03-15 2020-01-22 Modernatx Inc Vaccin contre le virus respiratoire syncytial
US11752206B2 (en) 2017-03-15 2023-09-12 Modernatx, Inc. Herpes simplex virus vaccine
MA52262A (fr) 2017-03-15 2020-02-19 Modernatx Inc Vaccin à large spectre contre le virus de la grippe
US11045540B2 (en) 2017-03-15 2021-06-29 Modernatx, Inc. Varicella zoster virus (VZV) vaccine
MA47790A (fr) 2017-03-17 2021-05-05 Modernatx Inc Vaccins à base d'arn contre des maladies zoonotiques
WO2018175783A1 (fr) 2017-03-22 2018-09-27 Modernatx, Inc. Vaccins antibactériens à arn
US11905525B2 (en) 2017-04-05 2024-02-20 Modernatx, Inc. Reduction of elimination of immune responses to non-intravenous, e.g., subcutaneously administered therapeutic proteins
US20200054737A1 (en) 2017-04-26 2020-02-20 Modema TX, Inc. Herpes simplex virus vaccine
WO2018232355A1 (fr) 2017-06-15 2018-12-20 Modernatx, Inc. Anticorps d'arn
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010037539A1 (fr) * 2008-09-30 2010-04-08 Curevac Gmbh Composition comprenant un arn(m) complexé et un arnm nu destinée à fournir ou à améliorer une réponse immunostimulatrice chez un mammifère et ses utilisations
US20130156849A1 (en) * 2011-12-16 2013-06-20 modeRNA Therapeutics Modified nucleoside, nucleotide, and nucleic acid compositions
US10022435B2 (en) * 2014-04-23 2018-07-17 Modernatx, Inc. Nucleic acid vaccines

Cited By (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10709779B2 (en) 2014-04-23 2020-07-14 Modernatx, Inc. Nucleic acid vaccines
US10702597B2 (en) 2015-07-21 2020-07-07 Modernatx, Inc. CHIKV RNA vaccines
US10449244B2 (en) 2015-07-21 2019-10-22 Modernatx, Inc. Zika RNA vaccines
US11364292B2 (en) 2015-07-21 2022-06-21 Modernatx, Inc. CHIKV RNA vaccines
US11007260B2 (en) 2015-07-21 2021-05-18 Modernatx, Inc. Infectious disease vaccines
US11484590B2 (en) 2015-10-22 2022-11-01 Modernatx, Inc. Human cytomegalovirus RNA vaccines
US10543269B2 (en) 2015-10-22 2020-01-28 Modernatx, Inc. hMPV RNA vaccines
US10383937B2 (en) 2015-10-22 2019-08-20 Modernatx, Inc. Human cytomegalovirus RNA vaccines
US11235052B2 (en) 2015-10-22 2022-02-01 Modernatx, Inc. Chikungunya virus RNA vaccines
US11643441B1 (en) 2015-10-22 2023-05-09 Modernatx, Inc. Nucleic acid vaccines for varicella zoster virus (VZV)
US11278611B2 (en) 2015-10-22 2022-03-22 Modernatx, Inc. Zika virus RNA vaccines
US10675342B2 (en) 2015-10-22 2020-06-09 Modernatx, Inc. Chikungunya virus RNA vaccines
US10493143B2 (en) 2015-10-22 2019-12-03 Modernatx, Inc. Sexually transmitted disease vaccines
US10702600B1 (en) 2015-10-22 2020-07-07 Modernatx, Inc. Betacoronavirus mRNA vaccine
US11872278B2 (en) 2015-10-22 2024-01-16 Modernatx, Inc. Combination HMPV/RSV RNA vaccines
US10702599B2 (en) 2015-10-22 2020-07-07 Modernatx, Inc. HPIV3 RNA vaccines
US10517940B2 (en) 2015-10-22 2019-12-31 Modernatx, Inc. Zika virus RNA vaccines
US10716846B2 (en) 2015-10-22 2020-07-21 Modernatx, Inc. Human cytomegalovirus RNA vaccines
US10933127B2 (en) 2015-10-22 2021-03-02 Modernatx, Inc. Betacoronavirus mRNA vaccine
US11285222B2 (en) 2015-12-10 2022-03-29 Modernatx, Inc. Compositions and methods for delivery of agents
US10485885B2 (en) 2015-12-10 2019-11-26 Modernatx, Inc. Compositions and methods for delivery of agents
US10556018B2 (en) 2015-12-10 2020-02-11 Modernatx, Inc. Compositions and methods for delivery of agents
US10465190B1 (en) 2015-12-23 2019-11-05 Modernatx, Inc. In vitro transcription methods and constructs
US11202793B2 (en) 2016-09-14 2021-12-21 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
US10653712B2 (en) 2016-09-14 2020-05-19 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
US10695419B2 (en) 2016-10-21 2020-06-30 Modernatx, Inc. Human cytomegalovirus vaccine
US11197927B2 (en) 2016-10-21 2021-12-14 Modernatx, Inc. Human cytomegalovirus vaccine
US11541113B2 (en) 2016-10-21 2023-01-03 Modernatx, Inc. Human cytomegalovirus vaccine
US10925958B2 (en) 2016-11-11 2021-02-23 Modernatx, Inc. Influenza vaccine
US11696946B2 (en) 2016-11-11 2023-07-11 Modernatx, Inc. Influenza vaccine
US11103578B2 (en) 2016-12-08 2021-08-31 Modernatx, Inc. Respiratory virus nucleic acid vaccines
US11464848B2 (en) * 2017-03-15 2022-10-11 Modernatx, Inc. Respiratory syncytial virus vaccine
US11045540B2 (en) 2017-03-15 2021-06-29 Modernatx, Inc. Varicella zoster virus (VZV) vaccine
US11918644B2 (en) * 2017-03-15 2024-03-05 Modernatx, Inc. Varicella zoster virus (VZV) vaccine
US11752206B2 (en) * 2017-03-15 2023-09-12 Modernatx, Inc. Herpes simplex virus vaccine
US11576961B2 (en) 2017-03-15 2023-02-14 Modernatx, Inc. Broad spectrum influenza virus vaccine
US20220409720A1 (en) * 2017-03-15 2022-12-29 Modernatx, Inc. Varicella zoster virus (vzv) vaccine
US20200054737A1 (en) * 2017-04-26 2020-02-20 Modema TX, Inc. Herpes simplex virus vaccine
US11066686B2 (en) 2017-08-18 2021-07-20 Modernatx, Inc. RNA polymerase variants
US10526629B2 (en) 2017-08-18 2020-01-07 Modernatx, Inc. RNA polymerase variants
US11767548B2 (en) 2017-08-18 2023-09-26 Modernatx, Inc. RNA polymerase variants
US10653767B2 (en) 2017-09-14 2020-05-19 Modernatx, Inc. Zika virus MRNA vaccines
US11207398B2 (en) 2017-09-14 2021-12-28 Modernatx, Inc. Zika virus mRNA vaccines
WO2020163853A1 (fr) * 2019-02-08 2020-08-13 Rensselaer Polytechnic Institute Vaccin contraceptif basé sur le catsper de protéine associée au sperme
US11351242B1 (en) 2019-02-12 2022-06-07 Modernatx, Inc. HMPV/hPIV3 mRNA vaccine composition
US11485960B2 (en) 2019-02-20 2022-11-01 Modernatx, Inc. RNA polymerase variants for co-transcriptional capping
US11851694B1 (en) 2019-02-20 2023-12-26 Modernatx, Inc. High fidelity in vitro transcription
CN114502204A (zh) * 2019-08-14 2022-05-13 库尔维科公司 具有降低的免疫刺激性质的rna组合和组合物
US11638754B2 (en) * 2020-02-14 2023-05-02 Merck Sharp & Dohme Llc HPV vaccine
US20210252138A1 (en) * 2020-02-14 2021-08-19 Merck Sharp & Dohme Corp. Hpv vaccine
US11406703B2 (en) 2020-08-25 2022-08-09 Modernatx, Inc. Human cytomegalovirus vaccine
US11622972B2 (en) 2021-02-19 2023-04-11 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same

Also Published As

Publication number Publication date
EP3364982A4 (fr) 2019-04-17
EP3364982A2 (fr) 2018-08-29
WO2017070616A2 (fr) 2017-04-27
JP2018531290A (ja) 2018-10-25
US20180296662A1 (en) 2018-10-18
CA3002819A1 (fr) 2017-04-27
MA45209A (fr) 2019-04-17
US10493143B2 (en) 2019-12-03
AU2016342376A1 (en) 2018-06-07
WO2017070616A3 (fr) 2017-07-27
US20230346907A1 (en) 2023-11-02

Similar Documents

Publication Publication Date Title
US20230346907A1 (en) Sexually transmitted disease vaccines
US11918644B2 (en) Varicella zoster virus (VZV) vaccine
US20230374079A1 (en) Nucleic acid vaccines for varicella zoster virus (vzv)
US11484590B2 (en) Human cytomegalovirus RNA vaccines
US11752206B2 (en) Herpes simplex virus vaccine
US20230114180A1 (en) Respiratory syncytial virus vaccine
US20220096626A1 (en) Human cytomegalovirus vaccine
AU2016342049B2 (en) Herpes simplex virus vaccine
US20200054737A1 (en) Herpes simplex virus vaccine
US20240156952A1 (en) Herpes simplex virus vaccine

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

AS Assignment

Owner name: MODERNATX, INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CIARAMELLA, GIUSEPPE;HIMANSU, SUNNY;SIGNING DATES FROM 20180608 TO 20180622;REEL/FRAME:048404/0250

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED