US20090142262A1 - Method of Diagnosing, Monitoring, Staging, Imaging and Treating Prostate Cancer - Google Patents

Method of Diagnosing, Monitoring, Staging, Imaging and Treating Prostate Cancer Download PDF

Info

Publication number
US20090142262A1
US20090142262A1 US12/199,482 US19948208A US2009142262A1 US 20090142262 A1 US20090142262 A1 US 20090142262A1 US 19948208 A US19948208 A US 19948208A US 2009142262 A1 US2009142262 A1 US 2009142262A1
Authority
US
United States
Prior art keywords
csg
prostate
levels
cancer
patient
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/199,482
Inventor
Susan Salceda
Herve Recipon
Robert Cafferkey
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Diadexus Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1999/024331 external-priority patent/WO2000023111A1/en
Application filed by Individual filed Critical Individual
Priority to US12/199,482 priority Critical patent/US20090142262A1/en
Assigned to DIADEXUS, INC. reassignment DIADEXUS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: RECIPON, HERVE, CAFFERKEY, ROBERT, SALCEDA, SUSANA
Publication of US20090142262A1 publication Critical patent/US20090142262A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Definitions

  • This invention relates, in part, to newly developed assays for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating cancers, particularly prostate cancer.
  • Cancer of the prostate is the most prevalent malignancy in adult males, excluding skin cancer, and is an increasingly prevalent health problem in the United States. In 1996, it was estimated that 41,400 deaths would result from this disease in the United States alone, indicating that prostate cancer is second only to lung cancer as the most common cause of death in the same population. If diagnosed and treated early, when the cancer is still confined to the prostate, the chances of cure is significantly higher.
  • AUA American Urological Association
  • the AUA system divides prostate tumors into four stages, A to D. Stage A, microscopic cancer within prostate, is further subdivided into stages A1 and A2.
  • Stage A1 is a well-differentiated cancer confined to one site within the prostate. Treatment is generally observation, radical prostatectomy, or radiation.
  • Stage A2 is a moderately to poorly differentiated cancer at multiple sites within the prostate. Treatment is radical prostatectomy or radiation.
  • Stage B palpable lump within the prostate, is also further subdivided into sub-stages B1 and B2.
  • sub-stage B1 the cancer forms a small nodule in one lobe of the prostate.
  • sub-stage B2 the cancer forms large or multiple nodules, or occurs in both lobes of the prostate.
  • Treatment for sub-stages B1 and B2 is either radical prostatectomy or radiation.
  • Stage C is a large cancer mass involving most or all of the prostate and is also further subdivided into two sub-stages.
  • the cancer forms a continuous mass that may have extended beyond the prostate.
  • sub-stage C2 the cancer forms a continuous mass that invades the surrounding tissue.
  • Treatment for both these sub-stages is radiation with or without drugs to address the cancer.
  • Stage D is metastatic cancer and is also subdivided into two sub-stages.
  • sub-stage D1 the cancer appears in the lymph nodes of the pelvis.
  • sub-stage D2 the cancer involves tissues beyond lymph nodes. Treatment for both of these sub-stages is systemic drugs to address the cancer as well as pain.
  • cancer specific genes or CSGs include, but are not limited to: Pro109 which is a human zinc- ⁇ 2-glycoprotein (Freje et al. Genomics 1993 18(3):575-587); Pro112 which is a human cysteine-rich protein with a zinc-finger motif (Liebhaber et al. Nucleic Acid Research 1990 18(13):3871-3879; WO9514772 and WO9845436); Pro111 which is a prostate-specific transglutaminase (Dubbink et al.
  • Pro115 which is a novel serine protease with transmembrane, LDLR, and SRCR domains and maps to 21q22.3 (Paoloni-Giacobino et al. Genomics 1997 44(3):309-320; WO9837418 and WO987093); Pro110 which is a human breast carcinoma fatty acid synthase (U.S. Pat. No. 5,665,874 and WO9403599); Pro113 which is a homeobox gene, HOXB13 (Steinicki et al. J. Invest. Dermatol.
  • CSG refers, among other things, to native protein expressed by the gene comprising a polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • CSG it is also meant herein polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1-20, but which still encode the same protein.
  • CSG means the native mRNA encoded by the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, levels of the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, or levels of a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • a method of diagnosing metastatic prostate cancer in a patient having prostate cancer which is not known to have metastasized by identifying a human patient suspected of having prostate cancer that has metastasized; analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing the CSG levels in such cells, tissues, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in CSG levels in the patient versus the normal human control is associated with prostate cancer which has metastasized.
  • Also provided by the invention is a method of staging prostate cancer in a human which has such cancer by identifying a human patient having such cancer; analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing CSG levels in such cells, tissues, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control sample, wherein an increase in CSG levels in the patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of CSG is associated with a cancer which is regressing or in remission.
  • the method comprises identifying a human patient having such cancer that is not known to have metastasized; periodically analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing the CSG levels in such cells, tissue, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control sample, wherein an increase in CSG levels in the patient versus the normal human control is associated with a cancer which has metastasized.
  • the method comprises identifying a human patient having such cancer; periodically analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing the CSG levels in such cells, tissue, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control sample, wherein an increase in CSG levels in the patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of CSG is associated with a cancer which is regressing or in remission.
  • therapeutic agents such as antibodies targeted against CSG or fragments of such antibodies can be used to detect or image localization of CSG in a patient for the purpose of detecting or diagnosing a disease or condition.
  • Such antibodies can be polyclonal, monoclonal, or omniclonal or prepared by molecular biology techniques.
  • the term “antibody”, as used herein and throughout the instant specification is also meant to include aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art.
  • Antibodies can be labeled with a variety of detectable labels including, but not limited to, radioisotopes and paramagnetic metals.
  • Therapeutics agents such as antibodies or fragments thereof can also be used in the treatment of diseases characterized by expression of CSG.
  • the antibody can be used without or with derivatization to a cytotoxic agent such as a radioisotope, enzyme, toxin, drug or a prodrug.
  • the present invention relates to diagnostic assays and methods, both quantitative and qualitative for detecting, diagnosing, monitoring, staging and prognosticating cancers by comparing levels of CSG in a human patient with those of CSG in a normal human control.
  • CSG levels is, among other things, native protein expressed by the gene comprising a polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • CSG it is also meant herein polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1-20, but which still encode the same protein.
  • the native protein being detected may be whole, a breakdown product, a complex of molecules or chemically modified.
  • CSG means the native mRNA encoded by the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, levels of the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, or levels of a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • Such levels are preferably determined in at least one of, cells, tissues and/or bodily fluids, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for diagnosing overexpression of CSG protein compared to normal control bodily fluids, cells, or tissue samples may be used to diagnose the presence of prostate cancer.
  • All the methods of the present invention may optionally include determining the levels of other cancer markers as well as CSG.
  • Other cancer markers, in addition to CSG, useful in the present invention will depend on the cancer being tested and are known to those of skill in the art.
  • the present invention provides methods for diagnosing the presence of prostate cancer by analyzing for changes in levels of CSG in cells, tissues or bodily fluids compared with levels of CSG in cells, tissues or bodily fluids of preferably the same type from a normal human control, wherein an increase in levels of CSG in the patient versus the normal human control is associated with the presence of prostate cancer.
  • a positive result indicating the patient being tested has cancer is one in which cells, tissues or bodily fluid levels of the cancer marker, such as CSG, are at least two times higher, and most preferably are at least five times higher, than in preferably the same cells, tissues or bodily fluid of a normal human control.
  • the cancer marker such as CSG
  • the present invention also provides a method of diagnosing metastatic prostate cancer in a patient having prostate cancer which has not yet metastasized for the onset of metastasis.
  • a human cancer patient suspected of having prostate cancer which may have metastasized (but which was not previously known to have metastasized) is identified. This is accomplished by a variety of means known to those of skill in the art.
  • determining the presence of CSG levels in cells, tissues or bodily fluid is particularly useful for discriminating between prostate cancer which has not metastasized and prostate cancer which has metastasized.
  • Existing techniques have difficulty discriminating between prostate cancer which has metastasized and prostate cancer which has not metastasized and proper treatment selection is often dependent upon such knowledge.
  • the cancer marker levels measured in such cells, tissues or bodily fluid is CSG, and are compared with levels of CSG in preferably the same cells, tissue or bodily fluid type of a normal human control. That is, if the cancer marker being observed is just CSG in serum, this level is preferably compared with the levee of CSG in serum of a normal human control. An increase in the CSG in the patient versus the normal human control is associated with prostate cancer which has metastasized.
  • a positive result indicating the cancer in the patient being tested or monitored has metastasized is one in which cells, tissues or bodily fluid levels of the cancer marker, such as CSG, are at least two times higher, and most preferably are at least five times higher, than in preferably the same cells, tissues or bodily fluid of a normal patient.
  • the cancer marker such as CSG
  • Normal human control as used herein includes a human patient without cancer and/or non cancerous samples from the patient; in the methods for diagnosing or monitoring for metastasis, normal human control may preferably also include samples from a human patient that is determined by reliable methods to have prostate cancer which has not metastasized.
  • the invention also provides a method of staging prostate cancer in a human patient.
  • the method comprises identifying a human patient having such cancer and analyzing cells, tissues or bodily fluid from such human patient for CSG.
  • the CSG levels determined in the patient are then compared with levels of CSG in preferably the same cells, tissues or bodily fluid type of a normal human control, wherein an increase in CSG levels in the human patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of CSG (but still increased over true normal levels) is associated with a cancer which is regressing or in remission.
  • a method of monitoring prostate cancer in a human patient having such cancer for the onset of metastasis comprises identifying a human patient having such cancer that is not known to have metastasized; periodically analyzing cells, tissues or bodily fluid from such human patient for CSG; and comparing the CSG levels determined in the human patient with levels of CSG in preferably the same cells, tissues or bodily fluid type of a normal human control, wherein an increase in CSG levels in the human patient versus the normal human control is associated with a cancer which has metastasized.
  • normal human control samples may also include prior patient samples.
  • the method comprises identifying a human patient having such cancer; periodically analyzing cells, tissues or bodily fluid from such human patient for CSG; and comparing the CSG levels determined in the human patient with levels of CSG in preferably the same cells, tissues or bodily fluid type of a normal human control, wherein an increase in CSG levels in the human patient versus the normal human control is associated with a cancer which is progressing in stage and a decrease in the levels of CSG is associated with a cancer which is regressing in stage or in remission.
  • normal human control samples may also include prior patient samples.
  • Monitoring a patient for onset of metastasis is periodic and preferably done on a quarterly basis. However, this may be more or less frequent depending on the cancer, the particular patient, and the stage of the cancer.
  • Assay techniques that can be used to determine levels of gene expression (including protein levels), such as CSG of the present invention, in a sample derived from a patient are well known to those of skill in the art.
  • Such assay methods include, without limitation, radioimmunoassays, reverse transcriptase PCR (RT-PCR) assays, immunohistochemistry assays, in situ hybridization assays, competitive-binding assays, Western Blot analyses, ELISA assays and proteomic approaches: two-dimensional gel electrophoresis (2D electrophoresis) and non-gel based approaches such as mass spectrometry or protein interaction profiling.
  • ELISAs are frequently preferred to diagnose a gene's expressed protein in biological fluids.
  • An ELISA assay initially comprises preparing an antibody, if not readily available from a commercial source, specific to CSG, preferably a monoclonal antibody.
  • a reporter antibody generally is prepared which binds specifically to CSG.
  • the reporter antibody is attached to a detectable reagent such as radioactive, fluorescent or enzymatic reagent, for example horseradish peroxidase enzyme or alkaline phosphatase.
  • antibody specific to CSG is incubated on a solid support, e.g. a polystyrene dish, that binds the antibody. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • a non-specific protein such as bovine serum albumin.
  • the sample to be analyzed is incubated in the dish, during which time CSG binds to the specific antibody attached to the polystyrene dish. Unbound sample is washed out with buffer.
  • a reporter antibody specifically directed to CSG and linked to a detectable reagent such as horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to CSG. Unattached reporter antibody is then washed out.
  • Reagents for peroxidase activity including a calorimetric substrate are then added to the dish.
  • Immobilized peroxidase, linked to CSG antibodies, produces a colored reaction product.
  • the amount of color developed in a given time period is proportional to the amount of CSG protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.
  • a competition assay can also be employed wherein antibodies specific to CSG are attached to a solid support and labeled CSG and a sample derived from the host are passed over the solid support. The amount of label detected which is attached to the solid support can be correlated to a quantity of CSG in the sample.
  • Nucleic acid methods can also be used to detect CSG mRNA as a marker for prostate cancer.
  • Polymerase chain reaction (PCR) and other nucleic acid methods such as ligase chain reaction (LCR) and nucleic acid sequence based amplification (NASABA), can be used to detect malignant cells for diagnosis and monitoring of various malignancies.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • NASABA nucleic acid sequence based amplification
  • RT-PCR reverse-transcriptase PCR
  • cDNA complementary DNA
  • RT-PCR can thus reveal by amplification the presence of a single species of mRNA. Accordingly, if the mRNA is highly specific for the cell that produces it, RT-PCR can be used to identify the presence of a specific type of cell.
  • Hybridization to clones or oligonucleotides arrayed on a solid support can be used to both detect the expression of and quantitate the level of expression of that gene.
  • a cDNA encoding the CSG gene is fixed to a substrate.
  • the substrate may be of any suitable type including but not limited to glass, nitrocellulose, nylon or plastic.
  • At least a portion of the DNA encoding the CSG gene is attached to the substrate and then incubated with the analyte, which may be RNA or a complementary DNA (cDNA) copy of the RNA, isolated from the tissue of interest.
  • Hybridization between the substrate bound DNA and the analyte can be detected and quantitated by several means including but not limited to radioactive labeling or fluorescence labeling of the analyte or a secondary molecule designed to detect the hybrid. Quantitation of the level of gene expression can be done by comparison of the intensity of the signal from the analyte compared with that determined from known standards. The standards can be obtained by in vitro transcription of the target gene, quantitating the yield, and then using that material to generate a standard curve.
  • 2D electrophoresis is a technique well known to those in the art. Isolation of individual proteins from a sample such as serum is accomplished using sequential separation of proteins by different characteristics usually on polyacrylamide gels. First, proteins are separated by size using an electric current. The current acts uniformly on all proteins, so smaller proteins move farther on the gel than larger proteins. The second dimension applies a current perpendicular to the first and separates proteins not on the basis of size but on the specific electric charge carried by each protein. Since no two proteins with different sequences are identical on the basis of both size and charge, the result of a 2D separation is a square gel in which each protein occupies a unique spot. Analysis of the spots with chemical or antibody probes, or subsequent protein microsequencing can reveal the relative abundance of a given protein and the identity of the proteins in the sample.
  • Tissue extracts are obtained routinely from tissue biopsy and autopsy material.
  • Bodily fluids useful in the present invention include blood, urine, saliva or any other bodily secretion or derivative thereof.
  • blood it is meant to include whole blood, plasma, serum or any derivative of blood.
  • CSGs are also useful in the rational design of new therapeutics for imaging and treating cancers, and in particular prostate cancer.
  • antibodies which specifically bind to CSG can be raised and used in vivo in patients suspected of suffering from prostate cancer.
  • Antibodies which specifically bind a CSG can be injected into a patient suspected of having prostate cancer for diagnostic and/or therapeutic purposes.
  • the preparation and use of antibodies for in vivo diagnosis is well known in the art.
  • antibody-chelators labeled with Indium-111 have been described for use in the radioimmunoscintographic imaging of carcinoembryonic antigen expressing tumors (Sumerdon et al. Nucl. Med. Biol. 1990 17:247-254).
  • these antibody-chelators have been used in detecting tumors in patients suspected of having recurrent colorectal cancer (Griffin et al. J. Clin. Onc. 1991 9:631-640).
  • Antibodies with paramagnetic ions as labels for use in magnetic resonance imaging have also been described (Lauffer, R. B. Magnetic Resonance in Medicine 1991 22:339-342).
  • Antibodies directed against CSG can be used in a similar manner.
  • Labeled antibodies which specifically bind CSG can be injected into patients suspected of having prostate cancer for the purpose of diagnosing or staging of the disease status of the patient. The label used will be selected in accordance with the imaging modality to be used.
  • radioactive labels such as Indium-111, Technetium-99m or Iodine-131 can be used for planar scans or single photon emission computed tomography (SPECT).
  • Positron emitting labels such as Fluorine-19 can be used in positron emission tomography.
  • Paramagnetic ions such as Gadlinium (III) or Manganese (II) can be used in magnetic resonance imaging (MRI). Localization of the label permits determination of the spread of the cancer. The amount of label within an organ or tissue also allows determination of the presence or absence of cancer in that organ or tissue.
  • an antibody which specifically binds CSG can also have a therapeutic benefit.
  • the antibody may exert its therapeutic effect alone.
  • the antibody can be conjugated to a cytotoxic agent such as a drug, toxin or radionuclide to enhance its therapeutic effect.
  • Drug monoclonal antibodies have been described in the art for example by Garnett and Baldwin, Cancer Research 1986 46:2407-2412. The use of toxins conjugated to monoclonal antibodies for the therapy of various cancers has also been described by Pastan et al. Cell 1986 47:641-648.
  • Yttrium-90 labeled monoclonal antibodies have been described for maximization of dose delivered to the tumor while limiting-toxicity to normal tissues (Goodwin and Meares Cancer Supplement 1997 80:22675-2680).
  • Other cytotoxic radionuclides including, but not limited to Copper-67, Iodine-131 and Rhenium-186 can also be used for labeling of antibodies against CSG.
  • Antibodies which can be used in these in vivo methods include polyclonal, monoclonal and omniclonal antibodies and antibodies prepared via molecular biology techniques. Antibody fragments and aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art can also be used.
  • Small molecules predicted via computer imaging to specifically bind to regions of CSGs can also be designed and synthesized and tested for use in the imaging and treatment of prostate cancer. Further, libraries of molecules can be screened for potential anticancer agents by assessing the ability of the molecule to bind to CSGs identified herein. Molecules identified in the library as being capable of binding to CSG are key candidates for further evaluation for use in the treatment of prostate cancer.
  • CSGs were carried out by a systematic analysis of data in the LIFESEQ database available from Incyte Pharmaceuticals, Palo Alto, Calif., using the data mining Cancer Leads Automatic Search Package (CLASP) developed by diaDexus LLC, Santa Clara, Calif.
  • CLASP Cancer Leads Automatic Search Package
  • the CLASP performs the following steps: selection of highly expressed organ specific genes based on the abundance level of the corresponding EST in the targeted organ versus all the other organs; analysis of the expression level of each highly expressed organ specific genes in normal, tumor tissue, disease tissue and tissue libraries associated with tumor or disease; selection of the candidates demonstrating component ESTs were exclusively or more frequently found in tumor libraries.
  • the CLASP allows the identification of highly expressed organ and cancer specific genes. A final manual in depth evaluation is then performed to finalize the CSGs selection.
  • Clones depicted in the following Table 1 are CSGs useful in diagnosing, monitoring, staging, imaging and treating prostate cancer.
  • Real-Time quantitative PCR with fluorescent Taqman probes is a quantitation detection system utilizing the 5′-3′ nuclease activity of Taq DNA polymerase.
  • the method uses an internal fluorescent oligonucleotide probe (Taqman) labeled with a 5′ reporter dye and a downstream, 3′ quencher dye.
  • Taqman internal fluorescent oligonucleotide probe
  • the 5′-3′ nuclease activity of Taq DNA polymerase releases the reporter, whose fluorescence can then be detected by the laser detector of the Model 7700 Sequence Detection System (PE Applied Biosystems, Foster City, Calif., USA)
  • Amplification of an endogenous control is used to standardize the amount of sample RNA added to the reaction and normalize for Reverse Transcriptase (RT) efficiency.
  • Either cyclophilin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ATPase, or 18S ribosomal RNA (rRNA) is used as this endogenous control.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • rRNA 18S ribosomal RNA
  • RNA was extracted from normal tissues, cancer tissues, and from cancers and the corresponding matched adjacent tissues.
  • first strand cDNA was prepared with reverse transcriptase and the polymerase chain reaction was done using primers and Taqman probes specific to each target gene.
  • the results were analyzed using the ABI PRISM 7700 Sequence Detector.
  • the absolute numbers are relative levels of expression of the target gene in a particular tissue compared to the calibrator tissue.
  • the absolute numbers depicted in Table 3 are relative levels of expression of Pro109 in 28 pairs of matching samples and 4 unmatched samples. All the values are compared to normal stomach (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • the level of mRNA expression was compared in cancer samples and the isogenic normal adjacent tissue from the same individual. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent).
  • Table 3 shows overexpression of Pro109 in 6 out of 9 primary prostate cancer tissues compared with their respective normal adjacents. Thus, overexpression in the cancer tissue was observed in 66.66% of the prostate matching samples tested (total of 9 prostate matching samples).
  • RNA samples depicted in Table 4 are relative levels of expression of the CSG Pro112 in 12 normal different tissues. All the values are compared to normal thymus (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • the relative levels of expression in Table 4 show that Pro112 mRNA expression is the 3 rd most highly expressed gene (after uterus and mammary) in the pool of normal prostate tissue compared to a total of 12 tissues analyzed.
  • the absolute numbers in Table 4 were obtained analyzing pools of samples of a particular tissue from different individuals.
  • the absolute numbers depicted in Table 6 are relative levels of expression of Pro111 in 48 pairs of matching and 18 unmatched samples. All the values are compared to normal testis (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • the level of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent).
  • Table 6 shows overexpression of Pro111 in 5 out of 16 primary prostate cancer samples compared with their respective normal adjacent (prostate samples 2, 5, 10, 17, and 19). Similar expression levels were observed in 3 unmatched prostate cancers (prostate samples 13, 14, 15), 2 prostatitis (prostate samples 20, 21), and 6 benign prostatic hyperplasia samples (prostate samples 22 through 27). Thus, there is overexpression in the cancer tissue of 31.25% of the prostate matching samples tested (total of 16 prostate matching samples).
  • the absolute numbers depicted in Table 8 are relative levels of expression of Pro115 in 17 pairs of matching and 21 unmatched samples. All the values are compared to normal thymus (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • the absolute numbers depicted in Table 10 are relative levels of expression of Pro110 in 33 pairs of matching samples. All the values are compared to normal small intestine (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent).
  • Table 10 shows overexpression of Pro110 in 8 of the 9 primary prostate cancer tissues compared with their respective normal adjacent (except prostate 4). Thus, there was overexpression in 88.88% of the cancer prostate tissue as compared to the prostate matching samples tested (total of 9 prostate matching samples).
  • Pro110 mRNA expression is upregulated in prostate cancer tissues.
  • the mRNA overexpression in 88.88% of the primary prostate matching cancer samples tested is indicative of Pro110 being a diagnostic marker for prostate cancer.
  • Pro110 also showed overexpression in several other cancers tested including small intestine, colon, liver, mammary and lung (see Table 10). Accordingly Pro110 may be a diagnostic marker for other types of cancer as well.
  • Table 11 The absolute numbers in Table 11 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 12.
  • the absolute numbers depicted in Table 12 are relative levels of expression of Pro113 in 78 pairs of matching and 25 unmatched tissue samples. All the values are compared to normal thymus (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In cancers (for example, ovary) where it was not possible to obtain normal adjacent samples from the same individual, samples from a different normal individual were analyzed.
  • prostate cancer samples In the analysis of matching samples, the higher levels of expression were in prostate, showing a high degree of tissue specificity for prostate tissue. In addition to the higher expression levels in prostate cancer samples, Pro113 expression was found to be either induced (where not expressed in normal adjacent tissues) or somewhat upregulated in several other cancers. However, the relative expression and the fold increase in prostate cancer samples far exceeds that in other cancer tissues and is highly significant.
  • the levels of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent).
  • Table 12 shows overexpression of Pro113 in 13 out of 16 primary prostate cancer tissues compared with their respective normal adjacent (prostate samples 2, 3, 4, 5, 6 7, 8, 9, 10, 11, 13, 14, 16). Thus, there was overexpression in the cancer tissue for 81.25% of the prostate matching samples tested.
  • the median for the level of expression in prostate cancer tissue samples is 609, whereas the median for all other cancers is only 7.93, with the exception of one colon sample, colon 9, whose expression was similar to that found in prostate cancer tissues.
  • Pro113 being a diagnostic marker for prostate cancer.
  • Expression was also found to be higher in other cancer tissues compared with their respective normal adjacent tissues (kidney, bladder, testis, skin, stomach, small intestine, colon, pancreas, lung, mammary, endometrium, uterus, and ovary) thus indicating Pro113 to be a pan cancer marker.
  • Table 13 The absolute numbers depicted in Table 13 are relative levels of expression of the CSG Pro114 in 12 normal different tissues. All the values are compared to normal muscle (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • the high level of tissue specificity is indicative of Pro114 being a diagnostic marker for diseases of the prostate, especially cancer.
  • Table 14 The absolute numbers depicted in Table 14 are relative levels of expression of the CSG Pro118 in 12 normal different tissues. All the values are compared to normal kidney (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • Pro118 mRNA expression is the 3 rd highest in prostate (962.1) next to endometrium (19282) and uterus (1064), which are female-specific tissues. Testis, with a relative expression level of 343.7 is the only other male tissue expressing moderate levels of mRNA for Pro118. These results establish Pro118 mRNA expression to be highly specific for reproductive tissues including the prostate.
  • the absolute numbers in Table 14 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 15.
  • the absolute numbers depicted in Table 15 are relative levels of expression of Pro118 in 59 pairs of matching and 21 unmatched samples. All the values are compared to normal kidney (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.

Abstract

The present invention provides new methods for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating prostate cancer.

Description

    FIELD OF THE INVENTION
  • This invention relates, in part, to newly developed assays for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating cancers, particularly prostate cancer.
    • BACKGROUND OF THE INVENTION
  • Cancer of the prostate is the most prevalent malignancy in adult males, excluding skin cancer, and is an increasingly prevalent health problem in the United States. In 1996, it was estimated that 41,400 deaths would result from this disease in the United States alone, indicating that prostate cancer is second only to lung cancer as the most common cause of death in the same population. If diagnosed and treated early, when the cancer is still confined to the prostate, the chances of cure is significantly higher.
  • Treatment decisions for an individual are linked to the stage of prostate cancer present in that individual. A common classification of the spread of prostate cancer was developed by the American Urological Association (AUA). The AUA system divides prostate tumors into four stages, A to D. Stage A, microscopic cancer within prostate, is further subdivided into stages A1 and A2. Sub-stage A1 is a well-differentiated cancer confined to one site within the prostate. Treatment is generally observation, radical prostatectomy, or radiation. Sub-stage A2 is a moderately to poorly differentiated cancer at multiple sites within the prostate. Treatment is radical prostatectomy or radiation. Stage B, palpable lump within the prostate, is also further subdivided into sub-stages B1 and B2. In sub-stage B1, the cancer forms a small nodule in one lobe of the prostate. In sub-stage B2, the cancer forms large or multiple nodules, or occurs in both lobes of the prostate. Treatment for sub-stages B1 and B2 is either radical prostatectomy or radiation. Stage C is a large cancer mass involving most or all of the prostate and is also further subdivided into two sub-stages. In sub-stage C1, the cancer forms a continuous mass that may have extended beyond the prostate. In sub-stage C2, the cancer forms a continuous mass that invades the surrounding tissue. Treatment for both these sub-stages is radiation with or without drugs to address the cancer. The fourth stage, Stage D is metastatic cancer and is also subdivided into two sub-stages. In sub-stage D1, the cancer appears in the lymph nodes of the pelvis. In sub-stage D2, the cancer involves tissues beyond lymph nodes. Treatment for both of these sub-stages is systemic drugs to address the cancer as well as pain.
  • However, current prostate cancer staging methods are limited. As many as 50% of prostate cancers initially staged as A2, B, or C are actually stage D, metastatic. Discovery of metastasis is significant because patients with metastatic cancers have a poorer prognosis and require significantly different therapy than those with localized cancers. The five year survival rates for patients with localized and metastatic prostate cancers are 93% and 29%, respectively.
  • Accordingly, there is a great need for more sensitive and accurate methods for the staging of a cancer in a human to determine whether or not such cancer has metastasized and for monitoring the progress of a cancer in a human which has not metastasized for the onset of metastasis.
  • It has now been found that a number of proteins in the public domain are useful as diagnostic markers for prostate cancer. These diagnostic markers are referred to herein as cancer specific genes or CSGs and include, but are not limited to: Pro109 which is a human zinc-α 2-glycoprotein (Freje et al. Genomics 1993 18(3):575-587); Pro112 which is a human cysteine-rich protein with a zinc-finger motif (Liebhaber et al. Nucleic Acid Research 1990 18(13):3871-3879; WO9514772 and WO9845436); Pro111 which is a prostate-specific transglutaminase (Dubbink et al. Genomics 1998 51(3):434-444); Pro115 which is a novel serine protease with transmembrane, LDLR, and SRCR domains and maps to 21q22.3 (Paoloni-Giacobino et al. Genomics 1997 44(3):309-320; WO9837418 and WO987093); Pro110 which is a human breast carcinoma fatty acid synthase (U.S. Pat. No. 5,665,874 and WO9403599); Pro113 which is a homeobox gene, HOXB13 (Steinicki et al. J. Invest. Dermatol. 1998 111:57-63); Pro114 which is a human tetraspan NET-1 (WO9839446); and Pro118 which is a human JM27 protein (WO9845435). ESTs for these CSGs are set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 and 15 while the full length contigs for these CSGs are set forth in SEQ ID NO:2, 4, 6, 8, 10, 12, 14 and 16, respectively. Additional CSGs for use in the present invention are depicted herein in SEQ ID NO: 17, 18, 19 and 20.
  • In the present invention, methods are provided for detecting, diagnosing, monitoring, staging, prognosticating, imaging and treating prostate cancer via the cancer specific genes referred to herein as CSGs. For purposes of the present invention, CSG refers, among other things, to native protein expressed by the gene comprising a polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. By “CSG” it is also meant herein polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1-20, but which still encode the same protein. In the alternative, what is meant by CSG as used herein, means the native mRNA encoded by the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, levels of the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, or levels of a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.
    • SUMMARY OF THE INVENTION
  • Toward these ends, and others, it is an object of the present invention to provide a method for diagnosing the presence of prostate cancer by analyzing for changes in levels of CSG in cells, tissues or bodily fluids compared with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein a change in levels of CSG in the patient versus the normal human control is associated with prostate cancer.
  • Further provided is a method of diagnosing metastatic prostate cancer in a patient having prostate cancer which is not known to have metastasized by identifying a human patient suspected of having prostate cancer that has metastasized; analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing the CSG levels in such cells, tissues, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control, wherein an increase in CSG levels in the patient versus the normal human control is associated with prostate cancer which has metastasized.
  • Also provided by the invention is a method of staging prostate cancer in a human which has such cancer by identifying a human patient having such cancer; analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing CSG levels in such cells, tissues, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control sample, wherein an increase in CSG levels in the patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of CSG is associated with a cancer which is regressing or in remission.
  • Further provided is a method of monitoring prostate cancer in a human having such cancer for the onset of metastasis. The method comprises identifying a human patient having such cancer that is not known to have metastasized; periodically analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing the CSG levels in such cells, tissue, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control sample, wherein an increase in CSG levels in the patient versus the normal human control is associated with a cancer which has metastasized.
  • Further provided is a method of monitoring the change in stage of prostate cancer in a human having such cancer by looking at levels of CSG in a human having such cancer. The method comprises identifying a human patient having such cancer; periodically analyzing a sample of cells, tissues, or bodily fluid from such patient for CSG; comparing the CSG levels in such cells, tissue, or bodily fluid with levels of CSG in preferably the same cells, tissues, or bodily fluid type of a normal human control sample, wherein an increase in CSG levels in the patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of CSG is associated with a cancer which is regressing or in remission.
  • Further provided are methods of designing new therapeutic agents targeted to a CSG for use in imaging and treating prostate cancer. For example, in one embodiment, therapeutic agents such as antibodies targeted against CSG or fragments of such antibodies can be used to detect or image localization of CSG in a patient for the purpose of detecting or diagnosing a disease or condition. Such antibodies can be polyclonal, monoclonal, or omniclonal or prepared by molecular biology techniques. The term “antibody”, as used herein and throughout the instant specification is also meant to include aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art. Antibodies can be labeled with a variety of detectable labels including, but not limited to, radioisotopes and paramagnetic metals.
  • Therapeutics agents such as antibodies or fragments thereof can also be used in the treatment of diseases characterized by expression of CSG. In these applications, the antibody can be used without or with derivatization to a cytotoxic agent such as a radioisotope, enzyme, toxin, drug or a prodrug.
  • Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.
    • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention relates to diagnostic assays and methods, both quantitative and qualitative for detecting, diagnosing, monitoring, staging and prognosticating cancers by comparing levels of CSG in a human patient with those of CSG in a normal human control. For purposes of the present invention, what is meant be CSG levels is, among other things, native protein expressed by the gene comprising a polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. By “CSG” it is also meant herein polynucleotides which, due to degeneracy in genetic coding, comprise variations in nucleotide sequence as compared to SEQ ID NO: 1-20, but which still encode the same protein. The native protein being detected, may be whole, a breakdown product, a complex of molecules or chemically modified. In the alternative, what is meant by CSG as used herein, means the native mRNA encoded by the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, levels of the gene comprising the polynucleotide sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, or levels of a polynucleotide which is capable of hybridizing under stringent conditions to the antisense sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. Such levels are preferably determined in at least one of, cells, tissues and/or bodily fluids, including determination of normal and abnormal levels. Thus, for instance, a diagnostic assay in accordance with the invention for diagnosing overexpression of CSG protein compared to normal control bodily fluids, cells, or tissue samples may be used to diagnose the presence of prostate cancer.
  • All the methods of the present invention may optionally include determining the levels of other cancer markers as well as CSG. Other cancer markers, in addition to CSG, useful in the present invention will depend on the cancer being tested and are known to those of skill in the art.
    • Diagnostic Assays
  • The present invention provides methods for diagnosing the presence of prostate cancer by analyzing for changes in levels of CSG in cells, tissues or bodily fluids compared with levels of CSG in cells, tissues or bodily fluids of preferably the same type from a normal human control, wherein an increase in levels of CSG in the patient versus the normal human control is associated with the presence of prostate cancer.
  • Without limiting the instant invention, typically, for a quantitative diagnostic assay a positive result indicating the patient being tested has cancer is one in which cells, tissues or bodily fluid levels of the cancer marker, such as CSG, are at least two times higher, and most preferably are at least five times higher, than in preferably the same cells, tissues or bodily fluid of a normal human control.
  • The present invention also provides a method of diagnosing metastatic prostate cancer in a patient having prostate cancer which has not yet metastasized for the onset of metastasis. In the method of the present invention, a human cancer patient suspected of having prostate cancer which may have metastasized (but which was not previously known to have metastasized) is identified. This is accomplished by a variety of means known to those of skill in the art.
  • In the present invention, determining the presence of CSG levels in cells, tissues or bodily fluid, is particularly useful for discriminating between prostate cancer which has not metastasized and prostate cancer which has metastasized. Existing techniques have difficulty discriminating between prostate cancer which has metastasized and prostate cancer which has not metastasized and proper treatment selection is often dependent upon such knowledge.
  • In the present invention, the cancer marker levels measured in such cells, tissues or bodily fluid is CSG, and are compared with levels of CSG in preferably the same cells, tissue or bodily fluid type of a normal human control. That is, if the cancer marker being observed is just CSG in serum, this level is preferably compared with the levee of CSG in serum of a normal human control. An increase in the CSG in the patient versus the normal human control is associated with prostate cancer which has metastasized.
  • Without limiting the instant invention, typically, for a quantitative diagnostic assay a positive result indicating the cancer in the patient being tested or monitored has metastasized is one in which cells, tissues or bodily fluid levels of the cancer marker, such as CSG, are at least two times higher, and most preferably are at least five times higher, than in preferably the same cells, tissues or bodily fluid of a normal patient.
  • Normal human control as used herein includes a human patient without cancer and/or non cancerous samples from the patient; in the methods for diagnosing or monitoring for metastasis, normal human control may preferably also include samples from a human patient that is determined by reliable methods to have prostate cancer which has not metastasized.
    • Staging
  • The invention also provides a method of staging prostate cancer in a human patient. The method comprises identifying a human patient having such cancer and analyzing cells, tissues or bodily fluid from such human patient for CSG. The CSG levels determined in the patient are then compared with levels of CSG in preferably the same cells, tissues or bodily fluid type of a normal human control, wherein an increase in CSG levels in the human patient versus the normal human control is associated with a cancer which is progressing and a decrease in the levels of CSG (but still increased over true normal levels) is associated with a cancer which is regressing or in remission.
    • Monitoring
  • Further provided is a method of monitoring prostate cancer in a human patient having such cancer for the onset of metastasis. The method comprises identifying a human patient having such cancer that is not known to have metastasized; periodically analyzing cells, tissues or bodily fluid from such human patient for CSG; and comparing the CSG levels determined in the human patient with levels of CSG in preferably the same cells, tissues or bodily fluid type of a normal human control, wherein an increase in CSG levels in the human patient versus the normal human control is associated with a cancer which has metastasized. In this method, normal human control samples may also include prior patient samples.
  • Further provided by this invention is a method of monitoring the change in stage of prostate cancer in a human patient having such cancer. The method comprises identifying a human patient having such cancer; periodically analyzing cells, tissues or bodily fluid from such human patient for CSG; and comparing the CSG levels determined in the human patient with levels of CSG in preferably the same cells, tissues or bodily fluid type of a normal human control, wherein an increase in CSG levels in the human patient versus the normal human control is associated with a cancer which is progressing in stage and a decrease in the levels of CSG is associated with a cancer which is regressing in stage or in remission. In this method, normal human control samples may also include prior patient samples.
  • Monitoring a patient for onset of metastasis is periodic and preferably done on a quarterly basis. However, this may be more or less frequent depending on the cancer, the particular patient, and the stage of the cancer.
    • Assay Techniques
  • Assay techniques that can be used to determine levels of gene expression (including protein levels), such as CSG of the present invention, in a sample derived from a patient are well known to those of skill in the art. Such assay methods include, without limitation, radioimmunoassays, reverse transcriptase PCR (RT-PCR) assays, immunohistochemistry assays, in situ hybridization assays, competitive-binding assays, Western Blot analyses, ELISA assays and proteomic approaches: two-dimensional gel electrophoresis (2D electrophoresis) and non-gel based approaches such as mass spectrometry or protein interaction profiling. Among these, ELISAs are frequently preferred to diagnose a gene's expressed protein in biological fluids.
  • An ELISA assay initially comprises preparing an antibody, if not readily available from a commercial source, specific to CSG, preferably a monoclonal antibody. In addition a reporter antibody generally is prepared which binds specifically to CSG. The reporter antibody is attached to a detectable reagent such as radioactive, fluorescent or enzymatic reagent, for example horseradish peroxidase enzyme or alkaline phosphatase.
  • To carry out the ELISA, antibody specific to CSG is incubated on a solid support, e.g. a polystyrene dish, that binds the antibody. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the sample to be analyzed is incubated in the dish, during which time CSG binds to the specific antibody attached to the polystyrene dish. Unbound sample is washed out with buffer. A reporter antibody specifically directed to CSG and linked to a detectable reagent such as horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to CSG. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a calorimetric substrate are then added to the dish. Immobilized peroxidase, linked to CSG antibodies, produces a colored reaction product. The amount of color developed in a given time period is proportional to the amount of CSG protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.
  • A competition assay can also be employed wherein antibodies specific to CSG are attached to a solid support and labeled CSG and a sample derived from the host are passed over the solid support. The amount of label detected which is attached to the solid support can be correlated to a quantity of CSG in the sample.
  • Nucleic acid methods can also be used to detect CSG mRNA as a marker for prostate cancer. Polymerase chain reaction (PCR) and other nucleic acid methods, such as ligase chain reaction (LCR) and nucleic acid sequence based amplification (NASABA), can be used to detect malignant cells for diagnosis and monitoring of various malignancies. For example, reverse-transcriptase PCR (RT-PCR) is a powerful technique which can be used to detect the presence of a specific mRNA population in a complex mixture of thousands of other mRNA species. In RT-PCR, an mRNA species is first reverse transcribed to complementary DNA (cDNA) with use of the enzyme reverse transcriptase; the cDNA is then amplified as in a standard PCR reaction. RT-PCR can thus reveal by amplification the presence of a single species of mRNA. Accordingly, if the mRNA is highly specific for the cell that produces it, RT-PCR can be used to identify the presence of a specific type of cell.
  • Hybridization to clones or oligonucleotides arrayed on a solid support (i.e. gridding) can be used to both detect the expression of and quantitate the level of expression of that gene. In this approach, a cDNA encoding the CSG gene is fixed to a substrate. The substrate may be of any suitable type including but not limited to glass, nitrocellulose, nylon or plastic. At least a portion of the DNA encoding the CSG gene is attached to the substrate and then incubated with the analyte, which may be RNA or a complementary DNA (cDNA) copy of the RNA, isolated from the tissue of interest. Hybridization between the substrate bound DNA and the analyte can be detected and quantitated by several means including but not limited to radioactive labeling or fluorescence labeling of the analyte or a secondary molecule designed to detect the hybrid. Quantitation of the level of gene expression can be done by comparison of the intensity of the signal from the analyte compared with that determined from known standards. The standards can be obtained by in vitro transcription of the target gene, quantitating the yield, and then using that material to generate a standard curve.
  • Of the proteomic approaches, 2D electrophoresis is a technique well known to those in the art. Isolation of individual proteins from a sample such as serum is accomplished using sequential separation of proteins by different characteristics usually on polyacrylamide gels. First, proteins are separated by size using an electric current. The current acts uniformly on all proteins, so smaller proteins move farther on the gel than larger proteins. The second dimension applies a current perpendicular to the first and separates proteins not on the basis of size but on the specific electric charge carried by each protein. Since no two proteins with different sequences are identical on the basis of both size and charge, the result of a 2D separation is a square gel in which each protein occupies a unique spot. Analysis of the spots with chemical or antibody probes, or subsequent protein microsequencing can reveal the relative abundance of a given protein and the identity of the proteins in the sample.
  • The above tests can be carried out on samples derived from a variety of cells, bodily fluids and/or tissue extracts such as homogenates or solubilized tissue obtained from a patient. Tissue extracts are obtained routinely from tissue biopsy and autopsy material. Bodily fluids useful in the present invention include blood, urine, saliva or any other bodily secretion or derivative thereof. By blood it is meant to include whole blood, plasma, serum or any derivative of blood.
    • In Vivo Targeting of CSGs
  • Identification of these CSGs is also useful in the rational design of new therapeutics for imaging and treating cancers, and in particular prostate cancer. For example, in one embodiment, antibodies which specifically bind to CSG can be raised and used in vivo in patients suspected of suffering from prostate cancer. Antibodies which specifically bind a CSG can be injected into a patient suspected of having prostate cancer for diagnostic and/or therapeutic purposes. The preparation and use of antibodies for in vivo diagnosis is well known in the art. For example, antibody-chelators labeled with Indium-111 have been described for use in the radioimmunoscintographic imaging of carcinoembryonic antigen expressing tumors (Sumerdon et al. Nucl. Med. Biol. 1990 17:247-254). In particular, these antibody-chelators have been used in detecting tumors in patients suspected of having recurrent colorectal cancer (Griffin et al. J. Clin. Onc. 1991 9:631-640). Antibodies with paramagnetic ions as labels for use in magnetic resonance imaging have also been described (Lauffer, R. B. Magnetic Resonance in Medicine 1991 22:339-342). Antibodies directed against CSG can be used in a similar manner. Labeled antibodies which specifically bind CSG can be injected into patients suspected of having prostate cancer for the purpose of diagnosing or staging of the disease status of the patient. The label used will be selected in accordance with the imaging modality to be used. For example, radioactive labels such as Indium-111, Technetium-99m or Iodine-131 can be used for planar scans or single photon emission computed tomography (SPECT). Positron emitting labels such as Fluorine-19 can be used in positron emission tomography. Paramagnetic ions such as Gadlinium (III) or Manganese (II) can be used in magnetic resonance imaging (MRI). Localization of the label permits determination of the spread of the cancer. The amount of label within an organ or tissue also allows determination of the presence or absence of cancer in that organ or tissue.
  • For patients diagnosed with prostate cancer, injection of an antibody which specifically binds CSG can also have a therapeutic benefit. The antibody may exert its therapeutic effect alone. Alternatively, the antibody can be conjugated to a cytotoxic agent such as a drug, toxin or radionuclide to enhance its therapeutic effect. Drug monoclonal antibodies have been described in the art for example by Garnett and Baldwin, Cancer Research 1986 46:2407-2412. The use of toxins conjugated to monoclonal antibodies for the therapy of various cancers has also been described by Pastan et al. Cell 1986 47:641-648. Yttrium-90 labeled monoclonal antibodies have been described for maximization of dose delivered to the tumor while limiting-toxicity to normal tissues (Goodwin and Meares Cancer Supplement 1997 80:22675-2680). Other cytotoxic radionuclides including, but not limited to Copper-67, Iodine-131 and Rhenium-186 can also be used for labeling of antibodies against CSG.
  • Antibodies which can be used in these in vivo methods include polyclonal, monoclonal and omniclonal antibodies and antibodies prepared via molecular biology techniques. Antibody fragments and aptamers and single-stranded oligonucleotides such as those derived from an in vitro evolution protocol referred to as SELEX and well known to those skilled in the art can also be used.
  • Small molecules predicted via computer imaging to specifically bind to regions of CSGs can also be designed and synthesized and tested for use in the imaging and treatment of prostate cancer. Further, libraries of molecules can be screened for potential anticancer agents by assessing the ability of the molecule to bind to CSGs identified herein. Molecules identified in the library as being capable of binding to CSG are key candidates for further evaluation for use in the treatment of prostate cancer.
    • EXAMPLES
  • The present invention is further described by the following examples. These examples are provided solely to illustrate the invention by reference to specific embodiments. These exemplifications, while illustrating certain aspects of the invention, do not portray the limitations or circumscribe the scope of the disclosed invention.
  • All examples outlined here were carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail. Routine molecular biology techniques of the following example can be carried out as described in standard laboratory manuals, such as Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
    • Example 1 Identification of CSGs
  • Identification of CSGs were carried out by a systematic analysis of data in the LIFESEQ database available from Incyte Pharmaceuticals, Palo Alto, Calif., using the data mining Cancer Leads Automatic Search Package (CLASP) developed by diaDexus LLC, Santa Clara, Calif.
  • The CLASP performs the following steps: selection of highly expressed organ specific genes based on the abundance level of the corresponding EST in the targeted organ versus all the other organs; analysis of the expression level of each highly expressed organ specific genes in normal, tumor tissue, disease tissue and tissue libraries associated with tumor or disease; selection of the candidates demonstrating component ESTs were exclusively or more frequently found in tumor libraries. The CLASP allows the identification of highly expressed organ and cancer specific genes. A final manual in depth evaluation is then performed to finalize the CSGs selection.
  • Clones depicted in the following Table 1 are CSGs useful in diagnosing, monitoring, staging, imaging and treating prostate cancer.
  • TABLE 1
    CSGs
    Clone ID Pro # SEQ ID NO:
    3424528H1 Pro109 1, 2
    578349H1 Pro112 3, 4
    1794013H1 Pro111 5, 6
    2189835H1 Pro115 7, 8
    3277219H1 Pro110  9, 10
    1857415 Pro113 11, 12
    1810463H1 Pro114 13, 14
    zr65G11 Pro118 15, 16
    2626135H1 17
    zd46d08 18
    1712252H1 19
    784583H1 20
    • Example 2 Relative Quantitation of Gene Expression
  • Real-Time quantitative PCR with fluorescent Taqman probes is a quantitation detection system utilizing the 5′-3′ nuclease activity of Taq DNA polymerase. The method uses an internal fluorescent oligonucleotide probe (Taqman) labeled with a 5′ reporter dye and a downstream, 3′ quencher dye. During PCR, the 5′-3′ nuclease activity of Taq DNA polymerase releases the reporter, whose fluorescence can then be detected by the laser detector of the Model 7700 Sequence Detection System (PE Applied Biosystems, Foster City, Calif., USA)
  • Amplification of an endogenous control is used to standardize the amount of sample RNA added to the reaction and normalize for Reverse Transcriptase (RT) efficiency. Either cyclophilin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ATPase, or 18S ribosomal RNA (rRNA) is used as this endogenous control. To calculate relative quantitation between all the samples studied, the target RNA levels for one sample were used as the basis for comparative results (calibrator). Quantitation relative to the “calibrator” can be obtained using the standard curve method or the comparative method (User Bulletin #2: ABI PRISM 7700 Sequence Detection System).
  • The tissue distribution and the level of the target gene were evaluated for every sample in normal and cancer tissues. Total RNA was extracted from normal tissues, cancer tissues, and from cancers and the corresponding matched adjacent tissues. Subsequently, first strand cDNA was prepared with reverse transcriptase and the polymerase chain reaction was done using primers and Taqman probes specific to each target gene. The results were analyzed using the ABI PRISM 7700 Sequence Detector. The absolute numbers are relative levels of expression of the target gene in a particular tissue compared to the calibrator tissue.
    • Expression of Clone ID 3424528H1 (Pro109)
  • For the CSG Pro109, real-time quantitative PCR was performed using the following primers:
  • Forward Primer:
    5′- ATCAGAACAAAGAGGCTGTGTC -3′ (SEQ ID NO: 21)
    Reverse Primer:
    5′- ATCTCTAAAGCCCCAACCTTC -3′ (SEQ ID NO: 22)

    The absolute numbers depicted in Table 2 are relative levels of expression of the CSG referred to as Pro109 in 12 normal different tissues. All the values are compared to normal stomach (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 2
    Relative Levels of CSG Pro109 Expression in Pooled
    Samples
    Tissue NORMAL
    Colon 0.02
    Endometrium 0.01
    Kidney 0.48
    Liver 14.83
    Ovary 0.08
    Pancreas 4.38
    Prostate 11.24
    Small Intestine 0.42
    Spleen 0
    Stomatch 1
    Testis 0.62
    Uterus 0.02

    The relative levels of expression in Table 2 show that with the exception of liver (14.83), Pro109 mRNA expression is higher (11.24) in prostate compared with all other normal tissues analyzed. Pancreas, with a relative expression level of 4.38, is the only other tissue expressing considerable mRNA for Pro109.
  • The absolute numbers in Table 2 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 3.
  • The absolute numbers depicted in Table 3 are relative levels of expression of Pro109 in 28 pairs of matching samples and 4 unmatched samples. All the values are compared to normal stomach (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • TABLE 3
    Relative Levels of CSG Pro109 Expression in
    Individual Samples
    Matching
    Normal
    Sample ID Tissue Cancer Adjacent
    Pro34B Prostate 1 5.98 6.06
    Pro65XB Prostate 2 16.68 3.85
    Pro69XB Prostate 3 20.46 6.82
    Pro78XB Prostate 4 1.39 1.4
    Pro101XB Prostate 5 24.8 9.8
    Pro12B Prostate 6 9.1 0.2
    Pro13XB Prostate 7 0.5 9.7
    Pro20XB Prostate 8 13 12.5
    Pro23B Prostate 9 16.8 3
    Ovr10005O Ovary 1 0.4
    Ovr1028 Ovary 2 1.9
    Ovr18GA Ovary 3 0.1
    Ovr206I Ovary 4 0.1
    Mam12X Mammary Gland 1 13.5 1.4
    Mam47XP Mammary Gland 2 0.7 0.2
    Lng47XQ Lung 1 2.36 0.03
    Lng60XL Lung 2 7.39 0.2
    Lng75XC Lung 3 0.77 0.27
    StoAC44 Stomach 1 0.05 1.19
    StoAC93 Stomach 2 0.55 0.8
    StoAC99 Stomach 3 0.12 3.04
    ColAS43 Colon 1 16.11 0.07
    ColAS45 Colon 2 0.11 0.08
    ColAS46 Colon 3 4.99 0.4
    Liv15XA Liver 1 8.43 10.97
    Liv42X Liver 2 1.57 20.82
    Liv94XA Liver 3 2.98 9.19
    Pan77X Pancreas 1 36 32
    Pan82XP Pancreas 2 0.09 7.09
    Pan92X Pancreas 3 0.7 0
    Pan71XL Pancreas 4 2.48 0.73
    Pan10343 Pancreas 5 46 5.5
    0 = Negative
  • In the analysis of matching samples, the higher levels of expression were in prostate, showing a high degree of tissue specificity for prostate tissue. Of all the samples different than prostate analyzed, only 4 cancer samples (the cancer sample mammary 1 with 13.5, colon 1 with 16.11, liver 1 with 8.43, and lung 2 with 7.39) showed an expression comparable to the mRNA expression in prostate. These results confirmed some degree of tissue specificity as obtained with the panel of normal pooled samples (Table 2).
  • Furthermore, the level of mRNA expression was compared in cancer samples and the isogenic normal adjacent tissue from the same individual. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent). Table 3 shows overexpression of Pro109 in 6 out of 9 primary prostate cancer tissues compared with their respective normal adjacents. Thus, overexpression in the cancer tissue was observed in 66.66% of the prostate matching samples tested (total of 9 prostate matching samples).
  • Altogether, the degree of tissue specificity, plus the mRNA overexpression in 66.66% of the primary prostate matching samples tested is indicative of Pro109 being a diagnostic marker for prostate cancer.
    • Expression of Clone ID 578349H1 (Pro112):
  • For the CSG Pro112, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- TGCCGAAGAGGTTCAGTGC -3′ (SEQ ID NO: 23)
    Reverse Primer
    5′- GCCACAGTGGTACTGTCCAGAT -3′ (SEQ ID NO: 24)
  • 5
  • The absolute numbers depicted in Table 4 are relative levels of expression of the CSG Pro112 in 12 normal different tissues. All the values are compared to normal thymus (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 4
    Relative Levels of CSG Pro112 Expression in Pooled
    Samples
    Tissue NORMAL
    Brain 2.9
    Heart 0.1
    Kidney 0.2
    Liver 0.2
    Lung 7.7
    Mammary 4.2
    Muscle 0.1
    Prostate 5.5
    Small Intestine 1.8
    Testis 1
    Thymus 1
    Uterus 21
  • The relative levels of expression in Table 4 show that Pro112 mRNA expression is the 3rd most highly expressed gene (after uterus and mammary) in the pool of normal prostate tissue compared to a total of 12 tissues analyzed. The absolute numbers in Table 4 were obtained analyzing pools of samples of a particular tissue from different individuals. These results demonstrate that Pro112 mRNA expression is specific for prostate thus indicating Pro112 to be a diagnostic marker for prostate disease especially cancer.
    • Expression of Clone ID 1794013H1 (Pro111)
  • For the CSG Pro111, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- GCTGCAAGTTCTCCACATTGA -3′ (SEQ ID NO: 25)
    Reverse Primer
    5′- CAGCCGCAGGTGAAACAC -3′ (SEQ ID NO: 26)

    The absolute numbers depicted in Table 5 are relative levels of expression of the CSG Pro111 in 12 normal different tissues. All the values are compared to normal testis (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 5
    Relative Levels of CSG Pro111 Expression in Pooled
    Samples
    Tissue NORMAL
    Brain 0.04
    Heart 0
    Kidney 0
    Liver 0
    Lung 0.05
    Mammary 0.14
    Muscle 5166.6
    Prostate 1483.72
    Small Intestine 0.33
    Testis 1
    Thymus 0.49
    Uterus 0.07
  • The relative levels of expression in Table 5 show that Pro111 mRNA expression is extraordinarily high in the pool of normal prostate (1483.72) compared to all the other tissues analyzed with the exception of muscle (5166.6). These results demonstrate that Pro111 mRNA expression shows specificity for prostate and muscle.
  • The absolute numbers in Table 5 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 6.
  • The absolute numbers depicted in Table 6 are relative levels of expression of Pro111 in 48 pairs of matching and 18 unmatched samples. All the values are compared to normal testis (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • TABLE 6
    Relative Levels of CSG Pro111 Expression in
    Individual Samples
    Matching
    Normal
    Sample ID Tissue Cancer Adjacent
    Pro101XB Prostate 1 8.3 21.8
    Pro12B Prostate 2 2336 133
    Pro13XB Prostate 3 3.4 23
    Pro20XB Prostate 4 21.6 121.5
    Pro23B Prostate 5 19.4 3.7
    Pro34B Prostate 6 15 39
    Pro65XB Prostate 7 8 867
    Pro69XB Prostate 8 56 94
    Pro78XB Prostate 9 24 1515
    Pro84XB Prostate 10 119 15.35
    Pro90XB Prostate 11 8.08 112.2
    Pro91XB Prostate 12 0.88 51.8
    ProC215 Prostate 13 0.3
    ProC234 Prostate 14 0.35
    ProC280 Prostate 15 436.5
    Pro109XB Prostate 16 3.43 265
    Pro110 Prostate 17 18.2 8.73
    Pro125XB Prostate 18 0.34 186
    Pro326 Prostate 19 1392 110
    Pro10R Prostate 20 0.5
    (prostatitis)
    Pro20R Prostate 21 24.1
    (prostatitis)
    Pro258 Prostate 22 (BPH) 4610
    Pro263C Prostate 23 (BPH) 0
    Pro267A Prostate 24 (BPH) 1.46
    Pro271A Prostate 25 (BPH) 0
    Pro460Z Prostate 26 (BPH) 1.47
    ProC032 Prostate 27 (BPH) 14.4
    Tst39X Testis 1 0 0
    Bld32XK Bladder 1 0.44 0.41
    Bld46XK Bladder 2 0 0
    Bld66X Bladder 3 0 0
    BldTR14 Bladder 4 0 0
    Kid106XD Kidney 1 0 0
    Kid107XD Kidney 2 0 0
    Kid109XD Kidney 3 0 0
    Pan10343 Pancreas 1 0 0
    Pan71XL Pancreas 2 0 0
    Pan77X Pancreas 3 0 0
    Liv15XA Liver 1 0 0
    Liv42X Liver 2 0 0
    ClnAS43 Colon 1 0 0
    ClnAS45 Colon 2 0 0
    ClnAS46 Colon 3 0 0
    ClnAS67 Colon 4 0 0
    ClnAC19 Colon 5 0 0
    ClnAS12 Colon 6 0 0
    SmI21XA Small Intestine 1 0 0
    SmIH89 Small Intestine 2 0 0
    Lng47XQ Lung 1 0.7 0
    Lng60XL Lung 2 0 0
    Lng75XC Lung 3 0 0
    Lng90X Lung 4 0 0
    Mam12X Mammary Gland 1 0 1.4
    Mam59X Mammary Gland 2 0.2 0
    MamA06X Mammary Gland 3 0 0
    MamS127 Mammary Gland 4 0 0
    Mam162X Mammary Gland 5 0 0
    Mam42DN Mammary Gland 6 0 0
    Ovr103X Ovary 1 0.14 0
    Ovr1005O Ovary 2 0.2
    Ovr1028 Ovary 3 0
    Ovr1040O Ovary 4 0.2
    Ovr18GA Ovary 5 0
    Ovr206I Ovary 6 0
    Ovr20GA Ovary 7 0.2
    Ovr25GA Ovary 8 0
    0 = Negative
  • In the analysis of matching samples, the higher levels of expression were in prostate showing a high degree of tissue specificity for prostate. These results confirm the tissue specificity results obtained with normal pooled samples (Table 5).
  • Furthermore, the level of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent). Table 6 shows overexpression of Pro111 in 5 out of 16 primary prostate cancer samples compared with their respective normal adjacent (prostate samples 2, 5, 10, 17, and 19). Similar expression levels were observed in 3 unmatched prostate cancers (prostate samples 13, 14, 15), 2 prostatitis (prostate samples 20, 21), and 6 benign prostatic hyperplasia samples (prostate samples 22 through 27). Thus, there is overexpression in the cancer tissue of 31.25% of the prostate matching samples tested (total of 16 prostate matching samples).
  • Altogether, the high level of tissue specificity, plus the mRNA overexpression in 31.25% of the prostate matching samples tested are indicative of Pro111 being a diagnostic marker for prostate cancer.
    • Expression of Clone ID 2189835H1 (Pro115)
  • For the CSG Pro115, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- TGGCTTTGAACTCAGGGTCA -3′ (SEQ ID NO: 27)
    Reverse Primer
    5′- CGGATGCACCTCGTAGACAG -3′ (SEQ ID NO: 28)

    The absolute numbers depicted in Table 7 are relative levels of expression of the CSG Pro115 in 12 normal different tissues. All the values are compared to normal thymus (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 7
    Relative Levels of CSG Pro115 Expression in Pooled
    Samples
    Tissue NORMAL
    Brain 0.016
    Heart 0.002
    Kidney 8.08
    Liver 2.20
    Lung 112.99
    Mammary 29.45
    Muscle 0.05
    Prostate 337.79
    Small Intestine 7.54
    Testis 1.48
    Thymus 1
    Uterus 1.4
  • The relative levels of expression in Table 7 show that Pro115 mRNA expression is higher (337.79) in prostate compared with all the other normal tissues analyzed. Lung, with a relative expression level of 112.99, and mammary (29.446) are the other tissues expressing moderate levels of mRNA for Pro115. These results establish Pro115 mRNA expression to be highly specific for prostate.
  • The absolute numbers in Table 7 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 8.
  • The absolute numbers depicted in Table 8 are relative levels of expression of Pro115 in 17 pairs of matching and 21 unmatched samples. All the values are compared to normal thymus (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • TABLE 8
    Relative Levels of CSG Pro115 Expression in
    Individual Samples
    Matching
    Normal
    Sample ID Tissue Cancer Adjacent
    Pro12B Prostate 1 1475.9 190.3
    ProC234 Prostate 2 169.61
    Pro109XB Prostate 3 639.53
    Pro101XB Prostate 4 1985.2 2882.9
    Pro13XB Prostate 5 34.9 13.9
    Pro215 Prostate 6 525.59
    Pro125XB Prostate 7 556.05
    Pro23B Prostate 8 1891.4 1118.6
    ProC280 Prostate 9 454.3
    Pro20XB Prostate 10 1332.6
    Pro34B Prostate 11 362.91
    Pro65XB Prostate 12 135.06
    Pro69XB Prostate 13 179.67
    Pro10R Prostate 14 143.82
    (prostatitis)
    Pro20R Prostate 15 397.79
    (prostatitis)
    Pro258 Prostate 16 (BPH) 216.6
    Pro263C Prostate 17 (BPH) 601.25
    Pro267A Prostate 18 (BPH) 200.28
    Pro271A Prostate 19 (BPH) 111.43
    Pro460Z Prostate 20 (BPH) 53.84
    ProC032 Prostate 21 (BPH) 56.94
    SmI21XA Small Intestine 1 28.8 29.9
    SmIH89 Small Intestine 2 70.8 348.5
    ClnAC19 Colon 1 22.73 446.47
    ClnAS12 Colon 2 116.97 493.18
    Kid106XD Kidney 1 86.13 41.14
    Kid107XD Kidney 2 0.26 35.14
    Lng47XQ Lung 1 5.13 20.98
    Lng60XL Lung 2 13.93 114.78
    Lng75XC Lung 3 16.47 53.79
    Mam12X Mammary Gland 1 6.25 10.75
    Mam162X Mammary Gland 2 1.84 2.54
    Mam42DN Mammary Gland 3 23.08 35.51
    Ovr10050 Ovary 1 0.9
    Ovr1028 Ovary 2 261.4
    Ovr103X Ovary 3 7 0.1
    Ovr20GA Ovary 4 0
    Ovr25GA Ovary 5 0
    0 = Negative
  • Higher levels of expression were seen in prostate, showing a high degree of tissue specificity for prostate tissue. Of all the analyzed samples different from prostate, only two cancer samples (colon 2 with 116.97 and ovary 2 with 261.4), and 5 normal adjacent tissue samples (small intestine 2, colon 1, colon 2, kidney 1, and lung 2), showed an expression comparable to the mRNA expression in prostate. These results confirmed the tissue specificity results obtained with the panel of normal pooled samples (Table 7).
  • Furthermore, the levels of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent). Table 8 shows higher expression of Pro115 in 3 out of 4 matched prostate cancer tissues (prostate samples 1, 5 & 8).
  • Altogether, the high level of tissue specificity, plus the higher expression in 75% of the prostate matching samples tested, are indicative of Pro115 being a diagnostic marker for prostate cancer.
    • Expression of Clone ID 3277219H1 (Pro110):
  • For the CSG Pro110, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- CGGCAACCTGGTAGTGAGTG -3′ (SEQ ID NO: 29)
    Reverse Primer
    5′- CGCAGCTCCTTGTAAACTTCAG -3′ (SEQ ID NO: 30)

    The absolute numbers depicted in Table 9 are relative levels of expression of the CSG Pro110 in 12 normal different tissues. All the values are compared to normal small intestine (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 9
    Relative Levels of CSG Pro110 Expression in Pooled
    Samples
    Tissue NORMAL
    Brain 6.61
    Heart 0.7
    Kidney 0.74
    Liver 7.94
    Lung 11.88
    Mammary 22.78
    Muscle 6.77
    Prostate 3.01
    Small Intestine 1
    Testis 2.58
    Thymus 13.74
    Uterus 2.61

    The relative levels of expression in Table 9 show that Pro110 mRNA expression is not as high in normal prostate (3.01) compared with all the other normal tissues analyzed.
  • The absolute numbers in Table 9 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 10.
  • The absolute numbers depicted in Table 10 are relative levels of expression of Pro110 in 33 pairs of matching samples. All the values are compared to normal small intestine (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • TABLE 10
    Relative Levels of CSG Pro110 Expression in
    Individual Samples
    Matching
    Normal
    Sample ID Tissue Cancer Adjacent
    Pro12B Prostate 1 11.8 0.3
    Pro78XB Prostate 2 14.3 6.3
    Pro101XB Prostate 3 33.2 10.7
    Pro13XB Prostate 4 0.3 0.4
    Pro23XB Prostate 5 25.5 14.4
    Pro20XB Prostate 6 43.3 4
    Pro34XB Prostate 7 31.8 18.7
    Pro65XB Prostate 8 26.9 3.4
    Pro69XB Prostate 9 12.5 7
    Lng75XC Lung 1 1.9 3
    Lng90X Lung 2 5.5 0.5
    LngAC11 Lung 3 9.3 9.7
    LngAC32 Lung 4 11.2 2.2
    Lng47XQ Lung 5 11.3 0.3
    Lng60XL Lung 6 29.1 6.8
    Mam12B Mammary Gland 1 19.8 0
    Mam603X Mammary Gland 2 13.7 0
    Mam82XI Mammary Gland 3 73.5 0
    MamA04 Mammary Gland 4 0 24.6
    MamB011X Mammary Gland 5 17.4 2
    MamC012 Mammary Gland 6 0 12.8
    MamC034 Mammary Gland 7 0 61
    Mam12X Mammary Gland 8 14 2.2
    Mam59X Mammary Gland 9 33 2.2
    MamA06X Mammary Gland 10 16.4 0.8
    Liv15XA Liver 1 4.7 0.6
    Liv42X Liver 2 7.5 2.6
    Liv94XA Liver 3 0.4 1.4
    ClnAS43 Colon 1 52.9 1.4
    ClnAS45 Colon 2 2.1 0.8
    ClnAS46 Colon 3 39.8 3.7
    SmI21X Small Intestine 1 0.9 0.1
    SmIH89 Small Intestine 2 5.8 0.9
    0 = Negative

    The levels of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent). Table 10 shows overexpression of Pro110 in 8 of the 9 primary prostate cancer tissues compared with their respective normal adjacent (except prostate 4). Thus, there was overexpression in 88.88% of the cancer prostate tissue as compared to the prostate matching samples tested (total of 9 prostate matching samples).
  • Although not tissue specific, Pro110 mRNA expression is upregulated in prostate cancer tissues. The mRNA overexpression in 88.88% of the primary prostate matching cancer samples tested is indicative of Pro110 being a diagnostic marker for prostate cancer. Pro110 also showed overexpression in several other cancers tested including small intestine, colon, liver, mammary and lung (see Table 10). Accordingly Pro110 may be a diagnostic marker for other types of cancer as well.
    • Expression of Clone ID 1857415; Gene ID 346880 (Pro113)
  • For the CSG Pro113, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- CGGGAACCTACCAGCCTATG -3′ (SEQ ID NO: 31)
    Reverse Primer
    5′- CAGGCAACAGGGAGTCATGT -3′ (SEQ ID NO: 32)

    The absolute numbers depicted in Table 11 are relative levels of expression of the CSG Pro113 in 12 normal different tissues. All the values are compared to normal thymus (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 11
    Relative Levels of CSG Pro113 Expression in
    Pooled Samples
    Tissue NORMAL
    Brain 0.03
    Heart 0
    Kidney 0.01
    Liver 0
    Lung 0
    Mammary Gland 0
    Muscle 0.04
    Prostate 489.44
    Small Intestine 0.02
    Testis 0.35
    Thymus 1
    Uterus 0.13

    The relative levels of expression in Table 11 show that Pro113 mRNA expression is higher (489.44) in prostate compared with all the other normal tissues analyzed. Testis, with a relative expression level of 0.35, uterus (0.13), thymus (1.0), kidney (0.01) and brain (0.03) were among the other tissues expressing lower mRNA levels for Pro113. These results establish that Pro113 mRNA expression is highly specific for prostate.
  • The absolute numbers in Table 11 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 12.
  • The absolute numbers depicted in Table 12 are relative levels of expression of Pro113 in 78 pairs of matching and 25 unmatched tissue samples. All the values are compared to normal thymus (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual. In cancers (for example, ovary) where it was not possible to obtain normal adjacent samples from the same individual, samples from a different normal individual were analyzed.
  • TABLE 12
    Relative Levels of CSG Pro113 Expression in
    Individual Samples
    Matched or
    Unmatched
    Normal
    Sample ID Tissue Cancer Adjacent
    Pro780B/781B Prostate 1 375.58 446.29
    Pro1291B/1292B Prostate 2 1060 31
    Pro139B96/140B96 Prostate 3 41 32
    Pro209B96/210B96 Prostate 4 505 255
    Pro1256B/1257B Prostate 5 165.79 141.63
    Pro1293B/1294B Prostate 6 1613.7 874.61
    Pro694B/695B Prostate 7 458.6 142.21
    Pro1012B/1013B Prostate 8 1520 864
    Pro1222B/1223B Prostate 9 939 530
    Pro845B/846B Prostate 10 1552.4 374.6
    Pro1094B/1095B Prostate 11 278.37 135.89
    Pro650B/651B Prostate 12 532.81 640.85
    Pro902B/903B Prostate 13 609.05 415.86
    Pro916B/917B Prostate 14 699.42 401.24
    Pro9821110A/110B Prostate 15 156 487.8
    ProS9821326A/26B Prostate 16 744.4 472.8
    Pro9407c215 Prostate 17 1389.2
    Pro9407c234 Prostate 18 305.5
    Pro9407c280A Prostate 19 894.5
    Pro9409C010R Prostate 20 269.7
    (prostatitis)
    Pro9404C120R Prostate 21 299.2
    (prostatitis)
    Pro1000258 Prostate 22 149.6
    (BPH)
    Pro4001263C Prostate 23 576
    (BPH)
    Pro4001267A Prostate 24 132.1
    (BPH)
    Pro9411C032 Prostate 25 118.2
    (BPH)
    Pro4001460Z Prostate 26 276.3
    (BPH)
    Pro4001271A Prostate 27 58.7
    (BPH)
    Kid1064D/65D Kidney 1 0 0.1
    Kid1079D/1080D Kidney 2 0.3 0.02
    Kid1097D/1098D Kidney 3 35.14 0.32
    Kid1024D/1025D Kidney 4 1.31 0
    Kid1183D/1184D Kidney 5 24.79 0
    Kid1242D/1243D Kidney 6 0 0
    Bld469K Bladder 1 2.88
    Bld467K/468K Bladder 2 2.65
    Bld327K/328K Bladder 3 0 4.05
    Bld470K Bladder 4 1.64
    Bld665T/664T Bladder 5 0.21 1.99
    Bld1496K/1497K Bladder 6 13.55 1.14
    Bld1721K/1722K Bladder 7 120.16 1.34
    Tst239X/240X Testis 1 31.5 0.73
    TstS9820647A/47B Testis 2 15.7 0
    TstS9820663A/663B Testis 3 72 1.4
    SknS9821248A/248B Skin 1 1.8 0.5
    SknS99448A/448B Skin 2 251.6 0
    Skn99816A/816B Skin 3 33 0.7
    Sto4004864A4/B4 Stomach 1 14.12 0
    Sto4004509A3/B1 Stomach 2 40.74 39
    SmI9807A212A/213A Small 0.1 0
    Intestine 1
    SmI9802H008/H009 Small 5.8 0.1
    Intestine 2
    Cln9608B012/B011 Colon 1 4.5 0
    Cln9709c074ra/073ra Colon 2 65.8 3.1
    Cln4004709A1/709B1 Colon 3 1.1 0.9
    Cln9405C199/C200 Colon 4 34.76 0.73
    Cln9707c004gb/006ga Colon 5 90.26 0.96
    Cln96-09-B004/B003 Colon 6 17.9 20.64
    Cln9612B006/B005 Colon 7 17.56 0.3
    Cln9705F002D/F001C Colon 8 21.39 0
    ClnCXGA Colon 9 429.14 142.69
    Pan10343a Pancreas 1 0 0
    Pan776P/777P Pancreas 2 0 0.15
    Pan921O/922O Pancreas 3 7.36 0
    Pan714L/715L Pancreas 4 13.57 0.11
    Pan824P/825P Pancreas 5 0 0
    Lng476Q/477Q Lung 1 0 0
    Lng605L/606L Lung 2 0 0.1
    Lng11145B/11145C Lung 3 85.9 0
    Lng0008632A/32B Lung 4 23.85 0
    Lng750C/751C Lung 5 0.32 0.25
    Lng8890A/8890B Lung 6 10.63 0
    Lng8926A/8926B Lung 7 15.37 0
    Lng0010239A/39B Lung 8 26.17 0
    Lng9502C109R/110R Lung 9 0.68 0
    LngS9821944a/44b Lung 10 0 0
    Mam00042D01/42N01 Mammary Gland 1 8.5 0
    Mam59XC Mammary Gland 2 61.07 0
    Mam9706A066G/67C Mammary Gland 3 4.84 0
    Mam14153a1C Mammary Gland 4 9.72 6.99
    Mam1620F/1621F Mammary Gland 5 0.91 0
    Mam00014D05 Mammary Gland 6 2.45 0
    End10479B/D Endometrium 1 133.43 1.12
    End9705A125A/126A Endometrium 2 0 0.39
    End9704C281A/282A Endometrium 3 23.5 1.56
    End680o97/681o97 Endometrium 4 88.89 79.02
    Utr1359O/1358O Uterus 1 0.2 0
    Utr850U/851U Uterus 2 0 0
    Utr1417O/1418O Uterus 3 14 0.4
    Utr233U96/234U96 Uterus 4 8.65 4.64
    CvxVNM00052D01/52N01 Cervix 1 0.82 77.15
    CvxVNM00083D01/83N01 Cervix 2 0.78 221.48
    CvxND00023D01/23N01 Cervix 3 3.25 15.22
    Ovr1037O/1038O Ovary 1 0.1 0
    Ovr1005O Ovary 2 18.96
    Ovr1028 Ovary 3 0
    Ovr14638A1C Ovary 4 3.2
    Ovr14603A1D Ovary 5 882.3
    Ovr773O Ovary 6 0
    Ovr9702C018GA Ovary 7 0.15
    Ovr206I Ovary 8 0
    Ovr9702C020GA Ovary 9 0
    Ovr9702C025GA Ovary 10 0
    Ovr9701C035GA Ovary 11 0.07
    Ovr9701C050GB Ovary 12 0.58
    0 = Negative
  • In the analysis of matching samples, the higher levels of expression were in prostate, showing a high degree of tissue specificity for prostate tissue. In addition to the higher expression levels in prostate cancer samples, Pro113 expression was found to be either induced (where not expressed in normal adjacent tissues) or somewhat upregulated in several other cancers. However, the relative expression and the fold increase in prostate cancer samples far exceeds that in other cancer tissues and is highly significant.
  • Furthermore, the levels of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent). Table 12 shows overexpression of Pro113 in 13 out of 16 primary prostate cancer tissues compared with their respective normal adjacent (prostate samples 2, 3, 4, 5, 6 7, 8, 9, 10, 11, 13, 14, 16). Thus, there was overexpression in the cancer tissue for 81.25% of the prostate matching samples tested. The median for the level of expression in prostate cancer tissue samples is 609, whereas the median for all other cancers is only 7.93, with the exception of one colon sample, colon 9, whose expression was similar to that found in prostate cancer tissues.
  • Altogether, the high level of tissue specificity, plus the mRNA overexpression in 81.25% of the primary prostate matching samples tested are indicative of Pro113 being a diagnostic marker for prostate cancer. Expression was also found to be higher in other cancer tissues compared with their respective normal adjacent tissues (kidney, bladder, testis, skin, stomach, small intestine, colon, pancreas, lung, mammary, endometrium, uterus, and ovary) thus indicating Pro113 to be a pan cancer marker.
    • Expression of Clone ID 1810463H1 (Pro114):
  • For the CSG Pro114, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- TGGGCATCTGGGTGTCAA -3′ (SEQ ID NO: 33)
    Reverse Primer
    5′- CGGCTGCGATGAGGAAGTA -3′ (SEQ ID NO: 34)
  • The absolute numbers depicted in Table 13 are relative levels of expression of the CSG Pro114 in 12 normal different tissues. All the values are compared to normal muscle (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 13
    Relative Levels of CSG Pro114 Expression in
    Pooled Samples
    Tissue NORMAL
    Brain 9.7
    Heart 0.7
    Kidney 414.4
    Liver 4
    Lung 882.2
    Mammary 44
    Muscle 1
    Prostate 1951
    Small Intestine 22
    Testis 367.1
    Thymus 25.8
    Uterus 139.6

    The relative levels of expression in Table 13 show that Pro114 mRNA expression is higher (1951) in prostate compared with all the other normal tissues analyzed. Lung, with a relative expression level of 882.2, kidney 414.4, testis 367.1 and uterus 139.6, are the other tissues expressing higher levels of mRNA for Pro114. These results establish Pro114 mRNA expression to be more specific for prostate than other tissues examined.
  • The high level of tissue specificity is indicative of Pro114 being a diagnostic marker for diseases of the prostate, especially cancer.
  • Expression of Clone ID zr65g11 (Pro118):
  • For the CSG Pro118, real-time quantitative PCR was performed using the following primers:
  • Forward Primer
    5′- GCCCATCTCCTGCTTCTTTAGT -3′ (SEQ ID NO: 35)
    Reverse Primer
    5′- CGTCGAGATGGCTCTGATGTA -3′ (SEQ ID NO: 36)
  • The absolute numbers depicted in Table 14 are relative levels of expression of the CSG Pro118 in 12 normal different tissues. All the values are compared to normal kidney (calibrator). These RNA samples are commercially available pools, originated by pooling samples of a particular tissue from different individuals.
  • TABLE 14
    Relative Levels of CSG Pro118 Expression in
    Pooled Samples
    Tissue NORMAL
    Colon 0.87
    Endometrium 19282
    Kidney 1
    Liver 0
    Ovary 86.22
    Pancreas 0
    Prostate 962.1
    Small Intestine 0
    Spleen 0.75
    Stomach 0.54
    Testis 343.7
    Uterus 1064
  • The relative levels of expression in Table 14 show that Pro118 mRNA expression is the 3rd highest in prostate (962.1) next to endometrium (19282) and uterus (1064), which are female-specific tissues. Testis, with a relative expression level of 343.7 is the only other male tissue expressing moderate levels of mRNA for Pro118. These results establish Pro118 mRNA expression to be highly specific for reproductive tissues including the prostate.
  • The absolute numbers in Table 14 were obtained analyzing pools of samples of a particular tissue from different individuals. They cannot be compared to the absolute numbers originated from RNA obtained from tissue samples of a single individual in Table 15.
  • The absolute numbers depicted in Table 15 are relative levels of expression of Pro118 in 59 pairs of matching and 21 unmatched samples. All the values are compared to normal kidney (calibrator). A matching pair is formed by mRNA from the cancer sample for a particular tissue and mRNA from the normal adjacent sample for that same tissue from the same individual.
  • TABLE 15
    Relative Levels of CSG Pro118 Expression in
    Individual Samples
    Matching
    Normal
    Sample ID Tissue Cancer Adjacent
    Pro12B Prostate 1 41700.7 22242.83
    ProC234 Prostate 2 40087
    Pro78XB Prostate 3 4075.6 7066.7
    Pro109XB Prostate 4 334.4 777.2
    Pro84XB Prostate 5 11684 58290
    Pro101XB Prostate 6 21474.13 100720.8
    Pro91X Prostate 7 14849 33717
    Pro13XB Prostate 8 202.57 146.91
    ProC215 Prostate 9 73243
    Pro125XB Prostate 10 629.6 521.4
    Pro23B Prostate 11 157532.6 110654.4
    Pro90XB Prostate 12 2317 64134
    ProC280 Prostate 13 42020
    Pro20XB Prostate 14 2909.31
    Pro34B Prostate 15 29610 23264
    Pro110 Prostate 16 13354 30991
    Pro65XB Prostate 17 10126 11270
    Pro69XB Prostate 18 2671.42
    Pro326 Prostate 19 9962.3 19231
    Pro10R Prostate 20 27355
    (prostatitis)
    Pro20R Prostate 21 21081
    (prostatitis)
    Pro258 Prostate 22 (BPH) 79916.32
    Pro263C Prostate 23 (BPH) 108924.5
    Pro267A Prostate 24 (BPH) 92910.22
    Pro271A Prostate 25 (BPH) 57004.4
    Pro460Z Prostate 26 (BPH) 57449.23
    ProC032 Prostate 27 (BPH) 45781.44
    Kid106XD Kidney 1 3.08 217.36
    Kid107XD Kidney 2 0 38.36
    Kid109XD Kidney 3 0 123.5
    Kid10XD Kidney 4 17.69 67.8
    Kid11XD Kidney 5 16.74 360.8
    Kid124D Kidney 6 0 167.4
    Bld32XK Bladder 1 0 0
    Bld47K Bladder 2 36.38
    Bld66X Bladder 3 0 4.52
    BldTR14 Bladder 4 0 12.17
    BldTR17 Bladder 5 0 0
    Bld46XK Bladder 6 16.5 0
    Tst39X Testis 1 116.6 24.35
    Tst647T Testis 2 856.16 43.5
    StoAC44 Stomach 1 0 0
    StoAC93 Stomach 2 0 0
    SmI21XA Small Intestine 1 68.45 0
    SmIH89 Small Intestine 2 0 0
    ClnAC19 Colon 1 149 21.33
    ClnAS12 Colon 2 0 0
    ClnB34 Colon 3 0 0
    ClnB56 Colon 4 13.04 5.22
    ClnAS43 Colon 5 0 0
    Lng47XQ Lung 1 0 0
    Lng60XL Lung 2 0 0
    Lng75XC Lung 3 0 3.38
    Lng90X Lung 4 0 0
    LngBR26 Lung 5 0 26.82
    Pan10343 Pancreas 1 50.47 0
    Pan77X Pancreas 2 281.1 0
    Pan92X Pancreas 3 18.41 0
    Pan71XL Pancreas 4 0 0
    Pan82XP Pancreas 5 0 0
    PanC044 Pancreas 6 0 0
    Mam12X Mammary Gland 1 0 0
    Mam162X Mammary Gland 2 0 0
    Mam42DN Mammary Gland 3 0 0
    MamS127 Mammary Gland 4 12.58 0
    Mam14DN Mammary Gland 5 0 0
    End28XA Endometrium 1 331.9 1824
    End3AX Endometrium 2 27825 65839
    End4XA Endometrium 3 10.3 15935
    Utr141O Uterus 1 18885 18116
    Utr23XU Uterus 2 3358 7674
    CvxKS52 Cervix 1 0 0
    CvxKS83 Cervix 2 0 0
    Ovr1005O Ovary 1 72.86
    Ovr1028 Ovary 2 0
    Ovr638A Ovary 3 0
    Ovr63A Ovary 4 90.88
    Ovr773O Ovary 5 1.21
    Ovr1040O Ovary 6 5.08
    Ovr105O Ovary 7 0
    Ovr1118 Ovary 8 7.41
    Ovr103X Ovary 9 32.78
    Ovr20GA Ovary 10 0
    Ovr25GA Ovary 11 1173.83
    Ovr35GA Ovary 12 313.4
    Ovr50GB Ovary 13 823.1
    Ovr18GA Ovary 14 40.6
    Ovr206I Ovary 15 1264
    Ovr230A Ovary 16 1285
    0 = Negative

    In the analysis of matching samples, the higher levels of expression were in prostate, endometrium, testis, and ovary showing a high degree of tissue specificity for reproductive tissues. These results confirmed the tissue specificity results obtained with the panel of normal pooled samples (Table 14).
  • Furthermore, the levels of mRNA expression in cancer samples and the isogenic normal adjacent tissue from the same individual were compared. This comparison provides an indication of specificity for the cancer (e.g. higher levels of mRNA expression in the cancer sample compared to the normal adjacent). Table 15 shows overexpression of Pro118 in 5 out of 14 primary prostate cancer tissues (prostate samples 1, 8, 10, 11, 15) compared with their respective normal adjacent. Thus, there was overexpression in the cancer tissue for 35.71% of the prostate matching samples tested (total of 14 prostate matching samples). Expression of Pro118 was similarly higher in 3 unmatched cancer tissues (prostate samples 9, 13, 14), 2 prostatitis (prostate samples 20, 21), and 6 benign hyperplasia tissues (prostate samples 22 through 27).
  • Altogether, the high level of tissue specificity, plus the mRNA overexpression in 35.71% of the primary prostate matching samples tested are indicative of Pro118 being a diagnostic marker for prostate cancer.

Claims (12)

1: A method for diagnosing the presence of prostate cancer in a patient comprising:
(a) determining levels of CSG in cells, tissues or bodily fluids in a patient; and
(b) comparing the determined levels of CSG with levels of CSG in cells, tissues or bodily fluids from a normal human control, wherein a change in determined levels of CSG in said patient versus normal human control is associated with the presence of prostate cancer.
2: A method of diagnosing metastases of prostate cancer in a patient comprising:
(a) identifying a patient having prostate cancer that is not known to have metastasized;
(b) determining CSG levels in a sample of cells, tissues, or bodily fluid from said patient; and
(c) comparing the determined CSG levels with levels of CSG in cells, tissue, or bodily fluid of a normal human control, wherein an increase in determined CSG levels in the patient versus the normal human control is associated with a cancer which has metastasized.
3: A method of staging prostate cancer in a patient having prostate cancer comprising:
(a) identifying a patient having prostate cancer;
(b) determining CSG levels in a sample of cells, tissue, or bodily fluid from said patient; and
(c) comparing determined CSG levels with levels of CSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in determined CSG levels in said patient versus the normal human control is associated with a cancer which is progressing and a decrease in the determined CSG levels is associated with a cancer which is regressing or in remission.
4: A method of monitoring prostate cancer in a patient for the onset of metastasis comprising:
(a) identifying a patient having prostate cancer that is not known to have metastasized;
(b) periodically determining levels of CSG in samples of cells, tissues, or bodily fluid from said patient; and
(c) comparing the periodically determined CSG levels with levels of CSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in any one of the periodically determined CSG levels in the patient versus the normal human control is associated with a cancer which has metastasized.
5: A method of monitoring a change in stage of prostate cancer in a patient comprising:
(a) identifying a patient having prostate cancer;
(b) periodically determining levels of CSG in cells, tissues, or bodily fluid from said patient; and
(c) comparing the periodically determined CSG levels with levels of CSG in cells, tissues, or bodily fluid of a normal human control, wherein an increase in any one of the periodically determined CSG levels in the patient versus the normal human control is associated with a cancer which is progressing in stage and a decrease is associated with a cancer which is regressing in stage or in remission.
6: A method of identifying potential therapeutic agents for use in imaging and treating prostate cancer comprising screening molecules for an ability to bind to CSG wherein the ability of a molecule to bind to CSG is indicative of the molecule being useful in imaging and treating prostate cancer.
7: The method of claim 1, 2, 3, 4, 5 or 6 wherein the CSG comprises SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or a polypeptide encoded thereby.
8: An antibody which specifically binds CSG.
9: A method of imaging prostate cancer in a patient comprising administering to the patient an antibody of claim 8.
10: The method of claim 9 wherein said antibody is labeled with paramagnetic ions or a radioisotope.
11: A method of treating prostate cancer in a patient comprising administering to the patient an antibody of claim 8.
12: The method of claim 11 wherein the antibody is conjugated to a cytotoxic agent.
US12/199,482 1998-10-19 2008-08-27 Method of Diagnosing, Monitoring, Staging, Imaging and Treating Prostate Cancer Abandoned US20090142262A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/199,482 US20090142262A1 (en) 1998-10-19 2008-08-27 Method of Diagnosing, Monitoring, Staging, Imaging and Treating Prostate Cancer

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US10473798P 1998-10-19 1998-10-19
US09/807,201 US6902892B1 (en) 1998-10-19 1999-10-19 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
PCT/US1999/024331 WO2000023111A1 (en) 1998-10-19 1999-10-19 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US10/918,897 US7432064B2 (en) 1998-10-19 2004-08-16 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US12/199,482 US20090142262A1 (en) 1998-10-19 2008-08-27 Method of Diagnosing, Monitoring, Staging, Imaging and Treating Prostate Cancer

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/918,897 Continuation US7432064B2 (en) 1998-10-19 2004-08-16 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer

Publications (1)

Publication Number Publication Date
US20090142262A1 true US20090142262A1 (en) 2009-06-04

Family

ID=33566974

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/807,201 Expired - Fee Related US6902892B1 (en) 1998-10-19 1999-10-19 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US10/918,897 Expired - Fee Related US7432064B2 (en) 1998-10-19 2004-08-16 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US12/199,482 Abandoned US20090142262A1 (en) 1998-10-19 2008-08-27 Method of Diagnosing, Monitoring, Staging, Imaging and Treating Prostate Cancer

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US09/807,201 Expired - Fee Related US6902892B1 (en) 1998-10-19 1999-10-19 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US10/918,897 Expired - Fee Related US7432064B2 (en) 1998-10-19 2004-08-16 Method of diagnosing, monitoring, staging, imaging and treating prostate cancer

Country Status (1)

Country Link
US (3) US6902892B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100304390A1 (en) * 2009-05-26 2010-12-02 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulations
US8546552B2 (en) 2009-12-23 2013-10-01 Quest Diagnostics Investments Incorporated TMPRSS2 for the diagnosis of prostate disease
US10260104B2 (en) 2010-07-27 2019-04-16 Genomic Health, Inc. Method for using gene expression to determine prognosis of prostate cancer

Families Citing this family (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6902892B1 (en) * 1998-10-19 2005-06-07 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US20030138975A1 (en) * 2001-12-20 2003-07-24 Kimberly-Clark Worldwide, Inc. Diagnostic signal amplification with proteinoid microspheres
US7056535B2 (en) * 2001-12-20 2006-06-06 Kimberly-Clark Worldwide, Inc. Triggered release from proteinoid microspheres
US20060078893A1 (en) 2004-10-12 2006-04-13 Medical Research Council Compartmentalised combinatorial chemistry by microfluidic control
GB0307428D0 (en) 2003-03-31 2003-05-07 Medical Res Council Compartmentalised combinatorial chemistry
GB0307403D0 (en) 2003-03-31 2003-05-07 Medical Res Council Selection by compartmentalised screening
US20050221339A1 (en) 2004-03-31 2005-10-06 Medical Research Council Harvard University Compartmentalised screening by microfluidic control
US7968287B2 (en) 2004-10-08 2011-06-28 Medical Research Council Harvard University In vitro evolution in microfluidic systems
CA2814598A1 (en) 2005-09-12 2007-03-22 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US9957569B2 (en) 2005-09-12 2018-05-01 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US20100137163A1 (en) 2006-01-11 2010-06-03 Link Darren R Microfluidic Devices and Methods of Use in The Formation and Control of Nanoreactors
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
US20080003142A1 (en) 2006-05-11 2008-01-03 Link Darren R Microfluidic devices
US9012390B2 (en) 2006-08-07 2015-04-21 Raindance Technologies, Inc. Fluorocarbon emulsion stabilizing surfactants
WO2008097559A2 (en) 2007-02-06 2008-08-14 Brandeis University Manipulation of fluids and reactions in microfluidic systems
US8592221B2 (en) 2007-04-19 2013-11-26 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
JP5433572B2 (en) 2007-07-06 2014-03-05 ザ リージェンツ オブ ザ ユニバーシティ オブ ミシガン MIPOL1-ETV1 gene rearrangement
WO2009020521A2 (en) 2007-08-03 2009-02-12 The Brigham And Women's Hospital, Inc. Identification and treatment of estrogen responsive prostate tumors
WO2010009365A1 (en) 2008-07-18 2010-01-21 Raindance Technologies, Inc. Droplet libraries
EP3415235A1 (en) 2009-03-23 2018-12-19 Raindance Technologies Inc. Manipulation of microfluidic droplets
EP2478120B1 (en) * 2009-09-17 2015-09-02 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US10520500B2 (en) 2009-10-09 2019-12-31 Abdeslam El Harrak Labelled silica-based nanomaterial with enhanced properties and uses thereof
WO2011079176A2 (en) 2009-12-23 2011-06-30 Raindance Technologies, Inc. Microfluidic systems and methods for reducing the exchange of molecules between droplets
US9366632B2 (en) 2010-02-12 2016-06-14 Raindance Technologies, Inc. Digital analyte analysis
US10351905B2 (en) 2010-02-12 2019-07-16 Bio-Rad Laboratories, Inc. Digital analyte analysis
US9399797B2 (en) 2010-02-12 2016-07-26 Raindance Technologies, Inc. Digital analyte analysis
WO2011100604A2 (en) 2010-02-12 2011-08-18 Raindance Technologies, Inc. Digital analyte analysis
EP3447155A1 (en) 2010-09-30 2019-02-27 Raindance Technologies, Inc. Sandwich assays in droplets
US8945556B2 (en) 2010-11-19 2015-02-03 The Regents Of The University Of Michigan RAF gene fusions
US9364803B2 (en) 2011-02-11 2016-06-14 Raindance Technologies, Inc. Methods for forming mixed droplets
US9150852B2 (en) 2011-02-18 2015-10-06 Raindance Technologies, Inc. Compositions and methods for molecular labeling
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
WO2012167142A2 (en) 2011-06-02 2012-12-06 Raindance Technolgies, Inc. Enzyme quantification
US8658430B2 (en) 2011-07-20 2014-02-25 Raindance Technologies, Inc. Manipulating droplet size
EP3495817A1 (en) 2012-02-10 2019-06-12 Raindance Technologies, Inc. Molecular diagnostic screening assay
WO2013165748A1 (en) 2012-04-30 2013-11-07 Raindance Technologies, Inc Digital analyte analysis
EP2986762B1 (en) 2013-04-19 2019-11-06 Bio-Rad Laboratories, Inc. Digital analyte analysis
US11901041B2 (en) 2013-10-04 2024-02-13 Bio-Rad Laboratories, Inc. Digital analysis of nucleic acid modification
US9944977B2 (en) 2013-12-12 2018-04-17 Raindance Technologies, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
US11193176B2 (en) 2013-12-31 2021-12-07 Bio-Rad Laboratories, Inc. Method for detecting and quantifying latent retroviral RNA species
US10647981B1 (en) 2015-09-08 2020-05-12 Bio-Rad Laboratories, Inc. Nucleic acid library generation methods and compositions
US10998178B2 (en) 2017-08-28 2021-05-04 Purdue Research Foundation Systems and methods for sample analysis using swabs

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5514579A (en) * 1991-12-31 1996-05-07 Zymogenetics, Inc. Human transglutaminases
US6043033A (en) * 1997-02-27 2000-03-28 Incyte Pharmaceuticals, Inc. Human prostate-associated protease
US6203979B1 (en) * 1998-01-16 2001-03-20 Incyte Pharmaceuticals, Inc. Human protease molecules
US6262245B1 (en) * 1997-02-25 2001-07-17 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US6294663B1 (en) * 1999-03-03 2001-09-25 The Board Of Trustees Of The University Of Arkansas Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US6902892B1 (en) * 1998-10-19 2005-06-07 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US20090226921A1 (en) * 1998-06-01 2009-09-10 Afar Daniel E H Methods to detect tumors using 20p1f12/tmprss2 expression

Family Cites Families (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001004311A1 (en) 1999-07-07 2001-01-18 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO2000073454A1 (en) 1999-06-02 2000-12-07 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP0941366A2 (en) 1996-11-06 1999-09-15 Whitehead Institute For Biomedical Research Biallelic markers
US5912143A (en) * 1996-12-27 1999-06-15 Incyte Pharmaceuticals, Inc. Polynucleotides encoding a human mage protein homolog
US6479274B1 (en) 1997-02-13 2002-11-12 Amrad Operations Pty., Ltd. DNA molecules encoding human HELA2 or testisin serine proteinases
DE69831222T2 (en) 1997-02-25 2006-07-13 Corixa Corp., Seattle COMPOUNDS FOR THE IMMUNDIAGNOSIS OF PROSTATE CANCER AND THEIR USE
WO2000004149A2 (en) 1998-07-14 2000-01-27 Corixa Corporation Compositions and methods for therapy and diagnosis of prostate cancer
JP2001519666A (en) 1997-04-10 2001-10-23 ジェネティックス・インスチチュート・インコーポレーテッド Secretory expression sequence tags (sESTs)
JP3809709B2 (en) 1997-07-16 2006-08-16 小野薬品工業株式会社 Novel eosinophil serine protease
ES2267192T3 (en) 1997-08-01 2007-03-01 Serono Genetics Institute S.A. ESTS 5 'FOR NON-SPECIFIC SECRETED TISSUE PROTEINS.
NZ503343A (en) 1997-09-17 2002-09-27 Genentech Inc Secreted and transmembrane polypeptides and use to induce apoptosis of tumour cells
EP1047793B1 (en) 1998-01-21 2006-11-15 Dianon Systems, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate disease
WO1999057132A1 (en) 1998-05-07 1999-11-11 Genetics Institute, Inc. Secreted proteins and polynucleotides encoding them
EP1082460A4 (en) 1998-05-21 2003-02-12 Diadexus Inc A novel method of diagnosing, monitoring, and staging prostate cancer
EP2080802B1 (en) 1998-06-01 2017-03-29 Agensys, Inc. Novel serpentine transmembrane antigens expressed in human cancers and uses thereof
PT1082341E (en) 1998-06-01 2011-02-15 Agensys Inc Tumor antigen useful in diagnosis and therapy of prostate and colon cancer
CA2331769A1 (en) 1998-06-22 1999-12-29 Incyte Pharmaceuticals, Inc. Prostate cancer-associated genes
AU4839999A (en) 1998-06-29 2000-01-17 Myriad Genetics, Inc. Tmprss2 is a tumor suppressor
US7399827B1 (en) 1998-09-01 2008-07-15 The United States Of America As Represented By The Department Of Health And Human Services Page-4, an x-linked gage-like gene expressed in normal and neoplastic prostate, testis and uterus, and uses therefor
CA2341142A1 (en) 1998-09-02 2000-03-09 Diadexus Llc A novel method of diagnosing, monitoring, staging, imaging and treating various cancers
AU5815699A (en) 1998-09-08 2000-03-27 Urocor, Inc. Prostate specific promoter and regulation of gene expression
JP2002526055A (en) 1998-09-23 2002-08-20 ダイアデクスアス・インコーポレーテッド Methods for diagnosing, monitoring, staging, imaging and treating gynecological and testicular cancer
AU6502199A (en) 1998-09-30 2000-04-17 Millennium Pharmaceuticals, Inc. Expression analysis of specific nucleic acids and polypeptides useful in the diagnosis and treatment of prostate cancer
JP2002527758A (en) 1998-10-19 2002-08-27 ダイアデクスアス・インコーポレーテッド Methods for diagnosing, monitoring, staging, imaging and treating prostate cancer
AU1181900A (en) 1998-11-17 2000-06-05 Protegene Inc. Human proteins having hydrophobic domains and dnas encoding these proteins
US6468546B1 (en) 1998-12-17 2002-10-22 Corixa Corporation Compositions and methods for therapy and diagnosis of ovarian cancer
EP1144614A4 (en) 1999-01-19 2003-08-06 Human Genome Sciences Inc 33 human secreted proteins
CA2296792A1 (en) 1999-02-26 2000-08-26 Genset S.A. Expressed sequence tags and encoded human proteins
AU3395900A (en) 1999-03-12 2000-10-04 Human Genome Sciences, Inc. Human lung cancer associated gene sequences and polypeptides
EP1159619A2 (en) 1999-03-15 2001-12-05 EOS Biotechnology, Inc. Methods of diagnosing and treating breast cancer
US6420157B1 (en) 1999-04-30 2002-07-16 Ortho-Mcneil Pharmaceutical, Inc. Zymogen activation system
JP2003501108A (en) 1999-06-11 2003-01-14 ヒューマン ジノーム サイエンシーズ， インコーポレイテッド 47 human secreted proteins
AU5638400A (en) 1999-06-23 2001-01-09 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
JP2003510074A (en) 1999-09-27 2003-03-18 ヒューマン ジノーム サイエンシーズ， インコーポレイテッド 26 human secreted proteins
WO2001025272A2 (en) 1999-10-04 2001-04-12 Corixa Corporation Compositions and methods for therapy and diagnosis of prostate cancer
AU1205901A (en) 1999-10-14 2001-04-23 Board Of Trustees Of The University Of Arkansas, The Tumor antigen derived gene-16 (tadg-16): a novel extracellular serine protease and uses thereof
WO2001034802A2 (en) 1999-11-12 2001-05-17 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
KR20030016217A (en) 2000-01-14 2003-02-26 코릭사 코포레이션 Compositions and methods for the therapy and diagnosis of prostate cancer

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5514579A (en) * 1991-12-31 1996-05-07 Zymogenetics, Inc. Human transglutaminases
US5952011A (en) * 1991-12-31 1999-09-14 Zymogenetics, Inc. Human transglutaminases
US6262245B1 (en) * 1997-02-25 2001-07-17 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US6043033A (en) * 1997-02-27 2000-03-28 Incyte Pharmaceuticals, Inc. Human prostate-associated protease
US6350448B1 (en) * 1997-02-27 2002-02-26 Incyte Genomics, Inc. Human prostate-associated protease
US6203979B1 (en) * 1998-01-16 2001-03-20 Incyte Pharmaceuticals, Inc. Human protease molecules
US20090226921A1 (en) * 1998-06-01 2009-09-10 Afar Daniel E H Methods to detect tumors using 20p1f12/tmprss2 expression
US6902892B1 (en) * 1998-10-19 2005-06-07 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US6294663B1 (en) * 1999-03-03 2001-09-25 The Board Of Trustees Of The University Of Arkansas Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100304390A1 (en) * 2009-05-26 2010-12-02 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulations
US8426133B2 (en) 2009-05-26 2013-04-23 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulation by intragenic differential expression
US8815516B2 (en) 2009-05-26 2014-08-26 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulation by intragenic differential expression
US9187788B2 (en) 2009-05-26 2015-11-17 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulation by intragenic differential expression
US9546404B2 (en) 2009-05-26 2017-01-17 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulation by intragenic differential expression
US10093985B2 (en) 2009-05-26 2018-10-09 Quest Diagnostics Investments Incorporated Methods for detecting gene dysregulation by intragenic differential expression
US10501809B2 (en) 2009-05-26 2019-12-10 Quest Diagnostics Investments Llc Methods for detecting gene dysregulation by intragenic differential expression
US11021758B2 (en) 2009-05-26 2021-06-01 Quest Diagnostics Investments Llc Methods for detecting gene dysregulation by intragenic differential expression
US8546552B2 (en) 2009-12-23 2013-10-01 Quest Diagnostics Investments Incorporated TMPRSS2 for the diagnosis of prostate disease
US9404159B2 (en) 2009-12-23 2016-08-02 Quest Diagnostics Investements Incorporated TMPRSS2 for the diagnosis of prostate disease
US10260104B2 (en) 2010-07-27 2019-04-16 Genomic Health, Inc. Method for using gene expression to determine prognosis of prostate cancer

Also Published As

Publication number Publication date
US7432064B2 (en) 2008-10-07
US6902892B1 (en) 2005-06-07
US20050009086A1 (en) 2005-01-13

Similar Documents

Publication Publication Date Title
US6902892B1 (en) Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US7858325B2 (en) Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US8029787B2 (en) Method of diagnosing, monitoring, staging, imaging and treating various cancers
US7326529B2 (en) Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
WO2000008210A1 (en) A novel method of diagnosing, monitoring, staging, imaging and treating breast cancer
US20050266483A1 (en) Novel method of diagnosing, monitoring, staging, imaging and treating colon cancer
EP1131095A1 (en) Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
CA2347656A1 (en) A novel method of diagnosing, monitoring, staging, imaging and treating lung cancer
EP1126877A1 (en) Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
EP1117833A1 (en) A novel method of diagnosing, monitoring, staging, imaging and treating gastrointestinal cancers
EP1115426B1 (en) Method of diagnosing, monitoring, staging, imaging and treating gynecologic cancers
US6962779B1 (en) Method of diagnosing, monitoring, staging, imaging and treating gastrointestinal cancers
US6869592B1 (en) Method and antibody for imaging lung cancer
CA2345285A1 (en) A novel method of diagnosing, monitoring, staging, imaging and treating gynecologic cancers
CA2346326A1 (en) A novel method of diagnosing, monitoring, staging and treating gynecological and prostatic cancers
WO2000012761A1 (en) A novel antibody for the diagnosis of bladder cancer
EP1728518A1 (en) Method of diagnosing monitoring, staging, imaging and treating gynecologic cancers and testicular cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: DIADEXUS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SALCEDA, SUSANA;RECIPON, HERVE;CAFFERKEY, ROBERT;REEL/FRAME:021455/0289;SIGNING DATES FROM 20010404 TO 20010418

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION