US20120101108A1 - Anaplastic Lymphoma Kinase In Kidney Cancer - Google Patents
Anaplastic Lymphoma Kinase In Kidney Cancer Download PDFInfo
- Publication number
- US20120101108A1 US20120101108A1 US13/204,342 US201113204342A US2012101108A1 US 20120101108 A1 US20120101108 A1 US 20120101108A1 US 201113204342 A US201113204342 A US 201113204342A US 2012101108 A1 US2012101108 A1 US 2012101108A1
- Authority
- US
- United States
- Prior art keywords
- alk
- polypeptide
- kidney cancer
- kinase activity
- mammalian kidney
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/415—1,2-Diazoles
- A61K31/4162—1,2-Diazoles condensed with heterocyclic ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/4545—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the invention relates generally to proteins and genes involved in cancer (e.g., kidney cancer), and to the detection, diagnosis and treatment of cancer.
- cancer e.g., kidney cancer
- Aberrant expression of protein kinase proteins can be the causative agent of (and the driver of) cancer. Aberrant expression can be caused by the fusion of the protein (or kinase portion thereof) with a secondary protein (or portion there), expression of a truncated portion of the protein, or by abnormal regulation of expression of the full-length protein.
- the BCR-ABL oncoprotein which is found in at least 90-95% of CML cases, is generated by the translocation of gene sequences from the c-ABL protein tyrosine kinase on chromosome 9 into BCR sequences on chromosome 22, producing the so-called Philadelphia chromosome. See, e.g. Kurzock et al., N. Engl. J. Med. 319: 990-998 (1988). The translocation is also observed in acute lymphocytic leukemia (ALL) and acute myeloid leukemia (AML) cases.
- ALL acute lymphocytic leukemia
- AML acute myeloid leukemia
- identification of such proteins will, among other things, desirably enable new methods for selecting patients for targeted therapies, as well as for the screening and development of new drugs that inhibit such proteins and, thus, treat cancer.
- the invention is based on the discovery of ALK kinase in kidney cancer cells. This unexpected discovery enables methods to detect, treat, and cure kidney cancers driven by ALK kinase activity.
- the invention provides a method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer.
- the method includes (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a detection molecule selected from the group consisting of a reagent that detects ALK kinase activity, a reagent that detects a polypeptide with ALK kinase activity, and a reagent that detects to a polynucleotide encoding the polypeptide with ALK kinase activity, and (c) detecting reaction of the detection molecule with the biological sample, wherein reaction of the detection molecule with the biological sample indicates said polypeptide with ALK kinase activity is present or active in said mammalian kidney cancer or suspected mammalian kidney cancer.
- a detection molecule selected
- the invention provides a method for identifying a mammalian kidney cancer or suspected mammalian kidney cancer that belongs to a subset of kidney cancers driven by ALK kinase activity, said method comprising the steps of (a) contacting a biological sample obtained from a mammalian kidney cancer or suspected mammalian kidney cancer with at least one detection molecule selected from the group consisting of a reagent that detects ALK kinase activity, a reagent that detects a polypeptide with ALK kinase activity, and a reagent that detects to a polynucleotide encoding the polypeptide with ALK kinase activity, and (b) detecting reaction of the detection molecule with said biological sample, wherein the reaction of the detection molecule with said biological sample indicates that said mammalian kidney cancer or suspected mammalian kidney cancer is driven by ALK kinase activity.
- the invention provides method for determining whether a compound inhibits the progression of a mammalian kidney cancer or suspected mammalian kidney cancer driven by a polypeptide with ALK kinase activity, said method comprising the step of determining whether said compound inhibits the expression and/or activity of said polypeptide in said cancer mammalian kidney cancer or suspected mammalian kidney cancer.
- the invention provides a method for inhibiting the progression of a mammalian kidney cancer or suspected mammalian kidney cancer driven by polypeptide with ALK kinase activity, comprising inhibiting the expression and/or activity of said polypeptide in said mammalian kidney cancer or suspected mammalian kidney cancer.
- the invention provides a method for treating a mammalian patient with mammalian kidney cancer or suspected mammalian kidney cancer driven by a polypeptide with ALK kinase activity, said method comprising the step of administering a composition comprising a therapeutically effective amount of a composition comprising an ALK-inhibiting therapeutic to the mammalian patient.
- the invention provides a method for treating a patient having a mammalian kidney cancer or suspected mammalian kidney cancer comprising the steps of: (a) detecting the presence or activity of said polypeptide with ALK kinase activity a biological sample of the mammalian kidney cancer or suspected mammalian kidney cancer of the patient; and (b) administering a composition comprising an ALK-inhibiting therapeutic to the patient.
- the patient is a human.
- the method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer comprising the steps of: (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a reagent that detects ALK kinase activity, wherein detection of ALK kinase activity by the reagent in the biological sample indicates said polypeptide with ALK kinase activity is present in said biological sample.
- the method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer comprises the steps of: (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a reagent that detects a polypeptide with ALK kinase activity, wherein detection of said polypeptide in said biological sample indicates said polypeptide with ALK kinase activity is present in said biological sample.
- the method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer comprises the steps of: (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a reagent that detects a polynucleotide encoding the polypeptide with ALK kinase activity, wherein detection of said polynucleotide in said biological sample indicates said polypeptide with ALK kinase activity is present in said biological sample.
- the inhibition of the expression and/or activity of the polypeptide is determined using a reagent that detects ALK kinase activity, a reagent that detects a polypeptide with ALK kinase activity, or a reagent that detects to a polynucleotide encoding the polypeptide with ALK kinase activity.
- the detection molecule is detectably labeled.
- the mammalian kidney cancer or suspected mammalian kidney cancer in which the presence or activity of said polypeptide with ALK kinase activity is detected is identified as a mammalian kidney cancer or suspected mammalian kidney cancer belonging to a subset of kidney cancers driven by ALK kinase activity.
- the mammalian kidney cancer or suspected mammalian kidney cancer in which the presence or activity of said polypeptide with ALK kinase activity is detected is identified as a mammalian kidney cancer or suspected mammalian kidney cancer likely to respond to an ALK-inhibiting therapeutic.
- the polypeptide with ALK kinase activity is aberrantly expressed full-length ALK protein.
- the polypeptide with ALK kinase activity is an ALK fusion polypeptide comprising at least a portion of a first fusion member and at least a portion of a second fusion member, wherein the second fusion member is an ALK protein comprises an ALK kinase domain.
- the portion of the ALK protein in some embodiments, is an NPM polypeptide, a ALO17 polypeptide, a TFG polypeptide, a MSN polypeptide, a TPM3 polypeptide, a TPM4 polypeptide, an ATIC polypeptide, a MYH9 polypeptide, a CLTC polypeptide, a SEC31L1 polypeptide, an RANBP2 polypeptide, a CARS polypeptide, an EML4 polypeptide, a KIF5B polypeptide, or a VCL polypeptide.
- the ALK fusion polypeptide is an NPM-ALK fusion polypeptide, an ALO17-ALK fusion polypeptide, an MSN-ALK fusion polypeptide, an TPM3-ALK fusion polypeptide, an TPM4-ALK fusion polypeptide, an ATIC-ALK fusion polypeptide, an MYH9-ALK fusion polypeptide, an CLTC-ALK fusion polypeptide, an SEC31L1-ALK fusion polypeptide, an RANBP2-ALK fusion polypeptide, an CARS-ALK fusion polypeptide, an EML4-ALK fusion polypeptide, an KIF5B-ALK fusion polypeptide, a TFG-ALK fusion polypeptide, or a VCL-ALK fusion polypeptide.
- the polypeptide with ALK kinase activity is a truncated ALK polypeptide.
- the reagent that detects ALK kinase activity is a substrate of ALK.
- the method is implemented in an in vitro kinase assay format.
- the method is implemented in an immunological assay employing a phosphorylated tyrosine-specific binding agent (e.g., an antibody that specifically binds to phosphorylated tyrosine residues).
- the reagent that detects a polypeptide with ALK kinase activity is a reagent that specifically binds to the polypeptide.
- the reagent that specifically binds to the polypeptide is an antibody.
- the reagent that specifically binds to the polypeptide is an AQUA peptide.
- the antibody specifically binds to a full length ALK protein.
- the reagent that detects a polypeptide with ALK kinase activity is reagent that specifically binds the ALK fusion polypeptide.
- the reagent that specifically binds to the ALK fusion polypeptide is an antibody.
- the reagent that specifically binds to the ALK fusion polypeptide is an AQUA peptide.
- the antibody specifically binds to the portion of the ALK protein present in the ALK fusion, to the portion of the first fusion member present in the ALK fusion, or to a junction between the first fusion member and the portion of the ALK protein present in the ALK fusion.
- the method is implemented in a flow cytometry assay format, an immunohistochemistry (IHC) assay format, an immunofluorescence (IF) assay format, an Enzyme-linked immunosorbent assay (ELISA) assay format, a Western blotting analysis assay format, or a mass spectrometry assay format.
- IHC immunohistochemistry
- IF immunofluorescence
- ELISA Enzyme-linked immunosorbent assay
- Western blotting analysis assay format or a mass spectrometry assay format.
- the reagent that detects a polynucleotide encoding the polypeptide with ALK kinase activity is a nucleic acid molecule that hybridizes to said polynucleotide.
- the nucleic acid molecule hybridizes to the polynucleotide under stringent conditions.
- the nucleic acid molecule is a polymerase chain reaction (PCR) probe, a fluorescence in situ hybridization (FISH) probe, or a Southern blotting probe.
- the method is implemented in a polymerase chain reaction (PCR) assay format, a in situ hybridization (ISH) assay format, or a Southern blotting assay format.
- the mammalian kidney cancer or suspected mammalian kidney cancer is a granular cell cancer or a squamous cell cancer.
- the mammalian kidney cancer or suspected mammalian kidney cancer is from a mammal.
- the mammalian kidney cancer or suspected mammalian kidney cancer is from a human.
- the biological sample is a circulating tumor cell from said mammalian kidney cancer or suspected mammalian kidney cancer.
- the biological sample is a tissue biopsy or a fine needle aspirate from said mammalian kidney cancer or suspected mammalian kidney cancer.
- a patient from whom said biological sample is obtained is diagnosed as having a mammalian kidney cancer or suspected mammalian kidney cancer driven by the polypeptide with ALK kinase activity.
- the patient is administered pharmaceutical composition comprising an ALK-inhibiting therapeutic (e.g., PF-02341066, NVT TAE-684, AP26113, CEP-14083, CEP-14513, CEP11988, WHI-P131 or WHI-P154).
- an ALK-inhibiting therapeutic e.g., PF-02341066, NVT TAE-684, AP26113, CEP-14083, CEP-14513, CEP11988, WHI-P131 or WHI-P154.
- the expression and/or activity of the polypeptide with ALK kinase activity is inhibited with a composition comprising an ALK-inhibiting therapeutic.
- the ALK-inhibiting therapeutic is PF-02341066 (also known as crizotinib).
- the ALK-inhibiting therapeutic is NVT TAE-684, AP26113, or CEP-14083, CEP-14513, CEP11988, WHI-P131 and WHI-P154.
- the invention provides methods for diagnosing kidney cancer in a patient (also referred to as a subject).
- the methods comprise obtaining a biological sample from a subject suspected of having kidney cancer, obtaining a control biological sample from a normal individual not suspected of having kidney cancer, measuring the level of expression and/or activity of a polypeptide with ALK kinase activity or polynucleotide encoding a polypeptide with ALK kinase activity in the biological sample and control biological sample using a detection device, generating a database of the detected levels of expression and/or activity of said polypeptide with ALK kinase activity or polynucleotide in the biological sample and control biological sample, and obtaining a report from the database of the detection device wherein a higher level of expression and/or activity of the polypeptide with ALK kinase activity or polynucleotide in the biological sample relative to the control biological sample is correlated to a kidney cancer diagnosis.
- the kidney cancer is likely to respond to treatment
- the polynucleotide encoding a polypeptide with ALK kinase activity is an mRNA or cDNA encoding full-length ALK protein or encoding an ALK fusion polypeptide, including a ALK fusion polypeptide comprising the intra-cellular domain of ALK, the tyrosine kinase domain of ALK, or the C-terminal domain of ALK.
- Detecting of the mRNA can be performed by any method including, for example, by RT-PCR or Northern blot analysis.
- the polypeptide with ALK kinase activity can be detected by an antibody specific for the intracellular domain of ALK, including an antibody that does not cross-react with c-Met, and an antibody that is specific for the tyrosine kinase domain of ALK.
- polypeptide with ALK kinase activity can be detected using a reagent that is specific for an ALK fusion polypeptide comprising amino acids 1376-1620 of full length ALK (where full length ALK is 1620 amino acids and is set forth in SEQ ID NO: 2), amino acid residues 1504-1507 of full length ALK, or amino acid residues 1603-1606 of full length ALK.
- the ALK fusion polypeptide is selected from the group consisting of VCL-ALK, EML4-ALK, NPM-ALK, TPM3-ALK, TFG-ALK, ATIC-ALK, CLTC-ALK, MSN-ALK, TPM4-ALK, ALO17-ALK, RANBP2-ALK, MYH9-ALK, CARS-ALK, SEC31L1-ALK, and KIF5B-ALK.
- the invention provides methods for treating a kidney cancer in a patient (also referred to as a subject).
- the methods comprise obtaining a biological sample from a patient suspected of having kidney cancer, obtaining a control biological sample from a normal individual not suspected of having kidney cancer, detecting a level of expression and/or activity of a polypeptide with ALK kinase activity in the biological sample and the control biological sample and treating the subject with an ALK inhibitor if the level of expression and/or activity of the polypeptide with ALK kinase activity in the biological sample is greater than the level of expression and/or activity of the polypeptide with ALK kinase activity in the control biological sample.
- the invention provides methods for diagnosing kidney cancer in a subject comprising obtaining a biological sample from a patient suspected of having kidney cancer and determining whether a polypeptide with ALK kinase activity or polynucleotide encoding the same is present in the biological sample.
- the invention also provides methods for treating a kidney cancer in a patient comprising obtaining a biological sample from a patient suspected of having kidney cancer, determining whether a polypeptide with ALK kinase activity or polynucleotide encoding the same is present in the biological sample and treating the patient with an ALK inhibitor if the polypeptide with ALK kinase activity or polynucleotide encoding the same is present.
- FIG. 1 is an immunohistochemical representation demonstrating ALK-specific monoclonal antibody staining of squamous cell carcinoma of the kidney.
- FIG. 2 is an immunohistochemical representation demonstrating ALK-specific monoclonal antibody staining of granular cell carcinoma of the kidney.
- FIG. 3 is an image (with the inset showing a expanded view of the cell immediately to the upper right of the inset) depicting the detection of ALK by FISH assay employing a dual-color (orange/green) break-apart probe specific to the ALK locus in kidney squamous cells.
- the yellow arrows point to orange/green signals either immediately adjacent to each other or fused together confirming the presence of the 2p23 ALK region in its native state.
- the red arrows point to a rearranged ALK locus. Images were taken at 100 ⁇ magnification with digital zoom inset.
- FIG. 4A depicts a Western blot of MDCK cell lysates probed with antibodies directed to pMet Y1234/5 antibody (Cell Signaling Technology, Inc., Danvers, Mass.; Catalog #3077), Met (25H2) mouse monoclonal antibody (Cell Signaling Technology #3127), pALK Y1278/82/83 antibody (Cell Signaling Technology, #3983), ALK (D5F3) XP®RmAb (Cell Signaling Technology #3633), and Beta Actin (Cell Signaling Technology #4970) after a 1 second exposure.
- pMet Y1234/5 antibody Cell Signaling Technology, Inc., Danvers, Mass.; Catalog #3077
- Met 25H2 mouse monoclonal antibody
- pALK Y1278/82/83 antibody Cell Signaling Technology, #3983
- ALK D5F3 XP®RmAb
- Beta Actin Cell Signaling Technology #4970
- the lanes represented MDCK serum starved overnight (lane 1), MDCK serum starved overnight, followed by HGF stimulation (50 ng/ml) for 5 minutes (lane 2), MDCK serum starved overnight, then serum starved over 24 hours (lane 3), MDCK serum starved followed by HGF stimulation (50 ng/ml) for 24 hours (lane 4), H3122 cells (positive control for ALK (EML4-ALK v1))(lane 5), and MKN45 cells (positive control for pMet)(lane 6) are depicted.
- FIG. 4B depicts a Western blot of MDCK cell lysates probed with antibodies directed to pMet Y1234/5 antibody (Cell Signaling Technology, #3077), Met (25H2) mouse monoclonal antibody (Cell Signaling Technology, #3127), pALK Y1278/82/83 antibody (Cell Signaling Technology #3983), ALK (D5F3) XP®RmAb (Cell Signaling Technology #3633), and Beta Actin (Cell Signaling Technology #4970) after a 15 second exposure.
- the lanes represented MDCK serum starved overnight (lane 1), MDCK serum starved overnight, followed by HGF stimulation (50 ng/ml) for 5 minutes (lane 2), MDCK serum starved overnight, then serum starved over 24 hours (lane 3), MDCK serum starved followed by HGF stimulation (50 ng/ml) for 24 hours (lane 4), H3122 cells (positive control for ALK (EML4-ALK v1))(lane 5), and MKN45 cells (positive control for pMet)(lane 6) are depicted.
- the invention is based upon the unexpected discovery of ALK kinase in human kidney cancer.
- ALK kinase is not known to be expressed in normal kidney tissue and cells, the presence of ALK kinase (and ALK kinase activity) is expected to drive the proliferation and survival of the subset of kidney cancer in which it is expressed.
- Such kidney cancers may be identified (e.g., diagnosed) and/or treated in accordance with the teachings provided herein.
- kidney cancer or suspected kidney cancer expresses a polypeptide with ALK activity where healthy patients (i.e., non-cancerous patients) do not express such proteins with ALK activity in their normal kidney tissue may respond favorably to administration of an ALK inhibitor (e.g., the growth of the kidney cancer may slow or stop as compared to an untreated patient suffering from the same cancer).
- an ALK inhibitor e.g., the growth of the kidney cancer may slow or stop as compared to an untreated patient suffering from the same cancer.
- the invention provides a method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer.
- the method includes (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a detection molecule selected from the group consisting of a reagent that detects ALK kinase activity, a reagent that detects a polypeptide with ALK kinase activity, and a reagent that detects to a polynucleotide encoding the polypeptide with ALK kinase activity, and (c) detecting reaction of the detection molecule with the biological sample, wherein reaction of the detection molecule with the biological sample indicates said polypeptide with ALK kinase activity is present or active in said mammalian kidney cancer or suspected mammalian kidney cancer.
- the invention provides a method for identifying a mammalian kidney cancer or suspected mammalian kidney cancer that belongs to a subset of kidney cancers driven by ALK kinase activity, said method comprising the steps of (a) contacting a biological sample obtained from a mammalian kidney cancer or suspected mammalian kidney cancer with at least one detection molecule selected from the group consisting of a reagent that detects ALK kinase activity, a reagent that detects a polypeptide with ALK kinase activity, and a reagent that detects to a polynucleotide encoding the polypeptide with ALK kinase activity, and (b) detecting reaction of the detection molecule with said biological sample, wherein the reaction of the detection molecule with said biological sample indicates that said mammalian kidney cancer or suspected mammalian kidney cancer is driven by ALK kinase activity.
- the invention provides method for determining whether a compound inhibits the progression of a mammalian kidney cancer or suspected mammalian kidney cancer driven by a polypeptide with ALK kinase activity, said method comprising the step of determining whether said compound inhibits the expression and/or activity of said polypeptide in said cancer mammalian kidney cancer or suspected mammalian kidney cancer.
- the invention provides a method for inhibiting the progression of a mammalian kidney cancer or suspected mammalian kidney cancer driven by polypeptide with ALK kinase activity, comprising inhibiting the expression and/or activity of said polypeptide in said mammalian kidney cancer or suspected mammalian kidney cancer.
- the invention provides a method for treating a mammalian patient with mammalian kidney cancer or suspected mammalian kidney cancer driven by a polypeptide with ALK kinase activity, said method comprising the step of administering a composition comprising a therapeutically effective amount of a composition comprising an ALK-inhibiting therapeutic to the mammalian patient.
- the invention provides a method for treating a patient having a mammalian kidney cancer or suspected mammalian kidney cancer comprising the steps of: (a) detecting the presence or activity of said polypeptide with ALK kinase activity a biological sample of the mammalian kidney cancer or suspected mammalian kidney cancer of the patient; and (b) administering a composition comprising an ALK-inhibiting therapeutic to the patient.
- the patient is a human.
- reaction as in the reaction of the detection molecule with a biological sample is meant that the detection molecule is detecting its target in the biological sample.
- the nature of the reaction will, of course, depend upon the type of detection molecule used.
- the methods of the invention include the use of detection molecules that may be reagents that detect ALK kinase activity (e.g., a phosphotyrosine-specific antibody that detects phosphorylation of an ALK substrate or detecting autophosphorylation of ALK). In this case, detection of reaction may be made by detecting specific binding of the phosphotyrosine-specific antibody to the biological sample.
- the methods of the invention also include the use of detection molecules that may be reagents that detect a polypeptide with ALK kinase activity (e.g., an antibody that specifically binds the polypeptide). In this case, detection of reaction may be made by detecting specific binding of the polypeptide with ALK kinase activity-specific antibody to the biological sample.
- detection molecules that may be reagents that detect a polynucleotide that encodes a polypeptide with ALK kinase activity (e.g., a nucleic acid probe that hybridizes to an exonic or intronic sequence from a portion of the ALK gene that encodes the ALK kinase domain). In this case, detection of reaction may be made by detecting hybridization (e.g., under stringent conditions) of the probe to the biological sample.
- the various aspects and embodiments of the invention are based on the discovery of ALK in cancerous cells in the kidney.
- ALK Anaplastic Lymphoma Kinase
- ALK is a receptor tyrosine kinase. This protein (which is 1620 amino acids long in humans) has a transmembrane domain in the central part and has a carboxyl-terminal tyrosine kinase region and an amino-terminal extracellular domain (Oncogene. 1997 Jan. 30; 14 (4): 439-49). See Pulford et al., Journal of Cellular Physiology, 199:330-358, 2004 for a comprehensive review relating to ALK.
- ALK sequence is disclosed in U.S. Pat. No. 5,770,421.
- full-length ALK protein expression has been detected in the brain and central nervous system, and has been reported in the small intestine and testis (see, e.g., Morris et al., Oncogene 14:2175-2188, 1997).
- the amino acid sequence of full length human ALK cDNA and protein is provided herein as SEQ ID NOs: 1 and 2, respectively.
- SEQ ID NOs: 1 and 2 As shown in Table 1, the signal peptide, extracellular, transmembrane, and kinase domains of ALK are found at the following amino acid residues in SEQ ID NO: 2:
- polypeptide sequence of exon 20 onward of the ALK is included herein as SEQ ID NO: 15.
- the polypeptide sequence of the ALK protein starting with the transmembrane domain and including the rest of the C′ terminal portion of the protein is set forth in amino acid residues 1060-1620 of SEQ ID NO: 2.
- polypeptide refers to a polymer formed from the linking, in a defined order, of preferably, ⁇ -amino acids, D-, L-amino acids, and combinations thereof.
- the link between one amino acid residue and the next is referred to as an amide bond or a peptide bond.
- Non-limiting examples of polypeptides include an oligopeptide, peptide, or protein sequence, and fragments or portions thereof, and naturally occurring or synthetic molecules (e.g., peptide synthesized by artificial means).
- Polypeptides also include derivatized molecules such as glycoproteins and lipoproteins as well as lower molecular weight polypeptides.
- amino acid sequence and like terms, such as “polypeptide” or “protein”, are not meant to limit the indicated amino acid sequence to the complete, naturally-occurring amino acid sequence associated with the recited polypeptide molecule. Accordingly, the term “polypeptide” also includes variants of the recited polypeptide that do not vary significantly from the structure or function of the recited polypeptide. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity (e.g. the kinase domain of ALK polypeptide). In general, it is possible to replace residues that form the tertiary structure, provided that residues performing a similar function are used. In other instances, the type of residue may be completely unimportant if the alteration occurs at a non-critical region of the protein.
- biological sample refers to saliva, cells, mucous, tears, blood, serum, lymph/interstitial fluids, buccal cells, mucosal cells, cerebrospinal fluid, semen, feces, plasma, urine, marrow, a suspension of cells, or a suspension of cells and viruses or extracts or any of the foregoing, and may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern analysis), RNA (in solution or bound to a solid support such as for northern analysis), cDNA (in solution or bound to a solid support) obtainable from any mammal (e.g., a human), such as a normal mammal or a mammal having or suspected of having kidney cancer.
- a biological sample is mammalian (e.g., human) and is a biopsy sample or a blood sample including a
- the biological sample comprises cells obtained from a tumor biopsy.
- the biopsy may be obtained, according to standard clinical techniques, from primary tumors occurring in an organ of a mammal, or by secondary tumors that have metastasized in other tissues.
- the biological sample comprises cells obtained from a fine needle aspirate taken from a tumor, and techniques for obtaining such aspirates are well known in the art (see Cristallini et al., Acta Cytol. 36(3): 416-22 (1992)).
- the biological sample comprises circulating tumor cells.
- Circulating tumor cells (“CTCs”) may be purified, for example, using the kits and reagents sold under the trademarks Vita-AssaysTM, Vita-CapTM, and CellSearch® (commercially available from Vitatex, LLC (a Johnson and Johnson corporation). Other methods for isolating CTCs are described (see, for example, PCT Publication No. WO/2002/020825, Cristofanilli et al., New Engl. J. of Med. 351 (8):781-791 (2004), and Adams et al., J. Amer. Chem. Soc. 130(27): 8633-8641 (July 2008)).
- a circulating tumor cell (“CTC”) may be isolated and identified as having originated from the kidney.
- the invention provides a method for isolating a CTC, and then screening the CTC one or more assay formats to identify the presence of a polypeptide with ALK kinase activity a polynucleotide encoding the same in the CTC.
- Some non-limiting assay formats include Western blotting analysis, flow-cytometry (FC), immuno-histochemistry (IHC), immuno-fluorescence (IF), in situ hybridization (ISH), fluorescence in situ hybridization (FISH), and polymerase chain reaction (PCR).
- a CTC from a patient that is identified as comprising a polypeptide with ALK kinase activity or polynucleotide encoding the same may indicate that the patient's originating cancer (e.g., a kidney cancer such as an squamous kidney cancer cell or a granular kidney cancer cell) is likely to respond to a composition comprising at least one ALK kinase-inhibiting therapeutic.
- a kidney cancer such as an squamous kidney cancer cell or a granular kidney cancer cell
- Bio samples useful in the practice of the methods of the invention may be obtained from any mammal in which a cancer driven by polypeptide with ALK kinase activity is or might be present or developing.
- the mammal (e.g., from which the mammalian kidney cancer or suspected mammalian kidney cancer originates) is a human, and the human may be a candidate for an ALK-inhibiting therapeutic for the treatment of cancer driven by a polypeptide with ALK kinase activity.
- the human candidate may be a patient currently being treated with, or considered for treatment with, an ALK-inhibiting therapeutic or other kinase-inhibiting therapeutic (e.g., Tarceva®).
- the mammal is large animal, such as a horse or cow, while in other embodiments, the mammal is a small animal, such as a dog or cat, all of which are known to develop kidney cancer.
- the biological sample comprises cells obtained from a tumor biopsy.
- the biopsy may be obtained, according to standard clinical techniques, from primary tumors occurring in an organ of a mammal, or by secondary tumors that have metastasized in other tissues.
- the biological sample comprises cells obtained from a fine needle aspirate taken from a tumor by methods well known in the art (see Cristallini et al., Acta Cytol. 36(3): 416-22 (1992)).
- Cellular extracts of the foregoing biological samples may be prepared, either crude or partially (or entirely) purified, in accordance with standard techniques, and used in the various methods of the invention.
- biological samples comprising whole cells may be utilized in assay formats such as immunohistochemistry (IHC), flow cytometry (FC), and immunofluorescence (IF), as further described herein.
- IHC immunohistochemistry
- FC flow cytometry
- IF immunofluorescence
- whole-cell assays are advantageous in that they minimize manipulation of the tumor cell sample and thus reduce the risks of altering the in vivo signaling/activation state of the cells and/or introducing artifact signals.
- Whole cell assays are also advantageous because they characterize expression and signaling only in tumor cells, rather than a mixture of tumor and normal cells.
- polypeptide having ALK kinase activity is meant any protein or polypeptide (or fusion or fragment thereof) that retains the signaling properties of a full length ALK protein (i.e., retains ALK kinase activity).
- polypeptides having ALK kinase activity include, without limitation, full-length ALK protein, portions of ALK comprising the kinase domain of ALK protein, truncated forms of ALK which retain ALK kinase activity (e.g., a truncated ALK polypeptide comprising the ALK kinase domain without the extracellular or transmembrane domain of full-length ALK) and all other ALK polypeptides, which may or may not be fused with other polypeptides, that retain their ALK biological activity and/or tyrosine kinase activity.
- ALK polypeptides having ALK kinase activity include, without limitation, full-length ALK protein, portions of ALK comprising the kinase domain of ALK protein, truncated forms of ALK which retain ALK kinase activity (e.g., a truncated ALK polypeptide comprising the ALK kinase domain without the extra
- ALK may be derived from any species, such as mammalian, including bovine, ovine, porcine, murine, equine, and human, and may be derived from any source whether natural, synthetic, semi-synthetic, or recombinant.
- the human full length ALK protein is set forth in SEQ ID NO: 2. Persons of skill in the art would be readily able to determine corresponding sequences in non-human mammalian ALK homologues.
- the polypeptide with ALK kinase activity is aberrantly expressed full-length ALK protein.
- aberrantly expressed full-length ALK polypeptide is meant that full length ALK is expressed in a cell of the kidney or kidney tissue of a cancer or suspected cancer patient where, in the same cell or tissue type of a normal individual, full-length ALK is not expressed.
- Such aberrant expression may be due to, for example, mutations in regulatory sequences (such the promoter, enhancer, or intronic genomic sequences) operably linked to exons encoding amino acids of full-length ALK polypeptide which result in aberrant expression of full-length ALK polypeptide in the cell bearing the mutation. Numerous examples of aberrantly expressed ALK kinase have been found in other cancers.
- ALK polypeptide domain For example, point mutations within the kinase domain have been found in neuroblastoma and overexpression of ALK has been found in numerous cancers (including, e.g., retinoblastoma, breast cancer, and melanoma). See review in Palmer et al., Biochem. J. 420(3): 345-361 (May 2009), herein incorporated by reference in its entirety.
- Aberrant expression (e.g., overexpression) of full length ALK polypeptide in a cancer may be the result of amplification of the ALK gene in the cancer cell's genome.
- the polypeptide with ALK kinase activity is an ALK fusion polypeptide comprising at least a portion of a first fusion member and at least a portion of a second fusion member, wherein the second fusion member is an ALK protein comprises an ALK kinase domain.
- ALK fusion polypeptide refers to a portion or fragment of the ALK protein fused to at least a portion or fragment of another protein.
- the portion of ALK protein present in an ALK fusion polypeptide comprises the kinase domain of full-length ALK protein.
- the portions of the ALK present in an ALK fusion polypeptide comprise amino acids encoded by exon 20 onward of an ALK-encoding gene.
- an ALK fusion polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 3.
- an ALK fusion polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 4.
- an ALK fusion polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 15.
- An ALK fusion polypeptide often results from a chromosomal translocation or inversion.
- ALK fusion polypeptides include VCL-ALK, EML4-ALK, NPM-ALK, TPM3-ALK, TFG-ALK, ATIC-ALK, CLTC-ALK, MSN-ALK, TPM4-ALK, ALO17-ALK, RANBP2-ALK, MYH9-ALK, CARS-ALK, SEC31L1-ALK, and KIF5B-ALK (see, e.g., Debelenko et al., Modern Pathology 24: 430-442, 2011; Marino-Enriquez et al., Genes, Chromosome, and Cancer 50(3): 146-153, 2011; Palmer et al., Biochem.
- ALK fusions have multiple variants, all of which are considered ALK fusions and, thus, are included in the definition of mutant ALK of the invention. For example, there are multiple variants of TFG-ALK (see, e.g., Hernandez et al., Amer.
- the amino acid at the fusion junction may appear in either full-length protein member of the fusion, or the amino acid, being created by a codon with nucleotides from fused exons and/or of both protein members, may be unique to the fusion polypeptide and not appear in either full-length protein member of the fusion.
- a “portion” or “fragment” means a sequence fragment less than the whole sequence.
- a 50 nucleotide sequence is a portion of a 100 nucleotide long sequence.
- a 50 amino acid residue long sequence is a portion of a 100 amino acid long sequence.
- a nucleic acid fragment or portion comprises at least 20 nucleotides, or at least 30 nucleotides, or at least 45 nucleotides, or at least 60 nucleotides, or at least 70 nucleotides, or at least 90 nucleotides.
- a polypeptide fragment or portion comprises at least 6 amino acid residues, or at least 10 amino acid residues, or at least 20 amino acid residues, or at least 30 amino acid residues, or at least 45 amino acid residues, or at least 60 amino acid residues, or at least 70 amino acid residues, or at least 90 amino acid residues.
- the ALK fusion polypeptide contains the complete ALK tyrosine kinase domain located at amino acids 1116-1392 of ALK (SEQ ID NO: 3). In another embodiment, the ALK fusion polypeptide contains the complete intracytoplasmic domain located at amino acids 1060-1620 of ALK (SEQ ID NO: 4). In another embodiment, the ALK fusion polypeptide contains amino acid residues 1504-1507 (SEQ ID NO:5) of ALK making up the phosphotyrosine-binding site of the C-terminal domain of ALK.
- the ALK fusion polypeptide contains amino acid residues 1603-1606 (SEQ ID NO:6) of ALK representing the interaction site for the phosphotyrosine-dependent binding of the substrate phospholipase C- ⁇ (PLC- ⁇ ).
- ALK is not known to be expressed in normal kidney cells
- the presence or activity of a polypeptide with ALK kinase activity in mammalian kidney cancer or suspected mammalian kidney cancer is, in accordance with the invention, identified as a mammalian kidney cancer or suspected mammalian kidney cancer belonging to a subset of kidney cancers driven by ALK kinase activity.
- drive or “driven” is meant that a mammalian kidney cancer or suspected mammalian kidney cancer has gained its cancerous state because of the presence within the cells of the mammalian kidney cancer or suspected mammalian kidney cancer of a polypeptide with ALK kinase activity.
- Such a presence may be detected by detecting the presence of a polynucleotide encoding the polypeptide with ALK kinase activity (e.g., detecting a gene translocation involving the ALK gene and another gene or detecting a mutation in the promoter of the ALK gene that would result in aberrant expression of full-length ALK polypeptide), detecting the polypeptide with ALK kinase activity, or by detecting ALK kinase activity of the polypeptide with ALK kinase activity.
- the presence of a polypeptide with ALK kinase activity stimulates or is the causative agent of the cancerous state of the mammalian kidney cancer or suspected mammalian kidney cancer.
- cancer or “cancerous” is meant a cell that shows abnormal growth as compared to a normal (i.e., non-cancerous) cell of the same cell type.
- a cancerous cell may be hyperplastic, anaplastic, metastatic, or benign (but shows abnormal growth).
- a cancerous cell may also show lack of contact inhibition where a normal cell of that same cell type shows contact inhibition.
- the activity of a polypeptide with ALK kinase activity is detected using as a detection molecule a reagent that detects ALK kinase activity.
- ALK kinase activity Numerous reagents can be employed that detect ALK kinase activity.
- substrates of ALK kinase are known (see, e.g., Donella-Deana et al., Biochemistry 44(23):8533-8542, 2005; Simonitsch et al., FASEB J 15:1416-1418, 2001; and the Poly(Glu:Tyr) 4:1 substrate commercially available from Sigma-Aldrich (St. Louis, Mo.; Catalog No. P-0275)).
- substrates can be added to standard in vitro kinase assays and their phosphorylation on tyrosine determined (using, e.g., a phosphotyrosine-specific antibody such as the 4G10 antibody commercially available from Millipore, Bedford, Mass. or the P-Tyr-100 antibody (Catalog No. 9411) commercially available from Cell Signaling Technology, Inc., Danvers, Mass.
- a phosphotyrosine-specific antibody such as the 4G10 antibody commercially available from Millipore, Bedford, Mass. or the P-Tyr-100 antibody (Catalog No. 9411) commercially available from Cell Signaling Technology, Inc., Danvers, Mass.
- the reagent that detects ALK kinase activity may itself be a phosphotyrosine-specific antibody that binds to tyrosine-phosphorylated ALK protein.
- ALK kinase activity is detected in an in vitro kinase assay format.
- In vitro kinase assays have been well known for many years (see, e.g., Ausubel et al., supra; Hernandez et al., Blood 94: 3265-3268, 1999). Indeed, in vitro kinase services for detecting ALK kinase activity are commercially available (from ProQinase GmbH, Freiburg, Germany).
- the method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer comprises the steps of: (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a reagent that detects a polypeptide with ALK kinase activity, wherein detection of said polypeptide in said biological sample indicates said polypeptide with ALK kinase activity is present in said biological sample.
- the expression of a polypeptide with ALK kinase activity is detected using as a detection molecule a reagent that detects a polypeptide with ALK kinase activity.
- the reagent specifically binds to a polypeptide with ALK kinase activity.
- binding means that a reagent that may be used in the various methods of the invention (e.g., an antibody or AQUA peptide) interacts with its target molecule (e.g., a polypeptide with ALK kinase activity such as a full-length ALK polypeptide or a ALK fusion polypeptide), where the interaction is dependent upon the presence of a particular structure (e.g., the antigenic determinant or epitope on the polypeptide or the nucleotide sequence of the polynucleotide); in other words, the reagent is recognizing and binding to a specific polypeptide or polynucleotide structure rather than to all polypeptides or polynucleotides in general.
- binding fragment thereof means a fragment or portion of a reagent that specifically binds the target molecule (e.g., an Fab fragment of an antibody).
- a reagent that specifically binds to the target molecule may be referred to as a target-specific reagent or an anti-target reagent.
- a target-specific reagent or an anti-target reagent an antibody that specifically binds to a NPM-ALK polypeptide may be referred to as a NPM-ALK-specific antibody or an anti-NPM-ALK antibody.
- an antibody that specifically binds to the full length ALK polypeptide may be referred to as an ALK-specific antibody or an anti-ALK antibody.
- a reagent that specifically binds its target molecule has a binding affinity (K D ) for its target molecule (e.g., an ALK fusion polypeptide) of 1 ⁇ 10 ⁇ 6 M or less.
- a reagent that specifically binds to its target molecule binds to its target molecule with a K D of 1 ⁇ 10 ⁇ 7 M or less, or a K D of 1 ⁇ 10 ⁇ 8 M or less, or a K D of 1 ⁇ 10 ⁇ 9 M or less, or a K D of 1 ⁇ 10 ⁇ 10 M or less, of a K D of 1 ⁇ 10 ⁇ 11 M or less, of a K D of 1 ⁇ 10 ⁇ 12 M or less.
- a reagent that specifically binds to its target molecule binds to its target molecule with a K D of 1 pM to 500 pM, or between 500 pM to 1 ⁇ M, or between 1 ⁇ M to 100 nM, or between 100 mM to 10 nM.
- a reagent that specifically binds to a polypeptide with ALK kinase activity is a heavy-isotope labeled peptide (i.e., an AQUA peptide).
- an AQUA peptide may be suitable for the absolute quantification of an expressed polypeptide with ALK kinase activity in a biological sample.
- the term “heavy-isotope labeled peptide” is used interchangeably with “AQUA peptide”.
- the production and use of AQUA peptides for the absolute quantification or detection of proteins (AQUA) in complex mixtures has been described. See PCT Publication No. WO/03016861 and also Gerber et al., Proc.
- the term “specifically detects” with respect to such an AQUA peptide means the peptide will only detect and quantify polypeptides and proteins that contain the AQUA peptide sequence and will not substantially detect polypeptides and proteins that do not contain the AQUA peptide sequence.
- AQUA internal peptide standards may desirably be produced to detect any quantify any unique site (e.g., the fusion junction within an ALK fusion polypeptide) within a polypeptide with ALK kinase activity.
- the AQUA methodology employs the introduction of a known quantity of at least one heavy-isotope labeled peptide standard (which has a unique signature detectable by LC-SRM chromatography) into a digested biological sample in order to determine, by comparison to the peptide standard, the absolute quantity of a peptide with the same sequence and protein modification in the biological sample.
- the AQUA methodology has two stages: peptide internal standard selection and validation and method development; and implementation using validated peptide internal standards to detect and quantify a target protein in sample.
- the method is a powerful technique for detecting and quantifying a given peptide/protein within a complex biological mixture, such as a cell lysate, and may be employed, e.g., to quantify change in protein phosphorylation as a result of drug treatment, or to quantify differences in the level of a protein in different biological states.
- a particular peptide (or modified peptide) within a target protein sequence is chosen based on its amino acid sequence and the particular protease to be used to digest.
- the peptide is then generated by solid-phase peptide synthesis such that one residue is replaced with that same residue containing stable isotopes ( 13 C, 15 N).
- the result is a peptide that is chemically identical to its native counterpart formed by proteolysis, but is easily distinguishable by MS via a 7-Da mass shift.
- the newly synthesized AQUA internal standard peptide is then evaluated by LC-MS/MS. This process provides qualitative information about peptide retention by reverse-phase chromatography, ionization efficiency, and fragmentation via collision-induced dissociation. Informative and abundant fragment ions for sets of native and internal standard peptides are chosen and then specifically monitored in rapid succession as a function of chromatographic retention to form a selected reaction monitoring (LC-SRM) method based on the unique profile of the peptide standard.
- the second stage of the AQUA strategy is its implementation to measure the amount of a protein or modified protein from complex mixtures.
- Whole cell lysates are typically fractionated by SDS-PAGE gel electrophoresis, and regions of the gel consistent with protein migration are excised. This process is followed by in-gel proteolysis in the presence of the AQUA peptides and LC-SRM analysis. (See Gerber et al., supra.)
- AQUA peptides are spiked in to the complex peptide mixture obtained by digestion of the whole cell lysate with a proteolytic enzyme and subjected to immunoaffinity purification as described above.
- the retention time and fragmentation pattern of the native peptide formed by digestion is identical to that of the AQUA internal standard peptide determined previously; thus, LC-MS/MS analysis using an SRM experiment results in the highly specific and sensitive measurement of both internal standard and analyte directly from extremely complex peptide mixtures.
- the ratio of the areas under the curve can be used to determine the precise expression levels of a protein or phosphorylated form of a protein in the original cell lysate.
- the internal standard is present during in-gel digestion as native peptides are formed, such that peptide extraction efficiency from gel pieces, absolute losses during sample handling (including vacuum centrifugation), and variability during introduction into the LC-MS system do not affect the determined ratio of native and AQUA peptide abundances.
- An AQUA peptide standard is developed for a known sequence previously identified by the IAP-LC-MS/MS method within in a target protein. If the site is modified, one AQUA peptide incorporating the modified form of the particular residue within the site may be developed, and a second AQUA peptide incorporating the unmodified form of the residue developed. In this way, the two standards may be used to detect and quantify both the modified an unmodified forms of the site in a biological sample.
- Peptide internal standards may also be generated by examining the primary amino acid sequence of a protein and determining the boundaries of peptides produced by protease cleavage.
- a protein may actually be digested with a protease and a particular peptide fragment produced can then sequenced.
- Suitable proteases include, but are not limited to, serine proteases (e.g. trypsin, hepsin), metallo proteases (e.g., PUMP1), chymotrypsin, cathepsin, pepsin, thermolysin, carboxypeptidases, etc.
- a peptide sequence within a target protein is selected according to one or more criteria to optimize the use of the peptide as an internal standard.
- the size of the peptide is selected to minimize the chances that the peptide sequence will be repeated elsewhere in other non-target proteins.
- a peptide is preferably at least about 6 amino acids.
- the size of the peptide is also optimized to maximize ionization frequency.
- the peptide is not longer than about 20 amino acids.
- the peptide is between about 7 to 15 amino acids in length.
- a peptide sequence is also selected that is not likely to be chemically reactive during mass spectrometry, thus sequences comprising cysteine, tryptophan, or methionine are avoided.
- a peptide sequence that does not include a modified region of the target region may be selected so that the peptide internal standard can be used to determine the quantity of all forms of the protein.
- a peptide internal standard encompassing a modified amino acid may be desirable to detect and quantify only the modified form of the target protein.
- Peptide standards for both modified and unmodified regions can be used together, to determine the extent of a modification in a particular sample (i.e. to determine what fraction of the total amount of protein is represented by the modified form).
- peptide standards for both the phosphorylated and unphosphorylated form of a protein known to be phosphorylated at a particular site can be used to quantify the amount of phosphorylated form in a sample.
- the peptide is labeled using one or more labeled amino acids (i.e., the label is an actual part of the peptide) or less preferably, labels may be attached after synthesis according to standard methods.
- the label is a mass-altering label selected based on the following considerations: The mass should be unique to shift fragments masses produced by MS analysis to regions of the spectrum with low background; the ion mass signature component is the portion of the labeling moiety that preferably exhibits a unique ion mass signature in MS analysis; the sum of the masses of the constituent atoms of the label is preferably uniquely different than the fragments of all the possible amino acids.
- the labeled amino acids and peptides are readily distinguished from unlabeled ones by the ion/mass pattern in the resulting mass spectrum.
- the ion mass signature component imparts a mass to a protein fragment that does not match the residue mass for any of the 20 natural amino acids.
- the label should be robust under the fragmentation conditions of MS and not undergo unfavorable fragmentation. Labeling chemistry should be efficient under a range of conditions, particularly denaturing conditions, and the labeled tag preferably remains soluble in the MS buffer system of choice.
- the label preferably does not suppress the ionization efficiency of the protein and is not chemically reactive.
- the label may contain a mixture of two or more isotopically distinct species to generate a unique mass spectrometric pattern at each labeled fragment position.
- Stable isotopes such as 2 H, 13 C, 15 N, 17 O, 18 O, or 34 S, are some non-limiting labels. Pairs of peptide internal standards that incorporate a different isotope label may also be prepared. Non-limiting amino acid residues into which a heavy isotope label may be incorporated include leucine, proline, valine, and phenylalanine.
- Peptide internal standards are characterized according to their mass-to-charge (m/z) ratio, and preferably, also according to their retention time on a chromatographic column (e.g., an HPLC column). Internal standards that co-elute with unlabeled peptides of identical sequence are selected as optimal internal standards.
- the internal standard is then analyzed by fragmenting the peptide by any suitable means, for example by collision-induced dissociation (CID) using, e.g., argon or helium as a collision gas.
- CID collision-induced dissociation
- the fragments are then analyzed, for example by multi-stage mass spectrometry (MS n ) to obtain a fragment ion spectrum, to obtain a peptide fragmentation signature.
- MS n multi-stage mass spectrometry
- peptide fragments have significant differences in m/z ratios to enable peaks corresponding to each fragment to be well separated, and a signature is that is unique for the target peptide is obtained. If a suitable fragment signature is not obtained at the first stage, additional stages of MS are performed until a unique signature is obtained.
- Fragment ions in the MS/MS and MS 3 spectra are typically highly specific for the peptide of interest, and, in conjunction with LC methods, allow a highly selective means of detecting and quantifying a target peptide/protein in a complex protein mixture, such as a cell lysate, containing many thousands or tens of thousands of proteins.
- a complex protein mixture such as a cell lysate, containing many thousands or tens of thousands of proteins.
- Any biological sample potentially containing a target protein/peptide of interest may be assayed. Crude or partially purified cell extracts are preferably employed.
- the sample has at least 0.01 mg of protein, typically a concentration of 0.1-10 mg/mL, and may be adjusted to a desired buffer concentration and pH.
- a known amount of a labeled peptide internal standard, preferably about 10 femtomoles, corresponding to a target protein to be detected/quantified is then added to a biological sample, such as a cell lysate.
- the spiked sample is then digested with one or more protease(s) for a suitable time period to allow digestion.
- a separation is then performed (e.g. by HPLC, reverse-phase HPLC, capillary electrophoresis, ion exchange chromatography, etc.) to isolate the labeled internal standard and its corresponding target peptide from other peptides in the sample.
- Microcapillary LC is a one non-limiting method.
- Each isolated peptide is then examined by monitoring of a selected reaction in the MS. This involves using the prior knowledge gained by the characterization of the peptide internal standard and then requiring the MS to continuously monitor a specific ion in the MS/MS or MS n spectrum for both the peptide of interest and the internal standard. After elution, the area under the curve (AUC) for both peptide standard and target peptide peaks are calculated. The ratio of the two areas provides the absolute quantification that can be normalized for the number of cells used in the analysis and the protein's molecular weight, to provide the precise number of copies of the protein per cell. Further details of the AQUA methodology are described in PCT Publication No. WO/03016861 and Gerber et al. supra.
- a reagent that specifically binds to a polypeptide with ALK kinase activity is an antibody.
- the antibody is specific for (i.e., specifically binds to) full length ALK polypeptide.
- the antibody does not cross-react with (i.e., does not specifically bind to) c-Met.
- the antibody is specific for the kinase domain of ALK.
- the antibody is specific for the extracellular domain of ALK.
- the antibody specifically binds to the portion of ALK polypeptide that is fused to the portion of ALK kinase present in the ALK fusion polypeptide.
- the fusion is EML4-ALK (the 796 variant)
- the antibody specifically binds to the portion of the ALK protein (e.g., the ALK kinase domain) present in the fusion.
- the antibody specifically binds to the portion of the fusion partner that is fused to the portion of ALK kinase present in the ALK fusion polypeptide.
- the fusion is EML4-ALK (the 796 variant)
- the antibody specifically binds to the N-terminus of the EML4 protein present in the fusion.
- antibody refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD, and IgE, including binding fragments thereof (i.e., fragments of an antibody that are capable of specifically binding to the antibody's target molecule, such as F ab , and F(ab′) 2 fragments), as well as recombinant, humanized, polyclonal, and monoclonal antibodies and/or binding fragments thereof.
- Antibodies of the invention can be derived from any species of animal, such as from a mammal.
- Non-limiting exemplary natural antibodies include antibodies derived from human, chicken, goats, and rodents (e.g., rats, mice, hamsters and rabbits), including transgenic rodents genetically engineered to produce human antibodies (see, e.g., Lonberg et al., WO93/12227; U.S. Pat. No. 5,545,806; and Kucherlapati, et al., WO91/10741; U.S. Pat. No. 6,150,584, which are herein incorporated by reference in their entirety).
- Antibodies of the invention may be also be chimeric antibodies. See, e.g., M. Walker et al., Molec. Immunol.
- the antibodies may be recombinant monoclonal antibodies produced according to known methods (see, e.g., U.S. Pat. Nos. 4,474,893; 4,816,567; 7,485,291, and US Patent Publication No. 20110045534).
- the antibodies may also be chemically constructed specific antibodies made according to the method disclosed in U.S. Pat. No. 4,676,980.
- Natural antibodies are the antibodies produced by a host animal, however the invention contemplates also genetically altered antibodies wherein the amino acid sequence has been varied from that of a native antibody. Because of the relevance of recombinant DNA techniques to this application, one need not be confined to the sequences of amino acids found in natural antibodies; antibodies can be redesigned to obtain desired characteristics. The possible variations are many and range from the changing of just one or a few amino acids to the complete redesign of, for example, the variable or constant region. Changes in the constant region will, in general, be made in order to improve or alter characteristics, such as complement fixation, interaction with membranes and other effector functions. Changes in the variable region will be made in order to improve the antigen binding characteristics.
- oligoclonal antibodies refers to a predetermined mixture of distinct monoclonal antibodies. See, e.g., PCT publication WO 95/20401; U.S. Pat. Nos. 5,789,208 and 6,335,163. In one embodiment, oligoclonal antibodies consisting of a predetermined mixture of antibodies against one or more epitopes are generated in a single cell.
- oligoclonal antibodies comprise a plurality of heavy chains capable of pairing with a common light chain to generate antibodies with multiple specificities (e.g., PCT publication WO 04/009618). Oligoclonal antibodies are particularly useful when it is desired to target multiple epitopes on a single target molecule. In view of the assays and epitopes disclosed herein, those skilled in the art can generate or select antibodies or mixtures of antibodies that are applicable for an intended purpose and desired need.
- Recombinant antibodies are also included in the present invention. These recombinant antibodies have the same amino acid sequence as the natural antibodies or have altered amino acid sequences of the natural antibodies. They can be made in any expression systems including both prokaryotic and eukaryotic expression systems or using phage display methods (see, e.g., Dower et al., WO91/17271 and McCafferty et al., WO92/01047; U.S. Pat. No. 5,969,108, which are herein incorporated by reference in their entirety). Antibodies can be engineered in numerous ways. They can be made as single-chain antibodies (including small modular immunopharmaceuticals or SMIPsTM), Fab and F(ab′) 2 fragments, etc.
- SMIPsTM small modular immunopharmaceuticals
- Antibodies can be humanized, chimerized, deimmunized, or fully human. Numerous publications set forth the many types of antibodies and the methods of engineering such antibodies. For example, see U.S. Pat. Nos. 6,355,245; 6,180,370; 5,693,762; 6,407,213; 6,548,640; 5,565,332; 5,225,539; 6,103,889; and 5,260,203.
- the genetically altered antibodies of the invention may be functionally equivalent to the above-mentioned natural antibodies.
- modified antibodies of the invention provide improved stability or/and therapeutic efficacy.
- Non-limiting examples of modified antibodies include those with conservative substitutions of amino acid residues, and one or more deletions or additions of amino acids that do not significantly deleteriously alter the antigen binding utility. Substitutions can range from changing or modifying one or more amino acid residues to complete redesign of a region as long as the therapeutic utility is maintained.
- Antibodies of the invention can be modified post-translationally (e.g., acetylation, and/or phosphorylation) or can be modified synthetically (e.g., the attachment of a labeling group).
- Antibodies with engineered or variant constant or Fc regions can be useful in modulating effector functions, such as, for example, antigen-dependent cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).
- ADCC antigen-dependent cytotoxicity
- CDC complement-dependent cytotoxicity
- Such antibodies with engineered or variant constant or Fc regions may be useful in instances where a parent singling protein is expressed in normal tissue; variant antibodies without effector function in these instances may elicit the desired therapeutic response while not damaging normal tissue. Accordingly, certain aspects and methods of the present disclosure relate to antibodies with altered effector functions that comprise one or more amino acid substitutions, insertions, and/or deletions.
- biologically active refers to a protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
- immunologically active refers to the capability of the natural, recombinant, or synthetic full-length ALK protein or ALK fusion polypeptide (e.g., a FN1-ALK fusion polypeptide or an FN1-tmALK fusion polypeptide of the invention), or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies.
- ALK protein or ALK fusion polypeptide e.g., a FN1-ALK fusion polypeptide or an FN1-tmALK fusion polypeptide of the invention
- an immunoglobulin chain may comprise in order from 5′ to 3′, a variable region and a constant region.
- the variable region may comprise three complementarity determining regions (CDRs), with interspersed framework (FR) regions for a structure FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.
- CDRs complementarity determining regions
- FR interspersed framework
- An antibody of the invention may comprise a heavy chain constant region that comprises some or all of a CH1 region, hinge, CH2 and CH3 region.
- ALK fusion polypeptide-specific antibody of the invention is a peptide fragment consisting essentially of about 11 to 17 amino acids of a fusion polypeptide sequence, which fragment encompasses the fusion junction between the ALK portion and the portion of the second fusion partner present in the ALK fusion polypeptide. It will be appreciated that antibodies that specifically binding shorter or longer peptides/epitopes encompassing the fusion junction of an ALK fusion polypeptide are within the scope of the present invention.
- the invention is not limited to use of antibodies, but includes equivalent molecules, such as protein binding domains or nucleic acid aptamers, which bind, in a fusion-protein or truncated-protein specific manner, to essentially the same epitope to which a polypeptide with kinase activity-specific antibody useful in the methods of the invention binds. See, e.g., Neuberger et al., Nature 312: 604 (1984). Such equivalent non-antibody reagents may be suitably employed in the methods of the invention further described below.
- Polyclonal antibodies useful in practicing the methods of the invention may be produced according to standard techniques by immunizing a suitable animal (e.g., rabbit, goat, etc.) with an antigen encompassing a desired epitope (e.g. the fusion junction between the ALK portion and the portion of the second fusion partner present in the ALK fusion polypeptide), collecting immune serum from the animal, and separating the polyclonal antibodies from the immune serum, and purifying polyclonal antibodies having the desired specificity, in accordance with known procedures.
- the antigen may be a synthetic peptide antigen comprising the desired epitopic sequence, selected and constructed in accordance with well-known techniques.
- Monoclonal antibodies may also be beneficially employed in the methods of the invention, and may be produced in hybridoma cell lines according to the well-known technique of Kohler and Milstein. Nature 265: 495-97 (1975); Kohler and Milstein, Eur. J. Immunol. 6: 511 (1976); see also, C URRENT P ROTOCOLS IN M OLECULAR B IOLOGY , Ausubel et al. Eds. (Wiley and Sins, New York, N.Y. 1989 and yearly updates up to and including 2010). Monoclonal antibodies so produced are highly specific, and improve the selectivity and specificity of assay methods provided by the invention. For example, a solution containing the appropriate antigen (e.g.
- a synthetic peptide comprising the fusion junction of the ALK portion and the portion of the second fusion partner present in the ALK fusion polypeptide may be injected into a mouse and, after a sufficient time (in keeping with conventional techniques), the mouse sacrificed and spleen cells obtained.
- the spleen cells are then immortalized by fusing them with myeloma cells, typically in the presence of polyethylene glycol, to produce hybridoma cells.
- Rabbit fusion hybridomas for example, may be produced as described in U.S. Pat. No. 5,675,063.
- the hybridoma cells are then grown in a suitable selection media, such as hypoxanthine-aminopterin-thymidine (HAT), and the supernatant screened for monoclonal antibodies having the desired specificity, as described below.
- a suitable selection media such as hypoxanthine-aminopterin-thymidine (HAT)
- HAT hypoxanthine-aminopterin-thymidine
- the secreted antibody may be recovered from tissue culture supernatant by conventional methods such as precipitation, ion exchange or affinity chromatography, or the like.
- Monoclonal Fab fragments may also be produced in Escherichia coli by recombinant techniques known to those skilled in the art. See, e.g., W. Huse, Science 246: 1275-81 (1989); Mullinax et al., Proc. Nat'l Acad. Sci. 87: 8095 (1990). If monoclonal antibodies of one isotype are desired for a particular application, particular isotypes can be prepared directly, by selecting from the initial fusion, or prepared secondarily, from a parental hybridoma secreting a monoclonal antibody of different isotype by using the sib selection technique to isolate class-switch variants (Steplewski, et al., Proc. Nat'l. Acad.
- the antigen combining site of the monoclonal antibody can be cloned by PCR and single-chain antibodies produced as phage-displayed recombinant antibodies or soluble antibodies in E. coli (see, e.g., A NTIBODY E NGINEERING P ROTOCOLS, 1995, Humana Press, Sudhir Paul editor.)
- U.S. Pat. No. 5,194,392 Geysen (1990) describes a general method of detecting or determining the sequence of monomers (amino acids or other compounds) which is a topological equivalent of the epitope (i.e., a “mimotope”) which is complementary to a particular paratope (antigen binding site) of an antibody of interest. More generally, this method involves detecting or determining a sequence of monomers which is a topographical equivalent of a ligand which is complementary to the ligand binding site of a particular receptor of interest.
- U.S. Pat. No. 5,480,971 Houghten et al.
- Antibodies useful in the methods of the invention may be screened for epitope and fusion protein specificity according to standard techniques. See, e.g., Czernik et al., Methods in Enzymology, 201: 264-283 (1991).
- the antibodies may be screened against a peptide library by ELISA to ensure specificity for both the desired antigen and, if desired, for reactivity only with the full-length ALK protein, a particular ALK fusion polypeptide (e.g., an EML4-ALK (1059 amino acid variant) polypeptide), or fragments thereof of the invention.
- the antibodies may also be tested by Western blotting against cell preparations containing target protein to confirm reactivity with the only the desired target and to ensure no appreciable binding to other proteins.
- the production, screening, and use of fusion protein-specific antibodies is known to those of skill in the art, and has been described. See, e.g., U.S. Patent Publication No. 20050214301.
- Full-length ALK protein-specific and ALK fusion polypeptide-specific antibodies useful in the methods of the invention may exhibit some limited cross-reactivity with similar epitopes in other proteins or polypeptides, such as similar fusion polypeptides. This is not unexpected as most antibodies exhibit some degree of cross-reactivity, and anti-peptide antibodies will often cross-react with epitopes having high homology or identity to the immunizing peptide. See, e.g., Czernik, supra. Cross-reactivity with other fusion proteins is readily characterized by Western blotting alongside markers of known molecular weight.
- Amino acid sequences of cross-reacting proteins may be examined to identify sites highly homologous or identical to full length ALK protein sequence or the ALK fusion polypeptide sequence to which the antibody binds. Undesirable cross-reactivity can be removed by negative selection using antibody purification on peptide columns.
- Polypeptide with ALK kinase activity-specific antibodies and ALK fusion polypeptide-specific antibodies of the invention that are useful in practicing the methods disclosed herein are ideally specific for human fusion polypeptide, but are not limited only to binding the human species, per se.
- the invention includes the production and use of antibodies that also bind conserved and highly homologous or identical epitopes in other mammalian species (e.g., mouse, rat, monkey). Highly homologous or identical sequences in other species can readily be identified by standard sequence comparisons, such as using BLAST, with the human ALK protein sequence (SEQ ID NO: 2.
- Antibodies employed in the methods of the invention may be further characterized by, and validated for, use in a particular assay format, for example flow cytometry (FC), immunohistochemistry (IHC), and/or immunocytochemistry (ICC).
- FC flow cytometry
- IHC immunohistochemistry
- ICC immunocytochemistry
- the use of polypeptide with ALK kinase activity-specific antibodies in such methods is further described herein.
- the antibodies described herein, used alone or in the below-described assays may also be advantageously conjugated to fluorescent dyes (e.g. Alexa488, phycoerythrin), or labels such as quantum dots, for use in multi-parametric analyses along with other signal transduction (phospho-AKT, phospho-Erk 1/2) and/or cell marker (cytokeratin) antibodies, as further described below.
- fluorescent dyes e.g. Alexa488, phycoerythrin
- quantum dots e.g. Alexa488, phycoerythrin
- the expression and/or activity of a polypeptide with ALK kinase activity in a given biological sample may also be advantageously examined using antibodies specific for (i.e., that specifically bind to) full length ALK protein or antibodies specific for ALK fusion polypeptides.
- ALK-specific antibodies i.e., antibodies that specifically bind full-length ALK are commercially available (see C ELL S IGNALING T ECHNOLOGY , I NC ., Danvers, Mass., Catalog Nos.
- ALK-specific antibodies used in the methods of the invention specifically bind the cytoplasmic domain of ALK and, thus, will detect full-length ALK and ALK fusion polypeptides. In some embodiments, ALK-specific antibodies used in the methods of the invention specifically bind the kinase domain of ALK.
- ALK fusion-specific antibodies are commercially available (see C ELL S IGNALING T ECHNOLOGY , I NC ., Beverly Mass., 2009/10 Catalogue, #'s 33435 (phospho-NPM-ALK), 3983 (phospho-NPM-ALK), Abcam, 2010 Catalogue, #ab4061 (NPM-ALK), and Thermo Scientific, 2010 Catalogue, #PA1-37060 (NPM-ALK), for example).
- Such antibodies may also be produced according to standard methods, as described above.
- Detection of expression and/or activity of full-length ALK and/or ALK fusion polypeptide in a biological sample can provide information on whether the fusion protein alone is driving the tumor, or whether aberrantly expressed full length ALK is also present and driving the tumor. Such information is clinically useful in assessing whether targeting the fusion protein or the full-length protein(s), or both, or is likely to be most beneficial in inhibiting progression of the tumor, and in selecting an appropriate therapeutic or combination thereof.
- Antibodies specific for the ALK kinase extracellular domain, which is not present in the mutant ALK disclosed herein, may be particularly useful for determining the presence/absence of the mutant ALK kinase.
- one or more polypeptide with ALK kinase activity-specific antibodies together with one or more antibodies specific for full-length ALK kinase, another kinase, receptor, or kinase substrate that is suspected of being, or potentially is, activated in a cancer in which a polypeptide with ALK kinase activity is expressed and/or active may be simultaneously employed to detect the activity of such other signaling molecules in a biological sample comprising cells from such cancer.
- fusion polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of other molecules to create chimeric polypeptides.
- an epitope-bearing fragment of an ALK fusion polypeptide may be combined with the constant domain of immunoglobulins (IgG) to facilitate purification of the chimeric polypeptide and increase the in vivo half-life of the chimeric polypeptide (see, e.g., examples of CD4-Ig chimeric proteins in EPA 394,827; Traunecker et al., Nature 331: 84-86 (1988)).
- IgG immunoglobulins
- Fusion proteins that have a disulfide-linked dimeric structure may also be more efficient in binding and neutralizing other molecules than the monomeric ALK fusion polypeptide alone (see Fountoulakis et al., J Biochem 270: 3958-3964 (1995)).
- the detection molecule used in the methods of the invention is attached to a detectable label.
- detectable label with respect to a polypeptide, polynucleotide, or reagent disclosed herein means a chemical, biological, or other modification of or to the polypeptide, polynucleotide, or binding agent, including but not limited to fluorescence, mass, residue, dye, radioisotope, label, or tag modifications, etc., by which the presence of the molecule of interest (e.g., a polypeptide with ALK kinase activity or a polynucleotide encoding a polypeptide with ALK kinase activity) may be detected.
- the detectable label may be directly or indirectly attached to the detection molecule by a covalent or non-covalent chemical bond. Methods for attaching detectable labels to molecules (e.g., to the detection molecules described herein) are well known.
- Immunoassays useful in the practice of the methods of the invention may be homogenous immunoassays or heterogeneous immunoassays.
- the immunological reaction usually involves a specific reagent (e.g., an ALK-specific antibody), a detectably labeled analyte, and the biological sample of interest.
- the signal arising from the detectable label is modified, directly or indirectly, upon the binding of the antibody to the detectably labeled analyte. Both the immunological reaction and detection of the extent thereof are carried out in a homogeneous solution.
- Immunochemical detectable labels that may be employed include free radicals, radio-isotopes, fluorescent dyes, enzymes, bacteriophages, coenzymes, and so forth.
- Semi-conductor nanocrystal labels, or “quantum dots”, may also be advantageously employed, and their preparation and use has been well described. See generally, K. Barovsky, Nanotech. Law & Bus. 1(2): Article 14 (2004) and patents cited therein.
- the reagents are usually the biological sample, binding reagent (e.g., an antibody), and suitable means for producing a detectable signal.
- Biological samples as further described below may be used.
- the antibody is generally immobilized on a support, such as a bead, plate or slide, and contacted with the sample suspected of containing the antigen in a liquid phase.
- the support is then separated from the liquid phase and either the support phase or the liquid phase is examined for a detectable signal employing means for producing such signal.
- the signal is related to the presence of the analyte in the biological sample.
- Means for producing a detectable signal include the use of radioactive labels, fluorescent labels, enzyme labels, quantum dots, and so forth.
- an antibody which binds to that site can be conjugated to a detectable group and added to the liquid phase reaction solution before the separation step.
- the presence of the detectable group on the solid support indicates the presence of the antigen in the test sample.
- suitable immunoassays are the radioimmunoassay, immunofluorescence methods, enzyme-linked immunoassays, and the like.
- Immunoassay formats and variations thereof, which may be useful for carrying out the methods disclosed herein, are well known in the art. See generally E. Maggio, Enzyme-Immunoassay, (1980) (CRC Press, Inc., Boca Raton, Fla.); see also, e.g., U.S. Pat. No. 4,727,022 (Skold et al., “Methods for Modulating Ligand-Receptor Interactions and their Application”); U.S. Pat. No. 4,659,678 (Forrest et al., “Immunoassay of Antigens”); U.S. Pat. No.
- the concentration of detectable reagent should be sufficient such that the binding of a protein with ALK kinase activity (e.g., a full-length ALK protein, a truncated ALK, or ALK fusion polypeptide) is detectable compared to background.
- a protein with ALK kinase activity e.g., a full-length ALK protein, a truncated ALK, or ALK fusion polypeptide
- Antibodies useful in the practice of the methods disclosed herein may be conjugated to a solid support suitable for a diagnostic assay (e.g., beads, plates, slides or wells formed from materials such as latex or polystyrene) in accordance with known techniques, such as precipitation.
- Antibodies or other binding reagents binding reagents may likewise be conjugated to detectable groups such as radiolabels (e.g., 35 S, 125 I, 131 I), enzyme labels (e.g., horseradish peroxidase, alkaline phosphatase), and fluorescent labels (e.g., fluorescein) in accordance with known techniques.
- radiolabels e.g., 35 S, 125 I, 131 I
- enzyme labels e.g., horseradish peroxidase, alkaline phosphatase
- fluorescent labels e.g., fluorescein
- Cell-based assays such flow cytometry (FC), immuno-histochemistry (IHC), immunocytochemistry (ICC), or immunofluorescence (IF) are particularly desirable in practicing the methods of the invention, since such assay formats are clinically-suitable, allow the detection of expression of a protein with ALK kinase activity (e.g., a mutant ALK polypeptide or an FN1-ALK fusion polypeptide) in vivo, and avoid the risk of artifact changes in activity resulting from manipulating cells obtained from, e.g. a tumor sample in order to obtain extracts. Accordingly, in some embodiments, the methods of the invention are implemented in a flow-cytometry (FC), immunocytochemistry (ICC), immuno-histochemistry (IHC), or immunofluorescence (IF) assay format.
- FC flow-cytometry
- IHC immunocytochemistry
- ICC immunocytochemistry
- IF immunofluorescence
- Flow cytometry may be employed to determine the expression of polypeptide with ALK kinase activity in a mammalian tumor before, during, and after treatment with a drug targeted at inhibiting ALK kinase activity.
- a drug targeted at inhibiting ALK kinase activity For example, tumor cells from a fine needle aspirate may be analyzed by flow cytometry for expression and/or activation of a polypeptide with ALK kinase activity or polynucleotide encoding the same as well as for markers identifying cancer cell types, etc., if so desired.
- Flow cytometry may be carried out according to standard methods. See, e.g. Chow et al., Cytometry ( Communications in Clinical Cytometry ) 46: 72-78 (2001).
- the following protocol for cytometric analysis may be employed: fixation of the cells with 2% paraformaldehyde for 10 minutes at 37° C. followed by permeabilization in 90% methanol for 10 minutes on ice. Cells may then be stained with the primary antibody (e.g., a full-length ALK-specific or a ALK fusion polypeptide-specific antibody), washed and labeled with a fluorescent-labeled secondary antibody. The cells would then be analyzed on a flow cytometer (e.g. a Beckman Coulter FC500) according to the specific protocols of the instrument used. Such an analysis would identify the level of expressed polypeptide with ALK kinase activity in the tumor. Similar analysis after treatment of the tumor with an ALK-inhibiting therapeutic would reveal the responsiveness of a polypeptide with ALK kinase activity-expressing tumor to the targeted inhibitor of ALK kinase.
- the primary antibody e.g., a full-length ALK-specific or a ALK fusion polypeptid
- Immunohistochemical (IHC) staining may be also employed to determine the expression and/or activation status of polypeptide with ALK kinase activity in a mammalian cancer (e.g., kidney cancer) before, during, and after treatment with a drug targeted at inhibiting ALK kinase activity (i.e., an ALK-inhibiting therapeutic).
- IHC may be carried out according to well-known techniques. See, e.g., A NTIBODIES : A L ABORATORY M ANUAL , Chapter 10, Harlow & Lane Eds., Cold Spring Harbor Laboratory (1988). Briefly, and by way of example, paraffin-embedded tissue (e.g.
- tumor tissue from a biopsy is prepared for immunohistochemical staining by deparaffinizing tissue sections with xylene followed by ethanol; hydrating in water then PBS; unmasking antigen by heating slide in sodium citrate buffer; incubating sections in hydrogen peroxide; blocking in blocking solution; incubating slide in primary antibody (e.g., an ALK-specific or ALK fusion polypeptide-specific antibody) and secondary antibody; and finally detecting using ABC avidin/biotin method according to manufacturer's instructions.
- primary antibody e.g., an ALK-specific or ALK fusion polypeptide-specific antibody
- Immunofluorescence assays may be also employed to determine the expression and/or activation status of a polypeptide with ALK kinase activity in a mammalian cancer before, during, and after treatment with a drug targeted at inhibiting ALK kinase activity.
- IF may be carried out according to well-known techniques. See, e.g., J. M. polak and S. Van Noorden (1997) I NTRODUCTION TO I MMUNOCYTOCHEMISTRY, 2nd Ed.; R OYAL M ICROSCOPY S OCIETY M ICROSCOPY H ANDBOOK 37, BioScientific/Springer-Verlag.
- patient samples may be fixed in paraformaldehyde followed by methanol, blocked with a blocking solution such as horse serum, incubated with a primary antibody against (i.e., that specifically binds to) a polypeptide with ALK kinase activity followed by a secondary antibody labeled with a fluorescent dye such as Alexa 488 and analyzed with an epifluorescent microscope.
- a primary antibody against i.e., that specifically binds to
- a polypeptide with ALK kinase activity followed by a secondary antibody labeled with a fluorescent dye such as Alexa 488 and analyzed with an epifluorescent microscope.
- a variety of other protocols including enzyme-linked immunosorbent assay (ELISA), radio-immunoassay (RIA), and fluorescent-activated cell sorting (FACS), for measuring expression and/or activity of a polypeptide with ALK kinase activity are known in the art and provide a basis for diagnosing the presence of the polypeptide with ALK kinase activity (e.g., full-length ALK, truncated ALK, or an ALK fusion polypeptide such as an NPM-ALK fusion polypeptide).
- ELISA enzyme-linked immunosorbent assay
- RIA radio-immunoassay
- FACS fluorescent-activated cell sorting
- Normal or standard values for polypeptide with ALK kinase activity expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably human, with an antibody that specifically binds to the polypeptide with ALK kinase activity under conditions suitable for complex formation.
- the amount of standard complex formation may be quantified by various methods, but preferably by photometric means. Quantities of the polypeptide with ALK kinase activity expressed in subject (i.e., a patient) and control samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
- the method for detecting the presence and/or activity of a polypeptide with ALK kinase activity in a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer comprises the steps of: (a) obtaining a biological sample from a mammalian kidney cancer or suspected mammalian kidney cancer and (b) contacting the biological sample with a reagent that detects a polynucleotide encoding the polypeptide with ALK kinase activity, wherein detection of said polynucleotide in said biological sample indicates said polypeptide with ALK kinase activity is present in said biological sample.
- polynucleotide refers to a polymer of individual nucleotides covalently joined together (e.g., via a phosphodiester bond).
- the definition includes, without limitation, DNA, RNA, genomic DNA, intronic DNA, exonic DNA, cDNA, hnRNA, mRNA, oligonucleotides, or synthetic nucleotides, all of which may be single- or double-stranded, and may represent the sense or anti-sense strand.
- Probes and primers are within the definition of polynucleotides of the invention.
- polynucleotide encoding a polypeptide with ALK kinase activity is meant to include, without limitation, any polynucleotide encoding a polypeptide with ALK kinase activity, any polynucleotide encoding a portion of a polypeptide with ALK kinase activity (e.g., the ALK kinase domain), and any polynucleotide from a gene encoding a polypeptide with ALK kinase activity regardless of whether that particular polynucleotide codes for any amino acid residues in that polypeptide with ALK kinase activity.
- intronic sequences from an ALK gene are included in the definition of polynucleotide encoding a polypeptide with ALK kinase activity.
- nucleotide sequences including cDNA and mRNA, of polynucleotides encoding polypeptides with ALK kinase activity have been previously published.
- Non-limiting examples include the nucleotide and protein sequences of human ALK (Genbank Accession Codes: U62540, U66559), the nucleotide and protein sequences of mouse ALK cDNAs (D83002), nucleotide and polypeptide sequences for EML4-ALK (U.S. Pat. No. 7,605,131), EML4-ALK (U.S. Pat. No.
- the reagent that detects a polynucleotide encoding the polypeptide with ALK kinase activity is a nucleic acid probe or primer that hybridizes to said polynucleotide.
- the nucleic acid probe or primer hybridizes to the polynucleotide encoding the polypeptide with ALK kinase activity under stringent conditions.
- probe As used herein, by “probe,” “primer,” or “oligonucleotide” is meant a single-stranded nucleic acid molecule of defined sequence that can base-pair to a second DNA or RNA molecule that contains a complementary sequence (the “target”).
- the target is generally a nucleic acid ALK gene product of an ALK fusion gene.
- the stability of the resulting hybrid depends upon the extent of the base-pairing that occurs.
- the extent of base-pairing is affected by parameters such as the degree of complementarity between the probe and target molecules, and the degree of stringency of the hybridization conditions.
- the degree of hybridization stringency is affected by parameters such as temperature, salt concentration, and the concentration of organic molecules such as formamide, and is determined by methods known to one skilled in the art.
- Probes or primers that specifically bind to a polynucleotide encoding a polypeptide having ALK kinase activity specifically bind the polynucleotide by hybridizing to the polynucleotide.
- the probe or primer that specifically binds (e.g., hybridizes) to the polynucleotide encoding a polypeptide having ALK kinase activity (or a fragment of such a polynucleotide) preferably has at least 50%-55% sequence complementarity, more preferably at least 60%-75% sequence complementarity, even more preferably at least 80%-90% sequence complementarity, yet more preferably at least 91%-99% sequence complementarity, and most preferably 100% sequence complementarity to the polynucleotide encoding a polypeptide having ALK kinase activity (or a fragment of such a polynucleotide) to be detected.
- Probes, primers, and oligonucleotides may be detectably-labeled, either radioactively, or non-radioactively, by methods well-known to those skilled in the art.
- Probes, primers, and oligonucleotides are used for methods involving nucleic acid hybridization, such as: nucleic acid sequencing, reverse transcription and/or nucleic acid amplification by the polymerase chain reaction, single stranded conformational polymorphism (SSCP) analysis, restriction fragment polymorphism (RFLP) analysis, Southern hybridization, Northern hybridization, in situ hybridization, electrophoretic mobility shift assay (EMSA).
- SSCP single stranded conformational polymorphism
- RFLP restriction fragment polymorphism
- hybridizes is meant that a probe, primer, or oligonucleotide recognizes and physically interact (i.e., forms base-pairs) with a substantially complementary nucleic acid (e.g., an mRNA encoding full-length ALK or an ALK fusion polypeptide of the invention) under stringent conditions, and does not substantially base pair with other nucleic acids.
- a nucleic acid probe, primer, or oligonucleotide that hybridizes under stringent conditions to its target may be referred to as a target-specific nucleic acid probe (or primer or oligonucleotide) or an anti-target nucleic acid probe (or primer or oligonucleotide).
- a nucleic acid probe that hybridizes to a polynucleotide encoding an EML4-ALK fusion polypeptide may be referred to as an EML4-ALK-specific nucleic acid probe or an anti-EML4-ALK nucleic acid probe.
- stringent conditions with respect to nucleotide sequence or nucleotide probe hybridization conditions is the “stringency” that occurs within a range from about T m minus 5° C. (i.e., 5° C. below the melting temperature (T m ) of the reagent or nucleic acid probe) to about 20° C. to 25° C. below T m .
- Typical stringent conditions are: overnight incubation at 42° C.
- stringent conditions may be achieved by hybridization occurring in a buffer containing 0.5 M NaHPO 4 , pH 7.2, 7% SDS, 1 mM EDTA, and 1% BSA (fraction V), at a temperature of 65° C., or a buffer containing 48% formamide, 4.8 ⁇ SSC, 0.2 M Tris-Cl, pH 7.6, 1 ⁇ Denhardt's solution, 10% dextran sulfate, and 0.1% SDS, at a temperature of 42° C. (or similarly typical conditions for stringenct Northern or Southern hybridizations).
- Stringent hybridization is relied upon for the success of numerous techniques routinely performed by molecular biologists, such as high stringency PCR, DNA sequencing, single strand conformational polymorphism analysis, and in situ hybridization. In contrast to Northern and Southern hybridizations, these techniques are usually performed with relatively short probes (e.g., usually 16 nucleotides or longer for PCR or sequencing, and 40 nucleotides or longer for in situ hybridization).
- the stringent conditions used in these techniques are well known to those skilled in the art of molecular biology, and may be found, for example, in F. Ausubel et al., Current Protocols in Molecular Biology , supra, herein incorporated by reference.
- the nucleic acid probe or primer is a polymerase chain reaction (PCR) probe, a fluorescence in situ hybridization (FISH) probe, or a Southern blotting probe.
- the method is implemented in a polymerase chain reaction (PCR) assay format, a in situ hybridization (ISH) assay format, or a Southern blotting assay format.
- Polynucleotides encoding a polypeptide with ALK kinase activity may also be used for diagnostic purposes.
- the polynucleotides that may be used include oligonucleotide sequences, antisense RNA and DNA molecules, and PNAs.
- the polynucleotides may be used to detect and quantitate gene expression in biopsied tissues in which expression of a polypeptide with ALK kinase activity (e.g., full length ALK, or an ALK fusion polypeptide,
- the diagnostic assay may be used to distinguish between absence, presence, and aberrant expression of a polypeptide with ALK kinase activity, and to monitor regulation of levels of a polypeptide with ALK kinase activity during therapeutic intervention.
- hybridization with PCR probes which are capable of detecting a polynucleotide, including genomic sequences, encoding a polypeptide with ALK kinase activity may be used to identify polynucleotides that encode such polypeptides with ALK kinase activity.
- genomic sequences including genomic sequences
- ALK kinase activity may be used to identify polynucleotides that encode such polypeptides with ALK kinase activity.
- nucleic acid probes useful in the methods described herein may hybridize to nucleotide sequences encoding the kinase domain of ALK (amino acids 1116-1392 of SEQ ID NO:2).
- the probes may alternatively hybridize nucleotides encoding the C-terminal domain located at amino acids 1376-1620 of SEQ ID NO: 2, amino acid residuesl504-1507 of SEQ ID NO:2 making up the phosphotyrosine-binding site of the C-terminal domain of ALK, or amino acid residues 1603-1606 of SEQ ID NO: 2 representing the interaction site for the phosphotyrosine-dependent binding of the substrate phosphlipase C- ⁇ (PLC- ⁇ ).
- the polynucleotides encoding a polypeptide with ALK kinase activity may be used to generate hybridization probes which are useful for mapping the naturally occurring genomic sequence.
- the sequences may be mapped to a particular chromosome or to a specific region of the chromosome using well known techniques.
- Such techniques include in-situ hybridization (ISH), FACS, or artificial chromosome constructions, such as yeast artificial chromosomes, bacterial artificial chromosomes, bacterial P1 constructions or single chromosome cDNA libraries, as reviewed in Price, C. M., Blood Rev. 7: 127-134 (1993), and Trask, B. J., Trends Genet. 7: 149-154 (1991).
- ISH In situ hybridization
- physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps.
- a gene on the chromosome of another mammalian species, such as mouse may reveal associated markers even if the number or arm of a particular human chromosome is not known.
- New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques.
- any sequences mapping to that area may represent associated or regulatory genes for further investigation.
- the nucleotide sequence of the subject invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc., among normal, carrier, or affected individuals.
- FISH fluorescence in-situ hybridization
- Verma et al. H UMAN C HROMOSOMES A M ANUAL OF B ASIC T ECHNIQUES , Pergamon Press, New York, N.Y. (1988)
- FISH technique is well known (see, e.g., U.S. Pat. Nos. 5,756,696; 5,447,841; 5,776,688; and 5,663,319). Examples of genetic map data can be found in the 1994 Genome Issue of Science (265: 19810.
- Correlation between the location of the gene encoding ALK protein and/or the gene encoding the fusion partner of an ALK fusion polypeptide on a physical chromosomal map and a specific disease, or predisposition to a specific disease, may help delimit the region of DNA associated with that genetic disease.
- the nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, carrier, or affected individuals. FISH protocols for detect translocations involving the ALK gene have been described (see, e.g., U.S. Pat. No. 7,700,339 and US Patent Publication No. 20110110923. A dual color, break apart probe designed to detect ALK gene translocation is also commercially available from Abbott Molecular (Abbott Park, Ill., US; Catalog No. 05J89-001).
- detection of a polynucleotide encoding an ALK fusion polypeptide in the genetic material of a biological sample may be followed by Western blotting analysis or immuno-histochemistry (IHC) analysis of the proteins of the sample to determine if the polynucleotide encoding the TFG-ALK fusion polypeptide is actually expressed as a TFG-ALK fusion polypeptide in the biological sample.
- a biological sample e.g., TFG-ALK in a circulating tumor cell
- IHC immuno-histochemistry
- Such Western blotting or IHC analyses may be performed using an antibody that specifically binds to the polypeptide encoded by the detected polynucleotide, or the analyses may be performed using antibodies that specifically bind either to full length TFG (e.g., bind to the N-terminus of the TFG protein) or to full length ALK (e.g., bind an epitope in the kinase domain of ALK protein).
- TFG e.g., bind to the N-terminus of the TFG protein
- ALK e.g., bind an epitope in the kinase domain of ALK protein.
- the CISH technology of Dako allows chromatogenic in situ hybridization with immuno-histochemistry on the same tissue section. See Elliot et al., Br J Biomed Sci 2008; 65(4): 167-171, 2008 for a comparison of CISH and FISH.
- the invention relates to detecting the detection molecules utilizing a detection device.
- detection device any device that is used to detect, measure, or otherwise quantify the expression and/or activity levels of the polypeptide with ALK kinase activity or polynucleotide encoding the polypeptide with ALK kinase activity.
- the detected levels of expression and/or activity may be used to generate a database of the samples, particularly of the test and control samples.
- the database can be used to generate a report to analyze and compare the levels of expression and/or activity of the polypeptide with ALK kinase activity or polynucleotide encoding the polypeptide with ALK kinase activity of the samples.
- Non-limiting examples of detection devices include a PCR cycler, DNA analyzer, DNA sequencer, DNA extraction column, gel, or kit, image analysis device, chromatographic device, or mass spectrometer, combinations thereof, and automated versions thereof.
- An image analysis device is any device that is used to create a visible image of the biological sample for detection of the polypeptide with ALK kinase activity or polynucleotide encoding the polypeptide with ALK kinase activity and includes the following non-limiting examples: FlowCAM, a biosensor imaging device, an infrared imaging systems, or a chemiluminescent imaging systems.
- a chromatographic device may alternatively be used to detect the ALK gene product, which can perform high performance liquid chromatography (HPLC), reverse HPLC, gas chromatography, or liquid chromatography.
- HPLC high performance liquid chromatography
- a mass spectrometer may be utilized.
- polypeptide with ALK kinase activity or polynucleotide encoding the polypeptide with ALK kinase activity are detected in a biological sample using a mass spectrometer.
- mass spectrometer means a device capable of detecting specific molecular species and measuring their accurate masses. The term is meant to include any molecular detector into which a polypeptide or peptide may be eluted for detection and/or characterization and includes, for example, MALDI and SELDI devices.
- a sample e.g., the elution solution, is loaded onto the MS instrument, and undergoes vaporization.
- the components of the sample are ionized by one of a variety of methods (e.g., by electrospray ionization or “ESI”), which results in the formation of positively charged particles (ions).
- ESI electrospray ionization
- the positive ions are then accelerated by a magnetic field.
- the computation of the mass-to-charge ratio of the particles is based on the details of motion of the ions as they transit through electromagnetic fields, and detection of the ions.
- the preferred mass measurement error of a mass spectrometer of the invention is 10 ppm or less, more preferable is 7 ppm or less; and most preferably 5 ppm or less.
- Fragment ions in the MS/MS and MS 3 spectra are generally highly specific and diagnostic for peptides of interest.
- the identification of peptide diagnostic signatures provides for a way to perform highly selective analysis of a complex protein mixture, such as a cellular lysate in which there may be greater than about 100, about 1000, about 10,000, or even about 100,000 different kinds of proteins.
- Test peptides in a biological sample are preferably examined by monitoring of a selected reaction in the mass spectrometer. This involves using the prior knowledge gained by the characterization of a standard peptide and then requiring the mass spectrometer to continuously monitor a specific ion in the MS/MS or MS′′ spectrum for both the peptide of interest and the standard peptide. After elution, the areas-under-the-curve (AUC) for both the standard peptide and target peptide peaks may be calculated. The ratio of the two areas provides the absolute quantification that may then be normalized for the number of cells used in the analysis and the protein's molecular weight, to provide the precise number of copies of the protein per cell.
- AUC areas-under-the-curve
- accurate mass refers to an experimentally or theoretically determined mass of an ion that is used to determine an elemental formula.
- mass For ions containing combinations of the elements C, H, N, O, P, S, and the halogens, with mass less than 200 Unified Atomic Mass Units, a measurement about 5 ppm uncertainty is sufficient to uniquely determine the elemental composition.
- predetermined peptide accurate mass refers to the experimentally determined or calculated accurate mass of a peptide with a known amino acid sequence (along with any associated post-translational modifications). The accurate mass of any such specific amino acid sequence may be readily calculated by one of skill in the art.
- a peptide fragmentation signature refers to the distribution of mass-to-charge ratios of fragmented peptide ions obtained from fragmenting a peptide, for example, by collision induced disassociation, ECD, LID, PSD, IRNPD, SID, and other fragmentation methods.
- a peptide fragmentation signature which is “diagnostic” or a “diagnostic signature” of a target protein or target polypeptide is one which is reproducibly observed when a peptide digestion product of a target protein/polypeptide identical in sequence to the peptide portion of a standard peptide, is fragmented and which differs only from the fragmentation pattern of the standard peptide by the mass of the mass-altering label and/or the presence of a ubiquitin remnant.
- a diagnostic signature is unique to the target protein (i.e., the specificity of the assay is at least about 95%, at least about 99%, and preferably, approaches 100%).
- the mammalian kidney cancer or suspected mammalian kidney cancer in which the presence or activity of said polypeptide with ALK kinase activity is detected is identified as a mammalian kidney cancer or suspected mammalian kidney cancer likely to respond to an ALK-inhibiting therapeutic.
- a cancer that is likely to respond to an ALK inhibitor is one that shrinks in size (e.g., the cancer cells apoptose) in response to the ALK inhibitor as compared to an untreated cancer.
- a cancer that is likely to respond to an ALK inhibitor is one that dies (e.g., the cancer cells apoptose) in response to the ALK inhibitor as compared to an untreated cancer.
- a patient or subject whose kidney cancer or suspected kidney cancer is identified as comprising a polypeptide with ALK kinase activity (e.g., by detection of ALK kinase activity, a polypeptide with ALK kinase activity, and/or a polynucleotide encoding a polypeptide with ALK kinase activity), that patient may be treated with (e.g., administered with) a therapeutically effective amount of an ALK-inhibiting therapeutic.
- the ALK-inhibiting therapeutic is administered in a pharmaceutically acceptable formulation.
- terapéuticaally effective amount or “pharmaceutically effective amount” is mean an amount of an ALK-inhibiting therapeutic that is adequate to inhibit the cancer (or cell thereof) or suspected cancer (or cells thereof), as compared to an untreated cancer or suspected cancer, by either slowing the growth of the cancer or suspected cancer, reducing the mass of the cancer or suspected cancer, reducing the number of cells of the cancer or suspected cancer, or killing the cancer.
- An ALK-inhibiting therapeutic may be any composition comprising at least one ALK inhibitor. Such compositions also include compositions comprising only a single ALK-inhibiting compound, as well as compositions comprising multiple therapeutics (including those against other RTKs), which may also include a non-specific therapeutic agent like a chemotherapeutic agent or general transcription inhibitor.
- an ALK-inhibiting therapeutic useful in the practice of the methods of the invention is a targeted, small molecule inhibitor.
- Small molecule targeted inhibitors are a class of molecules that typically inhibit the activity of their target enzyme by specifically, and often irreversibly, binding to the catalytic site of the enzyme, and/or binding to an ATP-binding cleft or other binding site within the enzyme that prevents the enzyme from adopting a conformation necessary for its activity.
- Crizotinib (also known as PF-02341066 or 1066), is a c-MET/HGFR and ALK (anaplastic lymphoma kinase) inhibitor of the aminopyridine chemical series that is being developed by Pfizer Incorporated (see Zou et al., Cancer Research 67: 4408-4417, 2007 and supplemental data). Crizotinib is currently undergoing clinical trials testing its safety and efficacy in treating several forms of cancer, particularly non-small cell lung carcinoma (NSCLC), anaplastic large cell lymphoma, neuroblastoma, and other advanced solid tumors in both adults and children.
- NSCLC non-small cell lung carcinoma
- U.S. Pub. No. 2008/0300273 discloses that PF-02341066 was able to reduce cell colony scattering in HGF-stimulated Madin-Darby Canine Kidney (MDCK) cells. As such, the compound was able to inhibit epithelial cell dispersion and motility in response to HGF. See also Zou et al., Cancer Research 67: 4408-4417, 2007. However, these publications do not disclose whether or not ALK or ALK fusions are actually expressed in kidney cells or kidney cancer cells. In fact, Zou et al., Cancer Research 67: 4408-4417, 2007 references Christensen et al., Cancer Res.
- HGF-stimulated MDCK cells To determine whether or not HGF-stimulated MDCK cells actually express ALK kinase, the present inventors replicated the conditions described in U.S. Pub. No. 2008/0300273. As described below in Example 3, using Western blotting analysis, it was determined that HGF-stimulated MDCK cells do not express any ALK kinase. The cells did not express phosphorylated or non-phosphorylated ALK kinase. Accordingly, the effects on HGF-stimulated MDCK cells in response to crizotinib described in U.S. Pub. No.
- 2008/0300273 could not have been mediated by the ALK kinase since ALK kinase was not present in the cells. Accordingly, as proposed in U.S. Pub. No. 2008/0300273, the effects of crizotinib on HGF-stimulated MDCK cells were mediated through MET kinase.
- TAE-684 from Novartis; see Galkin, et al., Proc. National Acad. Sci. 104(1) 270-275, 2007
- AP26113 Ariad Pharmaceuticals, Inc.
- CEP-14083, CEP-14513, and CEP-11988 Cephalon; see Wan et al., Blood 107: 1617-1623, 2006
- WHI-P131 and WHI-P154 EMD Biosciences; see Marzec et al., (Laboratory Investigation: A journal of Technical Methods and Pathology 2005, Vol. 85, p. 1544-1554, 2005).
- Another group has developed their own low-molecular-weight ALK-inhibiting substance and has demonstrated that this inhibitor induces the cell death of NPM-ALK-expressing lymphoma cell lines (Blood, 2006, Vol. 107, p. 1617-1623).
- Additional small molecule inhibitors and other inhibitors (e.g., indirect inhibitors) of ALK kinase activity may be rationally designed using X-ray crystallographic or computer modeling of ALK three dimensional structure, or may found by high throughput screening of compound libraries for inhibition of key upstream regulatory enzymes and/or necessary binding molecules, which results in inhibition of ALK kinase activity.
- Such approaches are well known in the art, and have been described.
- ALK inhibition by such therapeutics may be confirmed, for example, by examining the ability of the compound to inhibit ALK activity, but not other kinase activity, in a panel of kinases, and/or by examining the inhibition of ALK activity in a biological sample comprising cancer cells (e.g., kidney cancer cells).
- cancer cells e.g., kidney cancer cells
- ALK-inhibiting therapeutics useful in the methods of the invention may also be targeted antibodies that specifically bind to critical catalytic or binding sites or domains required for ALK activity, and inhibit the kinase by blocking access of ligands, substrates or secondary molecules to a and/or preventing the enzyme from adopting a conformation necessary for its activity.
- the production, screening, and therapeutic use of humanized target-specific antibodies has been well-described. See Merluzzi et al., Adv Clin Path. 4(2): 77-85 (2000).
- Commercial technologies and systems, such as Morphosys, Inc.'s Human Combinatorial Antibody Library (HuCAL®), for the high-throughput generation and screening of humanized target-specific inhibiting antibodies are available.
- Phage display approaches may also be employed to generate ALK-specific antibody inhibitors, and protocols for bacteriophage library construction and selection of recombinant antibodies are provided in the well-known reference text C URRENT P ROTOCOLS IN I MMUNOLOGY , Colligan et al. (Eds.), John Wiley & Sons, Inc. (1992-2000), Chapter 17, Section 17.1. See also U.S. Pat. No. 6,319,690, U.S. Pat. No. 6,300,064, U.S. Pat. No. 5,840,479, and U.S. Patent Publication No. 20030219839.
- ALK-binding targeted antibodies identified in screening of antibody libraries as describe above may then be further screened for their ability to block the activity of ALK, both in vitro kinase assay and in vivo in cell lines and/or tumors.
- ALK inhibition may be confirmed, for example, by examining the ability of such antibody therapeutic to inhibit ALK kinase activity in a panel of kinases, and/or by examining the inhibition of ALK activity in a biological sample comprising cancer cells, as described above.
- a ALK-inhibiting compound of the invention reduces ALK kinase activity, but reduces the kinase activity of other kinases to a lesser extent (or not at all). Methods for screening such compounds for ALK kinase inhibition are further described above.
- ALK-inhibiting compounds that useful in the practice of the disclosed methods may also be compounds that indirectly inhibit ALK activity by inhibiting the activity of proteins or molecules other than ALK kinase itself.
- Such inhibiting therapeutics may be targeted inhibitors that modulate the activity of key regulatory kinases that phosphorylate or de-phosphorylate (and hence activate or deactivate) ALK itself, or interfere with binding of ligands.
- ALK regulates downstream signaling through a network of adaptor proteins and downstream kinases. As a result, induction of cell growth and survival by ALK activity may be inhibited by targeting these interacting or downstream proteins.
- ALK kinase activity may also be indirectly inhibited by using a compound that inhibits the binding of an activating molecule necessary for full length ALK, an ALK fusion polypeptide (e.g., an FN1-ALK fusion polypeptide), or mutant ALK (e.g., a truncated ALK polypeptide or an FN1-tmALK fusion polypeptide) to adopt its active conformation.
- an ALK fusion polypeptide e.g., an FN1-ALK fusion polypeptide
- mutant ALK e.g., a truncated ALK polypeptide or an FN1-tmALK fusion polypeptide
- anti-PDGF antibodies has been described. See U.S. Patent Publication No. 20030219839, “Anti-PDGF Antibodies and Methods for Producing Engineered Antibodies,” Bowdish et al. Inhibition of ligand (PDGF) binding to the receptor directly down-regulates the receptor
- ALK inhibiting compounds or therapeutics may also comprise anti-sense and/or transcription inhibiting compounds that inhibit ALK kinase activity by blocking transcription of the gene encoding ALK, an FN1-ALK fusion-encoding gene, or a mutant ALK-encoding gene.
- antisense therapeutics for the treatment of cancer has been described. See, e.g., U.S. Pat. Nos. 6,734,017; 6,710,174, 6,617,162; 6,340,674; 5,783,683; 5,610,288.
- Antisense oligonucleotides may be designed, constructed, and employed as therapeutic agents against target genes in accordance with known techniques. See, e.g. Cohen, J., Trends in Pharmacol. Sci. 10(11): 435-437 (1989); Marcus-Sekura, Anal. Biochem. 172: 289-295 (1988); Weintraub, H., Sci. AM pp. 40-46 (1990); Van Der Krol et al., BioTechniques 6(10): 958-976 (1988); Skorski et al., Proc. Natl. Acad. Sci. USA (1994) 91: 4504-4508.
- ALK-inhibiting therapeutic comprising at least one antisense oligonucleotide against a mammalian ALK gene, FN1-ALK fusion polynucleotide or mutant ALK polynucleotide may be prepared according to methods described above.
- Pharmaceutical compositions comprising ALK-inhibiting antisense compounds may be prepared and administered as further described below.
- RNA interference Small interfering RNA molecule compositions, which inhibit translation, and hence activity, of ALK through the process of RNA interference, may also be desirably employed in the methods of the invention.
- RNA interference and the selective silencing of target protein expression by introduction of exogenous small double-stranded RNA molecules comprising sequence complimentary to mRNA encoding the target protein, has been well described. See, e.g. U.S. Patent Publication No. 20040038921, U.S. Patent Publication No. 20020086356, and U.S. Patent Publication 20040229266.
- RNA interference Double-stranded RNA molecules (dsRNA) have been shown to block gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi). Briefly, the RNAse III Dicer processes dsRNA into small interfering RNAs (siRNA) of approximately 22 nucleotides, which serve as guide sequences to induce target-specific mRNA cleavage by an RNA-induced silencing complex RISC (see Hammond et al., Nature (2000) 404: 293-296). RNAi involves a catalytic-type reaction whereby new siRNAs are generated through successive cleavage of longer dsRNA. Thus, unlike antisense, RNAi degrades target RNA in a non-stoichiometric manner. When administered to a cell or organism, exogenous dsRNA has been shown to direct the sequence-specific degradation of endogenous messenger RNA (mRNA) through RNAi.
- mRNA messenger RNA
- RNAi RNAi Technical Reference & Application Guide
- RNAi A Guide to Gene Silencing
- ALK-inhibiting siRNA products are also commercially available, and may be suitably employed in the method of the invention. See, e.g., Dharmacon, Inc., Lafayette, Colo. (Cat Nos. M-003162-03, MU-003162-03, D-003162-07 thru -10 (siGENOMETM SMARTselection and SMARTpool® siRNAs).
- dsRNA less than 49 nucleotides in length, and preferably 19-25 nucleotides, comprising at least one sequence that is substantially identical to part of a target mRNA sequence, and which dsRNA optimally has at least one overhang of 1-4 nucleotides at an end, are most effective in mediating RNAi in mammals. See U.S. Patent Publication Nos. 20040038921 and 20040229266. The construction of such dsRNA, and their use in pharmaceutical preparations to silence expression of a target protein, in vivo, are described in detail in such publications.
- 21-23 nt RNAs can be produced and tested for their ability to mediate RNAi in a mammalian cell, such as a human or other primate cell. Those 21-23 nt RNA molecules shown to mediate RNAi can be tested, if desired, in an appropriate animal model to further assess their in vivo effectiveness.
- Target sites that are known, for example target sites determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or antisense, or those targets known to be associated with a disease or condition such as those sites containing mutations or deletions, can be used to design siRNA molecules targeting those sites as well.
- the sequences of effective dsRNA can be rationally designed/predicted screening the target mRNA of interest for target sites, for example by using a computer folding algorithm.
- the target sequence can be parsed in silico into a list of all fragments or subsequences of a particular length, for example 23 nucleotide fragments, using a custom Perl script or commercial sequence analysis programs such as Oligo, MacVector, or the GCG Wisconsin Package.
- RNA sequence can be determined which sites are the most suitable target sites within the target RNA sequence. These parameters include but are not limited to secondary or tertiary RNA structure, the nucleotide base composition of the target sequence, the degree of homology between various regions of the target sequence, or the relative position of the target sequence within the RNA transcript. Based on these determinations, any number of target sites within the RNA transcript can be chosen to screen siRNA molecules for efficacy, for example by using in vitro RNA cleavage assays, cell culture, or animal models. See, e.g., U.S. Patent Publication No. 20030170891. An algorithm for identifying and selecting RNAi target sites has also recently been described. See U.S. Patent Publication No. 20040236517.
- DNA may also be introduced into cells using cationic liposomes (Feigner et al. (1987), Proc. Natl. Acad. Sci. USA 84: 7413).
- cationic lipid formulations include Tfx 50 (Promega) or Lipofectamin 200 (Life Technologies).
- viral vectors may be employed to deliver dsRNA to a cell and mediate RNAi. See U.S Patent Publication No. 20040023390.
- RNAi in mammalian cells are commercially available and have been well described. See, e.g., Dharmacon, Inc., DharmaFECTTM system; Promega, Inc., siSTRIKETTM U6 Hairpin system; see also Gou et al. (2003) FEES. 548, 113-118; Sui, G. et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells (2002) Proc. Natl. Acad. Sci. 99, 5515-5520; Yu et al. (2002) Proc. Natl. Acad. Sci. 99, 6047-6052; Paul, C. et al. (2002) Nature Biotechnology 19, 505-508; McManus et al. (2002) RNA 8, 842-850.
- siRNA interference in a mammal using prepared dsRNA molecules may then be effected by administering a pharmaceutical preparation comprising the dsRNA to the mammal.
- the pharmaceutical composition is administered in a dosage sufficient to inhibit expression of the target gene.
- dsRNA can typically be administered at a dosage of less than 5 mg dsRNA per kilogram body weight per day, and is sufficient to inhibit or completely suppress expression of the target gene.
- a suitable dose of dsRNA will be in the range of 0.01 to 2.5 milligrams per kilogram body weight of the recipient per day, preferably in the range of 0.1 to 200 micrograms per kilogram body weight per day, more preferably in the range of 0.1 to 100 micrograms per kilogram body weight per day, even more preferably in the range of 1.0 to 50 micrograms per kilogram body weight per day, and most preferably in the range of 1.0 to 25 micrograms per kilogram body weight per day.
- a pharmaceutical composition comprising the dsRNA is administered once daily, or in multiple sub-doses, for example, using sustained release formulations well known in the art. The preparation and administration of such pharmaceutical compositions may be carried out accordingly to standard techniques, as further described below.
- Such dsRNA may then be used to inhibit ALK expression and activity in a cancer, by preparing a pharmaceutical preparation comprising a therapeutically-effective amount of such dsRNA, as described above, and administering the preparation to a human subject having a cancer (e.g., kidney cancer) expressing an ALK fusion protein or aberrantly expressing full length ALK polypeptide, for example, via direct injection to the tumor.
- a cancer e.g., kidney cancer
- ALK inhibitors are to be provided to patients in an amount/dosage, frequency and form (including standard excipients if needed) as determined by a competent clinician or pharmacist.
- the inhibitors may be provided orally, parentally, intravenously, for example. If the PF02341066 is used as an ALK inhibitor in the context of the invention, guidance for its delivery, dosage and formulation may be found in U.S. Pub. No. 2008/0300273, for example.
- ALK-inhibiting therapeutic compositions useful in the practice of the methods of the invention may be administered to a mammal by any means known in the art including, but not limited to oral or peritoneal routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal and topical (including buccal and sublingual) administration.
- oral or peritoneal routes including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal and topical (including buccal and sublingual) administration.
- a ALK-inhibiting therapeutic will generally be provided in the form of tablets or capsules, as a powder or granules, or as an aqueous solution or suspension.
- Tablets for oral use may include the active ingredients mixed with pharmaceutically acceptable carriers and excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives.
- suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents.
- Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.
- Capsules for oral use include hard gelatin capsules in which the active ingredient is mixed with a solid diluent, and soft gelatin capsules wherein the active ingredients is mixed with water or an oil such as peanut oil, liquid paraffin or olive oil.
- the pharmaceutical compositions of the invention will generally be provided in sterile aqueous solutions or suspensions, buffered to an appropriate pH and isotonicity. Suitable aqueous vehicles include Ringer's solution and isotonic sodium chloride.
- the carrier may consist exclusively of an aqueous buffer (“exclusively” means no auxiliary agents or encapsulating substances are present which might affect or mediate uptake of the ALK-inhibiting therapeutic).
- Aqueous suspensions may include suspending agents such as cellulose derivatives, sodium alginate, polyvinyl-pyrrolidone and gum tragacanth, and a wetting agent such as lecithin.
- suspending agents such as cellulose derivatives, sodium alginate, polyvinyl-pyrrolidone and gum tragacanth, and a wetting agent such as lecithin.
- Suitable preservatives for aqueous suspensions include ethyl and n-propyl p-hydroxybenzoate.
- ALK-inhibiting therapeutic compositions may also include encapsulated formulations to protect the therapeutic (e.g., a dsRNA compound or an antibody that specifically binds an ALK fusion polypeptide) against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- encapsulated formulations to protect the therapeutic (e.g., a dsRNA compound or an antibody that specifically binds an ALK fusion polypeptide) against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
- Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811; PCT publication WO 91/06309; and European patent publication EP-A-43075.
- An encapsulated formulation may comprise a viral coat protein.
- the viral coat protein may be derived from or associated with a virus, such as a polyoma virus, or it may be partially or entirely artificial.
- the coat protein may be a Virus Protein 1 and/or Virus Protein 2 of the polyoma virus, or a derivative thereof.
- ALK-inhibiting compounds can also comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations.
- a delivery vehicle including liposomes
- methods for the delivery of nucleic acid molecules are described in Akhtar et al., 1992 , Trends Cell Bio., 2, 139; D ELIVERY S TRATEGIES FOR A NTISENSE O LIGONUCLEOTIDE T HERAPEUTICS , ed. Akbtar, 1995, Maurer et al., 1999 , Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999 , Handb. Exp.
- ALK-inhibiting therapeutics can be administered to a mammalian tumor by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (see PCT Publication No. WO 00/53722).
- the therapeutic/vehicle combination is locally delivered by direct injection or by use of an infusion pump.
- Direct injection of the composition can take place using standard needle and syringe methodologies, or by needle-free technologies such as those described in Conry et al., 1999 , Clin. Cancer Res., 5, 2330-2337 and PCT Publication No. WO 99/3 1262.
- compositions of ALK-inhibiting therapeutics include salts of the above described compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
- a pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or patient, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell. For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
- Administration routes that lead to systemic absorption are desirable and include, without limitation: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular.
- Each of these administration routes exposes the ALK-inhibiting therapeutic to an accessible diseased tissue or tumor.
- the rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size.
- the use of a liposome or other drug carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES).
- RES reticular endothelial system
- a liposome formulation that can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach can provide enhanced delivery of the drug to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as cancer cells.
- compositions or formulations that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity.
- agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as Pluronic P85), which can enhance entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999 , Fundam. Clin. Pharmacol., 13, 16-26); biodegradable polymers, such as poly(DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich et al, 1999 , Cell Transplant, 8, 47-58) (Alkermes, Inc.
- ALK-inhibiting compounds useful in the method of the invention include material described in Boado et al., 1998 , J. Pharm. Sci., 87, 1308-1315; Tyler et al., 1999 , FEBS Lett., 421, 280-284; Pardridge et al., 1995 , PNAS USA., 92, 5592-5596; Boado, 1995 , Adv.
- compositions comprising surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes) may also be suitably employed in the methods of the invention.
- PEG-modified, or long-circulating liposomes or stealth liposomes may also be suitably employed in the methods of the invention.
- These formulations offer a method for increasing the accumulation of drugs in target tissues.
- This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011).
- liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995 , Biochim. Biophys. Acta, 1238, 86-90).
- the long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; PCT Publication No. WO 96/10391; PCT Publication No.
- Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
- compositions may include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent.
- Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in REMINGTON′S PHARMACEUTICAL SCIENCES, Mack Publishing Co. (A. R. Gennaro edit. 1985).
- preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
- antioxidants and suspending agents can be used.
- a pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state.
- the pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
- Dosage levels of the order of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per patient per day).
- the amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host treated and the particular mode of administration.
- Dosage unit forms generally contain between from about 1 mg to about 500 mg of an active ingredient. It is understood that the specific dose level for any particular patient depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
- the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
- An ALK-inhibiting therapeutic useful in the practice of the invention may comprise a single compound as described above, or a combination of multiple compounds, whether in the same class of inhibitor (e.g., antibody inhibitor), or in different classes (e.g., antibody inhibitors and small-molecule inhibitors). Such combination of compounds may increase the overall therapeutic effect in inhibiting the progression of a fusion protein-expressing cancer.
- Crizotinib also known as PF-02341066
- Pfizer, Inc. see U.S. Pub. No. 2008/0300273
- Crizotinib also known as PF-02341066
- PF-02341066 produced by Pfizer, Inc.
- NVP-TAE684 small molecule inhibitors of ALK
- the therapeutic composition may also comprise one or more non-specific chemotherapeutic agent in addition to one or more targeted inhibitors.
- non-specific chemotherapeutic agent in addition to one or more targeted inhibitors.
- the present invention is further directed to a method of monitoring the effectiveness of a cancer therapy, such as kidney cancer therapy.
- the method involves detecting the expression levels or activity levels of a polypeptide with ALK kinase activity in the relevant biological sample of the cancer patient prior to and after the cancer therapy.
- the expression levels of the polypeptide with ALK kinase activity are further quantified so as to be able to compare the values prior to therapy and after therapy.
- An increase or steady value in the expression and/or levels of the polypeptide with ALK kinase activity after therapy as compared to before therapy indicates that the cancer therapy is not effective.
- a decrease in the expression and/or activity level of the polypeptide with ALK kinase activity indicates an effective cancer therapy.
- the cancer therapy may include biological therapies, such as surgery, immunotherapeutics, chemotherapeutics, and radiation therapies, and targeted therapies, such as drugs or other substances intended to block the growth and spread of cancer by interfering with specific molecular in tumor growth.
- ALK inhibitor treatments such as the use of crizotinib (PF02341066), may be monitored according to the present invention.
- the invention further provides a method for determining whether a compound inhibits the progression of a cancer (e.g., a kidney cancer) driven by polypeptide with ALK kinase activity.
- the method comprises the step of determining whether the compound inhibits the expression and/or activity of the polypeptide with ALK kinase activity in the cancer.
- inhibition of expression and/or activity of the polypeptide with ALK kinase is determined by examining a biological sample comprising cells from bone marrow, blood, or a tumor.
- inhibition of expression and/or activity of polypeptide with ALK kinase is determined using at least one detection molecule as described herein.
- the tested compound may be any type of therapeutic or composition as described above. Methods for assessing the efficacy of a compound, both in vitro and in vivo, are well established and known in the art. For example, a composition may be tested for ability to inhibit ALK in vitro using a cell or cell extract in which ALK kinase is activated. A panel of compounds may be employed to test the specificity of the compound for ALK (as opposed to other targets, such as EGFR or PDGFR).
- Another technique for drug screening which may be used provides for high throughput screening of compounds having suitable binding affinity to a protein of interest, as described in PCT Publication No. WO 84/03564.
- this method as applied to ALK fusion polypeptides or full-length ALK polypeptide, large numbers of different small test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.
- the test compounds are reacted with a polypeptide of the invention, or fragments thereof, and washed. Bound polypeptide is then detected by methods well known in the art.
- a purified polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques.
- non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
- a compound found to be an effective inhibitor of ALK activity in vitro may then be examined for its ability to inhibit the progression of a cancer expressing a polypeptide with kinase activity (such as kidney cancer), in vivo, using, for example, mammalian xenografts harboring human kidney tumors that are express a polypeptide with ALK kinase activity.
- cancer cell lines known to express a polypeptide with ALK kinase activity may be placed subcutaneously in an animal (e.g., into a nude or SCID mouse, or other immune-compromised animal). The cells then grow into a tumor mass that may be visually monitored. The animal may then be treated with the drug.
- the effect of the drug treatment on tumor size may be externally observed.
- the animal is then sacrificed and the tumor removed for analysis by IHC and Western blot.
- mammalian bone marrow transplants may be prepared, by standard methods, to examine drug response in hematological tumors expressing a mutant ALK kinase.
- the drug's ability to alter signaling in the tumor cells or surrounding stromal cells may be determined by analysis with phosphorylation-specific antibodies.
- the drug's effectiveness in inducing cell death or inhibition of cell proliferation may also be observed by analysis with apoptosis specific markers such as cleaved caspase 3 and cleaved PARP.
- Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- the compounds exhibit high therapeutic indices.
- Tissue microarrays comprised of samples of cancers of the breast, pancreas, prostate, bladder, endometrium, kidney and various metastases were obtained from BioChain Institute, Inc., Hayward, Calif.
- Tissue arrays were deparaffinized through three changes of xylene for 5 minutes each, then rehydrated through two changes of 100% ethanol and 2 changes of 95% ethanol, each for 5 minutes. Slides were rinsed for 5 minutes each in three changes of diH 2 O, then were subjected to antigen retrieval in a Decloaking Chamber (Biocare Medical, Concord, Calif.) as follows. Slides were immersed in 250 ml 1.0 mM EDTA, pH 8.0 in a 24 slide holder from Tissue Tek. The Decloaking Chamber was filled with 500 ml diH2O, the slide holder was placed in the chamber touching the heat shield, and retrieval was performed with the following settings as set by the manufacturer: SP1 125° C.
- Slides were developed for 1 minute then rinsed in diH 2 O, Slides were counterstained by incubating in hematoxylin (Ready to Use Invitrogen, Carlsbad, Calif.; Catalog #00-8011) for 1 minute, rinsed for 30 seconds in diH2O, incubated for 20 seconds in bluing reagent (Richard Allan Scientific, Catalog #7301), then finally washed for 30 seconds in diH2O, Slides were dehydrated in 2 changes of 95% ethanol for 20 seconds each and 2 changes of 100% ethanol for 2 minutes each. Slides were cleared in 2 changes of xylene for 20 seconds each, then air dried. Coverslips were mounted using VectaMount (Vector Laboratories, Burlingame, Calif.). Slides were air dried, then evaluated under the microscope.
- kidney carcinomas and normal kidney tissue (331 carcinomas and 26 normal tissues) were acquired from BioChain Institute, Inc., Hayward, Calif. and Folio Biosciences Columbus, Ohio and stained with ALK (D5F3) XP® Rabbit mAb as described above. Staining was observed in 1 squamous cell carcinoma of the kidney ( FIG. 1) and 1 granular cell carcinoma ( FIG. 2 ).
- ALK was analyzed by fluorescent in situ hybridization (FISH) in a lymphoma tissue of the kidney (Z7020052 I6/J6) and a squamous cell carcinoma tissue of the kidney (Z6020052 G8/H8) with the use of a break-apart probe specific to the ALK locus (Vysis LSI ALK Dual Color, Break Apart Rearrangement Probe; Abbott Molecular).
- the Vysis probe contains two differently labeled probes on opposite sides of the breakpoint of the ALK gene: one approximately 250 kb probe for the telomeric side of the ALK breakpoint is labeled with SpectrumOrange and the centromeric probe is approximately 300 kb and labeled with SpectrumGreen.
- the 2p23 ALK region in its native state is seen as two immediately adjacent or fused orange/green (yellow) signals.
- Paraffin embedded tissue sections were re-hydrated and incubated for 1 hour in TE buffer pH 8 in boiling water. Sections were digested with pepsin Digest All III (Invitrogen) at 37° C. for 20-40 minutes. Slides were then fixed with NBF for 1 minute and then dehydrated. The probe and tissue were then co-denatured at 93° C. for 3 minutes and then allowed to incubate at 37° C. for 18 hours.
- HGF-stimulated MDCK cell lines were evaluated to assess whether crizotinib was acting by inhibition of c-Met or ALK using antibodies specific for either c-Met, ALK or ALK fusion polypeptides.
- MDCK were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. The cells were serum-starved overnight and then either stimulated with hepatocyte growth factor (HGF) (50 ng/ml) at 37° C. for 5 min or 24 h, or serum-starved for an additional 5 min or 24 h.
- HGF hepatocyte growth factor
- H3122 cells (expressing EML4-ALK fusion polypeptide) were used as a positive control for ALK.
- MKN45 cells were used as a positive control for pMet.
- the MDCK, H3122, and MKN45 cell lysates were analyzed by Western Blot.
- the membranes were probed with the following antibodies: pMet Y1234/5 antibody (Cell Signaling Technology, #3077), Met (25H2) mouse monoclonal antibody (Cell Signaling Technology, #3127), pALK Y1278/82/83 antibody (Cell Signaling Technology #3983), ALK (D5F3) XP®RmAb (Cell Signaling Technology #3633), and Beta Actin (Cell Signaling Technology #4970).
- the results of the Western blot are represented by a 1 second exposure ( FIG. 4A ) and a 15 second exposure ( FIG. 4B ).
- the MDCK cells (lanes 1, 2, 3, and 4) are positive for Met (Cell Signaling Technology #3127), but not ALK (Cell Signaling Technology #3633).
- ALK and/or an ALK fusion polypeptide of the invention in cancer sample is detected using RT-PCR. These methods have been previously described. See, e.g., Cools et al., N. Engl. J. Med. 348: 1201-1214 (2003).
- Genomic PCR is done with 50 to 100 ng of DNA in a 25 ⁇ L reaction containing LongAmp Taq DNA polymerase (New England Biolabs, Ipswich, Mass.) under the following conditions: 3 min at 95° C. followed by 30 cycles of 10 s at 95° C., 1 min at 55° C., and 10 min at 68° C. plus a final extension for 20 min at 68° C.
- LongAmp Taq DNA polymerase New England Biolabs, Ipswich, Mass.
- the genomic fusion points for the E13; A20 variant are identified using forward PCR primer Fusion-genome-S or a primer residing in EML4 intron 13 (AGGA GAGAAAGAGCTGCAGTG) (SEQ ID NO: 7) and reverse primer Fusion-genome-AS or a primer located in ALK intron 19 (GCTCTGAACCTTTCCATCATACTT) (SEQ ID NO:8).
- the forward primers are placed within EML4 exon 20 (ACTGGTCCCCAGACAACAAG) (SEQ ID NO:9) or intron 20 (TTACTCTGTCAAATTGATGCTGCT) (SEQ ID NO:10), whereas the reverse primer is Fusion-genome-AS.
- the PCR products are resolved on agarose gel; if they appear specific, the original PCR product is used for direct sequencing. However, if additional nonspecific fragments are present, the desired fragments are excised, gel purified, cloned, and sequenced.
- a fusion partner of ALK is determined by performing RNA ligase-mediated rapid amplification of 5′ and 3′ cDNA ends with GeneRacer kit (Invitrogen).
- First-strand cDNA is amplified with Advantage HD DNA polymerase mix (Clontech) using GeneRacer 5′ primer and ALK-6R primer (CATGAGGAAATCCAGTTCGTCCTG) (SEQ ID NO:11).
- GeneRacer 5′ primer and ALK-6R primer CATGAGGAAATCCAGTTCGTCCTG
- Subsequent nested PCR is done using GeneRacer 5′ nested primer and ALK-2R primer (GAGGTCTTGCCAGCAAAGCAGTAG) (SEQ ID NO:12).
- Amplification products are gel purified with QIAquick gel extraction (Qiagen) and cloned using pCR4-TOPO TA Cloning (Invitrogen). Sequencing is done using 3730 ⁇ 1 DNA Analyzer (Applied Biosystems). Sequencing products may be analyzed with Sequencer software (Gene Codes). Basic Local Alignment and Search Tool against the BLAT database4 is used to determine the identity of unknown sequences
- RT-PCR is performed on RNA extracted from the kidney cancer cell samples of patients. RT-PCR is carried out using One Step RT-PCR (Qiagen) and primers previously described in (Soda et al., Nature 2007; 448:561-6. Choi Y L, Takeuchi K, Soda M, et al. Identification of novel isoforms of the EML4-ALK transforming gene in non-small cell lung cancer. Cancer Res 2008; 68:4971-76. PCR conditions for the detection of EML4-ALK fusion transcript include cDNA synthesis at 50° C. for 30 min, denaturation at 95° C.
- glyceraldehyde-3-phosphate dehydrogenase (GAPDH; AACGACCACTTTGTCAAGCTC (SEQ ID NO:13) and CTCTCTTCCTCTTGTGCTCTTGC) (SEQ ID NO:14) are used. Twenty cycles of amplification are performed. PCR products are resolved on agarose gel and their sizes are determined by using Trackit 1 kb Plus DNA ladder (Invitrogen). Fragments representing EML4-ALK fusion product are excised, gel purified, cloned, and sequenced.
- ALK and ALK fusion polypeptides are investigated by Western blotting and immunoprecipitation with anti-ALK antibodies.
- Cell lysates are prepared from kidney cancer cells by removing media and rinsing the cells with ice-cold PBS.
- the PBS is removed and 0.5 ml ice-cold 1 ⁇ cell lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM Sodium pyrophosphate, 1 mM (3-glycerophosphate, 1 mM Na 3 VO 4 , 1 ⁇ g/ml Leupeptin) is added to each plate and incubated.
- the cells are transferred to micro centrifuge tubes and samples are sonicated on ice three times for 5 second each and microcentrifuged for 10 min at 14,000 ⁇ g.
- the cell lysate is incubated with the primary antibodies specific for ALK protein, pALK Y1278/82/83 antibody (CST #3893) and ALK (D5F3) XP® RmAb (CST #3633) overnight at 4° C.
- Protein A or G agarose beads are added and incubated with gentle rocking for 1-3 hours at 4° C.
- the sample is microcentrifuged for 30 s at 4° C., washed, and resuspended with 20 ⁇ l 3 ⁇ SDS sample buffer.
- the sample is loaded on an SDS-PAGE gel and analyzed by Western blotting.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/204,342 US20120101108A1 (en) | 2010-08-06 | 2011-08-05 | Anaplastic Lymphoma Kinase In Kidney Cancer |
US14/844,832 US10551383B2 (en) | 2010-08-06 | 2015-09-03 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
US16/729,736 US20200363417A1 (en) | 2010-08-06 | 2019-12-30 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
US17/479,010 US20220003771A1 (en) | 2010-08-06 | 2021-09-20 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US37152510P | 2010-08-06 | 2010-08-06 | |
US13/204,342 US20120101108A1 (en) | 2010-08-06 | 2011-08-05 | Anaplastic Lymphoma Kinase In Kidney Cancer |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/844,832 Continuation US10551383B2 (en) | 2010-08-06 | 2015-09-03 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
Publications (1)
Publication Number | Publication Date |
---|---|
US20120101108A1 true US20120101108A1 (en) | 2012-04-26 |
Family
ID=44630107
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/204,342 Abandoned US20120101108A1 (en) | 2010-08-06 | 2011-08-05 | Anaplastic Lymphoma Kinase In Kidney Cancer |
US14/844,832 Active US10551383B2 (en) | 2010-08-06 | 2015-09-03 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
US16/729,736 Abandoned US20200363417A1 (en) | 2010-08-06 | 2019-12-30 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
US17/479,010 Abandoned US20220003771A1 (en) | 2010-08-06 | 2021-09-20 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
Family Applications After (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/844,832 Active US10551383B2 (en) | 2010-08-06 | 2015-09-03 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
US16/729,736 Abandoned US20200363417A1 (en) | 2010-08-06 | 2019-12-30 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
US17/479,010 Abandoned US20220003771A1 (en) | 2010-08-06 | 2021-09-20 | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
Country Status (2)
Country | Link |
---|---|
US (4) | US20120101108A1 (fr) |
WO (1) | WO2012019132A2 (fr) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015157624A3 (fr) * | 2014-04-10 | 2015-12-10 | Memorial Sloan-Kettering Cancer Center | Nouvelle isoforme de la kinase du lymphome anaplasique et ses utilisations |
WO2015143264A3 (fr) * | 2014-03-21 | 2016-01-14 | Purdue Research Foundation | Biocapteurs de tyrosine kinase et procédés d'utilisation |
US20180299451A1 (en) * | 2017-04-14 | 2018-10-18 | Ministry Of Food And Drug Safety | TPM4-ALK fusion protein and composition for diagnosing cancer |
US10551383B2 (en) | 2010-08-06 | 2020-02-04 | Cell Signaling Technology, Inc. | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3474014B1 (fr) | 2013-03-15 | 2020-06-17 | Expression Pathology, Inc. | Dosage srm afin d'indiquer une thérapie contre le cancer |
EP3227686A4 (fr) * | 2014-12-03 | 2018-08-29 | Ignyta, Inc. | Analyses d'immunocytochimie multiplexées pour le diagnostic et le traitement d'un cancer |
WO2018155947A1 (fr) | 2017-02-24 | 2018-08-30 | 재단법인 대구경북첨단의료산업진흥재단 | Composition pharmaceutique comprenant un composé apte à traverser la barrière hémato-encéphalique en tant que principe actif pour prévenir ou traiter le cancer du cerveau |
CA3065423A1 (fr) * | 2017-06-02 | 2018-12-06 | Peter Dominiek Emiel Maria VERHAERT | Histochimie par spectrometrie de masse de peptides a partir d'un tissu disperse dans de la paraffine et fixe par le formaldehyde |
Family Cites Families (95)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3023787A1 (de) | 1980-06-25 | 1982-01-21 | Studiengesellschaft Kohle mbH, 4330 Mülheim | Verfahren zur erhoehung der inkorporation und der expression von genetischem material in die kerne von intakten zellen mit hilfe von liposomen |
US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
US4474893A (en) | 1981-07-01 | 1984-10-02 | The University of Texas System Cancer Center | Recombinant monoclonal antibodies |
US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
US4659678A (en) | 1982-09-29 | 1987-04-21 | Serono Diagnostics Limited | Immunoassay of antigens |
NZ207394A (en) | 1983-03-08 | 1987-03-06 | Commw Serum Lab Commission | Detecting or determining sequence of amino acids |
US4727022A (en) | 1984-03-14 | 1988-02-23 | Syntex (U.S.A.) Inc. | Methods for modulating ligand-receptor interactions and their application |
JPH07119760B2 (ja) | 1984-07-24 | 1995-12-20 | コモンウエルス・セ−ラム・ラボラトリ−ズ・コミッション | ミモトープを検出または決定する方法 |
US4676980A (en) | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
US5756696A (en) | 1986-01-16 | 1998-05-26 | Regents Of The University Of California | Compositions for chromosome-specific staining |
US5447841A (en) | 1986-01-16 | 1995-09-05 | The Regents Of The Univ. Of California | Methods for chromosome-specific staining |
US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
US6548640B1 (en) | 1986-03-27 | 2003-04-15 | Btg International Limited | Altered antibodies |
US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
DK0452457T3 (da) | 1989-11-03 | 1998-03-02 | Univ Vanderbilt | Fremgangsmåde til in vivo fjernelse af funktionelle fremmede gener |
WO1991010741A1 (fr) | 1990-01-12 | 1991-07-25 | Cell Genesys, Inc. | Generation d'anticorps xenogeniques |
US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
DE4002897A1 (de) | 1990-02-01 | 1991-08-08 | Behringwerke Ag | Herstellung und verwendung von genbanken synthetischer menschlicher antikoerper ("synthetische human-antikoerper-bibliotheken") |
ES2225816T5 (es) | 1990-02-01 | 2014-08-21 | Siemens Healthcare Diagnostics Products Gmbh | Producción y utilización de bancos de genes de anticuerpos humanos ("bibliotecas de anticuerpos humanos") |
US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
GB9015198D0 (en) | 1990-07-10 | 1990-08-29 | Brien Caroline J O | Binding substance |
US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
US5491224A (en) | 1990-09-20 | 1996-02-13 | Bittner; Michael L. | Direct label transaminated DNA probe compositions for chromosome identification and methods for their manufacture |
JP4124480B2 (ja) | 1991-06-14 | 2008-07-23 | ジェネンテック・インコーポレーテッド | 免疫グロブリン変異体 |
US5565332A (en) | 1991-09-23 | 1996-10-15 | Medical Research Council | Production of chimeric antibodies - a combinatorial approach |
US6025165A (en) | 1991-11-25 | 2000-02-15 | Enzon, Inc. | Methods for producing multivalent antigen-binding proteins |
CA2124967C (fr) | 1991-12-17 | 2008-04-08 | Nils Lonberg | Animaux transgeniques non humains capables de produire des anticorps heterologues |
WO1994002595A1 (fr) | 1992-07-17 | 1994-02-03 | Ribozyme Pharmaceuticals, Inc. | Procede et reactif pour le traitement de maladies chez les animaux |
US6710174B2 (en) | 2001-09-13 | 2004-03-23 | Isis Pharmaceuticals, Inc. | Antisense inhibition of vascular endothelial growth factor receptor-1 expression |
IL108367A0 (en) | 1993-01-27 | 1994-04-12 | Hektoen Inst For Medical Resea | Antisense polynzcleotide inhibition of human growth factor-sensitive cancer cells |
US6340674B1 (en) | 1993-03-26 | 2002-01-22 | Thomas Jefferson University | Method of inhibiting the proliferation and causing the differentiation of cells with IGF-1 receptor antisense oligonucleotides |
US5480971A (en) | 1993-06-17 | 1996-01-02 | Houghten Pharmaceuticals, Inc. | Peralkylated oligopeptide mixtures |
US5529925A (en) | 1993-12-03 | 1996-06-25 | St. Jude Children's Research Hospital | Nucleic acid sequences and fusion proteins present in human t(2;5) lymphoma |
PT1231268E (pt) | 1994-01-31 | 2005-11-30 | Univ Boston | Bancos de anticorpos policlonais |
US6074642A (en) | 1994-05-02 | 2000-06-13 | Alexion Pharmaceuticals, Inc. | Use of antibodies specific to human complement component C5 for the treatment of glomerulonephritis |
US5885613A (en) | 1994-09-30 | 1999-03-23 | The University Of British Columbia | Bilayer stabilizing components and their use in forming programmable fusogenic liposomes |
US5820873A (en) | 1994-09-30 | 1998-10-13 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
US5753613A (en) | 1994-09-30 | 1998-05-19 | Inex Pharmaceuticals Corporation | Compositions for the introduction of polyanionic materials into cells |
US5783683A (en) | 1995-01-10 | 1998-07-21 | Genta Inc. | Antisense oligonucleotides which reduce expression of the FGFRI gene |
US5675063A (en) | 1995-02-28 | 1997-10-07 | Loyola University Of Chicago | Immortalized rabbit hybridoma fusion partner |
WO1997008320A1 (fr) | 1995-08-18 | 1997-03-06 | Morphosys Gesellschaft Für Proteinoptimierung Mbh | Banques de proteines/(poly)peptides |
US6395713B1 (en) | 1997-07-23 | 2002-05-28 | Ribozyme Pharmaceuticals, Inc. | Compositions for the delivery of negatively charged molecules |
US6617162B2 (en) | 2001-12-18 | 2003-09-09 | Isis Pharmaceuticals, Inc. | Antisense modulation of estrogen receptor alpha expression |
WO1999031262A2 (fr) | 1997-12-16 | 1999-06-24 | Valentis, Inc. | Injection sans aiguille de molecules d'acide nucleique formules |
US7300753B2 (en) | 1998-09-04 | 2007-11-27 | John Rush | Immunoaffinity isolation of modified peptides from complex mixtures |
US6573043B1 (en) | 1998-10-07 | 2003-06-03 | Genentech, Inc. | Tissue analysis and kits therefor |
WO2000053722A2 (fr) | 1999-03-10 | 2000-09-14 | Phogen Limited | Administration de substances a des cellules |
US7662793B2 (en) | 1999-06-18 | 2010-02-16 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Inhibition of human squamous cell carcinoma growth in vivo by epidermal growth factor receptor antisense RNA transcribed from a Pol III promoter |
US7829693B2 (en) | 1999-11-24 | 2010-11-09 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of a target gene |
IL151928A0 (en) | 2000-03-30 | 2003-04-10 | Whitehead Biomedical Inst | Rna sequence-specific mediators of rna interference |
US7785810B2 (en) | 2000-09-09 | 2010-08-31 | The Research Foundation Of State University Of New York | Method and compositions for isolating metastatic cancer cells, and use in measuring metastatic potential of a cancer thereof |
JP4095895B2 (ja) | 2000-12-01 | 2008-06-04 | マックス−プランク−ゲゼルシャフト ツール フォーデルング デル ヴィッセンシャフテン エー.ヴェー. | Rna干渉を媒介する短鎖rna分子 |
HUP0302525A2 (hu) | 2001-01-05 | 2003-10-28 | Abgenix, Inc. | Az inzulinszerű növekedési faktor I receptor elleni ellenanyagok |
JP2005514002A (ja) | 2001-05-17 | 2005-05-19 | ザ パブリック ヘルス リサーチ インスティテュート オブ ザ シティ オブ ニューヨーク,インコーポレーテッド | Rnaをアンチセンス攻撃するための標的部位の選択 |
US20040209832A1 (en) | 2001-11-30 | 2004-10-21 | Mcswiggen James | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
US20030170891A1 (en) | 2001-06-06 | 2003-09-11 | Mcswiggen James A. | RNA interference mediated inhibition of epidermal growth factor receptor gene expression using short interfering nucleic acid (siNA) |
WO2002102854A2 (fr) | 2001-06-20 | 2002-12-27 | Morphosys Ag | Anticorps bloquant l'activation d'une tyrosine kinase de type proteine receptrice, procedes permettant l'identification de cet anticorps et utilisations de celui-ci |
US20030099974A1 (en) | 2001-07-18 | 2003-05-29 | Millennium Pharmaceuticals, Inc. | Novel genes, compositions, kits and methods for identification, assessment, prevention, and therapy of breast cancer |
WO2003016861A2 (fr) | 2001-08-14 | 2003-02-27 | President And Fellows Of Harvard College | Quantification absolue de proteines et de formes modifiees de proteine par spectrometrie de masse multistade |
US20030219839A1 (en) | 2001-09-20 | 2003-11-27 | Katherine Bowdish | Anti-PDGF antibodies and methods for producing engineered antibodies |
US6734017B2 (en) | 2001-09-28 | 2004-05-11 | Isis Pharmaceuticals, Inc. | Antisense modulation of vascular endothelial growth factor receptor-2 expression |
DE10230997A1 (de) | 2001-10-26 | 2003-07-17 | Ribopharma Ag | Medikament zur Erhöhung der Wirksamkeit eines Rezeptor-vermittelt Apoptose in Tumorzellen auslösenden Arzneimittels |
JP2006508899A (ja) | 2002-05-20 | 2006-03-16 | アブジエニツクス・インコーポレイテツド | EGFrに対する抗体を使用する腎癌の治療方法 |
ES2442615T5 (es) | 2002-07-18 | 2023-03-16 | Merus Nv | Producción recombinante de mezclas de anticuerpos |
US20040023390A1 (en) | 2002-08-05 | 2004-02-05 | Davidson Beverly L. | SiRNA-mediated gene silencing with viral vectors |
ES2263862T3 (es) | 2003-03-07 | 2006-12-16 | Istituto Nazionale Per Lo Studio E La Cura Dei Tumori | Ensayo de quinasa de linfoma anaplasico, sus reactivos y composiciones. |
BRPI0408317A (pt) | 2003-03-14 | 2006-03-07 | Pharmacia Corp | anticorpos do receptor de igf-i para o tratamento de cáncer |
GB0305929D0 (en) | 2003-03-14 | 2003-04-23 | Novartis Ag | Organic compounds |
US7485291B2 (en) | 2003-06-03 | 2009-02-03 | Cell Genesys, Inc. | Compositions and methods for generating multiple polypeptides from a single vector using a virus derived peptide cleavage site, and uses thereof |
EP1648455A4 (fr) | 2003-07-23 | 2009-03-04 | Exelixis Inc | Modulateurs de la proteine alk (anaplastic lymphoma kinase) et leurs methodes d'utilisation |
MY147449A (en) | 2003-08-15 | 2012-12-14 | Novartis Ag | 2, 4-pyrimidinediamines useful in the treatment of neoplastic diseases, inflammatory and immune system disorders |
GB0321710D0 (en) | 2003-09-16 | 2003-10-15 | Novartis Ag | Organic compounds |
EP2418281B1 (fr) | 2003-10-24 | 2016-06-01 | Gencia Corporation | Procédés et compositions pour l'administration de polynucléotides |
AU2004295061B2 (en) * | 2003-11-21 | 2008-11-20 | Novartis Ag | 1H-imidazoquinoline derivatives as protein kinase inhibitors |
US20050214301A1 (en) | 2004-03-24 | 2005-09-29 | Cell Signaling Technology, Inc. | Antibodies specific for BCR-ABL fusion protein and uses thereof |
US7973061B2 (en) | 2004-03-31 | 2011-07-05 | Exelixis, Inc. | Anaplastic lymphoma kinase modulators and methods of use |
SI1959955T1 (sl) | 2005-12-05 | 2011-02-28 | Pfizer Prod Inc | Postopek zdravljenja abnormalne celične rasti |
EP2447359B1 (fr) | 2006-04-14 | 2015-11-04 | Cell Signaling Technology, Inc. | Défauts de gène et ALK kinase mutante dans des tumeurs solides humaines |
US7601716B2 (en) | 2006-05-01 | 2009-10-13 | Cephalon, Inc. | Pyridopyrazines and derivatives thereof as ALK and c-Met inhibitors |
US8106004B2 (en) | 2006-07-28 | 2012-01-31 | Children's Memorial Hospital | Methods of inhibiting tumor cell aggressiveness using the microenvironment of human embryonic stem cells |
EP1914240B1 (fr) | 2006-10-11 | 2009-12-02 | Astellas Pharma Inc. | Gène de fusion EML4-ALK |
CA2598893C (fr) | 2006-10-11 | 2012-04-10 | Astellas Pharma Inc. | Gene de fusion eml4-alk |
US8148391B2 (en) | 2006-10-23 | 2012-04-03 | Cephalon, Inc. | Fused bicyclic derivatives of 2,4-diaminopyrimidine as ALK and c-Met inhibitors |
BRPI0722384A2 (pt) | 2006-12-08 | 2012-06-12 | Irm Llc | compostos inibidores de proteÍna quinase, composiÇÕes contendo os mesmos bem como seus usos |
TWI389893B (zh) | 2007-07-06 | 2013-03-21 | Astellas Pharma Inc | 二(芳胺基)芳基化合物 |
EP2042191B1 (fr) | 2007-09-28 | 2013-01-02 | Roberto Chiarle | Kinase de lymphome anaplastique (ALK) en tant qu'oncoantigène pour une vaccination contre le lymphome |
US20110110923A1 (en) | 2008-02-12 | 2011-05-12 | The Brigham And Women's Hospital, Inc. | Fish assay for eml4 and alk fusion in lung cancer |
JP2011518836A (ja) | 2008-04-24 | 2011-06-30 | インサイト・コーポレイション | 大環状化合物およびそれらのキナーゼ阻害剤としての使用 |
JP5580332B2 (ja) * | 2008-12-18 | 2014-08-27 | ネルビアーノ・メデイカル・サイエンシーズ・エツセ・エルレ・エルレ | キナーゼ阻害剤として活性な置換インダゾール誘導体 |
AU2010248782B2 (en) | 2009-05-15 | 2015-06-11 | Insight Genetics, Inc. | Methods and compositions relating to fusions of ALK for diagnosing and treating cancer |
US20110045534A1 (en) | 2009-08-20 | 2011-02-24 | Cell Signaling Technology, Inc. | Nucleic Acid Cassette For Producing Recombinant Antibodies |
TWI518325B (zh) * | 2010-02-04 | 2016-01-21 | 自治醫科大學 | 對alk抑制劑具有先抗性或後抗性癌症的識別、判斷和治療 |
WO2011146945A2 (fr) * | 2010-05-21 | 2011-11-24 | Cell Signaling Technology, Inc. | Kinase alk et ros dans le cancer |
US20120101108A1 (en) | 2010-08-06 | 2012-04-26 | Cell Signaling Technology, Inc. | Anaplastic Lymphoma Kinase In Kidney Cancer |
-
2011
- 2011-08-05 US US13/204,342 patent/US20120101108A1/en not_active Abandoned
- 2011-08-05 WO PCT/US2011/046807 patent/WO2012019132A2/fr active Application Filing
-
2015
- 2015-09-03 US US14/844,832 patent/US10551383B2/en active Active
-
2019
- 2019-12-30 US US16/729,736 patent/US20200363417A1/en not_active Abandoned
-
2021
- 2021-09-20 US US17/479,010 patent/US20220003771A1/en not_active Abandoned
Non-Patent Citations (10)
Title |
---|
Chiarle et al., Nature Reviews 8:11-23, January 2008 * |
Debelenko et al., Modern Pathology 24:430-442, published on-line on November 12, 2010 * |
Inman et al., Molecular Pharmacology 62(1):65-74, 2002 * |
Kovacs et al., Int. J. Cancer 40:171-178, 1987 * |
Pavlovich et al., Genes, Chromosomes and Cancer 37:252-260, 2003 * |
Perner et al., Neoplasia 10(3):298-302, March 2008 * |
Soda et al., Nature 448:561-566, 2007 * |
Takauchi et al., Clinical Cancer Research 15:3143-3149, 2009 * |
Yoshida et al., Cancer Research 46:2139-2147, 1986 * |
Zhao et al., Cancer Genet Cytogenet 82:128-139, 1995 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10551383B2 (en) | 2010-08-06 | 2020-02-04 | Cell Signaling Technology, Inc. | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer |
WO2015143264A3 (fr) * | 2014-03-21 | 2016-01-14 | Purdue Research Foundation | Biocapteurs de tyrosine kinase et procédés d'utilisation |
US10160993B2 (en) | 2014-03-21 | 2018-12-25 | Purdue Research Foundation | Tyrosine kinase biosensors and methods of use |
WO2015157624A3 (fr) * | 2014-04-10 | 2015-12-10 | Memorial Sloan-Kettering Cancer Center | Nouvelle isoforme de la kinase du lymphome anaplasique et ses utilisations |
US10190104B2 (en) | 2014-04-10 | 2019-01-29 | Memorial Sloan Kettering Cancer Center | Isoform of anaplastic lymphoma kinase and its uses |
US20180299451A1 (en) * | 2017-04-14 | 2018-10-18 | Ministry Of Food And Drug Safety | TPM4-ALK fusion protein and composition for diagnosing cancer |
Also Published As
Publication number | Publication date |
---|---|
WO2012019132A3 (fr) | 2012-03-29 |
US20150369810A1 (en) | 2015-12-24 |
US20220003771A1 (en) | 2022-01-06 |
WO2012019132A2 (fr) | 2012-02-09 |
US10551383B2 (en) | 2020-02-04 |
US20200363417A1 (en) | 2020-11-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20220003771A1 (en) | Methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer | |
US20210349095A1 (en) | Ros kinase in lung cancer | |
US9539254B2 (en) | Mutant ROS expression in human cancer | |
US20220267854A1 (en) | Egfr and ros1 kinase in cancer | |
US20170275706A1 (en) | Alk and ros kinase in cancer | |
US20100143918A1 (en) | Translocation and mutant ros kinase in human non-small cell lung carcinoma |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: CELL SIGNALING TECHNOLOGY, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HAACK, HERBERT;CROSBY, KATHERINE ELEANOR;RIMKUNAS, VICTORIA MCGUINNESS;AND OTHERS;SIGNING DATES FROM 20111021 TO 20111026;REEL/FRAME:027243/0629 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |