US20100105043A1 - Methods for modulating embryonic stem cell differentiation - Google Patents

Methods for modulating embryonic stem cell differentiation Download PDF

Info

Publication number
US20100105043A1
US20100105043A1 US12/529,004 US52900408A US2010105043A1 US 20100105043 A1 US20100105043 A1 US 20100105043A1 US 52900408 A US52900408 A US 52900408A US 2010105043 A1 US2010105043 A1 US 2010105043A1
Authority
US
United States
Prior art keywords
zscan4
cell
seq
cells
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/529,004
Other languages
English (en)
Inventor
Minoru S. H. Ko
Geppino Falco
Sung-Lim Lee
Manuela Monti
Ilaria Stanghellini
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Priority to US12/529,004 priority Critical patent/US20100105043A1/en
Assigned to THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES reassignment THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FALCO, GEPPINO, LEE, SUNG-LIM, KO, MINORU S.H., MONTI, MANUELA, STANGHELLINI, ILARIA
Publication of US20100105043A1 publication Critical patent/US20100105043A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0608—Germ cells
    • C12N5/0611—Primordial germ cells, e.g. embryonic germ cells [EG]
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0393—Animal model comprising a reporter system for screening tests
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40—Regulators of development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian

Definitions

  • This application relates to the field of cellular differentiation, specifically to the methods of identifying and using a subpopulation of stem cells, which can be identified by the expression of Zscan4 or one or more Zscan4 co-expressed genes described herein, and the methods of inhibiting differentiation and prolonging viability by altering Zscan4.
  • This application also relates to the identification of Trim43 as a gene highly expressed at the morula stage.
  • Stem cells have been identified in several somatic tissues including the nervous system, bone marrow, epidermis, skeletal muscle, and liver. This ‘set-aside’ population of cells is believed to be responsible for maintaining homeostasis within individual tissues in adult animals. The number of stem cells and their decision to differentiate must be tightly controlled during embryonic development and in the adult animal to avoid premature aging or tumor formation. Different somatic stem cells share the properties of self-renewal and multi-developmental potential, suggesting the presence of common cellular machinery.
  • Embryonic stem (ES) cells can proliferate indefinitely in an undifferentiated state. Furthermore, ES cells are pluripotent cells, meaning that they can generate all of the cells present in the body (bone, muscle, brain cells, etc.). ES cells have been isolated from the inner cell mass of the developing murine blastocyst (Evans et al., Nature 292:154-156, 1981; Martin et al., Proc. Natl. Acad. Sci. U.S.A.
  • Zscan4 as a gene specifically expressed during the 2-cell embryonic stage and in embryonic stem cells. Further described herein is the identification of Zscan4 co-expressed genes which exhibit a similar expression pattern as Zscan4 in the developing embryo. Also described herein is the identification of Trim43 as a gene abundantly expressed at the morula stage of embryonic development.
  • the stem cell can be any type of stem cell, including, but not limited to, an embryonic stem cell, an embryonic germ cell, a germline stem cell or a multipotent adult progenitor cell.
  • Also provided herein is a method of promoting blastocyst outgrowth of an embryonic stem cell, comprising increasing the expression of Zscan4 in the embryonic stem cell, thereby promoting blastocyst outgrowth of the embryonic stem cell.
  • a method of identifying an undifferentiated subpopulation of stem cells expressing Zscan4 comprising transfecting stem cells with an expression vector comprising a Zscan4 promoter and a reporter gene, wherein expression of the reporter gene indicates Zscan4 is expressed in the subpopulation of stem cells.
  • the promoter is a Zscan4c promoter.
  • an isolated expression vector comprising a Zscan4 promoter operably linked to a heterologous polypeptide is also provided.
  • the Zscan4 promoter is a Zscan4c promoter.
  • the heterologous polypeptide is a marker, enzyme or fluorescent protein.
  • an expression vector comprising a Trim43 promoter operably linked to a heterologous polypeptide.
  • the Trim43 promoter comprises at least a portion of the nucleic acid sequence set forth as SEQ ID NO: 31. Isolated embryonic stem cells comprising the expression vectors described herein are also provided.
  • FIG. 1A is a series of digital images showing the expression profile of Zscan4 during preimplantation development by whole mount in situ hybridization. Hybridizations were performed simultaneously under the same experimental conditions for all preimplantation developmental stages. Images were taken at 200 ⁇ magnification using phase contrast. Zscan4 shows a transient and high expression in the late 2-cell embryos. Such a high level of expression was not observed in 3-cell (two examples indicated by red arrows) and 4-cell embryos.
  • FIG. 1B shows a graph of the expression levels of Zscan4 during preimplantation development quantitated by qRT-PCR analysis.
  • Three sets of 10 pooled embryos were collected from each stage (0, oocyte; 1,1-cell embryo; E2, early 2-cell embryo; L2, late 2-cell embryo; 4,4-cell embryo; 8,8-cell embryo; M, morula; and B, blastocyst) and used for qRT-PCR analysis.
  • the expression levels of Zscan4 were normalized to Chuk control, and the average expression levels at each stage are represented as a fold change compared to the expression level in oocytes.
  • FIG. 2A shows diagrams of the exon-intron structures of nine Zscan4 paralogs. New proposed gene symbols are shown in bold italics with the current gene symbols.
  • FIG. 2B illustrates the putative protein structures of Zscan4 paralogs, and shows predicted domains.
  • FIG. 3A is a diagram that illustrates the genomic structure of the Zscan4 locus (encompassing 850 kb on Chromosome 7).
  • the top panel shows genes near the Zscan4 locus.
  • the lower panel shows nine Zscan4 paralogous genes and their characteristic features. Six other genes (LOCs) are predicted in this region, but unrelated to Zscan4.
  • FIG. 3B is a diagram that depicts the TaqI-, MspI-, or TaqI/MspI-digested DNA fragment sizes predicted from the genome sequences assembled from individual BAC sequences.
  • FIG. 3A is a diagram that illustrates the genomic structure of the Zscan4 locus (encompassing 850 kb on Chromosome 7).
  • the top panel shows genes near the Zscan4 locus.
  • the lower panel shows nine Zscan4 paralogous genes and their characteristic features. Six other genes (LOCs) are predicted in this region, but unrelated to Zscan4.
  • FIG. 3B is a
  • 3C is a digital image that shows the Southern blot analysis of C57BL/6J genomic DNAs digested with TaqI, MspI, or TaqI/MspI restriction enzymes. Sizes of all DNA fragments hybridized with a Zscan4 probe (containing only exon 3 from cDNA clone C0348C03) matched with those predicted in FIG. 3B , validating the manually assembled sequences.
  • FIG. 4A is a table showing the three types of siRNA technologies used for the analysis of Zscan4 in preimplantation embryos and their target sequences (SEQ ID NOs: 54-59).
  • FIG. 4B is a diagram that illustrates the locations of siRNA target sequences in the Zscan4 cDNA.
  • FIG. 4C is a series of digital images showing the development of shZscan4-injected embryos. The morphology of representative embryos is shown. Stages of shZscan4-injected and shControl-injected embryos were assessed at 61 hrs, 80 hrs, 98 hrs and 108 hrs post-hCG injections.
  • FIG. 4D is a series of graphs showing the percentage of shZscan4- and shControl-injected embryos at each developmental stage.
  • FIG. 4E is a graph showing the transcript levels of Zscan4 in shControl-injected and shZscan4-injected 2-cell embryos by qRT-PCR analysis. The expression levels were normalized by Eef1a1.
  • FIGS. 5A-5C are a series of graphs indicating the number of embryos at each developmental stage following injection with shZscan4. Embryos received shZscan4-injection in the nucleus of one blastomere of early 2-cell embryos. The stages of shZscan4-(gray) and shControl-(white) microinjected embryos were assessed at 52 hrs, 74 hrs and 96 hrs post-hCG injections.
  • FIGS. 5D-5F show photographs of a 3-cell embryo (D), an unevenly cleaved embryo (E) and a mixed morula and blastocyst like embryo (F).
  • the 3-cell embryo has one blastomere that remained at the size of a 2-cell stage blastomere and two smaller blastomeres with the size of 4-cell stage blastomeres.
  • the 5-cell embryo has one delayed blastomere and four smaller blastomeres with the size of 8-cell blastomeres. These embryos eventually formed blastocyst-like structures, but seemed to be a mixture of a blastocyst-like cell mass and a morula-like cell mass.
  • the morula-like cell mass was developed from one blastomere receiving shZscan4 injection, as shown by the presence of GFP, which was carried in the shZscan4 plasmid ( FIG. 5G ). Magnification is 200 ⁇ .
  • FIG. 6A is an image that illustrates the expression of Zscan4 and Pou5f1 in blastocysts, blastocyst outgrowth and ES cells by whole mount in situ hybridization.
  • FIG. 6B is a schematic illustration of the Zscan4 expression patterns.
  • FIGS. 7A-7E is a series of tables comparing nucleotide and amino acid sequence similarity (percent identity) among human ZSCAN4, mouse Zscan4c, Zscan4d, and Zscan4f genes.
  • FIG. 8 is an illustration showing the Zscan4 syntenic regions of mouse and human genomes.
  • FIGS. 9A-9B is a series of graphs and photographs showing the development of embryos that received a siZscan4-injection in the cytoplasm.
  • FIG. 9A shows the percentage of embryos at each developmental stage for siControl-injected embryos (white bar) and siZscan4-injected embryos (gray bar) at 2.0, 3.5 and 4.0 d.p.c.
  • FIG. 9B shows the percentage of expanded and hatched blastocysts at 4.5 d.p.c. in siControl-injected embryos (gray bar; photograph (a)) and siZscan4-injected embryos (black bar; photograph (b)).
  • FIGS. 10A-10D are a series of graphs and a table showing the development of embryos that received plus-siZscan4-injection in cytoplasm.
  • FIG. 10A shows the percentage of embryos at each developmental stage for siControl-injected embryos (white bar) and plus-siZscan4-injected embryos (gray bar) at 2.0, 2.2, 3.0, and 4.0 days post coitus.
  • FIGS. 10B and 10C show the transcript levels of Zscan4 in siControl-injected embryos and plus-siZscan4-injected embryos, measured by qRT-PCR analysis and normalized by Chuk ( FIG. 10B ) and H2afz ( FIG. 10C ).
  • FIG. 10D provides the raw data of 3 biological replications of qRT-PCR analysis. ⁇ , the mean value of the cycle threshold for each biological replicate; ⁇ , the standard deviation.
  • FIG. 11 is an illustration depicting the expression vector comprising the Zscan4c promoter sequence and reporter gene Emerald.
  • the sequence of the expression vector is set forth as SEQ ID NO: 28.
  • FIG. 12A is a fluorescence activated cell sorting (FACS) graph showing a subpopulation of mouse ES expressing Zscan4.
  • Mouse ES cells were transfected with an expression vector comprising a Zscan4c promoter and a fluorescent reporter gene (Emerald). Expression of the reporter gene in a cell (an Emerald-positive cell) indicates the cell expresses Zscan4.
  • FIG. 12B is a graph showing expression levels of Zscan4c and Pou5f1 in the subpopulation of ES cells identified as Emerald-positive. The Y-axis represents the fold difference in gene expression between Emerald-positive and Emerald-negative cells.
  • FIGS. 13A-G are graphs showing expression profiles of Zscan4 and six genes co-expressed with Zscan4 in a sub-population of ES cells. Shown are the expression profiles of Zscan4 (A), AF067063 (B), Tcstv3 (C), Tho4 (D), Arginase II (E), BC061212 (F) and Gm428 (G)) in metaphase II oocytes (MII), 1 cell embryos, early 2 cell (e 2 cell) embryos, late 2 cell (l 2 cell) embryos, 4 cell embryos, 8 cell embryos, morula (mo) and blastocyts (bl).
  • MII metaphase II oocytes
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • SEQ ID NOs: 1 and 2 are the nucleotide sequences of forward and reverse PCR primers for amplification of Zscan4d from 2-cell embryos.
  • SEQ ID NOs: 3 and 4 are the nucleotide sequences of PCR primers for amplifying a probe designed to contain exon 3 of Zscan4.
  • SEQ ID NO: 5 is the nucleotide sequence of the Zscan4 PCR and sequencing primer Zscan4_For.
  • SEQ ID NO: 6 is the nucleotide sequence of the Zscan4 PCR and sequencing primer Zscan4_Rev.
  • SEQ ID NO: 7 is the nucleotide sequence of the Zscan4 sequencing primer Zscan4 — 400Rev.
  • SEQ ID NO: 8 is the nucleotide sequence of the Zscan4 sequencing primer Zscan4 — 300Rev.
  • SEQ ID NO: 9 is the nucleotide sequence of the shZscan4 siRNA.
  • SEQ ID NO: 10 is the nucleotide sequence of the siControl siRNA.
  • SEQ ID NO: 11 is the nucleotide sequence of Genbank Accession No. BC050218 (deposited Apr. 3, 2003), a cDNA clone derived from ES cells (Clone No. C0348C03).
  • SEQ ID NO: 12 is the nucleotide sequence of Zscan4-ps1.
  • SEQ ID NO: 13 is the nucleotide sequence of Zscan4-ps2.
  • SEQ ID NO: 14 is the nucleotide sequence of Zscan4-ps3.
  • SEQ ID Nos: 15 and 16 are the nucleotide and amino acid sequences of Zscan4a.
  • SEQ ID Nos: 17 and 18 are the nucleotide and amino acid sequences of Zscan4b.
  • SEQ ID Nos: 19 and 20 are the nucleotide and amino acid sequences of Zscan4c.
  • SEQ ID Nos: 21 and 22 are the nucleotide and amino acid sequences of Zscan4d.
  • SEQ ID Nos: 23 and 24 are the nucleotide and amino acid sequences of Zscan4e.
  • SEQ ID Nos: 25 and 26 are the nucleotide and amino acid sequences of Zscan4f.
  • SEQ ID NO: 27 is the nucleotide sequence of Genbank Accession No. XM 145358, deposited Jan. 10, 2006, incorporated by reference herein.
  • SEQ ID NO: 28 is the nucleotide sequence of the Zscan4-Emerald expression vector.
  • SEQ ID NOs: 29 and 30 are the nucleotide and amino acid sequences of human ZSCAN4 (Genbank Accession No. NM 152677, deposited Sep. 6, 2002, incorporated by reference herein).
  • SEQ ID NO: 31 is the nucleotide sequence of the Trim43 promoter.
  • SEQ ID Nos: 32 and 33 are the nucleotide and amino acid sequences of Trim43.
  • SEQ ID NOs: 34 and 35 are the nucleotide and amino acid sequences of AF067063, Genbank Accession No. NM 001001449, deposited May 29, 2004, incorporated by reference herein.
  • SEQ ID NOs: 36 and 37 are the nucleotide and amino acid sequences of BC061212, Genbank Accession No. NM 198667.1, deposited Nov. 15, 2003, incorporated by reference herein.
  • SEQ ID NOs: 38 and 39 are the nucleotide and amino acid sequences of Gm428, Genbank Accession No. NM 001081644, deposited Feb. 22, 2007, incorporated by reference herein.
  • SEQ ID NOs: 40 and 41 are the nucleotide and amino acid sequences of Arginase II, Genbank Accession No. NM 009705, deposited Jan. 26, 2000, incorporated by reference herein.
  • SEQ ID NOs: 42 and 43 are the nucleotide and amino acid sequences of Tcstyl, Genbank Accession No. NM 018756, deposited Jul. 12, 2007, incorporated by reference herein.
  • SEQ ID NOs: 44 and 45 are the nucleotide and amino acid sequences of Tcstv3, Genbank Accession No. NM 153523, deposited Oct. 13, 2002, incorporated by reference herein.
  • SEQ ID NOs: 46 and 47 are the nucleotide and amino acid sequences of Tho4, Genbank Accession No. XM 902103, deposited Dec. 2, 2005, incorporated by reference herein.
  • SEQ ID NOs: 48 and 49 are the nucleotide and amino acid sequences of Eif1a, Genbank Accession No. NM 010120, deposited Aug. 3, 2002, incorporated by reference herein.
  • SEQ ID NOs: 50 and 51 are the nucleotide and amino acid sequences of EG668777, Genbank Accession No. XM 001003556, deposited Apr. 27, 2006, incorporated by reference herein.
  • SEQ ID NOs: 52 and 53 are the nucleotide and amino acid sequences of Pif1, Genbank Accession No. NM 172453, deposited Dec. 24, 2002, incorporated by reference herein.
  • SEQ ID NO: 54 is the nucleotide sequence of the Plus-siZscan4 (J-064700-05) target sequence.
  • SEQ ID NO: 55 is the nucleotide sequence of the Plus-siZscan4 (J-064700-06) target sequence.
  • SEQ ID NO: 56 is the nucleotide sequence of the Plus-siZscan4 (J-064700-07) target sequence.
  • SEQ ID NO: 57 is the nucleotide sequence of the Plus-siZscan4 (J-064700-08) target sequence.
  • SEQ ID NO: 58 is the nucleotide sequence of the siZscan4 target sequence.
  • SEQ ID NO: 59 is the nucleotide sequence of the of shZscan4 target sequence.
  • SEQ ID NO: 60 is the nucleotide consensus sequence of nucleotides 1-1848 of Zscan4c, Zscan4d and Zscan4f.
  • a change in an effective amount of a substance of interest such as a polynucleotide or polypeptide.
  • the amount of the substance can be changed by a difference in the amount of the substance produced, by a difference in the amount of the substance that has a desired function, or by a difference in the activation of the substance.
  • the change can be an increase or a decrease.
  • the alteration can be in vivo or in vitro.
  • altering an effective amount of a polypeptide or polynucleotide is at least about a 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% increase or decrease in the effective amount (level) of a substance.
  • Altering an effective amount of a polypeptide or polypeptide includes increasing the expression of Zscan4 in a cell.
  • an alteration in a polypeptide or polynucleotide affects a physiological property of a cell, such as the differentiation, proliferation, or viability of the cell.
  • increasing expression of Zscan4 in a stem cell inhibits differentiation and promotes viability of the stem cell.
  • Blastocyst The structure formed in early mammalian embryogenesis, after the formation of the blastocele, but before implantation. It possesses an inner cell mass, or embryoblast, and an outer cell mass, or trophoblast.
  • the human blastocyst comprises 70-100 cells.
  • blastocyst outgrowth refers to the process of culturing embryonic stem cells derived from the inner cell mass of a blastocyst. Promoting blastocyst outgrowth refers to enhancing the viability and proliferation of embryonic stem cells derived from the blastocyst.
  • cDNA complementary DNA: A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences that determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
  • genes that are “co-expressed” with Zscan4 are genes that exhibit a similar expression pattern as Zscan4 during embryonic development and in ES cells. Specifically, the co-expressed genes are expressed in the same undifferentiated subpopulation of ES cells as Zscan 4, and during embryonic development, these genes are most abundantly expressed at the 2-cell stage.
  • Zscan4 co-expressed genes are described herein, including AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 and Pif1.
  • co-expressed genes are not limited to those disclosed herein, but include any genes exhibiting an expression pattern similar to Zscan4.
  • AF067063 encodes hypothetical protein LOC380878.
  • the full length cDNA sequence of AF067063 (SEQ ID NO: 34) is 886 base pairs in length and is organized into three exons encoding several hypothetical proteins (for example, SEQ ID NO: 35), which appear to be mouse specific.
  • BC061212 encodes a protein belonging to the PRAME (preferentially expressed antigen melanoma) family.
  • the full length cDNA sequence of BC061212 (SEQ ID NO: 36) is 1625 base pairs in length and is organized into four exons, encoding a protein of 481 residues in length (SEQ ID NO: 37).
  • Gm428 (gene model 428) encodes a hypothetical protein.
  • the full length cDNA sequence of Gm428 (SEQ ID NO: 38) is 1325 base pairs in length and is organized into five exons encoding a protein of 360 residues in length (SEQ ID NO: 39).
  • Arginase II belongs to the Arginase family and may play a role in the regulation of extra-urea cycle arginine metabolism, and in down-regulation of nitric oxide synthesis.
  • the full length cDNA sequence of Arginase II (SEQ ID NO: 40) is 1415 base pairs in length and is organized into eight exons encoding a protein of 354 residues in length (SEQ ID NO: 41).
  • Tsctv1 and Tsctv3 are splice variants.
  • the full length cDNA of Tsctvl (SEQ ID NO: 42) is 858 base pairs in length and contains two exons encoding a protein of 171 residues (SEQ ID NO: 43).
  • the full length cDNA sequence of Tsctv3 (SEQ ID NO: 44) is 876 base pairs in length and contains one exon encoding a protein of 169 residues (SEQ ID NO: 45).
  • This family of proteins consists of several hypothetical proteins of approximately 170 residues in length and appears to be mouse-specific.
  • Tho4 also called EG627488 encodes a protein with an RNA recognition motif (RRM) involved in regulation of alternative splicing, and protein components of small nuclear ribonucleoproteins (snRNPs).
  • RRM RNA recognition motif
  • snRNPs small nuclear ribonucleoproteins
  • Eif1a belongs to the eukaryotic translation initiation factor family.
  • the full length cDNA sequence of Eif1a (SEQ ID NO: 48) is 2881 base pairs in length and encodes a protein of 144 amino acids (SEQ ID NO: 49).
  • EG668777 is a predicted gene having similarity to retinoblastoma-binding protein 6, isoform 2.
  • the full length cDNA sequence of EG668777 is 1918 base pairs in length (SEQ ID NO: 50) and contains one exon encoding a protein of 547 residues (SEQ ID NO: 51).
  • Pif1 is an ATP-dependent DNA helicase.
  • the full length cDNA sequence of Pif1 (SEQ ID NO: 52) is 3680 base pairs in length and contains 12 exons encoding a protein of 650 amino acids (SEQ ID NO: 53).
  • Degenerate variant A polynucleotide encoding a polypeptide, such as a Zscan4 polypeptide, that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included as long as the amino acid sequence of the polypeptide encoded by the nucleotide sequence is unchanged.
  • Differentiation refers to the process by which a cell develops into a specific type of cell (for example, muscle cell, skin cell etc.).
  • differentiation of embryonic stem cells refers to the development of the cells toward a specific cell lineage. As a cell becomes more differentiated, the cell loses potency, or the ability to become multiple different cell types.
  • inhibiting differentiation means preventing or slowing the development of a cell into a specific lineage.
  • Embryonic stem (ES) cells Pluripotent cells isolated from the inner cell mass of the developing blastocyst. “ES cells” can be derived from any organism. ES cells can be derived from mammals. In one embodiment, ES cells are produced from mice, rats, rabbits, guinea pigs, goats, pigs, cows, monkeys and humans. Human and murine derived ES cells are preferred. ES cells are pluripotent cells, meaning that they can generate all of the cells present in the body (bone, muscle, brain cells, etc.). Methods for producing murine ES cells can be found in U.S. Pat. No. 5,670,372, herein incorporated by reference. Methods for producing human ES cells can be found in U.S. Pat. No. 6,090,622, PCT Publication No. WO 00/70021 and PCT Publication No. WO 00/27995, herein incorporated by reference.
  • Expand A process by which the number or amount of cells in a cell culture is increased due to cell division. Similarly, the terms “expansion” or “expanded” refers to this process.
  • the terms “proliferate,” “proliferation” or “proliferated” may be used interchangeably with the words “expand,” “expansion”, or “expanded.” Typically, during expansion, the cells do not differentiate to form mature cells.
  • a vector is a nucleic acid molecule allowing insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and/or integrate in a host cell.
  • a vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
  • a vector can also include one or more selectable marker genes and other genetic elements.
  • An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes.
  • heterologous polypeptide or polynucleotide refers to a polypeptide or polynucleotide derived from a different source or species.
  • Host cells Cells in which a vector can be propagated and its DNA expressed.
  • the cell may be prokaryotic or eukaryotic.
  • the term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term “host cell” is used.
  • Isolated An isolated nucleic acid has been substantially separated or purified away from other nucleic acid sequences and from the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA.
  • isolated thus encompasses nucleic acids purified by standard nucleic acid purification methods.
  • the term also embraces nucleic acids prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
  • isolated proteins have been substantially separated or purified from other proteins of the cells of an organism in which the protein naturally occurs, and encompasses proteins prepared by recombination expression in a host cell as well as chemically synthesized proteins.
  • Multipotent cell refers to a cell that can form multiple cell lineages, but not all cell lineages.
  • Non-human animal Includes all animals other than humans.
  • a non-human animal includes, but is not limited to, a non-human primate, a farm animal such as swine, cattle, and poultry, a sport animal or pet such as dogs, cats, horses, hamsters, rodents, such as mice, or a zoo animal such as lions, tigers or bears.
  • the non-human animal is a transgenic animal, such as a transgenic mouse, cow, sheep, or goat.
  • the transgenic non-human animal is a mouse.
  • a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • operably linked nucleic acid sequences are contiguous and where necessary to join two protein coding regions, in the same reading frame.
  • compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed are conventional. Remington's Pharmaceutical Sciences , by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
  • solid compositions e.g., powder, pill, tablet, or capsule forms
  • conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
  • compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate.
  • non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate.
  • Pharmaceutical agent A chemical compound, small molecule, or other composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or a cell. “Incubating” includes a sufficient amount of time for a drug to interact with a cell. “Contacting” includes incubating a drug in solid or in liquid form with a cell.
  • Pluripotent cell refers to a cell that can form all of an organism's cell lineages (endoderm, mesoderm and ectoderm), including germ cells, but cannot form an entire organisms autonomously.
  • Polynucleotide A nucleic acid sequence (such as a linear sequence) of any length. Therefore, a polynucleotide includes oligonucleotides, and also gene sequences found in chromosomes.
  • An “oligonucleotide” is a plurality of joined nucleotides joined by native phosphodiester bonds.
  • An oligonucleotide is a polynucleotide of between 6 and 300 nucleotides in length.
  • An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions.
  • oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.
  • Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
  • PNA peptide nucleic acid
  • Polypeptide A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred.
  • the terms “polypeptide” or “protein” as used herein are intended to encompass any amino acid sequence and include modified sequences such as glycoproteins.
  • the term “polypeptide” is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.
  • polypeptide fragment refers to a portion of a polypeptide which exhibits at least one useful epitope.
  • functional fragments of a polypeptide refers to all fragments of a polypeptide that retain an activity of the polypeptide, such as a Zscan4.
  • Biologically functional fragments can vary in size from a polypeptide fragment as small as an epitope capable of binding an antibody molecule to a large polypeptide capable of participating in the characteristic induction or programming of phenotypic changes within a cell, including affecting cell proliferation or differentiation.
  • An “epitope” is a region of a polypeptide capable of binding an immunoglobulin generated in response to contact with an antigen.
  • soluble refers to a form of a polypeptide that is not inserted into a cell membrane.
  • substantially purified polypeptide refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the polypeptide is at least 50%, for example at least 80% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the polypeptide is at least 90% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the polypeptide is at least 95% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • a Zscan4 polypeptide, or other polypeptides disclosed herein includes at most two, at most five, at most ten, at most twenty, or at most fifty conservative substitutions.
  • the immunologic identity of the protein may be assessed by determining whether it is recognized by an antibody; a variant that is recognized by such an antibody is immunologically conserved.
  • Any cDNA sequence variant will preferably introduce no more than twenty, and preferably fewer than ten amino acid substitutions into the encoded polypeptide.
  • Variant amino acid sequences may be, for example, at least 80%, 90% or even 95% or 98% identical to the native amino acid sequence.
  • Primers Short nucleic acids, for example DNA oligonucleotides ten nucleotides or more in length, which are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a DNA polymerase enzyme.
  • Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
  • Probes and primers as used herein may, for example, include at least 10 nucleotides of the nucleic acid sequences that are shown to encode specific proteins. In order to enhance specificity, longer probes and primers may also be employed, such as probes and primers that comprise 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of the disclosed nucleic acid sequences. Methods for preparing and using probes and primers are described in the references, for example Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor, N.Y.; Ausubel et al. (1987) Current Protocols in Molecular Biology , Greene Publ. Assoc.
  • PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
  • the term “specific for (a target sequence)” indicates that the probe or primer hybridizes under stringent conditions substantially only to the target sequence in a given sample comprising the target sequence.
  • Prolonging viability As used herein, “prolonging viability” of a stem cell refers to extending the duration of time a stem cell is capable of normal growth and/or survival.
  • a promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription.
  • a promoter also optionally includes distal enhancer or repressor elements.
  • a “constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an “inducible promoter” is regulated by an external signal or molecule (for example, a transcription factor).
  • Reporter gene is a gene operably linked to another gene or nucleic acid sequence of interest (such as a promoter sequence). Reporter genes are used to determine whether the gene or nucleic acid of interest is expressed in a cell or has been activated in a cell. Reporter genes typically have easily identifiable characteristics, such as fluorescence, or easily assayed products, such as an enzyme. Reporter genes can also confer antibiotic resistance to a host cell. In one embodiment, the reporter gene encodes the fluorescent protein Emerald. In another embodiment, the reporter gene encodes the fluorescent protein Strawberry.
  • Senescence The inability of a cell to divide further. A senescent cell is still viable, but does not divide.
  • Stem cell A cell having the unique capacity to produce unaltered daughter cells (self-renewal; cell division produces at least one daughter cell that is identical to the parent cell) and to give rise to specialized cell types (potency).
  • Stem cells include, but are not limited to, ES cells, EG cells, GS cells, MAPCs, maGSCs and USSCs.
  • stem cells can generate a fully differentiated functional cell of more than one given cell type. The role of stem cells in vivo is to replace cells that are destroyed during the normal life of an animal.
  • stem cells can divide without limit. After division, the stem cell may remain as a stem cell, become a precursor cell, or proceed to terminal differentiation.
  • a precursor cell is a cell that can generate a fully differentiated functional cell of at least one given cell type.
  • precursor cells can divide. After division, a precursor cell can remain a precursor cell, or may proceed to terminal differentiation.
  • Subpopulation An identifiable portion of a population.
  • a “subpopulation” of stem cells expressing Zscan4 is the portion of stem cells in a given population that has been identified as expressing Zscan4.
  • the subpopulation is identified using an expression vector comprising a Zscan4 promoter and a reporter gene, wherein detection of expression of the reporter gene in a cell indicates the cell expresses Zscan4 and is part of the subpopulation.
  • the subpopulation of ES cells expressing Zscan4 can further be identified by co-expression of one or more genes disclosed herein, including AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 and Pif1.
  • Totipotent cell refers to a cell that can form an entire organism autonomously. Only a fertilized egg (oocyte) possesses this ability (stem cells do not).
  • Transgenic animal A non-human animal, usually a mammal, having a non-endogenous (heterologous) nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line DNA (i.e., in the genomic sequence of most or all of its cells). Heterologous nucleic acid is introduced into the germ line of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal according to methods well known in the art.
  • a “transgene” is meant to refer to such heterologous nucleic acid, such as, heterologous nucleic acid in the form of an expression construct (such as for the production of a “knock-in” transgenic animal) or a heterologous nucleic acid that upon insertion within or adjacent to a target gene results in a decrease in target gene expression (such as for production of a “knock-out” transgenic animal).
  • Transfecting or transfection refers to the process of introducing nucleic acid into a cell or tissue. Transfection can be achieved by any one of a number of methods, such as, but not limited to, liposomal-mediated transfection, electroporation and injection.
  • Trim43 (tripartite motif-containing protein 43): A gene identified herein as exhibiting morula-specific expression during embryonic development.
  • the nucleotide and amino acid sequences of Trim43 are provided herein as SEQ ID NO: 32 and SEQ ID NO: 33, respectively.
  • Zscan4 A group of genes identified herein as exhibiting 2-cell embryonic stage and ES cell-specific expression.
  • Zscan4 refers to a collection of genes including three pseudogenes (Zscanl-ps1, Zscan4-ps2 and Zscan4-ps3) and six expressed genes (Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e and Zscan4f).
  • Zscan4 also includes human ZSCAN4.
  • Zscan4 refers to Zscan4 polypeptides and Zscan4 polynucleotides encoding the Zscan4 polypeptides.
  • Zscan4 polypeptides and polynucleotides encoding these polypeptides which are of use in inhibiting differentiation and increasing proliferation of cells, such as stem cells, including embryonic stem cells.
  • stem cells especially ES cells in the undifferentiated condition, were previously considered to be a relatively homogenous cell population.
  • Zscan4 in a subpopulation of stem cells, which establishes the presence of a unique cell population among undifferentiated ES cells and provides the means to identify and isolate these cells.
  • identification of nine genes co-expressed with Zscan4 in the undifferentiated ES cell subpopulation are also described herein.
  • Zscan4 is specifically expressed during the 2-cell embryonic stage and in a subpopulation of embryonic stem cells.
  • Zscan4-related genes including three pseudogenes (Zscan4-ps1, Zscan4-ps2 and Zscan4-ps3) and six expressed genes (Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e and Zscan4f).
  • the Zscan4 genus also includes human ZSCAN4.
  • AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 and Pif1 are co-expressed with Zscan4 during embryonic development. Like Zscan4, during embryonic development, these genes are expressed most abundantly at the 2-cell stage.
  • the use of Zscan4 includes the use of any Zscan4 gene, including Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e, Zscan4f and human ZSCAN4.
  • the Zscan4 gene is at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to Zscan4c (SEQ ID NO: 19), Zscan4d (SEQ ID NO: 21) or Zscan4f (SEQ ID NO: 25).
  • the Zscan4 gene comprises SEQ ID NO: 60.
  • increasing expression of Zscan4 in a stem cell comprises transfecting the stem cell with a nucleotide encoding Zscan4 operably linked to a promoter.
  • the promoter can be any type of promoter, including a constitutive promoter or an inducible promoter.
  • the stem cells are transfected with a vector comprising the nucleotide sequence encoding Zscan4 operably linked to the promoter.
  • the vector can be any type of vector, such as a viral vector or a plasmid vector.
  • the Zscan4 nucleotide sequence is at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to Zscan4c (SEQ ID NO: 19), Zscan4d (SEQ ID NO: 21) or Zscan4f (SEQ ID NO: 25).
  • the Zscan4 nucleotide sequence comprises SEQ ID NO: 60.
  • inhibiting differentiation of the stem cell increases viability of the stem cells. In another embodiment, inhibiting differentiation of the stem cell prevents senescence of the stem cell.
  • the stem cell can be any type of stem cell, including, but not limited to, an embryonic stem cell, an embryonic germ cell, a germline stem cell or a multipotent adult progenitor cell.
  • Also provided herein is a method of promoting blastocyst outgrowth of an embryonic stem cell comprising increasing the expression of Zscan4 in the embryonic stem cell, thereby promoting blastocyst outgrowth of the embryonic stem cell.
  • Promoting blastocyst outgrowth can include increasing the efficiency of outgrowth or increasing the number of embryonic stem cells resulting from blastocyst outgrowth.
  • the method comprises increasing expression of Zscan4 in the cells during the early stages of blastocyst outgrowth, such as prior to proliferation of the stem cells.
  • Zscan4 includes any Zscan4 gene, including Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e, Zscan4f, and human ZSCAN4.
  • the Zscan4 gene is at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to Zscan4c (SEQ ID NO: 19), Zscan4d (SEQ ID NO: 21) or Zscan4f (SEQ ID NO: 25).
  • the Zscan4 gene comprises SEQ ID NO: 60.
  • increasing the expression of Zscan4 in the stem cell comprises transfecting the stem cell with a nucleotide sequence encoding a Zscan4 operably linked to a promoter.
  • the promoter can be any type of promoter, including an inducible promoter or a constitutive promoter.
  • the cells are transfected with a vector comprising the nucleotide encoding Zscan4 operably linked to a promoter.
  • the vector can be any type of vector, including a viral vector or a plasmid vector.
  • the promoter is a Zscan4c promoter.
  • the Zscan4c promoter includes the nucleic acid sequence set forth as nucleotides 1-2540 of SEQ ID NO: 28, such as nucleotides 1-2643, 1-3250, or 1-3347 of SEQ ID NO: 28.
  • the expression vector comprises the nucleic acid sequence set forth as SEQ ID NO: 28.
  • the subpopulation of ES cells expressing Zscan4 are in an undifferentiated state. Further provided is a method of identifying the undifferentiated subpopulation of ES cells by detecting expression of one or more Zscan4 co-expressed genes, such as AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 and Pif1. Detection of expression of these genes can be accomplished using any means well known in the art, such as, for example, RT-PCR, Northern blot or in situ hybridization. Further provided are isolated stem cells identified according to this method.
  • an isolated expression vector comprising a Zscan4 promoter operably linked to a nucleic acid sequence encoding a heterologous polypeptide is also provided.
  • the Zscan4 promoter is a Zscan4c promoter.
  • the Zscan4c promoter comprises the nucleic acid sequence set forth as nucleotides 1-2540 of SEQ ID NO: 28, such as nucleotides 1-2643, 1-3250, or 1-3347 of SEQ ID NO: 28.
  • the heterologous polypeptide is a marker, enzyme or fluorescent protein.
  • the expression vector can be any type of vector, including, but not limited to a viral vector or a plasmid vector.
  • an ES cell line comprising an expression vector comprising a Zscan4 promoter operably linked to a heterologous polypeptide.
  • the Zscan4 promoter is a Zscan4c promoter.
  • the Zscan4c promoter comprises the nucleic acid sequence set forth as nucleotides 1-2540 of SEQ ID NO: 28, such as nucleotides 1-2643, 1-3250, or 1-3347 of SEQ ID NO: 28.
  • the heterologous polypeptide is a marker, enzyme or fluorescent protein.
  • the fluorescent protein is Emerald.
  • an isolated expression vector comprising a Trim43 promoter operably linked to a nucleic acid sequence encoding a heterologous polypeptide is also provided.
  • the Trim43 promoter comprises at least a portion of the nucleic acid sequence set forth as SEQ ID NO: 31.
  • the portion of SEQ ID NO: 31 to be included in the expression vector is at least a portion of SEQ ID NO: 31 that is capable of promoting transcription of the heterologous polypeptide in a cell in which Trim43 is expressed.
  • the Trim43 promoter sequence is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to SEQ ID NO: 31.
  • the Trim43 promoter comprises SEQ ID NO: 31.
  • the Trim43 promoter consists of SEQ ID NO: 31.
  • the heterologous polypeptide is a marker, enzyme or fluorescent protein.
  • the fluorescent protein is Strawberry.
  • the expression vector can be any type of vector, including, but not limited to a viral vector or a plasmid vector.
  • an ES cell line containing an expression vector comprising a Trim43 promoter operably linked to a heterologous polypeptide.
  • the Trim43 promoter comprises at least a portion of the nucleic acid sequence set forth as SEQ ID NO: 31.
  • the Trim43 promoter sequence is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to SEQ ID NO: 31.
  • the Trim43 promoter comprises SEQ ID NO: 31.
  • the Trim43 promoter consists of SEQ ID NO: 31.
  • the heterologous polypeptide is a marker, enzyme or fluorescent protein.
  • the fluorescent protein is Strawberry.
  • the Zscan4 antibodies specifically recognize Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e, Zscan4f or human ZSCAN4. Also provided are antibodies specific for each Zscan4 co-expressed gene, including antibodies raised against at least a portion of a polypeptide encoded by AF067063, Tcstv1/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 or Pif1.
  • transgenic animals harboring a transgene that includes the Zscan4 polynucleotide sequences disclosed herein. Also provided are transgenic animals harboring a transgene that includes polynucleotide sequences of one or more of the Zscan4 co-expressed genes. Such transgenic animals include, but are not limited to, transgenic mice.
  • transgenic non-human animal comprising a nucleic acid sequence (a transgene) encoding a heterologous polypeptide operably linked to a Zscan4 promoter.
  • the heterologous polypeptide is a marker, enzyme or fluorescent protein.
  • the heterologous polypeptide is fluorescent protein.
  • the fluorescent protein is Emerald.
  • the Zscan4 promoter is a Zscan4c promoter.
  • the Zscan4c promoter comprises the nucleic acid sequence set forth as nucleotides 1-2540 of SEQ ID NO: 28, such as nucleotides 1-2643, 1-3250, or 1-3347 of SEQ ID NO: 28.
  • the transgenic non-human animal further comprises a nucleic acid sequence encoding a heterologous polypeptide operably linked to a Trim43 promoter.
  • the Trim43 promoter comprises the nucleic acid sequence set forth as SEQ ID NO: 31.
  • the heterologous polypeptide can be, for example, a marker, enzyme or fluorescent protein.
  • the heterologous polypeptide is a fluorescent protein.
  • the fluorescent protein is Strawberry.
  • the transgenic non-human animal is a transgenic mouse.
  • transgenic non-human animal is a transgenic mouse.
  • a method for inhibiting differentiation of a stem cell is disclosed herein.
  • a method for increasing viability and/or inducing proliferation of a stem cell is also disclosed herein.
  • a method is also provided herein for inhibiting senescence of a stem cell.
  • the methods include altering the level of a Zscan4 polypeptide in the cell, thereby inhibiting differentiation and/or inducing proliferation of the cell, and/or inhibiting senescence of the cell.
  • the cell can be in vivo or in vitro.
  • Zscan4 blocks the 2- to 4-cell stage embryonic transition Inhibition of Zscan4 expression also prevents blastocysts from expanding and implanting and prevents the outgrowth of embryonic stem cells from blastocysts.
  • Zscan4 expression is only detected in a subpopulation of undifferentiated stem cells.
  • expression of Zscan4 plays an important role in maintaining ES cells in an undifferentiated state, which is necessary for ES cell viability and proliferation.
  • Zscan4 is also important in allowing outgrowth of ES cells from blastocysts.
  • methods of increasing expression of Zscan4 in a stem cell to inhibit differentiation, increase viability and prevent senescence of a stem cell also include increasing expression of Zscan4 to promote blastocyst outgrowth of ES cells.
  • Expression of Zscan4 can be increased to inhibit differentiation and/or induce proliferation.
  • expression of Zscan4 is increased as compared to a control.
  • Increased expression includes, but is not limited to, at least a 20% increase in the amount of Zscan4 mRNA or polypeptide in a cell as compared to a control, such as, but not limited to, at least about a 30%, 50%, 75%, 100%, or 200% increase of Zscan4 mRNA or polypeptide.
  • Suitable controls include a cell not contacted with an agent that alters Zscan4 expression, or not transfected with a vector encoding Zscan4, such as a wild-type stem cell. Suitable controls also include standard values.
  • Exemplary Zscan4 amino acid sequences are set forth in the Sequence Listing as SEQ ID NO: 16 (Zscan4a), SEQ ID NO: 18 (Zscan4b), SEQ ID NO: 20 (Zscan4c), SEQ ID NO: 22 (Zscan4d), SEQ ID NO: 24 (Zscan4e), SEQ ID NO: 26 (Zscan4f) and SEQ ID NO: 30 (human ZSCAN4).
  • Zscan4 polypeptides include polypeptides including an amino acid sequence at least about 80%, 85%, 90%, 95%, or 99% homologous to the amino acid sequence set forth in SEQ ID NO: 16, 18, 20, 22, 24, 26 or 30.
  • a Zscan4 polypeptide is a conservative variant of SEQ ID NO: 16, 18, 20, 22, 24, 26 or 30, such that it includes no more than fifty conservative amino acid substitutions, such as no more than two, no more than five, no more than ten, no more than twenty, or no more than fifty conservative amino acid substitutions in SEQ ID NO: 16, 18, 20, 22, 24, 26 or 30.
  • a Zscan4 polypeptide has an amino acid sequence as set forth in SEQ ID NO: 16, 18, 20, 22, 24, 26 or 30.
  • a fragment of a Zscan4 polypeptide includes at least 8, 10, 15, or 20 consecutive amino acids of the Zscan4 polypeptide.
  • a fragment of a Zscan4 polypeptide includes a specific antigenic epitope found on a full-length Zscan4.
  • a fragment of Zscan4 is a fragment that confers a function of Zscan4 when transferred into a cell of interest, such as, but not limited to, inhibiting differentiation or increasing proliferation of the cell.
  • Zscan4 polypeptide can purify using standard techniques for protein purification.
  • the substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel.
  • the purity of the Zscan4 polypeptide can also be determined by amino-terminal amino acid sequence analysis.
  • Zscan4 polypeptide primary amino acid sequences may result in peptides which have substantially equivalent activity as compared to the unmodified counterpart polypeptide described herein. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein.
  • Fusion proteins including a Zscan4 polypeptide and a second polypeptide of interest.
  • a linker can be included between the Zscan4 polypeptide and the second polypeptide of interest.
  • Fusion proteins include, but are not limited to, a polypeptide including a Zscan4 polypeptide and a marker protein.
  • the marker protein can be used to identify or purify a Zscan4 polypeptide.
  • Exemplary fusion proteins include, but are not limited to, green fluorescent protein, six histidine residues, or myc and a Zscan4 polypeptide.
  • Polynucleotides encoding a Zscan4 polypeptide are also provided, and are termed Zscan4 polynucleotides. These polynucleotides include DNA, cDNA and RNA sequences which encode a Zscan4. It is understood that all polynucleotides encoding a Zscan4 polypeptide are also included herein, as long as they encode a polypeptide with the recognized activity, such as the binding to an antibody that recognizes a Zscan4 polypeptide, or modulating cellular differentiation or proliferation.
  • the polynucleotides include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon.
  • a Zscan4 polynucleotide encodes a Zscan4 polypeptide, as disclosed herein.
  • Exemplary polynucleotide sequences encoding Zscan4 are set for in the Sequence Listing as SEQ ID NO: 12 (Zscan4-ps1), SEQ ID NO: 13 (Zscan4-ps2), SEQ ID NO: 14 (Zscan4-ps3), SEQ ID NO: 15 (Zscan4a), SEQ ID NO: 17 (Zscan4b), SEQ ID NO: 19 (Zscan4c), SEQ ID NO: 21 (Zscan4d), SEQ ID NO: 23 (Zscan4e), SEQ ID NO: 25 (Zscan4f) and SEQ ID NO: 29 (human ZSCAN4).
  • the Zscan4 polynucleotide sequence is at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to Zscan4c (SEQ ID NO: 19), Zscan4d (SEQ ID NO: 21) or Zscan4f (SEQ ID NO: 25).
  • the Zscan4 gene comprises SEQ ID NO: 60.
  • the Zscan4 polynucleotides include recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences.
  • the nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single- and double-stranded forms of DNA.
  • fragments of the above-described nucleic acid sequences that are at least 15 bases in length, which is sufficient to permit the fragment to selectively hybridize to DNA that encodes the disclosed Zscan4 polypeptide (e.g., a polynucleotide that encodes SEQ ID NO: 16, 18, 20, 22, 24, 26 or 30) under physiological conditions.
  • the term “selectively hybridize” refers to hybridization under moderately or highly stringent conditions, which excludes non-related nucleotide sequences.
  • RNA interference also contemplated herein is the use of a Zscan4 polynucleotide, or the complement of a Zscan4 polynucleotide, for RNA interference. Fragments of Zscan4 polynucleotides or their complements can be designed as siRNA molecules to inhibit expression of one or more Zscan4 proteins. In one embodiment, the siRNA compounds are fragments of a Zscan4 pseudogene. Methods of preparing and using siRNA are generally disclosed in U.S. Pat. No. 6,506,559, incorporated herein by reference (see also reviews by Milhavet et al., Pharmacological Reviews 55:629-648, 2003; and Gitlin et al., J. Virol. 77:7159-7165, 2003; incorporated herein by reference). The double-stranded structure of siRNA can be formed by a single self-complementary RNA strand or two complementary RNA strands.
  • the siRNA can comprise one or more strands of polymerized ribonucleotide, and may include modifications to either the phosphate-sugar backbone or the nucleoside.
  • the phosphodiester linkages of natural RNA can be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure can be tailored to allow specific genetic inhibition while avoiding a general panic response in some organisms which is generated by dsRNA.
  • bases can be modified to block the activity of adenosine deaminase.
  • Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition. Nucleic acid containing a nucleotide sequence identical to a portion of a target sequence can be used for inhibition. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Sequence identity may be optimized by alignment algorithms known in the art and calculating the percent difference between the nucleotide sequences. Alternatively, the duplex region of the RNA can be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript.
  • Sequence identity can optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of particular target gene sequence is preferred.
  • the duplex region of the RNA can be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the particular target gene (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing).
  • the length of the identical nucleotide sequences may be at least 20, 25, 50, 100, 200, 300 or 400 bases. A 100% sequence identity between the RNA and Zscan4 is not required to practice the present methods.
  • the RNA can be directly introduced into the cell (such as intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing an organism in a solution containing RNA.
  • Physical methods of introducing nucleic acids include injection of a solution containing the RNA, bombardment by particles covered by the RNA, soaking the cell or organism in a solution of the RNA, or electroporation of cell membranes in the presence of the RNA.
  • a viral construct packaged into a viral particle can efficiently introduce an expression construct into the cell can provide transcription of RNA encoded by the expression construct.
  • RNA may be introduced along with components that perform one or more of the following activities: enhance RNA uptake by the cell, promote annealing of the duplex strands, stabilize the annealed strands, or other-wise increase inhibition of the target gene.
  • RNA may be synthesized either in vivo or in vitro. Endogenous RNA polymerase of the cell can mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro. For transcription from a transgene in vivo or an expression construct, a regulatory region can be used to transcribe the RNA strand (or strands). RNA may be chemically or enzymatically synthesized by manual or automated reactions. The RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (for example, T3, T7, SP6). The use and production of expression constructs are known in the art (for example, PCT Publication No.
  • RNA can be purified prior to introduction into the cell.
  • RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.
  • the RNA can be used with no or a minimum of purification to avoid losses due to sample processing.
  • the RNA can be dried for storage or dissolved in an aqueous solution. The solution can contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
  • a polynucleotide encoding Zscan4 can be included in an expression vector to direct expression of the Zscan4 nucleic acid sequence.
  • other expression control sequences including appropriate promoters, enhancers, transcription terminators, a start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons can be included in an expression vector.
  • expression control sequences include a promoter, a minimal sequence sufficient to direct transcription.
  • the expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells (e.g. an antibiotic resistance cassette).
  • Vectors suitable for use include, but are not limited, to the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J. Biol. Chem. 263:3521, 1988).
  • the expression vector will include a promoter.
  • the promoter can be inducible or constitutive.
  • the promoter can be tissue specific. Suitable promoters include the thymidine kinase promoter (TK), metallothionein I, polyhedron, neuron specific enolase, thyrosine hyroxylase, beta-actin, or other promoters.
  • the promoter is a heterologous promoter.
  • the polynucleotide encoding Zscan4 is located downstream of the desired promoter.
  • an enhancer element is also included, and can generally be located anywhere on the vector and still have an enhancing effect. However, the amount of increased activity will generally diminish with distance.
  • Expression vectors including a polynucleotide encoding Zscan4 can be used to transform host cells.
  • Hosts can include isolated microbial, yeast, insect and mammalian cells, as well as cells located in the organism.
  • Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art, and can be used to transfect any cell of interest.
  • the genetic change is generally achieved by introduction of the DNA into the genome of the cell (i.e., stable) or as an episome.
  • host cells can be used to produce Zscan4 polypeptides.
  • expression vectors can be used to transform host cells of interest, such as stem cells.
  • a “transfected cell” is a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding Zscan4. Transfection of a host cell with recombinant DNA may be carried out by conventional techniques as are well known in the art. Where the host is prokaryotic, such as E. coli , competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method using procedures well known in the art. Alternatively, MgCl 2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired, or by electroporation.
  • Eukaryotic cells When the host is a eukaryote, such as a stem cell, such methods of transfection of DNA as calcium phosphate co-precipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors may be used. Eukaryotic cells can also be cotransformed with DNA sequences encoding Zscan4, and a second foreign DNA molecule encoding a selectable phenotype, such as neomycin resistance.
  • a selectable phenotype such as neomycin resistance
  • Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein (see for example, Eukaryotic Viral Vectors , Cold Spring Harbor Laboratory, Gluzman ed., 1982).
  • a eukaryotic viral vector such as simian virus 40 (SV40) or bovine papilloma virus
  • SV40 simian virus 40
  • bovine papilloma virus bovine papilloma virus
  • the cell is a stem cell, such as, but not limited to, an embryonic stem cell, a germline stem cell or a multipotent adult progenitor cell.
  • a Zscan4 polypeptide, or a polynucleotide encoding the Zscan4 polypeptide is introduced into a stem cell to decrease differentiation and/or increase proliferation.
  • the cells are stem cells, such as embryonic stem cells.
  • stem cells such as embryonic stem cells.
  • murine, primate or human cells can be utilized.
  • ES cells can proliferate indefinitely in an undifferentiated state.
  • ES cells are totipotent cells, meaning that they can generate all of the cells present in the body (bone, muscle, brain cells, etc.).
  • ES cells have been isolated from the inner cell mass (ICM) of the developing murine blastocyst (Evans et al., Nature 292:154-156, 1981; Martin et al., Proc. Natl. Acad. Sci. 78:7634-7636, 1981; Robertson et al., Nature 323:445-448, 1986).
  • human cells with ES properties have been isolated from the inner blastocyst cell mass (Thomson et al., Science 282:1145-1147, 1998) and developing germ cells (Shamblott et al., Proc. Natl. Acad. Sci. USA 95:13726-13731, 1998), and human and non-human primate embryonic stem cells have been produced (see U.S. Pat. No. 6,200,806, which is incorporated by reference herein).
  • ES cells can be produced from human and non-human primates.
  • primate ES cells are isolated “ES medium” that express SSEA-3; SSEA-4, TRA-1-60, and TRA-1-81 (see U.S. Pat. No. 6,200,806).
  • ES medium consists of 80% Dulbecco's modified Eagle's medium (DMEM; no pyruvate, high glucose formulation, Gibco BRL), with 20% fetal bovine serum (FBS; Hyclone), 0.1 mM ⁇ -mercaptoethanol (Sigma), 1% non-essential amino acid stock (Gibco BRL).
  • primate ES cells are isolated on a confluent layer of murine embryonic fibroblast in the presence of ES cell medium.
  • embryonic fibroblasts are obtained from 12 day old fetuses from outbred mice (such as CF1, available from SASCO), but other strains may be used as an alternative.
  • Tissue culture dishes treated with 0.1% gelatin (type I; Sigma) can be utilized. Distinguishing features of ES cells, as compared to the committed “multipotential” stem cells present in adults, include the capacity of ES cells to maintain an undifferentiated state indefinitely in culture, and the potential that ES cells have to develop into every different cell types.
  • human ES (hES) cells do not express the stage-specific embryonic antigen SSEA-1, but express SSEA-4, which is another glycolipid cell surface antigen recognized by a specific monoclonal antibody (see, e.g., Amit et al., Devel. Biol. 227:271-278, 2000).
  • the zona pellucida is removed from blastocysts, such as by brief exposure to pronase (Sigma).
  • blastocysts are exposed to a 1:50 dilution of rabbit anti-marmoset spleen cell antiserum (for marmoset blastocysts) or a 1:50 dilution of rabbit anti-rhesus monkey (for rhesus monkey blastocysts) in DMEM for 30 minutes, then washed for 5 minutes three times in DMEM, then exposed to a 1:5 dilution of Guinea pig complement (Gibco) for 3 minutes.
  • lysed trophoectoderm cells are removed from the intact inner cell mass (ICM) by gentle pipetting, and the ICM plated on mouse inactivated (3000 rads gamma irradiation) embryonic fibroblasts.
  • ICM-derived masses are removed from endoderm outgrowths with a micropipette with direct observation under a stereo microscope, exposed to 0.05% Trypsin-EDTA (Gibco) supplemented with 1% chicken serum for 3-5 minutes and gently dissociated by gentle pipetting through a flame polished micropipette.
  • Trypsin-EDTA Gibco
  • Dissociated cells are re-plated on embryonic feeder layers in fresh ES medium, and observed for colony formation. Colonies demonstrating ES-like morphology are individually selected, and split again as described above. The ES-like morphology is defined as compact colonies having a high nucleus to cytoplasm ratio and prominent nucleoli. Resulting ES cells are then routinely split by brief trypsinization or exposure to Dulbecco's Phosphate Buffered Saline (PBS, without calcium or magnesium and with 2 mM EDTA) every 1-2 weeks as the cultures become dense. Early passage cells are also frozen and stored in liquid nitrogen.
  • PBS Dulbecco's Phosphate Buffered Saline
  • Cell lines may be karyotyped with a standard G-banding technique (such as by the Cytogenetics Laboratory of the University of Wisconsin State Hygiene Laboratory, which provides routine karyotyping services) and compared to published karyotypes for the primate species.
  • G-banding technique such as by the Cytogenetics Laboratory of the University of Wisconsin State Hygiene Laboratory, which provides routine karyotyping services
  • Isolation of ES cell lines from other primate species would follow a similar procedure, except that the rate of development to blastocyst can vary by a few days between species, and the rate of development of the cultured ICMs will vary between species. For example, six days after ovulation, rhesus monkey embryos are at the expanded blastocyst stage, whereas marmoset embryos do not reach the same stage until 7-8 days after ovulation.
  • the rhesus ES cell lines can be obtained by splitting the ICM-derived cells for the first time at 7-16 days after immunosurgery; whereas the marmoset ES cells were derived with the initial split at 7-10 days after immunosurgery.
  • Human ES cells can also be derived from preimplantation embryos from in vitro fertilized (IVF) embryos.
  • IVF in vitro fertilized
  • IVF-derived expanded human blastocysts grown in cellular co-culture, or in improved defined medium, allows isolation of human ES cells with the same procedures described above for non-human primates (see U.S. Pat. No. 6,200,806).
  • Precursor cells can also be utilized with the methods disclosed herein.
  • the precursor cells can be isolated from a variety of sources using methods known to one skilled in the art.
  • the precursor cells can be of ectodermal, mesodermal or endodermal origin. Any precursor cells which can be obtained and maintained in vitro can potentially be used in accordance with the present methods.
  • Such cells include cells of epithelial tissues such as the skin and the lining of the gut, embryonic heart muscle cells, and neural precursor cells (Stemple and Anderson, 1992, Cell 71:973-985).
  • the cells are mesenchymal progenitor cells.
  • Mesenchymal progenitors give rise to a very large number of distinct tissues (Caplan, J. Orth. Res 641-650, 1991).
  • Mesenchymal cells capable of differentiating into bone and cartilage have also been isolated from marrow (Caplan, J. Orth. Res. 641-650, 1991).
  • U.S. Pat. No. 5,226,914 describes an exemplary method for isolating mesenchymal stem cells from bone marrow.
  • the cells are epithelial progenitor cells or keratinocytes can be obtained from tissues such as the skin and the lining of the gut by known procedures (Rheinwald, Meth. Cell Bio. 21A:229, 1980). In stratified epithelial tissue such as the skin, renewal occurs by mitosis of precursor cells within the germinal layer, the layer closest to the basal lamina. Precursor cells within the lining of the gut provide for a rapid renewal rate of this tissue.
  • the cells can also be liver stem cells (see PCT Publication No. WO 94/08598) or kidney stem cells (see Karp et al., Dev. Biol. 91:5286-5290, 1994).
  • neuronal precursor cells are utilized.
  • Undifferentiated neural stem cells differentiate into neuroblasts and glioblasts which give rise to neurons and glial cells.
  • cells that are derived from the neural tube give rise to neurons and glia of the CNS.
  • Certain factors present during development such as nerve growth factor (NGF), promote the growth of neural cells.
  • NGF nerve growth factor
  • Methods of isolating and culturing neural stem cells and progenitor cells are well known to those of skill in the art (Hazel and Muller, 1997; U.S. Pat. No. 5,750,376). Methods for isolating and culturing neuronal precursor cells are disclosed, for example, in U.S. Pat. No. 6,610,540.
  • a Zscan4 promoter or a Trim43 promoter can be included in an expression vector to direct expression of a heterologous nucleic acid sequence.
  • Other expression control sequences including appropriate enhancers, transcription terminators, a start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons can be included with the Zscan4 or Trim43 promoter in an expression vector.
  • the promoter includes at least a minimal sequence sufficient to direct transcription of a heterologous nucleic acid sequence.
  • the heterologous nucleic acid sequence encodes a polypeptide.
  • the heterologous nucleic acid can be any RNA sequence of interest, such as an inhibitory RNA.
  • Expression vectors typically contain an origin of replication as well as specific genes which allow phenotypic selection of the transformed cells.
  • Vectors suitable for use include, but are not limited to the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J. Biol. Chem. 263:3521, 1988).
  • an enhancer is located upstream of the Zscan4 or Trim43 promoter, but enhancer elements can generally be located anywhere on the vector and still have an enhancing effect. However, the amount of increased activity will generally diminish with distance. Additionally, two or more copies of an enhancer sequence can be operably linked one after the other to produce an even greater increase in promoter activity.
  • an expression vector includes a nucleic acid sequence encoding a polypeptide of interest.
  • a polypeptide of interest can be a heterologous polypeptide, such as a polypeptide that affects a function of the transfected cell.
  • Polypeptides of interest include, but are not limited to, polypeptides that confer antibiotic resistance, receptors, oncogenes, and neurotransmitters.
  • a polypeptide of interest can also be a marker polypeptide, which is used to identify a cell of interest. Marker polypeptides include fluorescent polypeptides, enzymes, or antigens that can be identified using conventional molecular biology procedures.
  • the polypeptide can be a fluorescent marker (such as green fluorescent protein, Emerald (Invitrogen, Carlsbad, Calif.), Strawberry (Clontech, Mountain View, Calif.), Aequoria victoria , or Discosoma DSRed); an antigenic marker (such as human growth hormone, human insulin, human HLA antigens); a cell-surface marker (such as CD4, or any cell surface receptor); or an enzymatic marker (such as lacZ, alkaline phosphatase).
  • a fluorescent marker such as green fluorescent protein, Emerald (Invitrogen, Carlsbad, Calif.), Strawberry (Clontech, Mountain View, Calif.), Aequoria victoria , or Discosoma DSRed
  • an antigenic marker such as human growth hormone, human insulin, human HLA antigens
  • a cell-surface marker such as CD4, or any cell surface receptor
  • an enzymatic marker such as lacZ, alkaline phosphatase
  • RNA molecules transcribed from an expression vector need not always be translated into a polypeptide to express a functional activity.
  • Specific non-limiting examples of other molecules of interest include antisense RNA molecules complementary to an RNA of interest, ribozymes, small inhibitory RNAs, and naturally occurring or modified tRNAs.
  • Expression vectors including a Zscan4 or Trim43 promoter can be used to transform host cells.
  • Hosts can include isolated microbial, yeast, insect and mammalian cells, as well as cells located in the organism.
  • Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art, and can be used to transfect any cell of interest.
  • the genetic change is generally achieved by introduction of the DNA into the genome of the cell (stable integration).
  • the vector can also be maintained as an episome.
  • a “transfected cell” is a host cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule including a Zscan4 promoter element. Transfection of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E. coli , competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method using procedures well known in the art. Alternatively, MgCl 2 or RbC1 can be used. Transformation can also be performed after forming a protoplast of the host cell if desired, or by electroporation.
  • Eukaryotic cells can also be cotransformed with DNA sequences including the Zscan4 promoter, and a second foreign DNA molecule encoding a selectable phenotype, such as neomycin resistance.
  • Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein (see for example, Eukaryotic Viral Vectors , Cold Spring Harbor Laboratory, Gluzman ed., 1982).
  • a eukaryotic viral vector such as simian virus 40 (SV40) or bovine papilloma virus
  • SV40 simian virus 40
  • bovine papilloma virus bovine papilloma virus
  • an expression vector comprising a Zsan4 promoter sequence operably linked to a heterologous polypeptide is used to identify cells that express Zscan4.
  • the Zscan4 promoter is a Zscan4c promoter.
  • the Zscan4c promoter comprises Zsan4c exon and/or intron sequence.
  • the heterologous protein is typically a marker, an enzyme, or a fluorescent protein.
  • the heterologous protein is green fluorescent protein (GFP), or a variant of GFP, such as Emerald.
  • the subpopulation is identified by transfecting the stem cells with an expression vector, wherein the expression vector comprises a Zscan4 promoter sequence and a reporter gene.
  • the Zscan4 promoter is a Zscan4c promoter.
  • the Zscan4c promoter comprises the nucleic acid sequence set forth as nucleotides 1-2540 of SEQ ID NO: 28, such as nucleotides 1-2643, 1-3250, or 1-3347 of SEQ ID NO: 28.
  • the reporter gene can be any type of identifiable marker, such as an enzyme or a fluorescent protein.
  • the reporter gene is GFP or a variant of GFP, such as Emerald.
  • Expression of the reporter gene indicates the cell expresses Zscan4.
  • Methods of detecting expression of the reporter gene vary depending upon the type of reporter gene and are well known in the art. For example, when a fluorescent reporter is used, detection of expression can be achieved by fluorescence activated cell sorting or fluorescence microscopy. Identification of a subpopulation of stem cells expressing Zscan4 can be achieved with alternative methods, including, but not limited to, using antibodies specific for Zscan4 or by in situ hybridization.
  • the subpopulation of ES cells expressing Zscan4 is identified by detecting expression of one or more Zscan4 co-expressed genes, including AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 and Pif1.
  • an expression vector comprising a Trim43 promoter sequence operably linked to a heterologous polypeptide.
  • the heterologous protein is typically a marker, an enzyme, or a fluorescent protein.
  • the heterologous protein is the fluorescent protein Strawberry.
  • the Trim43 promoter sequence is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to SEQ ID NO: 31.
  • the Trim43 promoter comprises SEQ ID NO: 31.
  • the Trim43 promoter consists of SEQ ID NO: 31.
  • isolated ES cells comprising the Zscan4 or Trim43 expression vectors described herein.
  • the ES cells are a stable cell line.
  • the Zscan4 polynucleotide sequences disclosed herein can also be used in the production of transgenic animals such as transgenic mice, as described below.
  • Transgenic animals can also be produced that contain polynucleotide sequences of one or more Zscan4 co-expressed genes, including AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 and Pif1.
  • a non-human animal is generated that carries a transgene comprising a nucleic acid encoding Zscan4 operably linked to a promoter.
  • Specific promoters of use include, but are not limited to, a tissue specific promoter such as, but not limited to, an immunoglobulin promoter, a neuronal specific promoter, or the insulin promoter.
  • Specific promoters of use also include a constitutive promoter, such as, but not limited to, the thymidine kinase promoter or the human ⁇ -globin minimal, or an actin promoter, amongst others.
  • the Zscan4 promoter can also be used.
  • the transgenic non-human animal carries a transgene comprising a nucleic acid encoding a heterologous peptide, such as a marker, enzyme or fluorescent protein, operably linked to a Zscan4 promoter.
  • the Zscan4 promoter is a Zscan4c promoter, or a portion thereof.
  • the Zscan4c promoter comprises the nucleic acid sequence set forth as nucleotides 1-2540 of SEQ ID NO: 28, such as nucleotides 1-2643, 1-3250, or 1-3347 of SEQ ID NO: 28.
  • the heterologous peptide is the fluorescent protein Emerald.
  • the transgenic non-human animal carries a transgene comprising a nucleic acid encoding a heterologous peptide, such as a marker, enzyme or fluorescent protein, operably linked to a Trim43 promoter.
  • the Trim43 promoter comprises the nucleotide sequence of SEQ ID NO: 31, or a portion thereof.
  • the portion of SEQ ID NO: 31 to be included in the expression vector is at least a portion of SEQ ID NO: 31 that is capable of promoting transcription of the heterologous polypeptide in a cell in which Trim43 is expressed.
  • the Trim43 promoter sequence is at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identical to SEQ ID NO: 31.
  • the Trim43 promoter comprises SEQ ID NO: 31.
  • the Trim43 promoter consists of SEQ ID NO: 31.
  • the heterologous peptide is the fluorescent protein Strawberry.
  • the transgenic non-human animal carries two transgenes, a transgene comprising the Zscan4 promoter linked to a nucleic acid sequence encoding a heterologous peptide, and a transgene comprising the Trim43 promoter linked to a nucleic acid sequence encoding a heterologous peptide, as described above.
  • the transgenic non-human animal is a mouse comprising the Zscan4 promoter transgene and the Trim43 promoter transgene.
  • the heterologous polypeptide operably linked to the Zscan4 promoter sequence is the fluorescent protein Emerald and the heterologous polypeptide operably linked to the Trim43 promoter sequence is the fluorescent protein Strawberry. This mouse is referred to as a “rainbow” mouse (see Example 10 below).
  • Embryos obtained from transgenic “rainbow” animals exhibit green color at the late 2-cell stage and red color at the 4-cell to morula stages (with strongest expression at the morula stage).
  • the expression of these colors at the proper timing and intensity indicates the progress of a correct genetic program, and thus, can be used as indicators of proper development of preimplantation embryos.
  • These embryos have a variety of applications, including, but not limited to development of optimized culture media for human embryos for in vitro fertilization (IVF); training of technicians and clinicians in the IVF clinic and research laboratories; testing of chemical compounds and drugs for embryo toxicity; and as indicators of successful nuclear reprogramming for nuclear transplantation/cloning procedures.
  • nucleic acid sequences described herein can be introduced into a vector to produce a product that is then amplified, for example, by preparation in a bacterial vector, according to conventional methods (see, for example, Sambrook et al., Molecular Cloning: a Laboratory Manual , Cold Spring Harbor Press, 1989).
  • the amplified construct is thereafter excised from the vector and purified for use in producing transgenic animals.
  • any transgenic animal can be of use in the methods disclosed herein, provided the transgenic animal is a non-human animal.
  • a “non-human animal” includes, but is not limited to, a non-human primate, a farm animal such as swine, cattle, and poultry, a sport animal or pet such as dogs, cats, horses, hamsters, rodents, or a zoo animal such as lions, tigers or bears.
  • the non-human animal is a transgenic animal, such as, but not limited to, a transgenic mouse, cow, sheep, or goat.
  • the transgenic animal is a mouse.
  • the transgenic animal has altered proliferation and/or differentiation of a cell type as compared to a non-transgenic control (wild-type) animal of the same species.
  • a transgenic animal contains cells that bear genetic information received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by microinjection or infection with a recombinant virus, such that a recombinant DNA is included in the cells of the animal.
  • This molecule can be integrated within the animal's chromosomes, or can be included as extrachromosomally replicating DNA sequences, such as might be engineered into yeast artificial chromosomes.
  • a transgenic animal can be a “germ cell line” transgenic animal, such that the genetic information has been taken up and incorporated into a germ line cell, therefore conferring the ability to transfer the information to offspring. If such offspring in fact possess some or all of that information, then they, too, are transgenic animals.
  • Transgenic animals can readily be produced by one of skill in the art.
  • transgenic animals can be produced by introducing into single cell embryos DNA encoding a marker, in a manner such that the polynucleotides are stably integrated into the DNA of germ line cells of the mature animal and inherited in normal Mendelian fashion.
  • Advances in technologies for embryo micromanipulation permit introduction of heterologous DNA into fertilized mammalian ova.
  • totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means.
  • the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
  • developing embryos are infected with a retrovirus containing the desired DNA, and a transgenic animal is produced from the infected embryo.
  • the appropriate DNA(s) are injected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos are allowed to develop into mature transgenic animals.
  • These techniques are well known.
  • reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian (mouse, pig, rabbit, sheep, goat, cow) fertilized ova include: Hogan et al., Manipulating the Mouse Embryo , Cold Spring Harbor Press, 1986; Krimpenfort et al., Bio/Technology 9:86, 1991; Palmiter et al., Cell 41:343, 1985; Kraemer et al., Genetic Manipulation of the Early Mammalian Embryo , Cold Spring Harbor Laboratory Press, 1985; Hammer et al., Nature 315:680, 1985; Purcel et al., Science 244:1281, 1986; U.S. Pat. No. 5,175,385; U.
  • a Zscan4 polypeptide or a fragment or conservative variant thereof can be used to produce antibodies which are immunoreactive or specifically bind to an epitope of a Zscan4.
  • Polyclonal antibodies antibodies which consist essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations are included.
  • the Zscan4 antibodies recognize all Zscan4 proteins, including Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e, Zscan4f and human ZSCAN4.
  • the antibodies specifically recognize only one Zscan4 protein.
  • the ability of an antibody to specifically a particular Zscan4 protein means that the antibody detects expression of one Zscan4 protein, but none of the other Zscan4 proteins.
  • the antibodies recognize two or more different Zscan4 proteins.
  • a Zscan4 antibody may recognize only the Zscan4 proteins comprising a SCAN domain (e.g., Zscan4c, Zscan4d, Zscan4f).
  • a Zscan4 antibody may recognize only the Zscan4 proteins comprising the zinc finger domains, but lacking the SCAN domain (e.g., Zscan4a, Zscan4b, Zscan4e).
  • Antibodies can also be raised against one or more proteins encoded by genes identified herein as Zscan4 co-expressed genes.
  • a polypeptide encoded by AF067063, Tcstyl/Tcstv3, Tho4, Arginase II, BC061212 and Gm428, Eif1a, EG668777 or Pif1, or a fragment or conservative variant thereof can be used to produce antibodies which are immunoreactive or specifically bind to an epitope of the polypeptide.
  • antibodies can be generated that specifically bind Trim43.
  • a Trim43 polypeptide, or a fragment or conservative variant thereof can be used to produce antibodies which are immunoreactive or specifically bind to an epitope of Trim43.
  • polyclonal antibodies The preparation of polyclonal antibodies is well known to those skilled in the art. See, for example, Green et al., “Production of Polyclonal Antisera,” in: Immunochemical Protocols, pages 1-5, Manson, ed., Humana Press, 1992; Coligan et al., “Production of Polyclonal Antisera in Rabbits, Rats, Mice and Hamsters,” in: Current Protocols in Immunology , section 2.4.1, 1992.
  • monoclonal antibodies can be obtained by injecting mice with a composition comprising an antigen, verifying the presence of antibody production by removing a serum sample, removing the spleen to obtain B lymphocytes, fusing the B lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
  • Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography.
  • Multiplication in vitro may be carried out in suitable culture media such as Dulbecco's Modified Eagle Medium or RPMI 1640 medium, optionally supplemented by a mammalian serum such as fetal calf serum or trace elements and growth-sustaining supplements such as normal mouse peritoneal exudate cells, spleen cells, thymocytes or bone marrow macrophages.
  • suitable culture media such as Dulbecco's Modified Eagle Medium or RPMI 1640 medium
  • a mammalian serum such as fetal calf serum or trace elements
  • growth-sustaining supplements such as normal mouse peritoneal exudate cells, spleen cells, thymocytes or bone marrow macrophages.
  • Multiplication in vivo may be carried out by injecting cell clones into mammals histocompatible with the parent cells, such as syngeneic mice, to cause growth of antibody-producing tumors.
  • the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. After one to three weeks, the desired monoclonal antibody is recovered from the body fluid of the animal.
  • Antibodies can also be derived from a subhuman primate antibody.
  • General techniques for raising therapeutically useful antibodies in baboons can be found, for example, in PCT Publication No. WO 91/11465, 1991; and Losman et al., Int. J. Cancer 46:310, 1990.
  • an antibody that specifically binds a Zscan4 polypeptide can be derived from a humanized monoclonal antibody.
  • Humanized monoclonal antibodies are produced by transferring mouse complementarity determining regions from heavy and light variable chains of the mouse immunoglobulin into a human variable domain, and then substituting human residues in the framework regions of the murine counterparts.
  • the use of antibody components derived from humanized monoclonal antibodies obviates potential problems associated with the immunogenicity of murine constant regions. General techniques for cloning murine immunoglobulin variable domains are described, for example, by Orlandi et al., Proc. Natl. Acad. Sci. U.S.A. 86:3833, 1989.
  • Antibodies can be derived from human antibody fragments isolated from a combinatorial immunoglobulin library. See, for example, Barbas et al., in: Methods: a Companion to Methods in Enzymology , Vol. 2, page 119, 1991; Winter et al., Ann. Rev. Immunol. 12:433, 1994.
  • Cloning and expression vectors that are useful for producing a human immunoglobulin phage library can be obtained, for example, from STRATAGENE Cloning Systems (La Jolla, Calif.).
  • antibodies can be derived from a human monoclonal antibody.
  • Such antibodies are obtained from transgenic mice that have been “engineered” to produce specific human antibodies in response to antigenic challenge.
  • elements of the human heavy and light chain loci are introduced into strains of mice derived from embryonic stem cell lines that contain targeted disruptions of the endogenous heavy and light chain loci.
  • the transgenic mice can synthesize human antibodies specific for human antigens, and the mice can be used to produce human antibody-secreting hybridomas.
  • Methods for obtaining human antibodies from transgenic mice are described by Green et al., Nature Genet. 7:13, 1994; Lonberg et al., Nature 368:856, 1994; and Taylor et al., Int. Immunol. 6:579, 1994.
  • Antibodies include intact molecules as well as fragments thereof, such as Fab, F(ab′) 2 , and Fv which are capable of binding the epitopic determinant. These antibody fragments retain some ability to selectively bind with their antigen or receptor and are defined as follows:
  • Fab the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain;
  • Fab′ the fragment of an antibody molecule can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab′ fragments are obtained per antibody molecule;
  • (Fab′) 2 the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction;
  • F(ab′) 2 is a dimer of two Fab′ fragments held together by two disulfide bonds;
  • Fv defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
  • Single chain antibody defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
  • An epitope is any antigenic determinant on an antigen to which the paratope of an antibody binds.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • Antibody fragments can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli of DNA encoding the fragment.
  • Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
  • antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab′) 2 .
  • This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5 S Fab′ monovalent fragments.
  • an enzymatic cleavage using pepsin produces two monovalent Fab′ fragments and an Fc fragment directly (see U.S. Pat. No. 4,036,945 and U.S. Pat. No. 4,331,647, and references contained therein; Nisonhoff et al., Arch. Biochem. Biophys. 89:230, 1960; Porter, Biochem. J. 73:119, 1959; Edelman et al., Methods in Enzymology , Vol. 1, page 422, Academic Press, 1967; and Coligan et al. at sections 2.8.1-2.8.10 and 2.10.1-2.10.4).
  • cleaving antibodies such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
  • Fv fragments comprise an association of V H and V L chains. This association may be noncovalent (Inbar et al., Proc. Natl. Acad. Sci. U.S.A. 69:2659, 1972).
  • the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. See, e.g., Sandhu, supra.
  • the Fv fragments comprise V H and V L chains connected by a peptide linker.
  • These single-chain antigen binding proteins (sFv) are prepared by constructing a structural gene comprising DNA sequences encoding the V H and V L domains connected by an oligonucleotide.
  • the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli .
  • the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
  • Methods for producing sFvs are known in the art (see Whitlow et al., Methods: a Companion to Methods in Enzymology , Vol. 2, page 97, 1991; Bird et al., Science 242:423, 1988; U.S. Pat. No. 4,946,778; Pack et al., Bio/Technology 11:1271, 1993; and Sandhu, supra).
  • CDR peptides (“minimal recognition units”) can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells (Larrick et al., Methods: a Companion to Methods in Enzymology , Vol. 2, page 106, 1991).
  • Antibodies can be prepared using an intact polypeptide or fragments containing small peptides of interest as the immunizing antigen.
  • the polypeptide or a peptide used to immunize an animal can be derived from substantially purified polypeptide produced in host cells, in vitro translated cDNA, or chemical synthesis which can be conjugated to a carrier protein, if desired.
  • Such commonly used carriers which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid.
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • the coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
  • Polyclonal or monoclonal antibodies can be further purified, for example, by binding to and elution from a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound.
  • a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound.
  • Those of skill in the art will know of various techniques common in the immunology arts for purification and/or concentration of polyclonal antibodies, as well as monoclonal antibodies (see, for example, Coligan et al., Unit 9 , Current Protocols in Immunology , Wiley Interscience, 1991).
  • an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region that is the “image” of the epitope bound by the first mono-clonal antibody.
  • Binding affinity for a target antigen is typically measured or determined by standard antibody-antigen assays, such as competitive assays, saturation assays, or immunoassays such as ELISA or RIA. Such assays can be used to determine the dissociation constant of the antibody.
  • K D [Ab ⁇ Ag]/[Ab][Ag] where [Ab] is the concentration at equilibrium of the antibody, [Ag] is the concentration at equilibrium of the antigen and [Ab ⁇ Ag] is the concentration at equilibrium of the antibody-antigen complex.
  • the binding interactions between antigen and antibody include reversible noncovalent associations such as electrostatic attraction, Van der Waals forces and hydrogen bonds.
  • Effector molecules can be linked to an antibody that specifically binds Zscan4, using any number of means known to those of skill in the art.
  • Exemplary effector molecules include, but not limited to, radiolabels, fluorescent markers, or toxins (e.g. Pseudomonas exotoxin (PE), see “ Monoclonal Antibody - Toxin Conjugates: Aiming the Magic Bullet ,” Thorpe et al., “Monoclonal Antibodies in Clinical Medicine,” Academic Press, pp. 168-190, 1982; Waldmann, Science, 252: 1657, 1991; U.S. Pat. No. 4,545,985 and U.S. Pat. No.
  • PE Pseudomonas exotoxin
  • Both covalent and noncovalent attachment means may be used.
  • the procedure for attaching an effector molecule to an antibody varies according to the chemical structure of the effector.
  • Polypeptides typically contain a variety of functional groups; e.g., carboxylic acid (COOH), free amine (—NH 2 ) or sulfhydryl (—SH) groups, which are available for reaction with a suitable functional group on an antibody to result in the binding of the effector molecule.
  • the antibody is derivatized to expose or attach additional reactive functional groups. The derivatization may involve attachment of any of a number of linker molecules such as those available from Pierce Chemical Company, Rockford, Ill.
  • the linker can be any molecule used to join the antibody to the effector molecule.
  • the linker is capable of forming covalent bonds to both the antibody and to the effector molecule.
  • Suitable linkers are well known to those of skill in the art and include, but are not limited to, straight or branched-chain carbon linkers, heterocyclic carbon linkers, or peptide linkers.
  • the linkers may be joined to the constituent amino acids through their side groups (e.g., through a disulfide linkage to cysteine) or to the alpha carbon amino and carboxyl groups of the terminal amino acids.
  • immunoconjugates will comprise linkages that are cleavable in the vicinity of the target site. Cleavage of the linker to release the effector molecule from the antibody may be prompted by enzymatic activity or conditions to which the immunoconjugate is subjected either inside the target cell or in the vicinity of the target site.
  • Zscan4 The characterization of Zscan4 is disclosed herein. Zscan4 is shown herein to exhibit transient and specific expression at the late 2-cell embryonic stage and in embryonic stem cells. Without being bound by theory, Zscan4 is the only gene that is exclusively expressed during the first wave of de novo transcription, zygotic genome activation.
  • Zscan4 was identified from a cDNA clone derived from ES cells (clone number C0348C03) and subsequently sequenced by the Mammalian Gene Collection project (Gerhard et al. Genom Res. 14:2121-2127, 2004).
  • the cDNA sequence deposited under Genbank Accession No. BC050218 (SEQ ID NO: 11), comprised 2292 by organized into 4 exons encoding a protein of 506 amino acids.
  • SEQ ID NO: 11 Genbank Accession No. BC050218
  • RNAs derived from late 2-cell stage embryos were sequenced, as described in the Examples below.
  • the amplified sequence was 2268 by in length and like the cDNA isolated from ES cells, encoded a protein of 506 amino acids. Analysis of the nucleotide and amino acid sequences of the cDNA clones isolated from ES cells and late 2-cell embryos showed they were two different, but similar genes.
  • Zscan4 gene copies were identified in the mouse genome. Three copies are pseudogenes and were designated Zscan4-ps1 (SEQ ID NO: 12), Zscan4-ps2 (SEQ ID NO: 13) and Zscan4-ps3 (SEQ ID NO: 14), according to the convention of mouse gene nomenclature.
  • Zscan4a SEQ ID NOs: 15 and 16
  • Zscan4b SEQ ID NOs: 17 and 18
  • Zscan4c SEQ ID NOs: 19 and 20
  • Zscan4d SEQ ID NOs: 21 and 22
  • Zscan4e SEQ ID NOs: 23 and 24
  • Zscan4f SEQ ID NOs: 25 and 26.
  • Zscan4c, Zscan4d and Zscan4f encode proteins of 506 amino acids
  • Zscan4a, Zscan4b and Zscan4e encode shorter proteins of 360, 195 and 195 amino acids, respectively.
  • a polypeptide comprising any of the amino acid sequences set forth as SEQ ID NOs: 16, 18, 20, 22, 24, 26 or 30, or a polynucleotide encoding these polypeptides, are of use in the methods disclosed herein.
  • a polynucleotide encoding a Zscan4 pseudogene set forth as SEQ ID NOs: 12, 13 or 14 are also of use in the methods disclosed herein.
  • Zscan4 Analysis of the expression levels of Zscan4 demonstrated that expression of each of the six Zscan4 genes could be detected in ES cells with Zscan4c being the predominant transcript.
  • Zscan4d was the predominant transcript in 2-cell stage embryos; however, low levels of Zscan4a Zscan4e and Zscan4f could also be detected.
  • Zscan4 is temporally regulated and its expression or lack of expression at different embryonic stages is critical to proper development. As described in the Examples below, inhibition of Zscan4 expression in embryos blocked the 2- to 4-cell embryonic transition, prevented blastocysts from expanding, prevented blastocysts from implanting and prevented proliferation of ES cells from blastocyst outgrowths.
  • Trim43 is a gene exhibiting expression during the 4-cell to morula embryonic stages, with the highest level of expression observed at the morula stage. Also described herein is the development of a transgenic mouse, which comprises two transgenes, the first comprising Emerald operably linked to the Zscan4c promoter and the second comprising Strawberry operably linked to the Trim43 promoter.
  • Zscan4d gene was identified for its specific expression in 2-cell embryos.
  • a corresponding cDNA clone (no. C0348C03; R1 ES cells, 129 strain; Genbank Accession No. BC050218, SEQ ID NO: 11) was identified in the mouse cDNA collection described previously (Sharov et al., PLoS Bio. 1:E74, 2003).
  • a primer pair (5′-cctccctgggcttcttggcat-3′, SEQ ID NO: 1; 5′-agctgccaaccagaaagacactgt-3′, SEQ ID NO: 2) was designed and used to PCR-amplify the full-length cDNA sequence of this gene from 2-cell embryos (B6D2F1 mouse).
  • mRNA was extracted from 2-cell embryos and treated with DNAase (DNA-free, Ambion). The mRNA was annealed with an oligo-dT primer and reverse-transcribed into cDNA with ThermoScript Reverse Transcriptase (Invitrogen).
  • a full-length cDNA clone was PCR-amplified with Ex Taq Polymerase (Takara Minis Bio, Madison, Wis.), purified with the Wizard SV Gel and PCR Clean-Up System (Promega Biosciences, San Luis Obispo, Calif.), cloned into a pENTR plasmid vector with the Directional TOPO Cloning Kit (Invitrogen), and completely sequenced using BigDye Terminator kit (PE Applied Biosystems, Foster City, Calif.) and DyeEX 96 Kit (Qiagen Valencia, Calif.) on ABI 3100 Genetic Analyzer (PE Applied Biosystems). The sequence is set forth herein as SEQ ID NO: 21).
  • the WU-BLAST (available online) and UCSC genome browser were used to obtain Zscan4 orthologs in the human genome sequence.
  • Open reading frames (ORFs) were deduced by ORF finder (available online from the National Center for Biotechnology Information) and protein domains were identified by Pfam HMM database (available online).
  • Orthologous relationships were assessed with the phylogenetic tree of amino acid sequences determined by a sequence distance method and the Neighbor Joining (NJ) algorithm (Saitou and Nei, 1987) using Vector NTI software (Invitrogen, Carlsbad, Calif.).
  • NJ Neighbor Joining
  • Southern blot analysis was carried out to validate the genome sequence of the Zscan4 locus assembled using individual BAC clone sequences downloaded from the public database (RPCI-23 and RPCI-24 BAC libraries: C57BL/6J strain).
  • a probe containing exon 3 was designed and amplified from mouse DNA extracted from ES cells (C57BL/6) using a primer pair (5′-gcattcctacataccaatta-3′, SEQ ID NO: 3; 5′-gatttaatttagctgggctg-3′, SEQ ID NO: 4).
  • the PCR product was purified using GFX PCR DNA and Gel band purification kit (GE Healthcare).
  • Membranes were subjected to 3 washes of 30 min each (2 ⁇ SSC/0.1% (w/v) SDS at room temperature, 0.5 ⁇ SSC/0.1% (w/v) SDS at 42° C., and 0.1 ⁇ SSC/0.1% (w/v) SDS at room temperature) and autoradiographed for 48 hours at ⁇ 80° C.
  • Zscan4 cDNAs from ES cells 129.3 ES cells purchased from the Transgenic Core Laboratory of the Johns Hopkins University School of Medicine, Baltimore, Md.) and 2-cell embryos (B6D2F1 mice) were synthesized.
  • Zscan4 cDNA fragments were amplified using a Zscan4-specific primer pair (Zscan4_For:5′-cagatgccagtagacaccac-3′, SEQ ID NO: 5; Zscan4 Rev 5′-gtagatgttccttgacttgc-3′, SEQ ID NO: 6), which were100%-matched to all Zscan4 paralogs.
  • Zscan4_For 5′-cagatgccagtagacaccac-3′, SEQ ID NO: 5; Zscan4 — 400Rev, 5′-ggaagtgttatagcaattgttc-3′, SEQ ID NO: 7; Zscan4 Rev, 5′-gtagatgttccttgacttgc-3′, SEQ ID NO: 6; and Zscan4 — 300Rev, 5′-gtgttatagcaattgttcttg-3′, SEQ ID NO: 8. Electropherograms of these sequences were used to calculate the relative expression levels of nine paralogous copies of Zscan4 in the following manner.
  • nucleotide positions were identified where one or a few paralogous copies can be distinguished based on the nucleotide mismatches.
  • the phred base calling program version 0.020425.c (Ewing et al., Genome Res. 8:175-185, 1998)) was used to obtain the amplitudes of all four bases in the electropherogram for those nucleotide sites. After subtracting the noise level (i.e., the average of amplitudes of the bases that are not present in any of the nine paralogous copies), the amplitudes of each base (A, T, G, C) were obtained. The expression levels of each of the paralogous copies were calculated by the least square fitting, which found the expression levels that are most consistent with all mismatched nucleotide positions.
  • mice Four- to six-week old B6D2F1 mice were superovulated by injecting 5 IU pregnant mare serum gonadotropin (PMS; Sigma, St Louis, Mo., USA) and 5 IU human chorionic gonadotropin (HCG; Sigma) after 46-47 h (Protocol#220MSK-Mi approved by the National Institute on Aging Animal Care and Use Committee). Unfertilized eggs were harvested at 21 h post-HCG according to the standard method (Nagy et al., 2003, “Manipulation of the Mouse Embryo, A Laboratory Manual,” Cold Spring Harbor Laboratory Press, New York).
  • Fertilized eggs (1-cell embryos) were also harvested from mated superovulated mice in the same way as unfertilized eggs. Fertilized eggs (1-cell embryos) were cultured in synthetic oviductal medium enriched with potassium (KSOMaa MR-121-D) at 37° C. in an atmosphere of 5% CO2. For the embryo transfer procedure, 3.5 d.p.c. blastocysts were transferred into the uteri of 2.5 d.p.c. pseudopregnant ICR female mice.
  • embryos with two pronuclei were selected.
  • PN pronuclei
  • DNA was microinjected into embryos according to the following procedures.
  • Plasmid vectors constitutively expressing a siRNA against mouse Zscan4 were constructed by inserting the following target sequences in a pRNAT-U6.1/Neo vector (GenScript Corp., Scotch Plains, N.J., USA), shZscan4 (gagtgaattgctttgtgtc, SEQ ID NO: 9) and siControl (randomized 21-mer, agagacatagaatcgcacgca, SEQ ID NO: 10).
  • This vector contains a green fluorescence protein (GFP) marker under a cytomegalovirus (CMV) promoter.
  • GFP green fluorescence protein
  • CMV cytomegalovirus
  • RNA interference experiments 1-2 ⁇ l (2-3 ng/l) of a linearized vector DNA (shZscan4 or shControl) was microinjected into the male pronucleus of zygotes.
  • a plasmid vector constitutively expressing the Zscan4d gene was constructed by cloning the CDS of Zscan4d into a plasmid pPyCAGIP (Chambers et al., Cell 113:643-655, 2003).
  • 1-2 ⁇ l (2-3 ng/l) of plasmid DNA (Zscan4d-inserted or no insert pPyCAGIP vector) linearized by Seal was microinjected into the male pronucleus of zygotes.
  • RNA interference experiments were carried out by microinjecting ⁇ 10 ⁇ l (5 ng/l) of oligonucleotide (siZscan4, plus-siZscan4, and siControl) into the cytoplasm of zygotes.
  • the optimal amount of siRNA was determined by testing different concentrations of siRNA (4, 20, and 100 ng/ ⁇ l).
  • siRNAs were resuspended and diluted with the microinjection buffer (Specialty Media). The transfer of cultured blastocysts into pseudopregnant recipients was done according to the standard protocol (Nagy et al., 2003, “Manipulation of the Mouse Embryo, A Laboratory Manual,” Cold Spring Harbor Laboratory Press, New York). All media were purchased from Specialty Media (Phillipsburg, N.J.).
  • a mouse ES cell line (129.3 line derived from strain 129 and purchased from The Transgenic Core Laboratory of the Johns Hopkins University School of Medicine, Baltimore, Md., USA) was first cultured for two passages into a gelatin-coated culture dish in the presence of leukemia inhibitory factor (LIF) to remove contaminating feeder cells.
  • LIF leukemia inhibitory factor
  • blastocysts at 3.5 days post coitum were cultured individually in DMEM (Gibco catalog no. 10313-021) supplemented with 15% fetal bovine serum, 15 mM HEPES buffer, 100 units/ml of penicillin, 100 ⁇ g/ml of streptomycin, 100 ⁇ M nonessential amino acids, 4.5 mM of L-glutamine, and 100 ⁇ M of ⁇ -mercapto ethanol on gelatinized chamber slides at 37° C. in 5% CO2.
  • DMEM Gibco catalog no. 10313-021
  • a plasmid DNA (clone C0348C03) was digested with SalI/NotI and transcribed in vitro into digoxigenin-labeled antisense and sense probe as control.
  • Embryos obtained from young (7 weeks old) B6D2F1/J mice were fixed in 4% paraformaldehyde and used to perform whole mount in situ hybridization (WISH) according to the previously described protocol. WISH was also carried out on cultured ES cells according to the same protocol (Yoshikawa et al., Gene Expr. Patterns 6:213-224, 2006).
  • Embryos for quantitative reverse transcriptase (qRT)-PCR experiments were collected as described above and harvested at 23, 43, 55, 66, 80 and 102 hours post-hCG for 1-cell, early 2 cell, late 2-cell, 4-cell, 8-cell, morula and blastocyst embryos, respectively.
  • Three subsets of 10 synchronized and intact embryos were transferred in PBT 1X (PBS supplemented 0.1% Tween X20) and stored in liquid nitrogen. These pools of embryos were mechanically ruptured by a freeze/thaw and directly used as a template for cDNA preparations.
  • the Ovation system NuGen technologies, San Carlos, Calif., USA was used to synthesize cDNAs from each pool.
  • cDNAs were then diluted to 1:25 in a total of 1000 ⁇ l and 2 ⁇ l was used as a template for qPCR.
  • the qPCR was performed on the ABI 7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif., USA) as previously described (Falco et al., Reprod. Biomed. Online 13:394-403, 2006) and data were normalized by Chuk and H2afz with the ⁇ Ct method (Falco et al., Reprod. Biomed. Online 13:394-403, 2006; Livak and Schmittgen, Methods 25:402-408, 2001). Embryos subjected to RNA interference experiments were analyzed in the same way as described above for the normal preimplantation embryos
  • zygotic genome activation (DePamphilis et al., “Activation of Zygotic Gene Expression” In Advances in Developmental Biology and Biochemistry, Vol. 12, pp. 56-84, Elsevier Science B.V., 2002; Latham and Schultz, Front Biosci. 6:D748-759, 2001).
  • the ZGA is one of the first and most critical events in animal development. Earlier reports have established that the ZGA begins during the 1-cell stage (Aoki et al., Dev. Biol.
  • ES cells embryonal carcinoma (EC) cells (F9 and P19), trophoblast stem (TS) cells, or neural stem/progenitor (NS) cells (Aiba et al., Stem Cells 24:889-895, 2006).
  • EC embryonal carcinoma
  • TS trophoblast stem
  • NS neural stem/progenitor
  • the transcript was not detected in unfertilized eggs and embryos in other preimplantation stages including 3-cell embryos, suggesting a high specificity of gene expression at the late 2-cell stage and a relatively short half-life of the transcripts.
  • Quantitative reverse-transcriptase PCR (qRT-PCR) analysis confirmed the WISH results ( FIG. 1B ).
  • Previous microarray analysis showed that the expression of this gene at the late 2-cell stage was suppressed in embryos treated with ⁇ -amanitin (a blocker of RNA pol II-based transcription) (Hamatani et al., Dev. Cell 6:117-131, 2004), confirming that this gene is transcribed de novo during the major burst of ZGA.
  • the transient expression pattern was observed in both in vitro cultured embryos and freshly isolated in vivo embryos (Hamatani et al., Dev. Cell 6:117-131, 2004).
  • the full-length cDNA sequence (BC050218; SEQ ID NO: 11) was then aligned to the assembled genome sequence and nine gene copies were found, all of which had multi-exon gene organizations ( FIG. 2 , 3 A). Three gene copies were apparently pseudogenes as no evidence was found that they were transcribed based on available EST information and sequencing analysis of RT-PCR products. Therefore, the genes were named Zscan4-ps1 (SEQ ID NO: 12), Zscan4-ps2 (SEQ ID NO: 13), and Zscan4-ps3 (SEQ ID NO: 14), according to the convention of mouse gene nomenclature.
  • Zscan4a SEQ ID NO: 15
  • Zscan4b SEQ ID NO: 17
  • Zscan4c SEQ ID NO: 19
  • Zscan4d SEQ ID NO: 21
  • Zscan4e SEQ ID NO: 23
  • Zscan4f SEQ ID NO: 25.
  • Zscan4c corresponds to the cDNA clone isolated from ES cells (C0348C03; Genbank Accession No. BC050218; Gm397; SEQ ID NO: 11).
  • Zscan4d corresponds to the cDNA clone isolated from 2-cell embryos (SEQ ID NO: 21).
  • Zscan4f corresponds to a gene predicted from the genome sequence (Genbank Accession No. XM — 145358; SEQ ID NO: 27).
  • Zscan4d was a predominant transcript (90%).
  • Zscan4c was a predominant transcript (40%), although Zscan4f was a lesser, but significant transcript (24%).
  • RNAi and siRNA technology has been successfully used for blocking the expression of specific genes in preimplantation embryos (Kim et al., Biochem. Biopys. Res. Commun. 296:1372-1377, 2002; Stein et al., Dev. Biol. 286:464-471, 2005), widely-recognized off-target effects are generally a major concern (Jackson et al., Rna 12:1179-1187, 2006; Scacheri et al., Proc. Natl.
  • siRNA experiments were carried out by three independent siRNA technologies, an oligonucleotide-based siRNA (denoted here siZscan4 and obtained from Invitrogen); a vector-based shRNA (denoted here shZscan4 and obtained from Genscript); and a mixture of oligonucleotide siRNAs (denoted here plus-siZscan4 and obtained from Dharmacon) ( FIG. 4A , B).
  • Oligonucleotide sequences used for siZscan4, shZscan4, plus-siZscan4 matched 100% with cDNA sequences of Zscan4a, Zscan4b, Zscan4c, Zscan4d, Zscan4e and Zscan4f, except for shZscan4 with 2 by mismatches with Zscan4b and Zscan4e ( FIG. 4A , B).
  • a shZscan4 vector was microinjected into the male pronucleus of zygotes at 21-23 hours after the hCG injection and embryos were observed during preimplantation development ( FIGS. 4C and D).
  • the majority (58.8%) of shControl-injected embryos have already reached the 4-cell stage, the majority (78.8%) of shZscan4-injected embryos remained at the 2-cell stage.
  • the majority (70.0%) of shControl-injected embryos have reached blastocyst stage, the majority (52.5%) of shZscan4-injected embryos reached only morula stage.
  • a significant reduction ( ⁇ 95%) of Zscan4 RNA levels was confirmed by the qRT-PCR analysis ( FIG.
  • siZscan4-injected embryos formed normal looking early blastocysts (3.5 d.p.c.), but often failed to form expanded blastocysts (4.5 d.p.c.; 45% of siZscan4-injected embryos versus 6% of siControl-injected embryos; FIG. 9B ).
  • shZscan4-injected blastocysts were transferred to the uterus of pseudo-pregnant mice. None of the shZscan4-injected blastocysts implanted, whereas most shControl-injected embryos implanted (Table 1).
  • Zscan4d was overexpressed by microinjecting a Zscan4d-expressing plasmid into the male pronucleus of zygotes.
  • the Zscan4d plasmid-injected embryos showed a rate of development similar to control plasmid-injected embryos, the former blastocysts failed to produce the outgrowth (Table 2A) and failed to implant (Table 2B).
  • Table 2A the outgrowth
  • Table 2B failed to implant
  • Zscan4 is the exclusive expression in late 2-cell embryos and ES cells. This appears to be counter-intuitive, because ES cells are derived from the ICM and many genes that are expressed in ES cells are also expressed in the ICM (e.g., Yoshikawa et al., Gene Expr. Patterns 6:213-224, 2006). Therefore the expression of Zscan4 in blastocysts, blastocyst outgrowth, and ES cells was examined using WISH. The results demonstrated that the expression of Zscan4 was not detected anywhere in blastocysts, including the ICM and the early blastocyst outgrowth ( FIG. 6A ).
  • Zscan4 began to be detected in a small fraction of cells by the day 6 of the outgrowth. Surprisingly, the strong expression of Zscan4 was detected in only a small fraction of ES cells in undifferentiated colonies. In contrast, the expression of Pou5f1 (Oct3/4), a well-known marker for pluripotency, was detected in the ICM of blastocysts, a large fraction of the cells in the blastocyst outgrowth, and the majority of ES cells in undifferentiated colonies ( FIG. 6A ).
  • each Zscan4 paralog could not be distinguished by WISH, but the expression analysis by sequencing RT-PCR products mentioned above indicates that Zscan4c and Zscan4f were the genes detected in the subpopulation of the cells in blastocyst outgrowth and ES cells by WISH.
  • Zscan4 expression is only detected in a subpopulation of undifferentiated ES cells.
  • an expression plasmid was developed which comprises a Zscan4c promoter sequence and the Emerald reporter gene (a variant of green fluorescent protein).
  • the components and orientation of the expression vector are illustrated in FIG. 11 .
  • the sequence of the Zscan4c promoter-Emerald expression vector is set forth as SEQ ID NO: 28.
  • the nucleotide ranges of SEQ ID NO: 28 of the components of the expression vector are provided in Table 3.
  • Mouse ES cells were transfected with the Zscan4c promoter expression vector and analyzed by fluorescence activated cell sorting to identify Emerald-positive cells and Emerald-negative cells. If Zscan4 is expressed in a cell, it is Emerald-positive. The results show approximately 3-5% of mouse ES cells express Zscan4 ( FIG. 12 ).
  • Sorted cells were collected and analyzed by quantitative real time PCR (qPCR) for expression of Zscan4c and Pou5f1 (also known as Oct3, Oct4, Oct3/4), a well known marker for pluripotency.
  • qPCR quantitative real time PCR
  • Zscan4c also known as Oct3, Oct4, Oct3/4
  • Zscan4c is more highly expressed in Emerald-positive cells than in Emerald-negative cells.
  • the data indicate that the Zscan4c promoter sequence used in this vector can reproduce the expression of endogenous Zscan4c gene, and thus the Zscan4c promoter-Emerald expression vector can be used to purify Zscan4-expressing cells.
  • the data also indicate that both Zscan4-expressing cells and non-expressing cells retain the pluripotency-marker Pou5f1 expression, thus this subpopulation of ES cells cannot be identified by a standard pluripotency marker.
  • a mouse ES cell line was established in which the Zscan4c promoter expression vector described in Example 6 was stably incorporated into the cells.
  • the ES cell line expresses Emerald under control of the Zscan4c promoter.
  • the cells were cultured in the presence of the selectable marker (blasticidin).
  • the blasticidin-resistant ES cell clones were isolated and used for further analysis.
  • Zscan4 is only expressed in a subpopulation of undifferentiated ES cells (approximately 3-5% of ES cells). Accordingly, the ES cell line incorporating the Zscan4 promoter expression vector exhibits expression in only a small percentage, approximately three percent, of cells.
  • RNA microarray analysis was performed to compare gene expression patterns of Emerald(+) and Emerald( ⁇ ) cells.
  • Emerald(+) and Emerald( ⁇ ) cells were sorted by FACS and total RNAs were isolated from each cell population. These RNAs were labeled and hybridized to the NIA-Agilent 44K DNA microarray (Agilent Technologies).
  • Trim43 is Specifically Expressed in 4-Cell to Morula Stage Embryos
  • Trim43 expression was detected beginning at the 4-cell embryonic stage and peaked at the morula stage. A low level of Trim43 expression was detected in blastocysts. The function of the Trim43 protein is unknown.
  • the nucleotide and amino acid sequences of Trim43 are provided herein as SEQ ID NO: 32 and SEQ ID NO: 33, respectively.
  • the nucleic acid sequence of the Trim43 promoter is provided herein as SEQ ID NO: 31.
  • an expression vector comprising a Zscan4c promoter operably linked to a first heterologous polypeptide (Emerald) and an expression vector comprising a Trim43 promoter operably linked to a second heterologous polypeptide (Strawberry), have been generated.
  • a transgenic mouse (a “rainbow” mouse) can be generated which incorporates both of these expression constructs.
  • a 7155 base pair DNA fragment containing the Insulator-Zscan4 promoter-emerald and TK polyA and a 8672 base pair DNA fragment containing the Insulator-Trim43 promoter-Strawberry are co-injected into the pronucleus of fertilized mouse eggs (B6C3 X B6).
  • Embryos obtained from the rainbow mouse will exhibit green color (as a result of expression of Emerald) at the late 2-cell stage, and red color (due to expression of Strawberry) from the 4-cell stage to the morula stage (with peak expression at the morula stage).
  • the expression of Emerald and Strawberry at the appropriate stage of embryonic development indicates proper development of the embryo.
  • embryos obtained from the rainbow mouse can be used to develop optimized culture conditions for embryos, which can be applied to human embryos used in the IVF clinic.
  • these embryos can be used to test chemical compounds or drugs for toxicity to the embryo.
  • the embryos can also be used as indicators of successful nuclear reprogramming for nuclear transplantation procedures.
  • This disclosure provides methods of inhibiting differentiation of stem cells and promoting blastocyst outgrowth of ES cells.
  • the disclosure further provides a Zscan4 promoter sequence and methods of use, including identification of a subpopulation of stem cells expressing Zscan4. It will be apparent that the precise details of the methods described may be varied or modified without departing from the spirit of the described invention. We claim all such modifications and variations that fall within the scope and spirit of the claims below.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biophysics (AREA)
  • Reproductive Health (AREA)
  • Gynecology & Obstetrics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Environmental Sciences (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US12/529,004 2007-03-26 2008-03-26 Methods for modulating embryonic stem cell differentiation Abandoned US20100105043A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/529,004 US20100105043A1 (en) 2007-03-26 2008-03-26 Methods for modulating embryonic stem cell differentiation

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US92021507P 2007-03-26 2007-03-26
PCT/US2008/058261 WO2008118957A2 (fr) 2007-03-26 2008-03-26 Procédés de modulation de la différentiation des cellules souches embryonnaires
US12/529,004 US20100105043A1 (en) 2007-03-26 2008-03-26 Methods for modulating embryonic stem cell differentiation

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/058261 A-371-Of-International WO2008118957A2 (fr) 2007-03-26 2008-03-26 Procédés de modulation de la différentiation des cellules souches embryonnaires

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/332,800 Division US8617813B2 (en) 2007-03-26 2011-12-21 Methods for modulating embryonic stem cell differentiation

Publications (1)

Publication Number Publication Date
US20100105043A1 true US20100105043A1 (en) 2010-04-29

Family

ID=39677355

Family Applications (3)

Application Number Title Priority Date Filing Date
US12/529,004 Abandoned US20100105043A1 (en) 2007-03-26 2008-03-26 Methods for modulating embryonic stem cell differentiation
US13/332,800 Active US8617813B2 (en) 2007-03-26 2011-12-21 Methods for modulating embryonic stem cell differentiation
US14/143,568 Abandoned US20140120579A1 (en) 2007-03-26 2013-12-30 Methods for modulating embryonic stem cell differentiation

Family Applications After (2)

Application Number Title Priority Date Filing Date
US13/332,800 Active US8617813B2 (en) 2007-03-26 2011-12-21 Methods for modulating embryonic stem cell differentiation
US14/143,568 Abandoned US20140120579A1 (en) 2007-03-26 2013-12-30 Methods for modulating embryonic stem cell differentiation

Country Status (6)

Country Link
US (3) US20100105043A1 (fr)
EP (1) EP2129771B1 (fr)
JP (2) JP5705535B2 (fr)
AU (1) AU2008230870B2 (fr)
CA (1) CA2678901C (fr)
WO (1) WO2008118957A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012129342A1 (fr) * 2011-03-23 2012-09-27 Ko Minoru S H Compositions et procédés pour augmenter de la pluripotence des cellules souches
WO2012158564A1 (fr) * 2011-05-13 2012-11-22 The United States Of America As Represented By The Secretary, Department Of Health & Human Services Compositions et procédés permettant d'augmenter la fréquence de la recombinaison homologue
WO2013181641A1 (fr) * 2012-06-01 2013-12-05 Salk Institute For Biological Studies Cellules souches totipotentes
WO2014144932A2 (fr) 2013-03-15 2014-09-18 Elixirgen, Llc Procédés d'utilisation de zscan4 afin de rajeunir des cellules humaines

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2772619C (fr) 2009-09-04 2019-07-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Procede d'amelioration de la stabilite du genome et de l'elongation du telomere dans des cellules souches embryonnaires
CA2827179C (fr) 2011-01-25 2021-04-06 Minoru S.H. Ko Zscan4 en tant que marqueur de cellules souches et de cellules progenitrices pancreatiques et son utilisation
DK2685832T3 (da) 2011-03-18 2019-08-12 Realm Therapeutics Inc Stabiliserede hypohalogensyreopløsninger
WO2012158561A1 (fr) * 2011-05-13 2012-11-22 The United States Of America As Represented By The Secretary, Dept. Of Health And Human Services Utilisation de zscan4 et gènes dépendant de zscan4 pour reprogrammation directe de cellules somatiques
KR101600423B1 (ko) 2015-08-06 2016-03-07 이하청 단추, 이를 이용한 의류 및 패션 잡화

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5226914A (en) * 1990-11-16 1993-07-13 Caplan Arnold I Method for treating connective tissue disorders
US5670372A (en) * 1992-10-08 1997-09-23 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US5750376A (en) * 1991-07-08 1998-05-12 Neurospheres Holdings Ltd. In vitro growth and proliferation of genetically modified multipotent neural stem cells and their progeny
US6090622A (en) * 1997-03-31 2000-07-18 The Johns Hopkins School Of Medicine Human embryonic pluripotent germ cells
US6200806B1 (en) * 1995-01-20 2001-03-13 Wisconsin Alumni Research Foundation Primate embryonic stem cells
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6943241B2 (en) * 2001-11-05 2005-09-13 Research Association For Biotechnology Full-length cDNA
US20060251642A1 (en) * 2001-09-24 2006-11-09 Wolffe Alan P Modulation of stem cells using zinc finger proteins

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9308271D0 (en) * 1993-04-21 1993-06-02 Univ Edinburgh Method of isolating and/or enriching and/or selectively propagating pluripotential animal cells and animals for use in said method
US5523226A (en) * 1993-05-14 1996-06-04 Biotechnology Research And Development Corp. Transgenic swine compositions and methods
CA2349415A1 (fr) 1998-11-09 2000-05-18 Monash University Cellules souches embryonnaires
IL129966A (en) 1999-05-14 2009-12-24 Technion Res & Dev Foundation ISOLATED HUMAN EMBRYOID BODIES (hEB) DERIVED FROM HUMAN EMBRYONIC STEM CELLS
CA2430653A1 (fr) * 2000-11-27 2002-08-08 Yissum Research Development Company Of The Hebrew University In Jerusalem Transfection de cellules souches embryonnaires
AU2003253992A1 (en) * 2002-07-18 2004-02-09 Robert P. Bennett Viral vectors containing recombination sites
WO2004067744A1 (fr) * 2003-01-31 2004-08-12 Sumitomo Pharmaceuticals Co., Ltd. Facteur de determination de l'autoreplication de cellules souches embryonnaires

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5226914A (en) * 1990-11-16 1993-07-13 Caplan Arnold I Method for treating connective tissue disorders
US5750376A (en) * 1991-07-08 1998-05-12 Neurospheres Holdings Ltd. In vitro growth and proliferation of genetically modified multipotent neural stem cells and their progeny
US5670372A (en) * 1992-10-08 1997-09-23 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US6200806B1 (en) * 1995-01-20 2001-03-13 Wisconsin Alumni Research Foundation Primate embryonic stem cells
US6090622A (en) * 1997-03-31 2000-07-18 The Johns Hopkins School Of Medicine Human embryonic pluripotent germ cells
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20060251642A1 (en) * 2001-09-24 2006-11-09 Wolffe Alan P Modulation of stem cells using zinc finger proteins
US6943241B2 (en) * 2001-11-05 2005-09-13 Research Association For Biotechnology Full-length cDNA

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11059869B2 (en) * 2011-03-23 2021-07-13 Elixirgen, Llc Compositions for enhancing the pluripotency of stem cells
US11186621B2 (en) * 2011-03-23 2021-11-30 Elixirgen, Llc Methods for enhancing the pluripotency of stem cells
US20140370601A1 (en) * 2011-03-23 2014-12-18 Minoru S.H. Ko Compositions and methods for enhancing the pluripotency of stem cells
AU2012230894B2 (en) * 2011-03-23 2017-01-05 Elixirgen, Llc Compositions and methods for enhancing the pluripotency of stem cells
WO2012129342A1 (fr) * 2011-03-23 2012-09-27 Ko Minoru S H Compositions et procédés pour augmenter de la pluripotence des cellules souches
US20190330288A1 (en) * 2011-03-23 2019-10-31 Elixirgen, Llc Compositions and methods for enhancing the pluripotency of stem cells
WO2012158564A1 (fr) * 2011-05-13 2012-11-22 The United States Of America As Represented By The Secretary, Department Of Health & Human Services Compositions et procédés permettant d'augmenter la fréquence de la recombinaison homologue
WO2013181641A1 (fr) * 2012-06-01 2013-12-05 Salk Institute For Biological Studies Cellules souches totipotentes
US10335456B2 (en) 2013-03-15 2019-07-02 Elixirgen Therapeutics, Inc. Methods of using ZSCAN4 for rejuvenating human cells
EP3782628A1 (fr) 2013-03-15 2021-02-24 Elixirgen Therapeutics, Inc. Procédés d'utilisation de zscan4 afin de rajeunir des cellules humaines
US10744183B2 (en) 2013-03-15 2020-08-18 Elixirgen Therapeutics, Inc. Methods of using ZSCAN4 for rejuvenating human cells
WO2014144932A2 (fr) 2013-03-15 2014-09-18 Elixirgen, Llc Procédés d'utilisation de zscan4 afin de rajeunir des cellules humaines
US11389504B2 (en) 2013-03-15 2022-07-19 Elixirgen Therapeutics, Inc. Methods of using ZSCAN4 for rejuvenating human cells
EP4410976A2 (fr) 2013-03-15 2024-08-07 Elixirgen Therapeutics, Inc. Procédés d'utilisation de zscan4 pour rajeunir des cellules humaines

Also Published As

Publication number Publication date
CA2678901C (fr) 2017-11-14
AU2008230870A1 (en) 2008-10-02
US8617813B2 (en) 2013-12-31
WO2008118957A2 (fr) 2008-10-02
JP2010522565A (ja) 2010-07-08
WO2008118957A8 (fr) 2018-03-08
AU2008230870A2 (en) 2009-09-24
WO2008118957A3 (fr) 2009-03-05
EP2129771A2 (fr) 2009-12-09
CA2678901A1 (fr) 2008-10-02
AU2008230870B2 (en) 2013-09-05
JP2013106618A (ja) 2013-06-06
US20140120579A1 (en) 2014-05-01
US20120129161A1 (en) 2012-05-24
EP2129771B1 (fr) 2018-09-12
JP5705535B2 (ja) 2015-04-22

Similar Documents

Publication Publication Date Title
US8617813B2 (en) Methods for modulating embryonic stem cell differentiation
CA2956108A1 (fr) Reprogrammation amelioree de cellules ips
US11937586B2 (en) Compositions and methods for producing genetically modified animals
US11186621B2 (en) Methods for enhancing the pluripotency of stem cells
JP5785948B2 (ja) 胚性幹細胞におけるゲノムの安定性およびテロメアの伸長を促進するための方法
CN111118062A (zh) Polβ过表达质粒、细胞模型及其在抗卵巢衰老药物中的应用
US8889412B2 (en) Methods of enhancing pluripotentcy
DK2844064T3 (en) TRANSGENE ANIMAL MODEL OF AMYOTROPHIC LATERAL SCLEROSIS
AU2008349175B2 (en) Method for introducing foreign gene into early embryo of primate animal and method of producing transgenic primate animal comprising such method
JP4118579B2 (ja) Ｅｃａｔ５ノックアウト細胞
Zhang Investigating the role of a lncRNA (4833427F10Rik) in mouse placental development and function
Song Transcriptional and translational regulators of gene expression in germ cell development
Chang et al. Expression and Characterization of Bovine DNA Methyltransferase I
KR20040062981A (ko) 프로스타글란딘 ｅ 합성효소 ２ 유전자의 붕괴

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KO, MINORU S.H.;FALCO, GEPPINO;LEE, SUNG-LIM;AND OTHERS;SIGNING DATES FROM 20080421 TO 20080426;REEL/FRAME:023717/0151

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION