US20070213292A1 - Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof - Google Patents

Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof Download PDF

Info

Publication number
US20070213292A1
US20070213292A1 US11/657,341 US65734107A US2007213292A1 US 20070213292 A1 US20070213292 A1 US 20070213292A1 US 65734107 A US65734107 A US 65734107A US 2007213292 A1 US2007213292 A1 US 2007213292A1
Authority
US
United States
Prior art keywords
antagomir
ome
mir
mirna
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/657,341
Other languages
English (en)
Inventor
Markus Stoffel
Muthiah Manoharan
Kallanthottathil Rajeev
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rockefeller University
Regulus Therapeutics Inc
Original Assignee
Rockefeller University
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US11/502,158 external-priority patent/US20070123482A1/en
Priority to US11/657,341 priority Critical patent/US20070213292A1/en
Application filed by Rockefeller University, Alnylam Pharmaceuticals Inc filed Critical Rockefeller University
Assigned to THE ROCKEFELLER UNIVERSITY reassignment THE ROCKEFELLER UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: STOFFEL, MARKUS, MR.
Assigned to ALNYLAM PHARMACEUTICALS, INC. reassignment ALNYLAM PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: RAJEEV, KALLANTHOTTATHIL G, MR., MANOHARAN, MUTHIAH, MR.
Publication of US20070213292A1 publication Critical patent/US20070213292A1/en
Priority to PCT/US2008/001027 priority patent/WO2008091703A2/fr
Priority to US12/714,863 priority patent/US8541385B2/en
Priority to US14/011,387 priority patent/US20140073684A1/en
Assigned to Regulus Therapeutics Inc. reassignment Regulus Therapeutics Inc. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ALNYLAM PHARMACEUTICALS, INC.
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: ROCKEFELLER UNIVERSITY
Assigned to THE NATIONAL INSTITUTES OF HEALTH -DIRECTOR DEITR reassignment THE NATIONAL INSTITUTES OF HEALTH -DIRECTOR DEITR CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: THE ROCKEFELLER UNIVERSITY
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521—Methyl
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3527—Other alkyl chain
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3531—Hydrogen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533—Halogen

Definitions

  • This invention relates generally to chemically modified oligonucleotides (antagomirs) useful for modulating expression of microRNAs. More particularly, the invention relates to single stranded, double stranded, partially double stranded and hairpin structured chemically modified oligonucleotides for inhibiting microRNA expression and to methods of making and using the modified oligonucleotides.
  • nucleic acid species are capable of modifying gene expression. These include antisense RNA, siRNA, microRNA, RNA and DNA aptamers, and decoy RNAs. Each of these nucleic acid species can inhibit target nucleic acid activity, including gene expression.
  • MicroRNAs are a class of 18-24 nt non-coding RNAs (ncRNAs) that exist in a variety of organisms, including mammals, and are conserved in evolution. miRNAs are processed from hairpin precursors of 70 nt (pre-miRNA) which are derived from primary transcripts (pri-miRNA) through sequential cleavage by the RNAse III enzymes drosha and dicer. Many microRNAs can be encoded in intergenic regions, hosted within introns of pre-mRNAs or within ncRNA genes. Many miRNAs also tend to be clustered and transcribed as polycistrons and often have similar spatial temporal expression patterns. MiRNAs have been found to have roles in a variety of biological processes including developmental timing, differentiation, apoptosis, cell proliferation, organ development, and metabolism.
  • miRNAs are an abundant class of non-coding RNA ranging from 20 to 23 nucleotides of length that are post-transcriptional regulators of gene expression. miRNAs have been mainly associated with developmental processes in metazoa such as Caenorhabditis elegans or Drosophila melanogaster (Ambros, 2004 Nature 431:350-5). However, evidence also suggests a role for miRNAs in a wide range of functions in mammals, including insulin secretion, heart, skeletal muscle and brain development (Kloosterman, et al., 2006 Dev Cell 11:441-50, and Krutzfeldt, et al., 2006 Cell Metab 4:9-12).
  • miRNAs have been implicated in diseases such as cancer (Esquela-Kerscher, et al., 2006 Nat Rev Cancer 6:259-69) and hepatitis C (Jopling, et al., 2005 Science 309:1577-81), which make them attractive new drug targets.
  • siRNA small interfering RNA
  • strategies to inhibit miRNAs have been less well investigated.
  • Reverse-complement 2′-O-methyl sugar modified RNA is frequently being used to block miRNA function in cell-based systems (Krutzfeldt, et al., 2006 Nat Genet 38:S14-9).
  • the use of miRNA inhibitors remains challenging. Thus, there is a long felt need in the art for efficient and directed means of inhibiting miRNA.
  • the present invention satisfies this need.
  • the present invention is based in part on the discovery that expression of endogenous microRNAs (miRNAs) or pre-microRNAs (pre-miRNAs) can be inhibited by an agent herein defined as an antagomir, e.g., through systemic or local administration of the antagomir, as well as by parenteral administration of such agents.
  • an agent herein defined as an antagomir
  • the invention should not be limited to any particular route of administration.
  • the present invention provides specific compositions and methods that are useful in reducing miRNA and pre-miRNA levels, in e.g., a mammal, such as a human.
  • the present invention provides specific compositions and methods that are useful for reducing levels of the miRNAs miR-122, miR-16, miR-192, and miR-194.
  • the invention features antagomirs.
  • Antagomirs are single stranded, double stranded, partially double stranded and hairpin structured chemically modified oligonucleotides that target a microRNA.
  • FIGS. 5-11 provides representative structures of antagomirs.
  • antagomir consisting essentially of or comprising at least 12 or more contiguous nucleotides substantially complementary to an endogenous miRNA and more particularly agents that include 12 or more contiguous nucleotides substantially complementary to a target sequence of an miRNA or pre-miRNA nucleotide sequence.
  • an antagomir featured in the invention includes a nucleotide sequence sufficiently complementary to hybridize to a miRNA target sequence of about 12 to 25 nucleotides, preferably about 15 to 23 nucleotides. More preferably, the target sequence differs by no more than 1, 2, or 3 nucleotides from a sequence shown in Table 1, and in one embodiment, the antagomir is an agent shown in Table 2a-e, Table 4, and Table 7.
  • the antagomir includes a non-nucleotide moiety, e.g., a cholesterol moiety.
  • the non-nucleotide moiety can be attached, e.g., to the 3′ or 5′ end of the oligonucleotide agent.
  • a cholesterol moiety is attached to the 3′ end of the oligonucleotide agent.
  • antagomirs are stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification.
  • the antagomir includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5′ or 3′ end of the nucleotide sequence.
  • the antagomir includes a 2′-modified nucleotide, e.g., a 2′-deoxy, 2′-deoxy-2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), 2′-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O—N-methylacetamido (2′-O—NMA).
  • the antagomir includes at least one 2′-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides of the antagomir include a 2′-O-methyl modification.
  • antagomirs are RNA-like oligonucleotides that harbor various modifications for RNase protection and pharmacologic properties such as enhanced tissue and cellular uptake.
  • a preferred antagomir differs from normal RNA by having complete 2′-O-methylation of sugar, phosphorothioate backbone and a cholesterol-moiety at 3′-end. Phosphorothioate modifications provide protection against RNase activity and their lipophilicity contributes to enhanced tissue uptake.
  • the antagomir includes six phosphorothioate backbone modifications; two phosphorothioates are located at the 5′-end and four at the 3′-end.
  • Antagomirs of the present invention can also be modified with respect to their length or otherwise the number of nucleotides making up the antagomir. In some instances, it is preferred that the antagomirs of the present invention are of at least 19 nucleotides in length for optimal function.
  • An antagomir that is substantially complementary to a nucleotide sequence of an miRNA can be delivered to a cell or a human to inhibit or reduce the activity of an endogenous miRNA, such as when aberrant or undesired miRNA activity, or insufficient activity of a target mRNA that hybridizes to the endogenous miRNA, is linked to a disease or disorder.
  • an antagomir featured in the invention has a nucleotide sequence that is substantially complementary to miR-122 (see Table 1), which hybridizes to numerous RNAs, including aldolase A mRNA, N-myc downstram regulated gene (Ndrg3) mRNA, IQ motif containing GTPase activating protein-1 (Iqgap1) mRNA, HMG-CoA-reductase (Hmgcr) mRNA, and citrate synthase mRNA and others.
  • the antagomir that is substantially complementary to miR-122 is antagomir-122 (Table 2a-e, Table 4, and Table 7).
  • Aldolase A deficiencies have been found to be associated with a variety of disorders, including hemolytic anemia, arthrogryposis complex congenita, pituitary ectopia, rhabdomyolysis, hyperkalemia. Humans suffering from aldolase A deficiencies also experience symptoms that include growth and developmental retardation, midfacial hypoplasia, hepatomegaly, as well as myopathic symptoms. Thus a human who has or who is diagnosed as having any of these disorders or symptoms is a candidate to receive treatment with an antagomir that hybridizes to miR-122.
  • an antagomir featured in the invention has a nucleotide sequence that is substantially complementary to miR-16, miR-192, or miR-194.
  • the invention features a method of reducing the levels of an miRNA or pre-miRNA in a cell of a subject, e.g., a human subject.
  • the invention includes reducing the level of an miRNA or pre-miRNA in a cell of the central nervous system.
  • the method includes the step of administering an antagomir to the subject, where the antagomir is substantially single-stranded and includes a sequence that is substantially complementary to 12 to 23 contiguous nucleotides, and preferably 15 to 23 contiguous nucleotides, of a target sequence of an miRNA or pre-miRNA nucleotide sequence.
  • the target sequence differs by no more than 1, 2, or 3 nucleotides from a microRNA or pre-microRNA sequence, such as a microRNA sequence shown in Table 1.
  • the methods featured in the invention are useful for reducing the level of an endogenous miRNA (e.g., miR-122, miR-16, miR-192 or miR-194) or pre-miRNA in a cell, e.g, in a cell of a subject, such as a human subject.
  • the cell is a cell of the central nervous system.
  • Such methods include contacting the cell with an antagomir described herein for a time sufficient to allow uptake of the antagomir into the cell.
  • the invention features a pharmaceutical composition including an antagomir described herein, and a pharmaceutically acceptable carrier.
  • the antagomir included in the pharmaceutical composition hybridizes to miR-122, miR-16, miR-192, or miR-194.
  • the invention features a method of inhibiting miRNA expression (e.g., miR-122, miR-16, miR-192, or miR-194 expression) or pre-miRNA expression in a cell, e.g., a cell of a subject.
  • the cell is a cell of the central nervous system.
  • the method includes contacting the cell with an effective amount of an antagomir described herein, which is substantially complementary to the nucleotide sequence of the target miRNA or the target pre-miRNA.
  • Such methods can be performed on a mammalian subject by administering to a subject one of the oligonucleotide agents/pharmaceutical compositions described herein.
  • the invention features a method of increasing levels of an RNA or protein that are encoded by a gene whose expression is down-regulated by an miRNA, e.g., an endogenous miRNA, such as miR-122, miR-16, miR-192 or mir-194.
  • the method includes contacting the cell with an effective amount of an antagomir described herein, which is substantially complementary to the nucleotide sequence of the miRNA that binds to and effectively inhibits translation of the RNA transcribed from the gene.
  • the invention features a method of increasing aldolase A protein levels in a cell.
  • the invention features a method of increasing Ndrg3, Iqgap1, Hmgcr, and/or citrate synthase protein levels in a cell.
  • the methods include contacting the cell with an effective amount of an antagomir described herein (e.g., antagomir-122, described in Table 2a-e, Table 4, and Table 7), which is substantially complementary to the nucleotide sequence of miR-122 (see Table 1).
  • An mRNA transcribed from the target gene hybridizes to an endogenous miRNA, which consequently results in downregulation of mRNA expression.
  • An antagomir featured in the invention hybridizes to the endogenous miRNA and consequently causes an increase in mRNA expression.
  • the method can be used to increase expression of a gene and treat a condition associated with a low level of expression of the gene.
  • an antagomir that targets miR-122 can be used to increase expression of an aldolase A gene to treat a subject having, or at risk for developing, hemolytic anemia, arthrogryposis complex congenita, pituitary ectopia, rhabdomyolysis, hyperkalemia, or any other disorder associated with aldolase A deficiency.
  • antagomir that targets miR-122 can be also be used to increase expression of an Ndrg3, Iqgap1, Hmgcr, or citrate synthase gene to treat a subject having, or at risk for developing, a disorder associated with a decreased expression of any one of these genes.
  • FIG. 1A is a panel of Northern blots of total RNA (15 ⁇ g) isolated from mouse liver 24 h after injection of differently modified RNAs (240 mg/kg) targeting miR-122. Samples were separated in 14%-polyacrylamide gels in the absence of formamide, and the membranes were probed for miR-122. Ethidium bromide staining of tRNA is shown as a loading control.
  • FIG. 1B is a panel of Northern blots of total RNA (15 ⁇ g) isolated from mouse liver 24 h after injection of differently modified RNAs (240 mg/kg) against miR-122. Samples were separated in 14%-polyacrylamide gels in the absence of formamide, and the membranes were probed for miR-122, let7, and miR-22 RNAs. Ethidium bromide staining of tRNA is shown as a loading control.
  • FIG. 2B is a panel of Northern blots of total RNA (15 ⁇ g) isolated from mouse livers. RNA was isolated 3, 6, 9, 13, and 23 days after injection of antagomir-122. Membranes were probed for both the endogenous miR-122 and the injected antagomir-122. Ethidium bromide staining of tRNA is shown as a loading control.
  • FIG. 4 includes a panel of Northern blots of total RNA isolated from livers of mice injected with antagomiR-122, mm-antagomir-122, or PBS. RNA was extracted 24 h after injection by a bDNA lysis method. Northern blots were probed with miR-122 and let7 microRNAs. Ethidium bromide staining of tRNA is shown as a loading control.
  • FIG. 5 depicts ligand conjugated oligonucleotide to modulate expression of miRNA: (a) ligand of interest is conjugated to the oligonucleotide via a tether and linker; (b) ligand of interest is conjugated to the oligonucleotide via a linker without a tether or tether without an additional linker and (c) a ligand of interest is attached directly to the oligonucleotide.
  • FIG. 6 depicts ligand conjugated double stranded oligonucleotide to modulate expression of miRNA: (a) ligand of interest is conjugated to the oligonucleotide via a tether and linker; (b) ligand of interest is conjugated to the oligonucleotide via a linker without a tether or tether without an additional linker and (c) a ligand of interest is attached directly to the oligonucleotide.
  • FIG. 7 depicts ligand conjugated antisense strand comprising partially double stranded oligonucleotides to modulate expression of miRNA.
  • ligand of interest is conjugated to the oligonucleotide via a tether and linker;
  • d-f ligand of interest is conjugated to the oligonucleotide via a linker without a tether or tether without an additional linker and
  • g-i a ligand of interest is attached directly to the oligonucleotide.
  • FIG. 8 depicts ligand conjugated partial sense strand comprising partially double stranded oligonucleotides to modulate expression of miRNA.
  • ligand of interest is conjugated to the oligonucleotide via a tether and linker;
  • d-f ligand of interest is conjugated to the oligonucleotide via a linker without a tether or tether without an additional linker and
  • g-i a ligand of interest is attached directly to the oligonucleotide.
  • FIG. 9 depicts ligand conjugated partial hairpin oligonucleotides to modulate expression of miRNA.
  • ligand of interest is conjugated to either 3′ or 5′ end of the hairpin via a tether and linker;
  • ligand of interest is conjugated to the hairpin via a linker without a tether or tether without an additional linker and
  • e-f a ligand of interest is attached directly to the oligonucleotide.
  • the hairpin is comprised of nucleotides or non-nucleotide linkages.
  • FIG. 11 depicts cholesterol conjugated oligonucleotides to modulate expression of miRNA.
  • the oligonucleotide can be miRNA, anti-miRNA, chemically modified RNA or DNA; DNA or DNA analogues for antisense application.
  • FIG. 12 depicts activity of double-stranded antagomirs (see Table 2f for the description of agents used).
  • FIG. 13 depicts dose response for antagomir-122.
  • FIG. 14 depicts mismatch control for antagomir-122.
  • FIG. 15 depicts length effect on activity of antagomir-122.
  • FIG. 16 is a schematic representation of various chemical modifications to an antagomir.
  • the designation of (I), (II), (III), and (IV) corresponds to miR-122, antagomir-122, antagomir-122 all P ⁇ S and 5′-Quasar570 labeled antagomir-122, respectively.
  • FIG. 17 is a series of charts demonstrating the impact of antagomir phosphorothioate modifications and antagomir length on miR-122 levels.
  • FIG. 17 comprises Northern blots of total RNA isolated from livers of mice that were treated with different antagomir-122 chemistries at 3 ⁇ 20 mg/kg bw.
  • FIG. 17A demonstrates the impact of mm-antagomir-122, antagomir-122 (no phosphorothioate modification), and antagomir-122 on the RNA level of miR-122.
  • FIG. 17B demonstrates the impact of different phosphorothioate modifications to the antagomir on the RNA level of miR-122.
  • FIG. 17C demonstrates the impact of different lengths to the antagomir on the RNA level of miR-122. “P ⁇ S” indicates phosphorothioate modification.
  • FIG. 18 is a series of charts demonstrating dose- and time-dependency of miR-122 target regulation by antagomir-122.
  • FIG. 18A depicts a dose-dependent study.
  • FIG. 18B is a time-course experiment.
  • Also depicted in FIGS. 18A and 18B are the steady-state mRNA levels of miR-122 target genes in livers of mice treated with the indicated amounts or duration of antagomir-122.
  • the glyceraldehyde-3-phosphate dehydrogenase gene (Gapdh) was used as a loading control.
  • the upper row in each chart shows a Northern blot of liver RNA for miR-122.
  • FIG. 19 is a series of charts demonstrating sequence discrimination of antagomir-122.
  • FIG. 19 depicts steady-state mRNA levels of miR-122 target genes in livers of mice treated with the indicated amounts of antagomir-122 or antagomir-122 that harbored 4, 2 or 1 nucleotide mismatches ( FIG. 19A ), or 1 nucleotide mismatch at different positions ( FIG. 19B ).
  • FIG. 20 is a series of charts demonstrating the regulation of miR-122 targets by chemically protected antagomir-122/miR-122-duplexes.
  • FIG. 20 A is a schematic description of two different duplexes used.
  • FIG. 20B depicts the steady-state mRNA levels of miR-122 target genes in livers of mice treated with the indicated modified antagomir-122/miR-122-duplexes. Fold-regulation indicates the ratio of expression levels of the means of mice treated with antagomir-122/miR-122 duplex compared to the PBS group.
  • the upper row shows a Northern blot of liver RNA for miR-122.
  • FIG. 21 is a series of charts that demonstrate localization of antagomir-122 and miR-122 in hepatocytes.
  • Liver tissue from mice that were treated with 3 ⁇ 80 mg/kg Q570-labeled mm-antagomir-122 was fractionated on a sucrose gradient following ultracentrifugation. Localization of Q570-labeled mm-antagomir-122 was analyzed by spectrophotometry ( FIG. 21A ). Localization of t-RNA and miR-122 were analyzed using Northern blotting of total RNA isolated from each fraction ( FIG. 21B ).
  • mice were treated with Q570-labeled antagomir-122 and a DNA-plasmid expressing a GFP-GW182 hybrid.
  • P-body and Q570-antagomir localizations were visualized using laser-scanning microscopy ( FIG. 21C ).
  • FIG. 22 is a chart depicting Northern blots of miR-16 and miR-124 from total RNA isolated from mouse cerebral cortex that had been injected with antagomir-16 or PBS into the right and left cerebral hemispheres, respectively.
  • FIG. 23 is a chart demonstrating that miR-122 regulates mRNA levels of many targets.
  • FIG. 24 is a chart demonstrating that miR-122 regulates the expression of cholesterol biosynthesis genes.
  • FIG. 25 is a chart demonstrating metabolic parameters of antagomir-122 treated mice.
  • the present invention is based in part on the discovery that expression of endogenous microRNAs (miRNAs) or pre-microRNAs (pre-miRNAs) can be inhibited by an antagomir, e.g., through systemic administration of an antagomir, as well as by parenteral administration of such agents.
  • antagomir e.g., a mammal, such as a human.
  • the present invention provides specific compositions and methods that are useful for reducing levels of the miRNAs miR-122, miR-16, miR-192, and miR-194, herein defined as antagomirs.
  • antagomir is a single-stranded, double stranded, partially double stranded or hairpin structured chemically modified oligonucleotide agents that consisting of, consisting essentially of or comprising at least 12 or more contiguous nucleotides substantially complementary to an endogenous miRNA and more particularly agents that include 12 or more contiguous nucleotides substantially complementary to a target sequence of an miRNA or pre-miRNA nucleotide sequence.
  • partially double stranded referes to double stranded structures that contain less nucleotides than the complementary strand. In general, such partial double stranded agents will have less than 75% double stranded structure, preferably less than 50%, and more preferably less than 25%, 20% or 15% double stranded structure.
  • FIGS. 5-11 provides representative structures of antagomirs.
  • an antagomir featured in the invention includes a nucleotide sequence sufficiently complementary to hybridize to an miRNA target sequence of about 12 to 25 nucleotides, preferably about 15 to 23 nucleotides. More preferably, the target sequence differs by no more than 1, 2, or 3 nucleotides from a sequence shown in Table 1, and in one embodiment, the antagomir is an agent shown in Table 2a-e, Table 4 and Table 7.
  • the antagomir includes a non-nucleotide moiety, e.g., a cholesterol moiety. The non-nucleotide moiety can be attached, e.g., to the 3′ or 5′ end of the oligonucleotide agent. In a preferred embodiment, a cholesterol moiety is attached to the 3′ end of the oligonucleotide agent.
  • the length of the antagimor can contribute to the biochemical function of the antagimor with respect to the ability to decrease expression levels of a desired miRNA.
  • An miRNA-type antagomir can be, for example, from about 12 to 30 nucleotides in length, preferably about 15 to 28 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length). In some instances, antagomirs may require at least 19 nucleotides in length for optimal function.
  • the antagomir is further stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification.
  • the antagomir includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5′ or 3′ end of the nucleotide sequence.
  • An antagomir that is substantially complementary to a nucleotide sequence of an miRNA can be delivered to a cell or a human to inhibit or reduce the activity of an endogenous miRNA, such as when aberrant or undesired miRNA activity, or insufficient activity of a target mRNA that hybridizes to the endogenous miRNA, is linked to a disease or disorder.
  • Aldolase A deficiencies have been found to be associated with a variety of disorders, including hemolytic anemia, arthrogryposis complex congenita, pituitary ectopia, rhabdomyolysis, hyperkalemia. Humans suffering from aldolase A deficiencies also experience symptoms that include growth and developmental retardation, midfacial hypoplasia, hepatomegaly, as well as myopathic symptoms. Thus a human who has or who is diagnosed as having any of these disorders or symptoms is a candidate to receive treatment with an antagomir, such as a single-stranded oligonucleotide agent, that hybridizes to miR-122.
  • an antagomir such as a single-stranded oligonucleotide agent
  • the invention features an antagomir, such as a single-stranded oligonucleotide agent, that includes a nucleotide sequence that is substantially identical to a nucleotide sequence of an miRNA, such as an endogenous miRNA listed in Table 1.
  • An oligonucleotide sequence that is substantially identical to an endogenous miRNA sequence is 70%, 80%, 90%, or more identical to the endogenous miRNA sequence.
  • the agent is identical in sequence with an endogenous miRNA.
  • an antagomir that is substantially identical to a nucleotide sequence of an miRNA can be delivered to a cell or a human to replace or supplement the activity of an endogenous miRNA, such as when an miRNA deficiency is linked to a disease or disorder, or aberrant or unwanted expression of the mRNA that is the target of the endogenous miRNA is linked to a disease or disorder.
  • an antagomir agent featured in the invention can have a nucleotide sequence that is substantially identical to miR-122 (see Table 1).
  • Hmgcr inhibitors are useful to treat hyperglycemia and to reduce the risk of stroke and bone fractures.
  • a single stranded antagomir that is substantially identical to miR-122 can be useful for downregulating Hmgcr expression, and can be administered as a therapeutic composition to a subject having or at risk for developing hyperglycemia, stroke, or a bone fracture.
  • a single stranded antagomir that is substantially identical to miR-122 can be administered as a therapeutic composition to a subject having or at risk for developing a disorder characterized by the aberrant or unwanted expression of any of these genes, or any other gene downregulated by miR-122.
  • an antagomir such as a single-stranded oligonucleotide agent
  • Single-stranded oligonucleotide agents that are substantially identical to at least a portion of an miRNA, such as those described above, can be administered to a subject to treat the disease or disorder associated with the downregulation of an endogenous miRNA, or the aberrant or unwanted expression of an mRNA target of the endogenous miRNA.
  • the methods featured in the invention are useful for reducing the level of an endogenous miRNA (e.g., miR-122, miR-16, miR-192 or miR-194) or pre-miRNA in a cell, e.g, in a cell of a subject, such as a human subject.
  • Such methods include contacting the cell with an antagomir, such as a single-stranded oligonucleotide agent, described herein for a time sufficient to allow uptake of the antagomir into the cell.
  • the invention features a pharmaceutical composition including an antagomir, such as a single-stranded oligonucleotide agent, described herein, and a pharmaceutically acceptable carrier.
  • antagomir such as a single-stranded oligonucleotide agent
  • included in the pharmaceutical composition hybridizes to miR-122, miR-16, miR-192, or miR-194.
  • the invention features a method of inhibiting miRNA expression (e.g., miR-122, miR-16, miR-192, or miR-194 expression) or pre-miRNA expression in a cell, e.g., a cell of a subject.
  • the method includes contacting the cell with an effective amount of an antagomir, such as a single-stranded oligonucleotide agent, described herein, which is substantially complementary to the nucleotide sequence of the target miRNA or the target pre-miRNA.
  • antagomir such as a single-stranded oligonucleotide agent, described herein, which is substantially complementary to the nucleotide sequence of the target miRNA or the target pre-miRNA.
  • Such methods can be performed on a mammalian subject by administering to a subject one of the oligonucleotide agents/pharmaceutical compositions described herein.
  • the invention features a method of increasing levels of an RNA or protein that are encoded by a gene whose expression is down-regulated by an miRNA, e.g., an endogenous miRNA, such as miR-122, miR-16, miR-192 or mir-194.
  • the method includes contacting the cell with an effective amount of an antagomir, such as a single-stranded oligonucleotide agent, described herein, which is substantially complementary to the nucleotide sequence of the miRNA that binds to and effectively inhibits translation of the RNA transcribed from the gene.
  • an antagomir such as a single-stranded oligonucleotide agent, described herein, which is substantially complementary to the nucleotide sequence of the miRNA that binds to and effectively inhibits translation of the RNA transcribed from the gene.
  • the invention features a method of increasing aldolase A protein levels in a cell.
  • the invention features a method of increasing Ndrg3, Iqgap1, Hmgcr, and/or citrate synthase protein levels in a cell.
  • the methods include contacting the cell with an effective amount of an antagomir described herein (e.g., antagomir-122, described in Table 2a-e, Table 4 and Table 7), which is substantially complementary to the nucleotide sequence of miR-122 (see Table 1).
  • the ligand is a lipophilic moiety, e.g., cholesterol, which enhances entry of the antagomir, such as a single-stranded oligonucleotide agent, into a cell, such as a hepatocyte, synoviocyte, myocyte, keratinocyte, leukocyte, endothelial cell (e.g., a kidney cell), B-cell, T-cell, epithelial cell, mesodermal cell, myeloid cell, neural cell, neoplastic cell, mast cell, or fibroblast cell.
  • a myocyte is a smooth muscle cell or a cardiac myocyte.
  • the invention provides methods of increasing expression of a target gene by providing an antagomir to which a lipophilic moiety is conjugated, e.g., a lipophilic conjugated antagomir described herein, to a cell.
  • the antagomir preferably hybridizes to an miRNA (e.g., miR-122, miR-16, miR-192, or miR-194) or a pre-miRNA.
  • the conjugated antagomir can be used to increase expression of a target gene in an organism, e.g., a mammal, e.g., a human, or to increase expression of a target gene in a cell line or in cells which are outside an organism.
  • An mRNA transcribed from the target gene hybridizes to an endogenous miRNA, which consequently results in downregulation of mRNA expression.
  • An antagomir such as a single-stranded oligonucleotide agent, featured in the invention hybridizes to the endogenous miRNA and consequently causes an increase in mRNA expression.
  • the method can be used to increase expression of a gene and treat a condition associated with a low level of expression of the gene.
  • an antagomir such as a single-stranded oligonucleotide agent, that targets miR-122 (e.g., antagomir-122) can be used to increase expression of an aldolase A gene to treat a subject having, or at risk for developing, hemolytic anemia, arthrogryposis complex congenita, pituitary ectopia, rhabdomyolysis, hyperkalemia, or any other disorder associated with aldolase A deficiency.
  • the invention provides compositions and methods for treating a disease, disorder or condition of the central nervous system.
  • a disease, disorder or condition of the central nervous system is associated with abnormal expression of a target gene or otherwise an abnormal decreased expression of a target gene when compared with the normal expression of the otherwise identical gene.
  • Such an abnormal decreased expression of a target gene may be the result of a genetic mutation in the gene.
  • the term “disease, disorder or condition of the central nervous system” should also be construed to encompass other pathologies in the central nervous system which are not the result of a genetic defect per se in cells of the central nervous system, but rather are the result of infiltration of the central nervous system by cells which do not originate in the central nervous system, for example, metastatic tumor formation in the central nervous system.
  • the term should also be construed to include stroke or trauma to the central nervous system induced by direct injury to the tissues of the central nervous system.
  • Neurodegenerative diseases include but are not limited to, AIDS dementia complex; demyelinating diseases, such as multiple sclerosis and acute transferase myelitis; extrapyramidal and cerebellar disorders, such as lesions of the ecorticospinal system; disorders of the basal ganglia or cerebellar disorders; hyperkinetic movement disorders, such as Huntington's Chorea and senile chorea; drug-induced movement disorders, such as those induced by drugs that block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; progressive supra-nucleo palsy; structural lesions of the cerebellum; spinocerebellar degenerations, such as spinal ataxia, Friedreich's ataxia, cerebellar cortical degenerations, multiple systems degenerations (Mencel, Dejer
  • the invention includes compositions and methods for decreasing miRNA levels in the CNS, preferably the brain of a mammal.
  • miR-16 levels can effectively be decreased by local injection of an antagomir directed to miR-16 to a mouse brain.
  • the decrease expression of miR-16 levels in turn can increase expression of a target gene where expression therefrom is inhibited by miR-16. Therefore, an antagimor can effectively increase expression levels of a desired target gene in the CNS of a mammal.
  • the antagimor can effectively increase expression levels of a desired target gene in a cell of the CNS.
  • the antagomir such as a single-stranded oligonucleotide agent, to which a lipophilic moiety is conjugated is used to increase expression of a gene in a cell that is not part of a whole organism, such as when the cell is part of a primary cell line, secondary cell line, tumor cell line, or transformed or immortalized cell line.
  • Cells that are not part of a whole organism can be used in an initial screen to determine if an antagomir, such as a single-stranded oligonucleotide agent, is effective in increasing target gene expression levels, or decreasing levels of a target miRNA or pre-miRNA.
  • a test in cells that are not part of a whole organism can be followed by test of the antagomir in a whole animal.
  • the antagomir that is conjugated to a lipophilic moiety is administered to an organism, or contacted with a cell that is not part of an organism, in the absence of (or in a reduced amount of) other reagents that facilitate or enhance delivery, e.g., a compound which enhances transmit through the cell membrane.
  • a reduced amount can be an amount of such reagent which is reduced in comparison to what would be needed to get an equal amount of nonconjugated antagomir into the target cell).
  • the antagomir that is conjugated to a lipophilic moiety is administered to an organism, or contacted with a cell that is not part of an organism, in the absence (or reduced amount) of (i) an additional lipophilic moiety; (ii) a transfection agent (e.g., an ion or other substance which substantially alters cell permeability to an oligonucleotide agent); or (iii) a commercial transfecting agent such as LipofectamineTM (Invitrogen, Carlsbad, Calif.), Lipofectamine 2000TM, TransIT-TKOTM (Mirus, Madison, Wis.), FuGENE 6 (Roche, Indianapolis, Ind.), polyethylenimine, X-tremeGENE Q2 (Roche, Indianapolis, Ind.), DOTAP, DOSPER, MetafecteneTM (Biontex, Kunststoff, Germany), and the like.
  • a transfection agent e.g., an ion or other substance which substantially alters cell permeability to an
  • Cationic lipid particles have been used to encapsulate oligonucleotide reagents.
  • Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids. Heyes, James; Palmer, Lorne; Bremner, Kaz; MacLachlan, Ian., Journal of Controlled Release (2005), 107(2), 276-287.
  • DSDMA 1,2-distearyloxy-N,N-dimethyl-3-aminopropane
  • DODMA 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane
  • DLinDMA 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane
  • DLenDMA 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane
  • 31P-NMR anal. suggests that as satn. increases, from 2 to 0 double bonds, lamellar (L ⁇ ) to reversed hexagonal (HII) phase transition temp. increases, indicating decreasing fusogenicity. This trend is largely reflected by the efficiency of gene silencing observed in vitro when the lipids are formulated as Stable Nucleic Acid Lipid Particles (SNALPs) encapsulating small inhibitory RNA (siRNA). Uptake expts. suggest that despite their lower gene silencing efficiency, the less fusogenic particles are more readily internalized by cells. Microscopic visualization of fluorescently labeled siRNA uptake was supported by quant. data acquired using radiolabeled prepns.
  • SNALPs Stable Nucleic Acid Lipid Particles
  • siRNA small inhibitory RNA
  • the antagomir is suitable for delivery to a cell in vivo, e.g., to a cell in an organism.
  • the antagomir is suitable for delivery to a cell in vitro, e.g., to a cell in a cell line.
  • An antagomir to which a lipophilic moiety is attached can target any miRNA (e.g., miR-122, miR-16, miR-192, or miR-194) or pre-miRNA described herein and can be delivered to any cell type described herein, e.g., a cell type in an organism, tissue, or cell line. Delivery of the antagomir can be in vivo, e.g., to a cell in an organism, or in vitro, e.g., to a cell in a cell line.
  • miRNA e.g., miR-122, miR-16, miR-192, or miR-194
  • pre-miRNA described herein e.g., a cell type in an organism, tissue, or cell line. Delivery of the antagomir can be in vivo, e.g., to a cell in an organism, or in vitro, e.g., to a cell in a cell line.
  • the invention provides compositions including single-stranded oligonucleotide agents described herein, and in particular, compositions including an antagomir to which a lipophilic moiety is conjugated, e.g., a lipophilic conjugated antagomir that hybridizes to miR-122, miR-16, miR-192, or miR-194.
  • the composition is a pharmaceutically acceptable composition.
  • the composition is suitable for delivery to a cell in vivo, e.g., to a cell in an organism.
  • the antagomir is suitable for delivery to a cell in vitro, e.g., to a cell in a cell line.
  • an “antagomir” or “oligonucleotide agent” of the present invention referes to a single stranded, double stranded or partially double stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or both or modifications thereof, which is antisense with respect to its target.
  • This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages and which contain at least one non-naturally-occurring portions which function similarly.
  • modified or substituted oligonucleotides are preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • the antagomir does not include a sense strand, and in another preferred embodiment, the antagomir does not self-hybridize to a significant extent.
  • An antagomir featured in the invention can have secondary structure, but it is substantially single-stranded under physiological conditions.
  • An antagomir that is substantially single-stranded is single-stranded to the extent that less than about 50% (e.g., less than about 40%, 30%, 20%, 10%, or 5%) of the antagomir is duplexed with itself.
  • FIGS. 5-11 provides representative structures of antagomirs.
  • “Substantially complementary” means that two sequences are substantially complementary that a duplex can be formed between them.
  • the duplex may have one or more mismatches but the region of duplex formation is sufficient to down-regulate expression of the target nucleic acid.
  • the region of substantial complementarity can be perfectly paired. In other embodiments, there will be nucleotide mismatches in the region of substantial complementarity. In a preferred embodiment, the region of substantial complementarity will have no more than 1, 2, 3, 4, or 5 mismatches.
  • the antagomirs featured in the invention include oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or both or modifications thereof.
  • This term includes oligonucleotides composed of naturally occurring nucleobases, sugars, and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions that function similarly.
  • Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, and/or increased stability in the presence of nucleases.
  • the oligonucleotide agents can be about 12 to about 30 nucleotides long, e.g., about 15 to about 25, or about 18 to about 25 nucleotides long (e.g., about 19, 20, 21, 22, 23, 24 nucleotides long).
  • the antagomirs featured in the invention can target RNA, e.g., an endogenous pre-miRNA or miRNA of the subject or an endogenous pre-miRNA or miRNA of a pathogen of the subject.
  • the oligonucleotide agents can target an miRNA of the subject, such as miR-122, miR-16, miR-192, or miR-194.
  • miRNAs such as miR-122, miR-16, miR-192, or miR-194.
  • Such single-stranded oligonucleotide can be useful for the treatment of diseases involving biological processes that are regulated by miRNAs, including developmental timing, differentiation, apoptosis, cell proliferation, organ development, and metabolism.
  • the antagomir featured in the invention include microRNA-type (miRNA-type) oligonucleotide agents, e.g., the miRNA-type oligonucleotide agents listed in Table 2a-f.
  • MicroRNAs are small noncoding RNA molecules that are capable of causing post-transcriptional silencing of specific genes in cells such as by the inhibition of translation or through degradation of the targeted mRNA.
  • An miRNA can be completely complementary or can have a region of noncomplementarity with a target nucleic acid, consequently resulting in a “bulge” at the region of non-complementarity.
  • the region of noncomplementarity can be flanked by regions of sufficient complementarity, preferably complete complementarity to allow duplex formation.
  • the regions of complementarity are at least 8, 9, or 10 nucleotides long.
  • An miRNA can inhibit gene expression by repressing translation, such as when the microRNA is not completely complementary to the target nucleic acid, or by causing target RNA degradation, which is believed to occur only when the miRNA binds its target with perfect complementarity.
  • the invention also can include double-stranded precursors of miRNAs that may or may not form a bulge when bound to their targets.
  • An miRNA or pre-miRNA can be 18-100 nucleotides in length, and more preferably from 18-80 nucleotides in length.
  • Mature miRNAs can have a length of 19-30 nucleotides, preferably 21-25 nucleotides, particularly 21, 22, 23, 24, or 25 nucleotides.
  • MicroRNA precursors typically have a length of about 70-100 nucleotides and have a hairpin conformation.
  • MicroRNAs are generated in vivo from pre-miRNAs by the enzymes Dicer and Drosha, which specifically process long pre-miRNA into functional miRNA.
  • an miRNA-type antagomir Given a sense strand sequence (e.g., the sequence of a sense strand of a cDNA molecule), an miRNA-type antagomir can be designed according to the rules of Watson and Crick base pairing.
  • the miRNA-type antagomir can be complementary to a portion of an RNA, e.g., an miRNA, pre-miRNA, or mRNA.
  • the miRNA-type antagomir can be complementary to an miRNA endogenous to a cell, such as miR-122, miR-16, miR-192, or miR-194.
  • An miRNA-type antagomir can be, for example, from about 12 to 30 nucleotides in length, preferably about 15 to 28 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length).
  • the length of the antagimor can contribute to the biochemical function of the antagimor with respect to its ability to decrease the expression levels of a desired miRNA.
  • antagomirs may require at least 19 nucleotides in length for optimal function.
  • an miRNA-type antagomir featured in the invention can have a chemical modification on a nucleotide in an internal (i.e., non-terminal) region having noncomplementarity with the target nucleic acid.
  • a modified nucleotide can be incorporated into the region of an miRNA that forms a bulge.
  • the modification can include a ligand attached to the miRNA, e.g., by a linker.
  • the modification can, for example, improve pharmacokinetics or stability of a therapeutic miRNA-type oligonucleotide agent, or improve hybridization properties (e.g., hybridization thermodynamics) of the miRNA-type antagomir to a target nucleic acid.
  • the orientation of a modification or ligand incorporated into or tethered to the bulge region of an miRNA-type antagomir is oriented to occupy the space in the bulge region.
  • the modification can include a modified base or sugar on the nucleic acid strand or a ligand that functions as an intercalator. These are preferably located in the bulge.
  • the intercalator can be an aromatic, e.g., a polycyclic aromatic or heterocyclic aromatic compound.
  • a polycyclic intercalator can have stacking capabilities, and can include systems with 2, 3, or 4 fused rings.
  • the universal bases described below can be incorporated into the miRNA-type oligonucleotide agents.
  • the orientation of a modification or ligand incorporated into or tethered to the bulge region of an miRNA-type antagomir is oriented to occupy the space in the bulge region. This orientation facilitates the improved hybridization properties or an otherwise desired characteristic of the miRNA-type oligonucleotide agent.
  • an miRNA-type antagomir or a pre-miRNA can include an aminoglycoside ligand, which can cause the miRNA-type antagomir to have improved hybridization properties or improved sequence specificity.
  • exemplary aminoglycosides include glycosylated polylysine; galactosylated polylysine; neomycin B; tobramycin; kanamycin A; and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S-acridine, Neo-C-acridine, Tobra-N-acridine, and KanaA-N-acridine.
  • Use of an acridine analog can increase sequence specificity.
  • neomycin B has a high affinity for RNA as compared to DNA, but low sequence-specificity.
  • the guanidine analog (the guanidinoglycoside) of an aminoglycoside ligand is tethered to an oligonucleotide agent.
  • the amine group on the amino acid is exchanged for a guanidine group. Attachment of a guanidine analog can enhance cell permeability of an oligonucleotide agent.
  • the ligand can include a cleaving group that contributes to target gene inhibition by cleavage of the target nucleic acid.
  • the cleaving group is tethered to the miRNA-type antagomir in a manner such that it is positioned in the bulge region, where it can access and cleave the target RNA.
  • the cleaving group can be, for example, a bleomycin (e.g., bleomycin-A 5 , bleomycin-A 2 , or bleomycin-B 2 ), pyrene, phenanthroline (e.g., O-phenanthroline), a polyamine, a tripeptide (e.g., lys-tyr-lys tripeptide), or metal ion chelating group.
  • a bleomycin e.g., bleomycin-A 5 , bleomycin-A 2 , or bleomycin-B 2
  • pyrene e.g., phenanthroline (e.g., O-phenanthroline)
  • phenanthroline e.g., O-phenanthroline
  • polyamine e.g., a tripeptide (e.g., lys-tyr-lys tripeptide), or metal ion chelating group.
  • 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane can be conjugated to a peptide (e.g., by an amino acid derivative) to promote target RNA cleavage.
  • a peptide e.g., by an amino acid derivative
  • the methods and compositions featured in the invention include miRNA-type oligonucleotide agents that inhibit target gene expression by a cleavage or non-cleavage dependent mechanism.
  • An miRNA-type antagomir or pre-miRNA-type antagomir can be designed and synthesized to include a region of noncomplementarity (e.g., a region that is 3, 4, 5, or 6 nucleotides long) flanked by regions of sufficient complementarity to form a duplex (e.g., regions that are 7, 8, 9, 10, or 11 nucleotides long) with a target RNA, e.g., an miRNA, such as miR-122, miR-16, miR-192, or miR-194.
  • a target RNA e.g., an miRNA, such as miR-122, miR-16, miR-192, or miR-194.
  • the single-stranded oligonucleotide agents featured in the invention can include 2′-O-methyl, 2′-fluorine, 2′-O-methoxyethyl, 2′-O-aminopropyl, 2′-amino, and/or phosphorothioate linkages.
  • LNA locked nucleic acids
  • ENA ethylene nucleic acids
  • certain nucleobase modifications such as 2-amino-A, 2-thio (e.g., 2-thio-U), G-clamp modifications, can also increase binding affinity to the target.
  • antagomir can be further modified by including a 3′ cationic group, or by inverting the nucleoside at the 3′-terminus with a 3′-3′ linkage.
  • the 3′-terminus can be blocked with an aminoalkyl group, e.g., a 3′ C5-aminoalkyl dT.
  • Other 3′ conjugates can inhibit 3′-5′ exonucleolytic cleavage.
  • a 3′ conjugate such as naproxen or ibuprofen
  • Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars can block 3′-5′-exonucleases.
  • the antagomir can include a phosphorothioate at least the first, second, or third internucleotide linkage at the 5′ or 3′ end of the nucleotide sequence.
  • the antagomir includes a 2′-modified nucleotide, e.g., a 2′-deoxy, 2′-deoxy-2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), 2′-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O—N-methylacetamido (2′-O—NMA).
  • a 2′-modified nucleotide e.g., a 2′-deoxy, 2′-deoxy-2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE),
  • the 5′-terminus can be blocked with an aminoalkyl group, e.g., a 5′-O-alkylamino substitutent.
  • Other 5′ conjugates can inhibit 5′-3′ exonucleolytic cleavage.
  • a 5′ conjugate such as naproxen or ibuprofen, may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 5′ end of the oligonucleotide.
  • Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars can block 3′-5′-exonucleases.
  • an antagomir such as a single-stranded oligonucleotide agent, includes a modification that improves targeting, e.g. a targeting modification described herein.
  • modifications that target single-stranded oligonucleotide agents to particular cell types include carbohydrate sugars such as galactose, N-acetylgalactosamine, mannose; vitamins such as folates; other ligands such as RGDs and RGD mimics; and small molecules including naproxen, ibuprofen or other known protein-binding molecules.
  • antagomir such as a single-stranded oligonucleotide agent, featured in the invention can be constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art.
  • an antagomir can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antagomir and target nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Other appropriate nucleic acid modifications are described herein.
  • the antagomir can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest (e.g., an miRNA or pre-miRNA)).
  • an expression vector into which a nucleic acid has been subcloned in an antisense orientation i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest (e.g., an miRNA or pre-miRNA)).
  • halo refers to any radical of fluorine, chlorine, bromine or iodine.
  • alkyl refers to a hydrocarbon chain that may be a straight chain or branched chain, containing the indicated number of carbon atoms. For example, C 1 -C 12 alkyl indicates that the group may have from 1 to 12 (inclusive) carbon atoms in it.
  • haloalkyl refers to an alkyl in which one or more hydrogen atoms are replaced by halo, and includes alkyl moieties in which all hydrogens have been replaced by halo (e.g., perfluoroalkyl). Alkyl and haloalkyl groups may be optionally inserted with O, N, or S.
  • aralkyl refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group.
  • Aralkyl includes groups in which more than one hydrogen atom has been replaced by an aryl group. Examples of “aralkyl” include benzyl, 9-fluorenyl, benzhydryl, and trityl groups.
  • alkenyl refers to a straight or branched hydrocarbon chain containing 2-8 carbon atoms and characterized in having one or more double bonds. Examples of a typical alkenyl include, but not limited to, allyl, propenyl, 2-butenyl, 3-hexenyl and 3-octenyl groups.
  • alkynyl refers to a straight or branched hydrocarbon chain containing 2-8 carbon atoms and characterized in having one or more triple bonds. Some examples of a typical alkynyl are ethynyl, 2-propynyl, and 3-methylbutynyl, and propargyl.
  • the sp 2 and sp 3 carbons may optionally serve as the point of attachment of the alkenyl and alkynyl groups, respectively.
  • alkylamino and dialkylamino refer to —NH(alkyl) and —NH(alkyl) 2 radicals respectively.
  • aralkylamino refers to a —NH(aralkyl) radical.
  • alkoxy refers to an —O-alkyl radical
  • cycloalkoxy and “aralkoxy” refer to an —O-cycloalkyl and O-aralkyl radicals respectively.
  • sioxy refers to a R 3 SiO-radical.
  • mercapto refers to an SH radical.
  • thioalkoxy refers to an —S-alkyl radical.
  • alkylene refers to a divalent alkyl (i.e., —R—), e.g., —CH 2 —, —CH 2 CH 2 —, and —CH 2 CH 2 CH 2 —.
  • alkylenedioxo refers to a divalent species of the structure —O—R—O—, in which R represents an alkylene.
  • aryl refers to an aromatic monocyclic, bicyclic, or tricyclic hydrocarbon ring system, wherein any ring atom can be substituted.
  • aryl moieties include, but are not limited to, phenyl, naphthyl, anthracenyl, and pyrenyl.
  • cycloalkyl as employed herein includes saturated cyclic, bicyclic, tricyclic, or polycyclic hydrocarbon groups having 3 to 12 carbons, wherein any ring atom can be substituted.
  • the cycloalkyl groups herein described may also contain fused rings. Fused rings are rings that share a common carbon-carbon bond or a common carbon atom (e.g., spiro-fused rings). Examples of cycloalkyl moieties include, but are not limited to, cyclohexyl, adamantyl, and norbornyl, and decalin.
  • heterocyclyl refers to a nonaromatic 3-10 membered monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein any ring atom can be substituted.
  • the heterocyclyl groups herein described may also contain fused rings.
  • Fused rings are rings that share a common carbon-carbon bond or a common carbon atom (e.g., spiro-fused rings).
  • heterocyclyl include, but are not limited to tetrahydrofuranyl, tetrahydropyranyl, piperidinyl, morpholino, pyrrolinyl and pyrrolidinyl.
  • cycloalkenyl as employed herein includes partially unsaturated, nonaromatic, cyclic, bicyclic, tricyclic, or polycyclic hydrocarbon groups having 5 to 12 carbons, preferably 5 to 8 carbons, wherein any ring atom can be substituted.
  • the cycloalkenyl groups herein described may also contain fused rings. Fused rings are rings that share a common carbon-carbon bond or a common carbon atom (e.g., spiro-fused rings).
  • Examples of cycloalkenyl moieties include, but are not limited to cyclohexenyl, cyclohexadienyl, or norbornenyl.
  • heterocycloalkenyl refers to a partially saturated, nonaromatic 5-10 membered monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein any ring atom can be substituted.
  • the heterocycloalkenyl groups herein described may also contain fused rings.
  • Fused rings are rings that share a common carbon-carbon bond or a common carbon atom (e.g., spiro-fused rings).
  • heterocycloalkenyl include but are not limited to tetrahydropyridyl and dihydropyran.
  • heteroaryl refers to an aromatic 5-8 membered monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein any ring atom can be substituted.
  • the heteroaryl groups herein described may also contain fused rings that share a common carbon-carbon bond.
  • oxo refers to an oxygen atom, which forms a carbonyl when attached to carbon, an N-oxide when attached to nitrogen, and a sulfoxide or sulfone when attached to sulfur.
  • acyl refers to an alkylcarbonyl, cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl, or heteroarylcarbonyl substitutent, any of which may be further substituted by substitutents.
  • substituted refers to a group “substituted” on an alkyl, cycloalkyl, alkenyl, alkynyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any atom of that group.
  • Suitable substitutents include, without limitation, alkyl, alkenyl, alkynyl, alkoxy, halo, hydroxy, cyano, nitro, amino, SO 3 H, sulfate, phosphate, perfluoroalkyl, perfluoroalkoxy, methylenedioxy, ethylenedioxy, carboxyl, oxo, thioxo, imino (alkyl, aryl, aralkyl), S(O) n alkyl (where n is 0-2), S(O) n aryl (where n is 0-2), S(O) n heteroaryl (where n is 0-2), S(O) n heterocyclyl (where n is 0-2), amine (mono-, di-, alkyl, cycloalkyl, aralkyl, heteroaralkyl, and combinations thereof), ester (alkyl, aralkyl, heteroaralkyl), amide (mon
  • adeninyl, cytosinyl, guaninyl, thyminyl, and uracilyl refer to radicals of adenine, cytosine, guanine, thymine, and uracil.
  • a “protected” moiety refers to a reactive functional group, e.g., a hydroxyl group or an amino group, or a class of molecules, e.g., sugars, having one or more functional groups, in which the reactivity of the functional group is temporarily blocked by the presence of an attached protecting group.
  • Protecting groups useful for the monomers and methods described herein can be found, e.g., in Greene, T. W., Protective Groups in Organic Synthesis (John Wiley and Sons: New York), 1981, which is hereby incorporated by reference.
  • An antagomir such as a single-stranded oligonucleotide agent, featured in the invention includes a region sufficient complementarity to the target nucleic acid (e.g., target miRNA, pre-miRNA or mRNA), and is of sufficient length in terms of nucleotides, such that the antagomir forms a duplex with the target nucleic acid.
  • the antagomir can modulate the function of the targeted molecule.
  • the targeted molecule is an miRNA, such as miR-122, miR-16, miR-192, or miR-194
  • the antagomir can inhibit the gene silencing activity of the target miRNA, which action will up-regulate expression of the mRNA targeted by the target miRNA.
  • the antagomir can replace or supplement the gene silencing activity of an endogenous miRNA.
  • nucleotide or ribonucleotide is sometimes used herein in reference to one or more monomeric subunits of an oligonucleotide agent. It will be understood herein that the usage of the term “ribonucleotide” or “nucleotide” herein can, in the case of a modified RNA or nucleotide surrogate, also refer to a modified nucleotide, or surrogate replacement moiety at one or more positions.
  • An antagomir featured in the invention is, or includes, a region that is at least partially, and in some embodiments fully, complementary to the target RNA. It is not necessary that there be perfect complementarity between the antagomir and the target, but the correspondence must be sufficient to enable the oligonucleotide agent, or a cleavage product thereof, to modulate (e.g., inhibit) target gene expression.
  • An antagomir will preferably have one or more of the following properties:
  • Preferred 2′-modifications with C3′-endo sugar pucker include:
  • Preferred 2′-modifications with a C2′-endo sugar pucker include:
  • Sugar modifications can also include L-sugars and 2′-5′-linked sugars.
  • RNA molecules e.g., an miRNA or a pre-miRNA.
  • Specific binding requires a sufficient lack of complementarity to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed. It has been shown that a single mismatch between targeted and non-targeted sequences are sufficient to provide discrimination for siRNA targeting of an mRNA (Brummelkamp et al., Cancer Cell, 2002, 2:243).
  • an antagomir is “sufficiently complementary” to a target RNA, such that the antagomir inhibits production of protein encoded by the target mRNA.
  • the target RNA can be, e.g., a pre-mRNA, mRNA, or miRNA endogenous to the subject.
  • the antagomir is “exactly complementary” (excluding the SRMS containing subunit(s)) to a target RNA, e.g., the target RNA and the antagomir can anneal to form a hybrid made exclusively of Watson-Crick base pairs in the region of exact complementarity.
  • a “sufficiently complementary” target RNA can include a region (e.g., of at least 7 nucleotides) that is exactly complementary to a target RNA.
  • the antagomir specifically discriminates a single-nucleotide difference. In this case, the antagomir only down-regulates gene expression if exact complementarity is found in the region of the single-nucleotide difference.
  • Oligonucleotide agents discussed herein include otherwise unmodified RNA and DNA as well as RNA and DNA that have been modified, e.g., to improve efficacy, and polymers of nucleoside surrogates.
  • Unmodified RNA refers to a molecule in which the components of the nucleic acid, namely sugars, bases, and phosphate moieties, are the same or essentially the same as that which occur in nature, preferably as occur naturally in the human body.
  • the art has referred to rare or unusual, but naturally occurring, RNAs as modified RNAs, see, e.g., Limbach et al. ( Nucleic Acids Res., 1994, 22:2183-2196).
  • modified RNA refers to a molecule in which one or more of the components of the nucleic acid, namely sugars, bases, and phosphate moieties, are different from that which occur in nature, preferably different from that which occurs in the human body. While they are referred to as “modified RNAs” they will of course, because of the modification, include molecules that are not, strictly speaking, RNAs.
  • Nucleoside surrogates are molecules in which the ribophosphate backbone is replaced with a non-ribophosphate construct that allows the bases to be presented in the correct spatial relationship such that hybridization is substantially similar to what is seen with a ribophosphate backbone, e.g., non-charged mimics of the ribophosphate backbone. Examples of all of the above are discussed herein.
  • nucleic acids are polymers of subunits or monomers
  • many of the modifications described below occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety.
  • the modification will occur at all of the subject positions in the nucleic acid but in many, and in fact in most cases it will not.
  • a modification may only occur at a 3′ or 5′ terminal position, in a terminal region, e.g., at a position on a terminal nucleotide, or in the last 2, 3, 4, 5, or 10 nucleotides of a strand.
  • the ligand can be attached at the 3′ end, the 5′ end, or at an internal position, or at a combination of these positions.
  • the ligand can be at the 3′ end and the 5′ end; at the 3′ end and at one or more internal positions; at the 5′ end and at one or more internal positions; or at the 3′ end, the 5′ end, and at one or more internal positions.
  • a phosphorothioate modification at a non-linking O position may only occur at one or both termini, or may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of the oligonucleotide.
  • the 5′ end can be phosphorylated.
  • the scaffold presented above in Formula 1 represents a portion of a ribonucleic acid.
  • the basic components are the ribose sugar, the base, the terminal phosphates, and phosphate internucleotide linkers.
  • the bases are naturally occurring bases, e.g., adenine, uracil, guanine or cytosine
  • the sugars are the unmodified 2′ hydroxyl ribose sugar (as depicted) and W, X, Y, and Z are all O.
  • Formula 1 represents a naturally occurring unmodified oligoribonucleotide.
  • Unmodified oligoribonucleotides may be less than optimal in some applications, e.g., unmodified oligoribonucleotides can be prone to degradation by e.g., cellular nucleases. Nucleases can hydrolyze nucleic acid phosphodiester bonds. However, chemical modifications to one or more of the above RNA components can confer improved properties, and, for example, can render oligoribonucleotides more stable to nucleases. Unmodified oligoribonucleotides may also be less than optimal in terms of offering tethering points for attaching ligands or other moieties to an oligonucleotide agent.
  • Modified nucleic acids and nucleotide surrogates can include one or more of:
  • modification of the 3′ end or 5′ end of the RNA e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety, such as a fluorescently labeled moiety, to either the 3′ or 5′ end of RNA.
  • the actual electronic structure of some chemical entities cannot be adequately represented by only one canonical form (i.e. Lewis structure). While not wishing to be bound by theory, the actual structure can instead be some hybrid or weighted average of two or more canonical forms, known collectively as resonance forms or structures.
  • Resonance structures are not discrete chemical entities and exist only on paper. They differ from one another only in the placement or “localization” of the bonding and nonbonding electrons for a particular chemical entity. It can be possible for one resonance structure to contribute to a greater extent to the hybrid than the others.
  • the written and graphical descriptions of the embodiments of the present invention are made in terms of what the art recognizes as the predominant resonance form for a particular species. For example, any phosphoroamidate (replacement of a nonlinking oxygen with nitrogen) would be represented by X ⁇ O and Y ⁇ N in the above figure.
  • the phosphate group is a negatively charged species.
  • the charge is distributed equally over the two non-linking oxygen atoms (i.e., X and Y in Formula 1 above).
  • the phosphate group can be modified by replacing one of the oxygens with a different substitutent.
  • One result of this modification to RNA phosphate backbones can be increased resistance of the oligoribonucleotide to nucleolytic breakdown.
  • modified phosphate groups include phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters.
  • Phosphorodithioates have both non-linking oxygens replaced by sulfur. Unlike the situation where only one of X or Y is altered, the phosphorus center in the phosphorodithioates is achiral which precludes the formation of oligoribonucleotides diastereomers. Diastereomer formation can result in a preparation in which the individual diastereomers exhibit varying resistance to nucleases.
  • RNA containing chiral phosphate groups can be lower relative to the corresponding unmodified RNA species.
  • modifications to both X and Y which eliminate the chiral center, e.g., phosphorodithioate formation may be desirable in that they cannot produce diastereomer mixtures.
  • X can be any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl).
  • Y can be any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl). Replacement of X and/or Y with sulfur is preferred.
  • the phosphate linker can also be modified by replacement of a linking oxygen (i.e., W or Z in Formula 1) with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates).
  • the replacement can occur at a terminal oxygen (position W (3′) or position Z (5′)). Replacement of W with carbon or Z with nitrogen is preferred.
  • Candidate agents can be evaluated for suitability as described below.
  • a modified RNA can include modification of all or some of the sugar groups of the ribonucleic acid.
  • the 2′ hydroxyl group (OH) can be modified or replaced with a number of different “oxy” or “deoxy” substitutents. While not being bound by theory, enhanced stability is expected since the hydroxyl can no longer be deprotonated to form a 2′ alkoxide ion.
  • the 2′ alkoxide can catalyze degradation by intramolecular nucleophilic attack on the linker phosphorus atom.
  • MOE methoxyethyl group
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a modified RNA can include nucleotides containing e.g., arabinose, as the sugar.
  • Modified RNAs can also include “abasic” sugars, which lack a nucleobase at C-1′. These abasic sugars can also be further contain modifications at one or more of the constituent sugar atoms.
  • the 2′ modifications can be used in combination with one or more phosphate linker modifications (e.g., phosphorothioate).
  • phosphate linker modifications e.g., phosphorothioate
  • chimeric oligonucleotides are those that contain two or more different modifications.
  • the modification can also entail the wholesale replacement of a ribose structure with another entity (an SRMS) at one or more sites in the oligonucleotide agent.
  • an SRMS another entity
  • the phosphate group can be replaced by non-phosphorus containing connectors (cf. Bracket I in Formula 1 above). While not wishing to be bound by theory, it is believed that since the charged phosphodiester group is the reaction center in nucleolytic degradation, its replacement with neutral structural mimics should impart enhanced nuclease stability. Again, while not wishing to be bound by theory, it can be desirable, in some embodiment, to introduce alterations in which the charged phosphate group is replaced by a neutral moiety.
  • moieties which can replace the phosphate group include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino.
  • Preferred replacements include the methylenecarbonylamino and methylenemethylimino groups.
  • Oligonucleotide-mimicking scaffolds can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates (see Bracket II of Formula 1 above). While not wishing to be bound by theory, it is believed that the absence of a repetitively charged backbone diminishes binding to proteins that recognize polyanions (e.g. nucleases). Again, while not wishing to be bound by theory, it can be desirable in some embodiment, to introduce alterations in which the bases are tethered by a neutral surrogate backbone.
  • Examples include the mophilino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates.
  • a preferred surrogate is a PNA surrogate.
  • the 3′ and 5′ ends of an oligonucleotide can be modified. Such modifications can be at the 3′ end, 5′ end or both ends of the molecule. They can include modification or replacement of an entire terminal phosphate or of one or more of the atoms of the phosphate group.
  • the 3′ and 5′ ends of an oligonucleotide can be conjugated to other functional molecular entities such as labeling moieties, e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protecting groups (based e.g., on sulfur, silicon, boron or ester).
  • labeling moieties e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protecting groups (based e.g., on sulfur, silicon, boron or ester).
  • the functional molecular entities can be attached to the sugar through a phosphate group and/or a spacer.
  • the terminal atom of the spacer can connect to or replace the linking atom of the phosphate group or the C-3′ or C-5′ O, N, S or C group of the sugar.
  • the spacer can connect to or replace the terminal atom of a nucleotide surrogate (e.g., PNAs).
  • conjugation of certain moieties can improve transport, hybridization, and specificity properties.
  • terminal modifications include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g.
  • EDTA lipophilic carriers
  • lipophilic carriers e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyamino
  • biotin e.g., aspirin, vitamin E, folic acid
  • transport/absorption facilitators e.g., aspirin, vitamin E, folic acid
  • synthetic ribonucleases e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles.
  • Terminal modifications can be added for a number of reasons, including as discussed elsewhere herein to modulate activity or to modulate resistance to degradation.
  • Preferred modifications include the addition of a methylphosphonate at the 3′-most terminal linkage; a 3′ C5-aminoalkyl-dT; 3′ cationic group; or another 3′ conjugate to inhibit 3′-5′ exonucleolytic degradation.
  • Terminal modifications useful for modulating activity include modification of the 5′ end with phosphate or phosphate analogs.
  • oligonucleotide agents are 5′ phosphorylated or include a phosphoryl analog at the 5′ terminus.
  • 5′-phosphate modifications include those which are compatible with RISC mediated gene silencing.
  • Suitable modifications include: 5′-monophosphate ((HO)2(O)P—O-5′); 5′-diphosphate ((HO)2(O)P—O—P(HO)(O)—O-5′); 5′-triphosphate ((HO)2(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′); 5′-guanosine cap (7-methylated or non-methylated) (7m-G-O-5′-(HO)(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′); 5′-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N—O-5′-(HO)(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′); 5′-monothiophosphate (phosphorothioate; (HO)2(S)P—O-5′); 5′
  • Terminal modifications can also be useful for monitoring distribution, and in such cases the preferred groups to be added include fluorophores, e.g., fluorscein or an Alexa dye, e.g., Alexa 488. Terminal modifications can also be useful for enhancing uptake, useful modifications for this include cholesterol. Terminal modifications can also be useful for cross-linking anantagomir to another moiety; modifications useful for this include mitomycin C.
  • Adenine, guanine, cytosine and uracil are the most common bases found in RNA. These bases can be modified or replaced to provide RNA's having improved properties.
  • nuclease resistant oligoribonucleotides can be prepared with these bases or with synthetic and natural nucleobases (e.g., inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine) and any one of the above modifications.
  • substituted or modified analogs of any of the above bases e.g., “unusual bases” and “universal bases” described herein, can be employed.
  • Examples include without limitation 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
  • a candidate single-stranded oligonucleotide agent e.g., a modified candidate single-stranded oligonucleotide agent
  • a selected property by exposing the agent or modified molecule and a control molecule to the appropriate conditions and evaluating for the presence of the selected property.
  • resistance to a degradent can be evaluated as follows.
  • a candidate modified antagomir and preferably a control single-stranded oligonucleotide agent, usually the unmodified form
  • can be exposed to degradative conditions e.g., exposed to a milieu, which includes a degradative agent, e.g., a nuclease.
  • a biological sample e.g., one that is similar to a milieu, which might be encountered, in therapeutic use, e.g., blood or a cellular fraction, e.g., a cell-free homogenate or disrupted cells.
  • the candidate and control can then be evaluated for resistance to degradation by any of a number of approaches.
  • the candidate and control could be labeled, preferably prior to exposure, with, e.g., a radioactive or enzymatic label, or a fluorescent label, such as Cy3 or Cy5.
  • Control and modified oligonucleotide agents can be incubated with the degradative agent, and optionally a control, e.g., an inactivated, e.g., heat inactivated, degradative agent.
  • a physical parameter, e.g., size, of the modified and control molecules are then determined. They can be determined by a physical method, e.g., by polyacrylamide gel electrophoresis or a sizing column, to assess whether the molecule has maintained its original length, or assessed functionally. Alternatively, Northern blot analysis can be used to assay the length of an unlabeled modified molecule.
  • a functional assay can also be used to evaluate the candidate agent.
  • a functional assay can be applied initially or after an earlier non-functional assay, (e.g., assay for resistance to degradation) to determine if the modification alters the ability of the molecule to inhibit gene expression.
  • a cell e.g., a mammalian cell, such as a mouse or human cell
  • a plasmid expressing a fluorescent protein e.g., GFP
  • a candidate antagomir homologous to the transcript encoding the fluorescent protein (see, e.g., WO 00/44914).
  • a modified antagomir homologous to the GFP mRNA can be assayed for the ability to inhibit GFP expression by monitoring for a decrease in cell fluorescence, as compared to a control cell, in which the transfection did not include the candidate oligonucleotide agent, e.g., controls with no agent added and/or controls with a non-modified RNA added.
  • Efficacy of the candidate agent on gene expression can be assessed by comparing cell fluorescence in the presence of the modified and unmodified oligonucleotide agent.
  • a candidate antagomir homologous to an endogenous mouse gene preferably a maternally expressed gene, such as c-mos
  • a phenotype of the oocyte e.g., the ability to maintain arrest in metaphase II, can be monitored as an indicator that the agent is inhibiting expression. For example, cleavage of c-mos mRNA by an antagomir would cause the oocyte to exit metaphase arrest and initiate parthenogenetic development (Colledge et al. Nature 370: 65-68, 1994; Hashimoto et al.
  • Controls can include cells in which with no agent is added and/or cells in which a non-modified RNA is added.
  • Preferred single-stranded oligonucleotide agents have the following structure (see Formula 2 below):
  • R 1 , R 2 , and R 3 are each, independently, H, (i.e. abasic nucleotides), adenine, guanine, cytosine and uracil, inosine, thymine, xanthine, hypoxanthine, nubularine, tubercidine, isoguanisine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino, thio
  • H i.
  • R 4 , R 5 , and R 6 are each, independently, OR 8 , O(CH 2 CH 2 O) m CH 2 CH 2 OR 8 ; O(CH 2 ) n R 9 ; O(CH 2 ) n OR 9 , H; halo; NH 2 ; NHR 8 ; N(R 8 ) 2 ; NH(CH 2 CH 2 NH) m CH 2 CH 2 NHR 9 ; NH C(O)R 8 ; cyano; mercapto, SR 8 ; alkyl-thio-alkyl; alkyl, aralkyl, cycloalkyl, aryl, heteroaryl, alkenyl, alkynyl, each of which may be optionally substituted with halo, hydroxy, oxo, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino, alkylamino, dialkylamino, heterocycl
  • a 1 is:
  • a preferred A1 is chosen from 5′-monophosphate ((HO) 2 (O)P—O-5′), 5′-diphosphate ((HO) 2 (O)P—O—P(HO)(O)—O-5′), 5′-triphosphate ((HO) 2 (O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′), 5′-guanosine cap (7-methylated or non-methylated) (7m-G-O-5′-(HO)(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′), 5′-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N—O-5′-(HO)(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′), 5′-monothiophosphate (phosphorothioate; (N—O-5′-(HO)(O
  • a 2 is:
  • a 3 is:
  • a 4 is:
  • W 1 is OH, (CH 2 ) n R 10 , (CH 2 ) n NHR 10 , (CH 2 ) n OR 10 , (CH 2 ) n SR 10 ; O(CH 2 ) n R 10 ; O(CH 2 ) n OR 10 , O(CH 2 ) n NR 10 , O(CH 2 ) n SR 10 ; O(CH 2 ) n SS(CH 2 ) n OR 10 , O(CH 2 ) n C(O)OR 10 , NH(CH 2 ) n R 10 ; NH(CH 2 ) n NR 10 ; NH(CH 2 ) n OR 10 , NH(CH 2 ) n SR 10 ; S(CH 2 ) n R 10 , S(CH 2 ) n NR 10 , S(CH 2 ) n OR 10 , S(CH 2 ) n SR 10 O(CH 2 CH 2 O) m CH 2 CH
  • X 1 , X 2 , X 3 , and X 4 are each, independently, O or S.
  • Y 1 , Y 2 , Y 3 , and Y 4 are each, independently, OH, O ⁇ , OR 8 , S, Se, BH 3 ⁇ , H, NHR 9 , N(R 9 ) 2 alkyl, cycloalkyl, aralkyl, aryl, or heteroaryl, each of which may be optionally substituted.
  • Z 1 , Z 2 , and Z 3 are each independently O, CH 2 , NH, or S.
  • Z 4 is OH, (CH 2 ) n R 10 , (CH 2 ) n NHR 10 , (CH 2 ) n OR 10 , (CH 2 ) n SR 10 ; O(CH 2 ) n R 10 ; O(CH 2 ) n OR 10 , O(CH 2 ) n NR 10 O(CH 2 ) n SR 10 , O(CH 2 ) n SS(CH 2 ) n OR 10 , O(CH 2 ) n C(O)OR 10 ; NH(CH 2 ) n R 10 ; NH(CH 2 ) n NR 10 ; NH(CH 2 ) n OR 10 , NH(CH 2 ) n SR 10 ; S(CH 2 ) n R 10 , S(CH 2 ) n NR 10 , S(CH 2 ) n OR 10
  • X is 5-100, chosen to comply with a length for an antagomir described herein.
  • R 7 is H; or is together combined with R 4 , R 5 , or R 6 to form an [—O—CH 2 —] covalently bound bridge between the sugar 2′ and 4′ carbons.
  • R 8 is alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, amino acid, or sugar;
  • R 9 is NH 2 , alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid; and
  • R 10 is H; fluorophore (pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes); sulfur, silicon, boron or ester protecting group; intercalating agents (e.g. acridines), cross-linkers (e.g.
  • psoralene mitomycin C
  • porphyrins TPPC4, texaphyrin, Sapphyrin
  • polycyclic aromatic hydrocarbons e.g., phenazine, dihydrophenazine
  • artificial endonucleases e.g.
  • EDTA lipophilic carriers
  • lipophilic carriers cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyamino; alky
  • biotin e.g., aspirin, vitamin E, folic acid
  • synthetic ribonucleases e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles
  • M is 0-1,000,000, and n is 0-20.
  • Q is a spacer selected from the group consisting of abasic sugar, amide, carboxy, oxyamine, oxyimine, thioether, disulfide, thiourea, sulfonamide, or morpholino, biotin or fluorescein reagents.
  • Preferred oligonucleotide agents in which the entire phosphate group has been replaced have the following structure (see Formula 3 below):
  • a 10 -A 40 is L-G-L; A 10 and/or A 40 may be absent, in which L is a linker, wherein one or both L may be present or absent and is selected from the group consisting of CH 2 (CH 2 ) g ; N(CH 2 ) g ; O(CH 2 ) g ; S(CH 2 ) g .
  • G is a functional group selected from the group consisting of siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino.
  • R 10 , R 20 , and R 30 are each, independently, H, (i.e. abasic nucleotides), adenine, guanine, cytosine and uracil, inosine, thymine, xanthine, hypoxanthine, nubularine, tubercidine, isoguanisine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino, thiol, thioal
  • R 40 , R 50 , and R 60 are each, independently, OR 8 , O(CH 2 CH 2 O) m CH 2 CH 2 OR 8 ; O(CH 2 ) n R 9 ; O(CH 2 ) n OR 9 , H; halo; NH 2 ; NHR 8 ; N(R 8 ) 2 ; NH(CH 2 CH 2 NH) m CH 2 CH 2 R 9 ; NHC(O)R 8 ; cyano; mercapto, SR 7 ; alkyl-thio-alkyl; alkyl, aralkyl, cycloalkyl, aryl, heteroaryl, alkenyl, alkynyl, each of which may be optionally substituted with halo, hydroxy, oxo, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino, alkylamino, dialkylamino, heterocyclyl
  • X is 5-100 or chosen to comply with a length for an antagomir described herein.
  • R 70 is H; or is together combined with R 40 , R 50 , or R 60 to form an [—O—CH 2 —] covalently bound bridge between the sugar 2′ and 4′ carbons.
  • R 8 is alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, amino acid, or sugar; and R 9 is NH 2 , alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid.
  • M is 0-1,000,000, n is 0-20, and g is 0-2.
  • Preferred nucleoside surrogates have the following structure (see Formula 4 below): SLR-(M-SLR 200 ) x -M-SLR 300 FORMULA 4
  • S is a nucleoside surrogate selected from the group consisting of mophilino, cyclobutyl, pyrrolidine and peptide nucleic acid.
  • L is a linker and is selected from the group consisting of CH 2 (CH 2 ) g ; N(CH 2 ) g ; O(CH 2 ) g ; S(CH 2 ) g ; —C(O)(CH 2 ) n — or may be absent.
  • M is an amide bond; sulfonamide; sulfinate; phosphate group; modified phosphate group as described herein; or may be absent.
  • R 100 , R 200 , and R 300 are each, independently, H (i.e., abasic nucleotides), adenine, guanine, cytosine and uracil, inosine, thymine, xanthine, hypoxanthine, nubularine, tubercidine, isoguanisine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino, thiol, thioal
  • X is 5-100, or chosen to comply with a length for an antagomir described herein; and g is 0-2.
  • An antagomir can include an internucleotide linkage (e.g., the chiral phosphorothioate linkage) useful for increasing nuclease resistance.
  • an antagomir can include a ribose mimic for increased nuclease resistance. Exemplary internucleotide linkages and ribose mimics for increased nuclease resistance are described in co-owned PCT Application No. PCT/US2004/07070 filed on Mar. 8, 2004.
  • An antagomir can include ligand-conjugated monomer subunits and monomers for oligonucleotide synthesis. Exemplary monomers are described in co-owned U.S. application Ser. No. 10/916,185, filed on Aug. 10, 2004.
  • An antagomir can have a ZXY structure, such as is described in co-owned PCT Application No. PCT/US2004/07070 filed on Mar. 8, 2004.
  • An antagomir can be complexed with an amphipathic moiety.
  • exemplary amphipathic moieties for use with oligonucleotide agents are described in co-owned PCT Application No. PCT/US2004/07070 filed on Mar. 8, 2004.
  • the antagomir can be complexed to a delivery agent that features a modular complex.
  • the complex can include a carrier agent linked to one or more of (preferably two or more, more preferably all three of): (a) a condensing agent (e.g., an agent capable of attracting, e.g., binding, a nucleic acid, e.g., through ionic or electrostatic interactions); (b) a fusogenic agent (e.g., an agent capable of fusing and/or being transported through a cell membrane); and (c) a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type.
  • oligonucleotide agents complexed to a delivery agent are described in co-owned PCT Application No. PCT/US2004/07070 filed on Mar. 8, 2004.
  • An antagomir such as a single-stranded oligonucleotide agent, featured in the invention can have enhanced resistance to nucleases.
  • an oligonucleotide agent e.g., the oligonucleotide agent
  • the 2′ hydroxyl group (OH) can be modified or replaced with a number of different “oxy” or “deoxy” substitutents.
  • OR e.g., R ⁇ H, alkyl, cycloalkyl, aryl
  • MOE methoxyethyl group
  • Preferred substitutents are 2′-methoxyethyl, 2′-OCH3, 2′-O-allyl, 2′-C— allyl, and 2′-fluoro.
  • One way to increase resistance is to identify cleavage sites and modify such sites to inhibit cleavage, as described in co-owned U.S. Application No. 60/559,917, filed on May 4, 2004.
  • the dinucleotides 5′-UA-3′,5′-UG-3′,5′-CA-3′,5′-UU-3′, or 5′-CC-3′ can serve as cleavage sites.
  • Enhanced nuclease resistance can therefore be achieved by modifying the 5′ nucleotide, resulting, for example, in at least one 5′-uridine-adenine-3′ (5′-UA-3′) dinucleotide wherein the uridine is a 2′-modified nucleotide; at least one 5′-uridine-guanine-3′ (5′-UG-3′) dinucleotide, wherein the 5′-uridine is a 2′-modified nucleotide; at least one 5′-cytidine-adenine-3′ (5′-CA-3′) dinucleotide, wherein the 5′-cytidine is a 2′-modified nucleotide; at least one 5′-uridine-uridine-3′ (5′-UU-3′) dinucleotide, wherein the 5′-uridine is a 2′-modified nucleotide; or at least one 5′-cytidine-cytidine-3′ (5′-CC
  • the antagomir can include at least 2, at least 3, at least 4 or at least 5 of such dinucleotides. In certain embodiments, all the pyrimidines of an antagomir carry a 2′-modification, and the antagomir therefore has enhanced resistance to endonucleases.
  • the 2′ modifications can be used in combination with one or more phosphate linker modifications (e.g., phosphorothioate).
  • phosphate linker modifications e.g., phosphorothioate
  • chimeric oligonucleotides are those that contain two or more different modifications.
  • furanose sugars in the oligonucleotide backbone can also decrease endonucleolytic cleavage.
  • An antagomir can be further modified by including a 3′ cationic group, or by inverting the nucleoside at the 3′-terminus with a 3′-3′ linkage.
  • the 3′-terminus can be blocked with an aminoalkyl group, e.g., a 3′ C5-aminoalkyl dT.
  • Other 3′ conjugates can inhibit 3′-5′ exonucleolytic cleavage.
  • a 3′ conjugate such as naproxen or ibuprofen
  • Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars can block 3′-5′-exonucleases.
  • 5′ conjugates can inhibit 5′-3′ exonucleolytic cleavage.
  • a 5′ conjugate such as naproxen or ibuprofen, may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 5′-end of oligonucleotide.
  • Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars can block 3′-5′-exonucleases.
  • an antagomir can include modifications so as to inhibit degradation, e.g., by nucleases, e.g., endonucleases or exonucleases, found in the body of a subject.
  • nucleases e.g., endonucleases or exonucleases
  • NRMs Nuclease Resistance promoting Monomers
  • antagomir In many cases these modifications will modulate other properties of the antagomir as well, e.g., the ability to interact with a protein, e.g., a transport protein, e.g., serum albumin, or a member of the RISC, or the ability of the antagomir to form a duplex with another sequence, e.g., a target molecule, such as an miRNA or pre-miRNA.
  • a protein e.g., a transport protein, e.g., serum albumin, or a member of the RISC
  • a target molecule such as an miRNA or pre-miRNA.
  • NRM modifications can be introduced into an antagomir or into a sequence of an oligonucleotide agent.
  • An NRM modification can be used more than once in a sequence or in an oligonucleotide agent.
  • NRM modifications include some which can be placed only at the terminus and others which can go at any position. Some NRM modifications that can inhibit hybridization are preferably used only in terminal regions, and more preferably not at the cleavage site or in the cleavage region of the oligonucleotide agent.
  • Modifications which interfere with or inhibit endonuclease cleavage should not be inserted in the region which is subject to RISC mediated cleavage, e.g., the cleavage site or the cleavage region (As described in Elbashir et al., Genes and Dev. 15: 188, 2001, hereby incorporated by reference).
  • Cleavage of the target occurs about in the middle of a 20 or 21 nt oligonucleotide agent, or about 10 or 11 nucleotides upstream of the first nucleotide on the target mRNA which is complementary to the oligonucleotide agent.
  • cleavage site refers to the nucleotides on either side of the site of cleavage, on the target mRNA or on the antagomir which hybridizes to it.
  • Cleavage region means the nucleotides within 1, 2, or 3 nucleotides of the cleavage site, in either direction.
  • Such modifications can be introduced into the terminal regions, e.g., at the terminal position or with 2, 3, 4, or 5 positions of the terminus, of a sequence which targets or a sequence which does not target a sequence in the subject.
  • the single-stranded oligonucleotide agents described herein can be formulated for administration to a subject.
  • formulations, compositions, and methods in this section are discussed largely with regard to unmodified oligonucleotide agents. It should be understood, however, that these formulations, compositions, and methods can be practiced with other oligonucleotide agents, e.g., modified oligonucleotide agents, and such practice is within the invention.
  • a formulated antagomir composition can assume a variety of states.
  • the composition is at least partially crystalline, uniformly crystalline, and/or anhydrous (e.g., less than 80, 50, 30, 20, or 10% water).
  • the antagomir is in an aqueous phase, e.g., in a solution that includes water, this form being the preferred form for administration via inhalation.
  • the aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase), or a particle (e.g., a microparticle as can be appropriate for a crystalline composition).
  • a delivery vehicle e.g., a liposome (particularly for the aqueous phase), or a particle (e.g., a microparticle as can be appropriate for a crystalline composition).
  • the antagomir composition is formulated in a manner that is compatible with the intended method of administration.
  • An antagomir preparation can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an oligonucleotide agent, e.g., a protein that complexes with the oligonucleotide agent.
  • another agent e.g., another therapeutic agent or an agent that stabilizes an oligonucleotide agent, e.g., a protein that complexes with the oligonucleotide agent.
  • Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg 2+ ), salts, RNAse inhibitors (e.g., a broad specificity RNAse inhibitor such as RNAsin) and so forth.
  • the antagomir preparation includes another antagomir, e.g., a second antagomir that can down-regulate expression of a second gene. Still other preparations can include at least three, five, ten, twenty, fifty, or a hundred or more different oligonucleotide species.
  • the agents are directed to the same target nucleic acid but different target sequences.
  • each antagomir is directed to a different target.
  • the antagomir preparation includes a double stranded RNA that targets an RNA (e.g., an mRNA) for donwregulation by an RNAi silencing mechanism.
  • a composition that includes an antagomir featured in the invention can be delivered to a subject by a variety of routes.
  • routes include inhalation, intrathecal, parenchymal, intravenous, nasal, oral, and ocular delivery.
  • compositions can include one or more oligonucleotide agents and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • compositions featured in the invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, intranasal, transdermal, intrapulmonary), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.
  • delivery of an antagomir featured in the invention directs the agent to the site of infection in a subject.
  • the preferred means of delivery is through local administration directly to the site of infection, or by systemic administration, e.g. parental administration.
  • Formulations for direct injection and parenteral administration are well known in the art. Such formulations may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic.
  • a patient who has been diagnosed with a disorder characterized by unwanted miRNA expression can be treated by administration of an antagomir described herein to block the negative effects of the miRNA, thereby alleviating the symptoms associated with the unwanted miRNA expression.
  • a human who has or is at risk for developing a disorder characterized by underexpression of a gene that is regulated by an miRNA can be treated by the administration of an antagomir that targets the miRNA.
  • a human diagnosed with hemolytic anemia, and who carries a mutation in the aldolase A gene expresses a compromised form of the enzyme.
  • the patient can be administered an antagomir that targets endogenous miR-122, which binds aldolase A RNA in vivo, presumably to downregulate translation of the aldolase A mRNA and consequently downregulate aldolase A protein levels.
  • Administration of an antagomir that targets the endogenous miR-122 in a patient having hemolytic anemia will decrease miR-122 activity, which will result in the upregulation of aldolase A expression and an increase in aldolase A protein levels.
  • an increase in protein levels may be sufficient to relieve the disease symptoms.
  • a human who carries a mutation in the aldolase A gene can be a candidate for treatment with an antagomir that targets miR-122.
  • a human who carries a mutation in the aldolase A gene can have a symptom characterizing aldolase A deficiency including growth and developmental retardation, midfacial hypoplasia, and hepatomegaly.
  • a human who has or who is at risk for developing a disorder associated with overexpression of a gene regulated by an miRNA or by an miRNA deficiency can be treated by the administration of an antagomir, such as a single-stranded oligonucleotide agent, that is substantially identical to the deficient miRNA.
  • the single-stranded oligonucleotide agents featured in the invention can be administered systemically, e.g., orally or by intramuscular injection or by intravenous injection, in admixture with a pharmaceutically acceptable carrier adapted for the route of administration.
  • An antagomir can include a delivery vehicle, such as liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations.
  • Methods for the delivery of nucleic acid molecules are described in Akhtar et al., Trends in Cell Bio. 2:139, 1992; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995; Maurer et al., Mol. Membr.
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by ionophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins (see for example Gonzalez et al., Bioconjugate Chem. 10:1068, 1999), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722).
  • the antagomir can be administered to the subject either as a naked oligonucleotide agent, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the oligonucleotide agent.
  • the antagomir is administered as a naked oligonucleotide agent.
  • An antagomir featured in the invention can be administered to the subject by any means suitable for delivering the agent to the cells of the tissue at or near the area of unwanted target nucleic acid expression (e.g., target miRNA or pre-miRNA expression).
  • an antagomir that targets miR-122 can be delivered directly to the liver, or can be conjugated to a molecule that targets the liver.
  • Exemplary delivery methods include administration by gene gun, electroporation, or other suitable parenteral administration route.
  • Suitable enteral administration routes include oral delivery.
  • Suitable parenteral administration routes include intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., intraocular injection, intra-retinal injection, or sub-retinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the area at or near the site of neovascularization, for example by a catheter or other placement device (e.g., a retinal pellet or an implant comprising a porous, non-porous, or gelatinous material).
  • intravascular administration e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature
  • peri- and intra-tissue injection e.g., intraocular injection
  • An antagomir featured in the invention can be delivered using an intraocular implant.
  • Such implants can be biodegradable and/or biocompatible implants, or may be non-biodegradable implants.
  • the implants may be permeable or impermeable to the active agent, and may be inserted into a chamber of the eye, such as the anterior or posterior chambers, or may be implanted in the sclera, transchoroidal space, or an avascularized region exterior to the vitreous.
  • the implant may be positioned over an avascular region, such as on the sclera, so as to allow for transscleral diffusion of the drug to the desired site of treatment, e.g., the intraocular space and macula of the eye.
  • the site of transscleral diffusion is preferably in proximity to the macula.
  • An antagomir featured in the invention can also be administered topically, for example, by patch or by direct application to the eye, or by iontophoresis.
  • Ointments, sprays, or droppable liquids can be delivered by ocular delivery systems known in the art such as applicators or eyedroppers.
  • the compositions can be administered directly to the surface of the eye or to the interior of the eyelid.
  • Such compositions can include mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or poly(vinyl alcohol), preservatives such as sorbic acid, EDTA or benzylchronium chloride, and the usual quantities of diluents and/or carriers.
  • An antagomir featured in the invention may be provided in sustained release compositions, such as those described in, for example, U.S. Pat. Nos. 5,672,659 and 5,595,760.
  • sustained release compositions such as those described in, for example, U.S. Pat. Nos. 5,672,659 and 5,595,760.
  • immediate or sustained release compositions depends on the nature of the condition being treated. If the condition consists of an acute or over-acute disorder, treatment with an immediate release form will be preferred over a prolonged release composition. Alternatively, for certain preventative or long-term treatments, a sustained release composition may be appropriate.
  • An antagomir can be injected into the interior of the eye, such as with a needle or other delivery device.
  • An antagomir featured in the invention can be administered in a single dose or in multiple doses.
  • the infusion can be a single sustained dose or can be delivered by multiple infusions.
  • Injection of the agent can be directly into the tissue at or near the site of aberrant or unwanted target gene expression (e.g., aberrant or unwanted miRNA or pre-miRNA expression). Multiple injections of the agent can be made into the tissue at or near the site.
  • Dosage levels on the order of about 1 ⁇ g/kg to 100 mg/kg of body weight per administration are useful in the treatment of a disease.
  • One skilled in the art can also readily determine an appropriate dosage regimen for administering the antagomir of the invention to a given subject.
  • the antagomir can be administered to the subject once, e.g., as a single injection or deposition at or near the site on unwanted target nucleic acid expression.
  • the antagomir can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days.
  • the antagomir is injected at or near a site of unwanted target nucleic acid expression once a day for seven days.
  • a dosage regimen comprises multiple administrations, it is understood that the effective amount of antagomir administered to the subject can include the total amount of antagomir administered over the entire dosage regimen.
  • the exact individual dosages may be adjusted somewhat depending on a variety of factors, including the specific antagomir being administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disorder being treated, the severity of the disorder, the pharmacodynamics of the oligonucleotide agent, and the age, sex, weight, and general health of the patient.
  • oligonucleotide agents featured in the invention can be administered prophylactically in order to prevent or slow the onset of a particular disease or disorder.
  • an antagomir is administered to a patient susceptible to or otherwise at risk of a particular disorder, such as disorder associated with aberrant or unwanted expression of an miRNA or pre-miRNA.
  • the oligonucleotide agents featured by the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
  • Pharmaceutical compositions featured in the present invention are characterized as being at least sterile and pyrogen-free.
  • pharmaceutical formulations include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 18th ed., Mack Publishing Company, Easton, Pa. (1990), and The Science and Practice of Pharmacy, 2003, Gennaro et al., the entire disclosures of which are herein incorporated by reference.
  • the present pharmaceutical formulations include an antagomir featured in the invention (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a physiologically acceptable carrier medium.
  • Preferred physiologically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
  • compositions featured in the invention can also include conventional pharmaceutical excipients and/or additives.
  • Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • Pharmaceutical compositions can be packaged for use in liquid form, or can be lyophilized.
  • conventional non-toxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a solid pharmaceutical composition for oral administration can include any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of one or more single-stranded oligonucleotide agents featured in the invention.
  • compositions or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity.
  • agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as PluronicP85), which can enhance entry of drugs into the CNS (Jolliet-Riant and Tillement, Fundam. Clin. Pharmacol. 13:16, 1999); biodegradable polymers, such as poly(DL-lactide-coglycolide) microspheres for sustained release delivery.
  • delivery strategies for the nucleic acid molecules featured in the instant invention include material described in Boado et al., J. Pharm. Sci.
  • the invention also features the use of a composition that includes surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes).
  • PEG-modified, or long-circulating liposomes or stealth liposomes These formulations offer a method for increasing the accumulation of drugs in target tissues.
  • This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al., Chem. Rev. 95:2601, 1995; Ishiwata et al., Chem. Phare. Bull. 43:1005, 1995).
  • liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 267:1275, 1995; Oku et al., Biochim. Biophys. Acta 1238:86, 1995).
  • the long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Chem. 42:24864, 1995; Choi et al., International PCT Publication No. WO 96/10391; Ansell et al., International PCT Publication No.
  • WO 96/10390 Holland et al., International PCT Publication No. WO 96/103912.
  • Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
  • compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired oligonucleotides in a pharmaceutically acceptable carrier or diluent.
  • Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated by reference herein.
  • preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
  • antioxidants and suspending agents can be used.
  • nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect.
  • the use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
  • certain single-stranded oligonucleotide agents featured in the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, Science 229:345, 1985; McGarry and Lindquist, Proc. Natl. Acad. Sci. USA 83:399, 1986; Scanlon et al., Proc. Natl. Acad. Sci. USA 88:10591, 1991; Kashani-Sabet et al., Antisense Res. Dev. 2:3, 1992; propulic et al., J. Virol. 66:1432, 1992; Weerasinghe et al., J. Virol.
  • eukaryotic promoters e.g., Izant and Weintraub, Science 229:345, 1985; McGarry and Lindquist, Proc. Natl. Acad. Sci. USA 83:399, 1986; Scanlon et al.
  • nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., Nucleic Acids Symp. Ser. 27:156, 1992; Taira et al., Nucleic Acids Res. 19:5125, 1991; Ventura et al., Nucleic Acids Res. 21:3249, 1993; Chowrira et al., J. Biol. Chem. 269:25856, 1994).
  • a enzymatic nucleic acid Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595
  • Ohkawa et al. Nucleic Acids Symp. Ser. 27:156, 1992
  • Taira et al. Nucleic Acids
  • RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al., Trends in Genetics 12:510, 1996) inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • Oligonucleotide agent-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus.
  • pol III based constructs are used to express nucleic acid molecules of the invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and 6,146,886).
  • the recombinant vectors capable of expressing the oligonucleotide agents can be delivered as described above, and can persist in target cells.
  • viral vectors can be used that provide for transient expression of nucleic acid molecules.
  • Such vectors can be repeatedly administered as necessary.
  • the antagomir interacts with the target RNA (e.g., miRNA or pre-miRNA) and inhibits miRNA activity.
  • the antagomir forms a duplex with the target miRNA, which prevents the miRNA from binding to its target mRNA, which results in increased translation of the target mRNA.
  • oligonucleotide agent-expressing vectors can be systemic, such as by intravenous or intra-muscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., Trends in Genetics 12:510, 1996).
  • terapéuticaally effective amount is the amount present in the composition that is needed to provide the desired level of drug in the subject to be treated to give the anticipated physiological response.
  • physiologically effective amount is that amount delivered to a subject to give the desired palliative or curative effect.
  • pharmaceutically acceptable carrier means that the carrier can be taken into the subject with no significant adverse toxicological effects on the subject.
  • co-administration refers to administering to a subject two or more single-stranded oligonucleotide agents.
  • the agents can be contained in a single pharmaceutical composition and be administered at the same time, or the agents can be contained in separate formulation and administered serially to a subject. So long as the two agents can be detected in the subject at the same time, the two agents are said to be co-administered.
  • the types of pharmaceutical excipients that are useful as carrier include stabilizers such as human serum albumin (HSA), bulking agents such as carbohydrates, amino acids and polypeptides; pH adjusters or buffers; salts such as sodium chloride; and the like. These carriers may be in a crystalline or amorphous form or may be a mixture of the two.
  • HSA human serum albumin
  • bulking agents such as carbohydrates, amino acids and polypeptides
  • pH adjusters or buffers such as sodium chloride
  • salts such as sodium chloride
  • Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, and the like; disaccharides, such as lactose, trehalose, and the like; cyclodextrins, such as 2-hydroxypropyl-.beta.-cyclodextrin; and polysaccharides, such as raffinose, maltodextrins, dextrans, and the like; alditols, such as mannitol, xylitol, and the like.
  • a preferred group of carbohydrates includes lactose, threhalose, raffinose maltodextrins, and mannitol.
  • Suitable polypeptides include aspartame.
  • Amino acids include alanine and glycine, with glycine being preferred.
  • Suitable pH adjusters or buffers include organic salts prepared from organic acids and bases, such as sodium citrate, sodium ascorbate, and the like; sodium citrate is preferred.
  • An antagomir can be administered at a unit dose less than about 75 mg per kg of bodyweight, or less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of bodyweight, and less than 200 nmol of antagomir (e.g., about 4.4 ⁇ 10 16 copies) per kg of bodyweight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol of antagomir per kg of bodyweight.
  • the unit dose for example, can be administered by injection (e.g., intravenous or intramuscular, intrathecally, or directly into an organ), inhalation, or a topical application.
  • Delivery of an antagomir directly to an organ can be at a dosage on the order of about 0.00001 mg to about 3 mg per organ, or preferably about 0.0001-0.001 mg per organ, about 0.03-3.0 mg per organ, about 0.1-3.0 mg per organ or about 0.3-3.0 mg per organ.
  • the dosage can be an amount effective to treat or prevent a disease or disorder.
  • the unit dose is administered less frequently than once a day, e.g., less than every 2, 4, 8 or 30 days.
  • the unit dose is not administered with a frequency (e.g., not a regular frequency).
  • the unit dose may be administered a single time. Because oligonucleotide agent-mediated silencing can persist for several days after administering the antagomir composition, in many instances, it is possible to administer the composition with a frequency of less than once per day, or, for some instances, only once for the entire therapeutic regimen.
  • a subject is administered an initial dose, and one or more maintenance doses of an antagomir.
  • the maintenance dose or doses are generally lower than the initial dose, e.g., one-half less of the initial dose.
  • a maintenance regimen can include treating the subject with a dose or doses ranging from 0.01 ⁇ g to 75 mg/kg of body weight per day, e.g., 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of bodyweight per day.
  • the maintenance doses are preferably administered no more than once every 5, 10, or 30 days.
  • the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient.
  • the dosage may be delivered no more than once per day, e.g., no more than once per 24, 36, 48, or more hours, e.g., no more than once every 5 or 8 days.
  • the patient can be monitored for changes in his condition and for alleviation of the symptoms of the disease state.
  • the dosage of the compound may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, if the disease state has been ablated, or if undesired side-effects are observed.
  • the effective dose can be administered in a single dose or in two or more doses, as desired or considered appropriate under the specific circumstances. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, e.g., a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be advisable.
  • a delivery device e.g., a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be advisable.
  • the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the compound of the invention is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight (see U.S. Pat. No. 6,107,094).
  • the concentration of the antagomir composition is an amount sufficient to be effective in treating or preventing a disorder or to regulate a physiological condition in humans.
  • concentration or amount of antagomir administered will depend on the parameters determined for the agent and the method of administration, e.g. direct administration to the eye. For example, eye formulations tend to require much lower concentrations of some ingredients in order to avoid irritation or burning of the ocular tissues. It is sometimes desirable to dilute an oral formulation up to 10-100 times in order to provide a suitable ocular formulation.
  • Certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. It will also be appreciated that the effective dosage of the antagomir used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays. For example, the subject can be monitored after administering an antagomir composition. Based on information from the monitoring, an additional amount of the antagomir composition can be administered.
  • Dosing is dependent on severity and responsiveness of the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved.
  • Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual compounds, and can generally be estimated based on EC 50 s found to be effective in in vitro and in vivo animal models.
  • the present invention provides a method for inhibiting expression levels of an miRNA in a mammalian CNS tissue, preferably the brain of a mammal.
  • the invention encompasses methods for administering a desirable antagomir to a mammal suffering from a disease, disorder or condition of the CNS.
  • a mammal can be a rodent, rabbit, primate, human, etc.
  • the antagomir can be transplanted directly into the defective region of the brain or into the penumbral tissue, which is a tissue adjacent to a lesion or defective region. The tissue adjacent to the lesion provides a receptive environment, similar to that of a developing brain.
  • compositions of the present invention can be administered into including, but not limited to ischemic brain, injured brain, injured spinal cord, and into brain that exhibits symptoms of degeneration.
  • Administration of the composition into the mammal can also be performed in combination with growth factors including, but not limited to brain derived neurotrophic factor (BDNF), nerve growth factor (NGF), and the like.
  • BDNF brain derived neurotrophic factor
  • NGF nerve growth factor
  • the present invention is based on the discovery that an antagomir directed to miR-16 efficiently decreased miR-16 levels in mouse brain when injected locally. For example, local injection of a small amount of antagomir-16 efficiently reduced expression of miR-16 in the cortex. This inhibition was specific since the expression of other miRNAs was not affected and no alteration in miR-16 levels were measured in the contra-lateral hemisphere that was injected with PBS. Based on the present disclosure, a skilled artisan would appreciate that any antagomir presented herein can decrease expression levels of the corresponding miRNA.
  • the ability to regulate expression of a desired miRNA in vivo provides a strategy to regulate target genes that are regulated by a particular miRNA. As such, the invention encompasses inhibiting an miRNA in order to increase expression of a target gene that is regulated by the miRNA. The increase expression of a target gene can in turn increase the protein levels corresponding to the target gene.
  • the administered antagomir decreases a desired miRNA in a cell of a mammal and hence the increase expression level of a desired target gene.
  • the invention should also encompass a secondary effect as a result of the targeted decreased expression level of the desired miRNA. For example, if a target gene is a factor that is secreted from a cell, than the increased expression of the target gene (e.g. secreted factor) results in the increased amount of the factor being secreted.
  • Non-limiting factors include, but are not limited to, leukemia inhibitory factor (LIF), brain-derived neurotrophic factor (BDNF), epidermal growth factor receptor (EGF), basic fibroblast growth factor (bFGF), FGF-6, glial-derived neurotrophic factor (GDNF), granulocyte colony-stimulating factor (GCSF), hepatocyte growth factor (HGF), IFN- ⁇ , insulin-like growth factor binding protein (IGFBP-2), IGFBP-6, IL-1ra, IL-6, IL-8, monocyte chemotacetic protein (MCP-1), mononuclear phagocyte colony-stimulating factor (M-CSF), neurotrophic factors (NT3), tissue inhibitor of metalloproteinases (TIMP-1), TIMP-2, tumor necrosis factor (TNF- ⁇ ), vascular endothelial growth factor (VEGF), VEGF-D, urokinase plasminogen activator receptor (uPAR), bone morphogenetic protein 4 (BMP4),
  • the present invention also includes a method for regulating the secretion of a factor from a cell, whereby the secreted factor can have a beneficial effect on neighboring and/or distal cells.
  • the secreted factors can activate endogenous cells to proliferate and differentiate into cells of the CNS.
  • the factors secreted by the cell targeted by the antagomir can serve to activate endogenous stem cells and/or epedymal cells in the brain and/or spinal cord to proliferate and differentiate into parenchymal cells, including, but not limited to neurons.
  • the present invention includes a method of using an antigomir to directly and/or indirectly promote repair and plasticity of a CNS tissue in a mammal including, but not limited to brain and spinal cord diseases.
  • compositions of the invention may vary depending on several factors including the type of disease or disorder being treated, the age of the mammal, whether the compositions have been modified, or the like.
  • an antagomir can be introduced into the brain of a mammal by intracerebral administration.
  • the compositions may be introduced to the desired site by direct injection, or by any other means used in the art for the introduction of compounds into the CNS.
  • compositions of the present invention can be accomplished using techniques well known in the art as well as those described herein or as developed in the future. Exemplified herein are methods for administering compositions of the invention into a brain of a mammal, but the present invention is not limited to such anatomical sites. Rather, the composition can be injected into a number of sites, including the intraventricular region, the parenchyma (either as a blind injection or to a specific site by stereotaxic injections), and the subarachnoid or subpial spaces. Specific sites of injection can be portions of the cortical gray matter, white matter, basal ganglia, and spinal cord. Without wishing to be bound to any particular theory, any mammal affected by a CNS disorder, as described elsewhere herein, can be so treated by one or more of the methodologies described herein.
  • administration of the compositions into selected regions of a mammal's brain may be made by drilling a hole and piercing the dura to permit the needle of a microsyringe to be inserted.
  • the compositions can be injected intrathecally into a spinal cord region.
  • the types of diseases which are treatable using the compositions of the present invention are limitless.
  • the compositions may be used for treatment of a number of genetic diseases of the CNS, including, but not limited to, Tay-Sachs disease and the related Sandhoff's disease, Hurler's syndrome and related mucopolysaccharidoses and Krabbe's disease.
  • these diseases also produce lesions in the spinal cord and peripheral nerves.
  • treatment of head trauma during birth or following birth is treatable by introducing the compositions into the CNS of the individual.
  • CNS tumor formation in children is also treatable using the methods of the present invention.
  • the cells of the present invention are useful for treatment of Parkinson's disease, Alzheimer's disease, spinal cord injury, stroke, trauma, tumors, degenerative diseases of the spinal cord such as amyotropic lateral sclerosis, Huntington's disease, epilepsy and the like. Treatment of multiple sclerosis is also comtemplated.
  • antagomir-122 was designed to target miR-122, an miRNA expressed in the liver.
  • the sequence of antagomir-122 is shown in Table 3.
  • Antagomir-122 was administered to mice by intravenous injection in a small volume (0.2 ml, 80 mg/kg, 3 consecutive days) and normal pressure. Administration of antagomir-122 resulted in a striking reduction of endogenous miR-122 levels as detected by Northern blot analysis ( FIG.
  • FIG. 1A Administration of unmodified single-stranded RNA (anti-122) had no effect on hepatic miR-122 expression levels ( FIG. 1A ), while injection of unconjugated, but chemically-stabilized single-stranded RNAs with partial (pS) or complete (fS) phosphorothioate backbone and 2′-O-methyl sugar modifications (anti-122fS, anti-122pS, see Table 3) led to an incomplete effect ( FIG. 1A ).
  • the effects of antagomir-122 were found to be specific as animals injected with a control antagomir-122 derivative that harbored four mismatch mutations (mm-antagomir-122) had no effect on miR-122 expression in the liver.
  • MiR-122 is expressed at high levels in hepatocytes with over 50,000 copies per cell (Chang J. et al., RNA Biology 1:2, 106-113, 2004).
  • total RNA from livers of mice treated with unconjugated single-stranded anti-miR-122 RNAs (anti-122fS, anti-122pS) or antagomir-122 were examined under stringent, formamide-containing denaturing conditions ( FIG. 1C ).
  • mice were injected with 80, 160 or 240 mg/kg bodyweight antagomir-122 and miR-122 expression levels were measured.
  • the highest dose (240 mg/kg bodyweight) resulted in a complete loss of miR-122 signal and was subsequently used for all other experiments ( FIG. 2A ).
  • the duration of silencing with antagomir-122 was also measured. Levels of miR-122 were undetectable for as long as 23 days post-injection ( FIG. 2B ), indicating that silencing of miRNAs using antagomirs is long lasting.
  • the injected antagomirs were well tolerated even during the course of the prolonged treatment; no alterations in bodyweight or serum markers of liver toxicity (alanine aminotransferase) were detected.
  • mice were injected with antagomir-16 directed to miR-16, which is abundantly expressed in all tissues (miR-16 is predicted to target one or both of Activin type II receptor gene, which is involved in TGFbeta signaling, and Hox-A51 (John et al., PLoS Biology 2:1862-1878, 2004; correction in PLoS Biology 3:1328, 2005)).
  • Tissues were harvested one day after the final injection, and miRNA expression levels were compared to PBS-injected mice.
  • Northern blot analysis revealed that expression of miR-16 was efficiently silenced in all tissues tested except brain ( FIG. 3A ).
  • Antagomir-16 did not affect the expression of the 89 nt precursor of miR-16 as detected in bone marrow. The bioavailability of antagomir-16 was also assessed by Northern blotting in the above mentioned tissue samples. In concordance with the ability to silence miR-16 levels, significant levels of antagomir-16 were detected in all tissues except brain ( FIG. 3B ). Together, these data demonstrate that antagomirs achieve broad biodistribution and can efficiently silence miRNAs in most tissues in vivo.
  • miRNA genes have been found to be located in close proximity and to be coordinately transcribed. These polycistronic miRNA genes are transcribed to generate long primary transcripts (pri-miRNAs), which are processed by multiple enzymes in the nucleus and cytoplasm to generate the mature miRNA.
  • pri-miRNAs long primary transcripts
  • mice were injected with antagomirs targeting either miR-192 or miR-194 of the bicistronic cluster miR-192/194.
  • Administration of antagomir-192 into mice resulted in silencing of miR-192 in liver and kidney, with no effect on the expression levels of miR-194.
  • antagomir-194 injection of antagomir-194 into mice abolished miR-194 expression but had no demonstrable effect on the miR-192 levels compared to PBS-injected mice.
  • aldolase A a gene that is repressed in hepatocytes and predicted to be a target of miR-122.
  • the aldolase-A mRNA has a conserved nucleotide sequence with perfect sequence complementarity to miR-122 between nucleotides 29 and 36 downstream of the open reading frame.
  • Aldolase-A expression was increased 4-5 fold in livers of mice injected with antagomir-122 compared to a scrambled control (mm-antagomir-122). This regulation was observed in multiple experiments and different time points after injection.
  • the target was also independently confirmed by cloning the 3′UTR Aldolase-A downstream of the luciferase open reading frame and cotransfecting this vector with control miRNAs (miR-124 (5′-UAAGGCACGCGGUGAAUGCCA-3 SEQ ID NO:41); see Krek et al., Nature Genetics 37:495-500, 2005, and Lim et al., Nature 433:769-773, 2005) and miR-192) and miR-122 into HEK293 cells, which lack miR-122 expression. Cotransfection of miR-122 resulted in a significant reduction in luciferase activity compared to miR-124 and miR-192 transfected cells. Together, these data indicate that aldolase-A is a physiological target of miR-122.
  • aldolase-A is a housekeeping gene expressed in all cells. This gene is produced in large amounts in muscle where it can be as much as 5% of total cellular protein. In adult liver, aldolase-A expression is repressed and aldolase-B is produced. Conversely, dedifferentiated hepatocytes and transformed liver cells have increased aldolase-A expression levels and can even replace aldolase-B.
  • Expression of miR-122 shows an inverse relationship with aldolase-A expression, with highest levels in differentiated adult hepatocytes and complete absence in undifferentiated cells such as HepG2.
  • the top ranking functional category was “cholesterol biosynthesis” with a p-value of 1.6 ⁇ 10 ⁇ 11 and was found for gene transcripts down-regulated by antagomir-122.
  • the expression of at least 13 genes involved in cholesterol biosynthesis was decreased between 1.4 to 2,3-fold in antagomir-122 treated mice; some of these were confirmed by RT-PCR.
  • mice injected with an adenovirus expressing miR-122 (Ad-122) increased expression of some of these genes.
  • Hmgcr HMG-CoA-reductase
  • double stranded antagomirs were effective, six-week old female C57BL/6 mice were injected via the tail vein with 80 mg/kg/day on three consecutive days with either PBS, or compounds AP-3018, -3019, -3020 in a total volume of 0.2 ml. The liver was harvested 24 hrs after the last injection and total RNA was isolated using Trizol (Invitrogen). 10 ⁇ g of total RNA was run on formamide containing polyacrylamide gels, blotted and probed for miR-122 using a 32P-labeled antisense oligo. Two different autoradiography exposures are shown (see FIG. 12 ). Each lane represents an individual animal. Double stranded antagomirs were able to reduce mircoRNA levels.
  • antagomirs i.e., cholesterol conjugated RNAs
  • the synthesis started from a controlled-pore glass solid support carrying a cholesterol-hydroxyprolinol linker (Manoharan et al., U.S. Pat. Appl. Publ. 20050107325).
  • Antagomirs with phosphorothioate backbone at a given position were achieved by oxidation of phosphite with phenylacetyl disulfide (PADS) during oligonucleotide synthesis (Cheruvallath et al., Nucleosides Nucleotides 18:485-492, 1999).
  • PADS phenylacetyl disulfide
  • mice All animal models were maintained in C57B1/6J background on a 12 hours light/dark cycle in a pathogen-free animal facility at Rockefeller University. Six week old mice received, on one to three consecutive days, tail vein injections of saline or different RNAs. RNAs were administered at doses of 80 mg/kg body weight in 0.2 ml per injection. Measurements of miRNA levels in tissues were performed 24 h after the last injection unless indicated otherwise. Tissues were harvested, snap frozen and stored at ⁇ 80° C.
  • the recombinant adenovirus used to express miR-122 was generated by PCR, amplifying a 344 bp miRNA precursor sequence with primers 5′-AGTCAGATGTACAGTTATAAGCACAAGAGGACCAG-3′ (SEQ ID NO:42) and 5′-TTATTCAAGATCCCGGGGCTCTTCC-3′ (SEQ ID NO:43).
  • Ad5CMV-KnpA Ad-EGFP (ViraQuest, North Liberty, Iowa) was used as a control. Mice were infected with 1 ⁇ 10 9 pfu/mouse by tail vein injection.
  • RNA of mice treated with antagomirs or recombinant adenovirus was isolated three days after treatment. RNA was pooled from four animals for each group. The integrity of the RNA sample was assessed by denaturing formamide gel analysis.
  • First strand cDNA synthesis was completed with total RNA (30 ⁇ g) cleaned with RNAeasy columns (Qiagen, Valencia, Calif.) and the Superscript Choice cDNA synthesis protocol (Invitrogen, Carlsbad, Calif.), except and HPLC purified T7-promoter-dT30 primer (Proligo LLC, Boulder, Colo.) was used to initiate the first strand reaction.
  • Biotin labeled cRNA was synthesized from T7 cDNA using the RNA transcript labeling kit (Enzo Biochem, Farmingdale, N.Y.), supplemented with biotin 11-CTP and biotin-UTP (Enzo Biochem, Farmingdale, N.Y.) as specified by the Affymetrix protocol.
  • the sample was cleaned with an RNAeasy column (Qiagen, Valencia, Calif.) to remove free nucleotides and then quantitated spectrophotometrically.
  • Biotin-labeled cRNA was fragmented and hybridized to Mouse et 430 arrays (Affymetrix, Inc., Santa Clara, Calif.) according to the manufacturer's manual with a final concentration of fragmented cRNA of 0.05 ⁇ g/ ⁇ l.
  • the arrays were scanned using a Hewlett Packard confocal laser scanner and analyzed using ArrayAssist Lite and Affymetrix® Microarray Suite v.5 (MAS5) software.
  • RT-PCR Extraction of total RNA, synthesis of cDNA, and PCR were carried out as described in Shih et al. ( Proc. Natl. Acad. Sci. U.S.A. 99:3818-3823, 2002).
  • the mouse full length adolase-A 3′UTR was PCR-amplified using the following primers: 5′ d-(CCAGAGCTGAACTAAGGCTGCTCCA)-3′ (SEQ ID NO:44) and 5′ d-(CCCCTTAAATAGTTGTTTAT TGGCA)-3′ (SEQ ID NO:9) and cloned downstream of the stop codon in pRL-TK (Promega, Madison, Wis.).
  • HEK293 cells were cultured in 24-well plates and each transfected with 50 ng of pRL-TK (Rr-luc), 50 ng of pGL3 control vector (Pp-luc) (Promega, Madison, Wis.) and 200 ng of double-stranded siRNA (Dharmacon, Lafayette, Colo.). Cells were harvested and assayed 24-30 h post-transfection.
  • 3′ UTR sequences and mapping of array probes to transcripts were extracted mouse 3′ UTRs using the Refseq data set (Pruitt et al., Nucleic Acids Res. 33:D501-D504, 2005). 17264 3′ UTR sequences of at least 30 nucleotides in length were obtained. Affymetrix probe identifiers were assigned to the Refseq transcripts by using a mapping provided by Ensembl software (Hubbard et al., Nucleic Acids Res. 33 Database issue :D447-D453, 2005). When only one probe identifier mapped to a transcript, the significance call for a fold change and the fold change itself, as provided by the Affymetrix software, was taken at face value.
  • HMGR activity assay HMG-CoA reductase (HMGR) activity assay.
  • Hepatic microsomal HMGR activity was assayed by a method modified from a previously published procedure (Nguyen, et al., J. Clin. Invest. 86:923-931, 1990). Briefly, hepatic microsomal protein extracts were preincubated with an NADPH-generating system (3.4 mM NADP+/30 mM glucose 6-phosphate/0.3 units of glucose-6-phosphate dehydrogenase) in buffer (50 mM K 2 PHO4/70 mM KCl/10 mM DTT/30 mM EDTA, pH 7.4).
  • NADPH-generating system 3.4 mM NADP+/30 mM glucose 6-phosphate/0.3 units of glucose-6-phosphate dehydrogenase
  • the reaction was started with the addition of 15 ⁇ l 14 C-labeled substrate ([ 14 C]HMG CoA, (Amersham, Piscataway, N.J.)). The mixture was incubated for 15 min. and stopped with 15 ⁇ l 6 M HCl. [ 3 H]mevalonolactone and unlabeled mevalonolactone were added for recovery standard and product marker, respectively. After lactonization the products were extracted with ether and separated by TLC on Silica Gel 60 plates (VWR Scientific, West Chester, Pa.) with benzene/acetone (1:1, vol/vol) as the solvent system. The immediate product ( 14 C-labeled mevalonolactone) was quantitated by scintillation spectrometry.
  • Trizol® Reagent and Ethanol can be Used to Precipitate a miR-122/Antagomir-122 Duplex
  • duplex did precipitate in (i) 80% isopropanol, (ii) in 70% ethanol/0.5M NH 4 -Acetate, and (iii) in 70% ethanol/0.08M Na-acetate.
  • the duplex would not precipitate in 50% isopropanol, which follows the conventional Trizol® protocol.
  • Trizol® Did not Precipitate a miR/Antagomir Duplex in the Absence of Ethanol or Isopropanol
  • Liver tissue was homogenized in Trizol®, aliquoted into eppendorf tubes (1 ml volume each) and preformed duplex miR-122/antagomir-122 or miR-16/antagomir-16 was added. Samples were vortexed and left at room temperature for 10 minutes. 200 ml of chloroform were added and samples vortexed for 2 min at room temperature, followed by centrifugation at 13,200 rpm at room temperature for 15 minutes. 400 ml of the supernatant were added to 1 ml 100% ethanol and 40 ml 3 M sodium acetate, pH 5.2. After 30 min. at ⁇ 80° C. samples were centrifuged for 20 min. at 4° C.
  • liver/Trizol® homogenates were processed exactly as described, but 4 mg each of (i) miR-122, (ii) antagomir-122, (iii) anti122pS, or (iv) miR-122 (4 mg) and antagomir-122 (4 mg) together were added to the homogenates. After the incubation and precipitation steps, only miR-122 was isolated. This was the result whether miR-122 alone was added to the homogenate, or whether miR-122 was added in combination with antagomir-122.
  • Trizol® precipitation protocol total liver RNA was isolated (using the protocol), and then the RNA was dissolved in water. 40 mg of the isolated RNA were incubated in a total volume of 50 ml water with the increasing amounts of antagomir-122 for 5 min. at 65° C. followed by 2 h at 37° C. and 30 min. at room temperature. The amounts of antagomir-122 tested were 6.4 pg, 320 pg, 16 ng, 0.8 ⁇ g, 40 ⁇ g, and 120 ⁇ g. 1 ml of Trizol® was added to the samples and Trizol® extraction was performed again as described above. The precipitates were dissolved in 60 ml water, and then 30 ml of each sample was separated on 14% polyacrylamide gels with or without 20% formamide. miR-122 was then detected using Northern blotting.
  • the miR-122 was precipitated and detected by gel electrophoresis in the presence of formamide regardless of the amount of antagomir-122 added to the precipitation mix.
  • 40 ⁇ g or 120 ⁇ g were used in the precipitation mix, a duplex between miR-122 and antagomir was visible when analyzed on a sequencing gel. Minor amounts of antagomir were always retrieved by the Trizol® protocol.
  • miR-122 was detected using Northern blotting, then the membrane was re-probed against antagomir-122, which detected the presence of the antagomir-122. Incubation with antagomir-122 did not alter the miR-122 signal detected on the gel.
  • mice were administered 80 mg/kg/day antagomir-122 or a scrambled control (mm-antagmir122) via tail-vein on three separate days. Livers were harvested at days 3, 6, 9, 13, and 23 post-injection, and subjected to Trizol® isolation as described above. Approximately 50 mg liver were homogenized in 1 ml Trizol®. Analysis by Northern blot indicated that antagomir-122 could be detected for at least 23 days post-injection.
  • 100 mg liver were sonicated in 2 ml T+C (Epicentre®, Madison, Wis.) in the presence of 350 mg proteinase K.
  • 100 ml of the homogenate was supplemented with either miR-122/antagomir-122 duplexes (8 mg per lane), miR-122 (4 mg per lane) or antagomir-122 (4 mg per lane).
  • 200 ml 1 ⁇ STE-buffer was added, then 200 ml of phenol, pH 4 or pH 8. Samples were vortexed for 30 sec and left on ice for 2 min.
  • miR-122/antagomir-122 duplexes and miR-122 were detected by ethidium bromide staining.
  • the duplexes and miR-122 were successfully isolated with phenol at pH4 and at pH 8.
  • Antagomir-122 Caused a Decrease in miR-122 Levels In Vivo
  • mice were administered PBS, mm-antagomir-122 or antagomir-122 (80 mg/kg/day) via tail-vein injection for 3 subsequent days. Livers were harvested 24 hrs after the last injection and ⁇ 20 mg of tissue was sonicated in 1 ml T+C (Epicentre®, Madison, Wis.) and proteinase K and processed as described in example 4. Precipitated RNA was dissolved in water and analyzed on 14% polyacrylamide gels that contained 20% formamide. Northern blotting was performed for miR-122 and let7 miRNAs.
  • mice injected with antagomir-122 revealed a striking decrease in the amount of miR-122 isolated from liver, as compared to mice injected with PBS or mm-antagomir-122 ( FIG. 4 ).
  • the level of let7 miRNA isolated from liver was similar in the three test groups.
  • mice were administered PBS, mm-antagomir-122 or antagomir-122 (80 mg/kg/day) via tail-vein injection for 3 subsequent days. Livers were then harvested 72 h, 10 days or 27 days after the last injection. Tissues were processed as described in example 4, and Northern blot analysis revealed a marked reduction of miR-122 in the antagomir-treated mice, even 27 days post-injection. As a further note, the Northern blot analysis revealed an RNA of higher molecular weight specifically detected by the miR-122 probe. This molecule is most likely an miR-122 precursor.
  • Phosphate buffered saline (PBS) injected mice (3 ⁇ 0.2 ml) served as controls.
  • Mice were sacrificed on day 4 and total RNA was extracted from livers for Northern blotting.
  • Mir-122 expression was analyzed following Northern blotting using a 32 P-labeled oligonucleotide with complementary sequence to miR-122.
  • Expression levels of aldolase A, a validated target gene of miR-122 were analyzed by RT-PCR.
  • Gapdh served as a loading control
  • Gapdh-RT indicates the absence of reverse transcriptase as a control for DNA contamination.
  • results demonstrate that reduction of miR-122 can be achieved at a dose of 3 ⁇ 20 mg/kg bodyweight. A >90% reduction in miR-122 levels is required to detect a significant increase in aldolaseA expression ( FIG. 13 ).
  • results demonstrate that an additional nucleotide at both 3′ and 5′ ends of antagomir-122 (25-mer), or a deletion at either end (21-mer) has no effect of the ability of antagomirs to silence miR-122. Further shortening of antagomirs (19- and 17-mers) result in a loss of antagomir activity ( FIG. 15 ).
  • Antagomir-122 (23-mer) oA*oC*oAoAoAoCoAoCoCoAoUoUoGoUoCoAo (SEQ ID NO:5) CoAoCoU*oC*oC*oA*-CHOL 25-mer: oC*oA*oCoAoAoAoCoAoCoCoAoUoUoGoUoCo (SEQ ID NO:31) AoCoAoCoUoC*oC*oA*oC*-CHOL 21-mer: oC*oA*oAoCoAoCoCoAoUoUoGoUoCoAoCo (SEQ ID NO:32) AoC*oU*oC*oC*-CHOL 19-mer: oA*oA*oCoAoCoCoAoUoUoGoUoCoAoCo (SEQ ID NO:33) A*oC*oU*oC*-CHOL 17-mer: oA*oA*o
  • oligonucleotides were synthesized on an AKTAoligopilot synthesizer or on an ABI 394 DNA/RNA synthesizer.
  • Commercially available controlled pore glass solid supports rU-CPG, 2′-O-methly modified rA-CPG and 2′-O-methyl modified rG-CPG from Prime Synthesis
  • the in-house synthesized solid support hydroxyprolinol-cholesterol-CPG were used for the synthesis.
  • RNA phosphoramidites and 2′-O-methyl modified RNA phosphoramidites with standard protecting groups (5′-O-dimethoxytrityl-N-6-benzoyl-2′-t-butyldimethylsilyl-adenosine-3′-O—N,N′-diisopropyl-2-cyanoethylphosphoramidite, 5′-O-dimethoxytrityl-N4-acetyl-2′-t-butyldimethylsilyl-cytidine-3′-O—N,N′-diisopropyl-2-cyanoethylphosphoramidite, 5′-O-dimethoxytrityl-N2-isobutryl-2′-t-butyldimethylsilyl-guanosine-3′-O—N,N′-diisopropyl-2-cyanoethylphosphoramidite, 5′-O-dimethoxytrityl-2′-
  • the Quasar 570 phosphoramidite was obtained from Biosearch Technologies.
  • the 5′-O-dimethoxytrityl-2′-t-butyldimethylsilyl-inosine-3′-O—N,N′-diisopropyl-2-cyanoethylphosphoramidite was obtained from ChemGenes Research.
  • All phosphoramidites were used at a concentration of 0.2 M in CH 3 CN except for guanosine and 2′-O-methyl-uridine, which were used at 0.2 M concentration in 10% THF/CH 3 CN (v/v).
  • Coupling/recycling time of 16 minutes was used for all phosphoramidite couplings.
  • the activator was 5-ethyl-thio-tetrazole (0.75 M, American International Chemicals).
  • 50 mM iodine in water/pyridine (10:90 v/v) was used and for the PS-oxidation 2% PADS (GL Synthesis) in 2,6-lutidine/CH 3 CN (1:1 v/v) was used.
  • Quasar 570 phosphoramidite Coupling of the Quasar 570 phosphoramidite was carried out on the ABI DNA/RNA synthesizer.
  • the Quasar 570 phosphoramidite was used at a concentration of 0.1M in CH 3 CN with a coupling time of 10 mins.
  • the activator was 5-ethyl-thio-tetrazole (0.25 M, Glen Research) and 0.1M DDTT (AM Chemicals) in pyridine was used for PS oxidation.
  • the support was transferred to a 100 mL glass bottle (VWR).
  • the oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 40 mL of a 40% aq. methyl amine (Aldrich) 90 mins at 45° C.
  • the bottle was cooled briefly on ice and then the methylamine was filtered into a new 500 mL bottle.
  • the CPG washed three times with 40 mL portions of DMSO. The mixture was then cooled on dry ice.
  • the support was transferred to a 15 mL tube (VWR).
  • the oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 7 mL of a 40% aq. methyl amine (Aldrich) 15 mins at 65° C.
  • the bottle was cooled briefly on ice and then the methylamine was filtered into a 100 mL bottle (VWR).
  • the CPG washed three times with 7 mL portions of DMSO. The mixture was then cooled on dry ice.
  • the unconjugated crude oligonucleotides were first analyzed by HPLC (Dionex PA 100).
  • the buffers were 20 mM phosphate, pH 11 (buffer A); and 20 mM phosphate, 1.8 M NaBr, pH 11 (buffer B).
  • the flow rate 1.0 mL/min and monitored wavelength was 260-280 nm. Injections of 5-15 ⁇ L were done for each sample.
  • the unconjugated samples were purified by HPLC on a TSK-Gel SuperQ-5PW (20) column packed in house (17.3 ⁇ 5 cm) or on a commercially available TSK-Gel SuperQ-5PW column (15 ⁇ 0.215 cm) available from TOSOH Bioscience.
  • the buffers were 20 mM phosphate in 10% CH 3 CN, pH 8.5 (buffer A) and 20 mM phosphate, 1.0 M NaBr in 10% CH 3 CN, pH 8.5 (buffer B).
  • the flow rate was 50.0 mL/min for the in house packed column and 10.0 ml/min for the commercially obtained column. Wavelengths of 260 and 294 nm were monitored.
  • the fractions containing the full-length oligonucleotides were pooled together, evaporated, and reconstituted to ⁇ 100 mL with deionised water.
  • the cholesterol-conjugated crude oligonucleotides were first analyzed by LC/MS to determine purity.
  • the cholesterol conjugated sequences were HPLC purified on RPC-Source15 reverse-phase columns packed in house (17.3 ⁇ 5 cm or 15 ⁇ 2 cm).
  • the buffers were 20 mM NaOAc in 10% CH 3 CN (buffer A) and 20 mM NaOAc in 70% CH 3 CN (buffer B).
  • the flow rate was 50.0 mL/min for the 17.3 ⁇ 5 cm column and 12.0 ml/min for the 15 ⁇ 2 cm column. Wavelengths of 260 and 284 nm were monitored.
  • the fractions containing the full-length oligonucleotides were pooled, evaporated, and reconstituted to 100 mL with deionised water.
  • the purified oligonucleotides were desalted on either an AKTA Explorer or an AKTA Prime system (Amersham Biosciences) using a Sephadex G-25 column packed in house. First, the column washed with water at a flow rate of 40 mL/min for 20-30 min. The sample was then applied in 40-60 mL fractions. The eluted salt-free fractions were combined, dried, and reconstituted in ⁇ 50 mL of RNase free water.
  • Step 6 Purity Analysis by Capillary Gel Electrophoresis (CGE), Ion-Exchange HPLC (IEX), and Electrospray LC/Ms
  • Approximately 0.3 OD of each of the desalted oligonucleotides were diluted in water to 300 ⁇ L and were analyzed by CGE, ion exchange HPLC, and LC/MS.
  • RNA strands were mixed together. The mixtures were frozen at ⁇ 80° C. and dried under vacuum on a speed vac. Dried samples were then dissolved in 1 ⁇ PBS to a final concentration of 40 mg/ml. The dissolved samples were heated to 95° C. for 5 min and slowly cooled to room temperature.
  • the strands are shown written 5′ to 3′. Lower case “s” indicates a phosphorothioate linkage. “Chol-” indicates a hydroxyprolinol cholesterol conjugate. Subscript “OMe” indicates a 2′-O-methyl sugar. “I” is ribo-Inosine nucleoside. Purity was determined by CGE except for the where indicated by (*), in these cases purity was determined by anion-exchange HPLC.
  • Double stranded oligonucleotides to modulate microRNAs AL-DP # Strand 1 Strand 2 Target 3018 AL-SQ-3035 AL-SQ-3037 miR-122A 3019 AL-SQ-3035 AL-SQ-3038 miR-122A 3020 AL-SQ-3036 AL-SQ-3039 miR-122A 3021 AL-SQ-3036 AL-SQ-3040 miR-122A
  • antagomirs that have optimized phosphorothioate modification and are preferably greater than 19 nucleotides in length exhibit the highest biological efficiency, and can discriminate between single nucleotide mismatches of the targeted miRNA.
  • RNAi RNA interference
  • antagomirs are incapable of silencing miRNAs in the central nervous system (CNS) when injected systemically, the antagomirs efficiently targeted miRNAs in the CNS when injected locally into the mouse cortex.
  • CNS central nervous system
  • RNAs and modified RNA analogs were synthesized as previously elsewhere herein.
  • the oligonucleotides used in this study are listed in Table 7 and a schematic representation of the chemical modifications is shown in FIG. 16 .
  • Quasar-570 (Q570) phosphoramidite from Biosearch Technologies was coupled to the 5′-terminal under standard solid phase phosphoramidite synthesis conditions to obtain fluorophore tagged antagomir 122 and mm-antagomir-122.
  • Extended 15 minute coupling of quasar-570 phosphoramidite was carried out at a concentration of 0.1M in CH 3 CN in the presence of 5-(ethylthio)-1H-tetrazole activator followed by standard capping, oxidation and deprotection afforded labeled oligonucleotides.
  • the Q570 conjugated sequences were HPLC purified on an in-house packed RPC-Source15 reverse-phase column.
  • the buffers were 20 mM NaOAc in 10% CH 3 CN (buffer A) and 20 mM NaOAc in 70% CH 3 CN (buffer B). Fractions containing full-length oligonucleotides were pooled and desalted.
  • Analytical HPLC, CGE and ES LC-MS established the integrity of the compounds.
  • equal molar mounts of miR-122 and antagomir were heated in 1 ⁇ PBS at 95° C. for 5 minutes and slowly cooled to room temperature.
  • mice All animals were maintained in a C57B1/6J background on a 12 hour light/dark cycle in a pathogen-free animal facility at Rockefeller University. Six-week-old mice received on three consecutive days tail vein injections of saline or different RNAs in 0.2 ml per injection at normal pressure. Liver tissue was harvested 24 hours after the last injection or as otherwise indicated.
  • mice were anaesthetized and antagomir-16 was injected into the left frontal cortex ( ⁇ 800 ng). Injections of equal volume PBS into the contralateral area of the right hemisphere served as controls. After 72 hours, mice were sacrificed, blood was removed through systemic perfusion of the left ventricle with PBS and a ⁇ 0.4 cm 3 area surrounding the injection site was excised from the cortex for analysis.
  • mice were perfused with ice-cold PBS through the left ventricle and ⁇ 100 mg liver tissue excised. Cells were fractionated on continuous sucrose density gradients from 0.4-2M. Fractions were separated on 14% PAGE containing 8M urea and 20% formamide. Concentration of 5′-Q570-labeled antagomir in liver fractions was measured using an fmax spectrophotometer from Molecular devices.
  • mice were anesthetized and perfused through the left ventricle with 2% paraformaldehyde. Livers were incubated overnight at 4° C. in 4% paraformaldehyde, followed by a 16 hour incubation period in 30% sucrose/PBS (v/v). Frozen sections (7 ⁇ m) were mounted on glass slides and analyzed using a laser-scanning microscope.
  • Results are given as means ⁇ standard errors. Statistical analysis was performed with Student's t-test, and the null hypothesis was rejected at the 0.05 level. Results are typically presented as means ⁇ standard errors.
  • the antagomir-122 chemistry includes 6 phosphorothioate backbone modifications. Two phosphorothioates are located at the 5′-end and four at the 3′-end. The following experiment was designed to test whether the number of phosphorothioates is critical for the ability of antagomir-122 to silence miR-122.
  • Four different antagomir-122 molecules that only differ in the number of phosphorothioate modification (P ⁇ S) were compared. Injection of antagomir-122 at 3 ⁇ 20 mg/kg bw with no P ⁇ S into mice did not influence miR-122 levels in the liver ( FIG. 17A ).
  • 25mer antagomir Without wishing to be bound by any particular theory, it is believed that the tendency for improved activity of 25mer antagomir can be explained on the basis of improved thermodynamic binding affinity of the 25mer, which should also have higher biostability from exonucleases for the core 23mer.
  • miR-122 levels as well as mRNA levels of endogenous miR-122 targets were analyzed.
  • Northern blots show that optimal reduction of miR-122 levels is achieved at antagomir concentrations between 3 ⁇ 40 and 3 ⁇ 80 mg/kg bw ( FIG. 18A ).
  • the expression of miR-122 targets correlated with the reduction of miR-122 levels in Northern blots and showed highest upregulation at antagomir concentrations between 3 ⁇ 40 and 3 ⁇ 80 mg/kg bw ( FIG. 18A ).
  • antagomir chemistry enables discrimination of a single nucleotide. This effect depends on the position of the mismatch within the antagomir sequence. It has been observed that nucleotide exchanges at the very 5′-end of the antagomir or in the center did not prevent downregulation of miR-122 levels in Northern blots and upregulation of miR-122 targets. Without wishing to be bound by any particular theory, it appears that asymmetry of a single nucleotide mismatch may therefore be more detrimental for targeting miRNAs than symmetric changes. These data are important for the design of antagomirs that target specific members of miRNA families or when off-target effects are being considered.
  • RNA-induced silencing complex RISC
  • the siRNA duplex of passenger strand and guide strand is integrated into the RISC complex and the argonaute-2 (Ago2) protein subsequently cleaves the passenger strand across from the guide strand's phosphate bond between position 10 and 11 (Rand, et al., 2005 Cell, 123:621-9, and Matranga, et al., 2005 Cell 123:607-20).
  • miRNA/antagomir-duplexes were injected into mice that harbored a 2′-O-methyl endonuclease protection of the microRNA corresponding to nucleotide 10 and 11 of the antagomir.
  • endonuclease protection between nucleotides 10 and 11 did not prevent the degradation of the miRNA as demonstrated by abundant miRNA fragments in Northern analysis, nor did it prevent the upregulation of miR-122 targets.
  • Ago2-mediated cleavage is unlikely to mediate this process.
  • Similar results were obtained when the miRNA was protected at the outside positions using phosphorothioates, indicating that the miRNA targeting does not dependent on exonuclease activity either.
  • the fact that miRNA/antagomir-duplexes regulated miRNA targets suggests antagomir recycling. The appearance of miRNA fragments of decreased length also suggests that degradation is involved in this recycling process.
  • fluorophore labeled antagomirs were engineered. Fluorophore labeling of siRNA has previously been used to evaluate cellular uptake of siRNA (Grunweller, et al., 2003 Oligonucleotides, 13:345-52, and Lingor, et al., 2005 Brain 128:550-8). Q570-labeled antagomirs were cleared from the plasma at a t 1/2 of approximately 30 minutes, which is considerably faster than the plasma-clearance of cholesterol-conjugated siRNA of about 90 minutes (Soutschek, et al., 2004 Nature 432:173-8).
  • antagomir localization within hepatocytes was strictly limited to the cytosol. Without wishing to be bound by any particular theory, it is believed that antagomir localization to the cytosol explains why antagomirs did not influence steady-state levels of the nuclear precursors of miRNAs (Krutzfeldt, et al., 2005 Nature 438:685-9).
  • Phosphorothioate modifications provide protection against RNase activity and their lipophilicity contributes to enhanced tissue uptake. Phosphorothioates also decrease the melting temperature of RNA duplexes (Davis, et al., 2006 Nucleic Acids Res 34:2294-304) and have been shown to be general inhibitors of cellular RNAse activity (Crooke, et al., 2000 J Pharmacol Exp Ther 292:140-9).
  • the results presented herein indicate a critical balance of the number of phosphorothioates within the antagomir chemistry. While a significant number of phosphorothioates increases efficiency, complete phosphorothioate modification decreased efficiency. For example, it was demonstrated that antagomirs require >19 nucleotides length for optimal function.
  • results presented herein demonstrate that antagomirs can efficiently decrease miR-16 levels in mouse brain when injected locally.
  • Systemic infusions of antagomir-16 do not result in an observable change in the brain levels of miR-16. This is because it is believed that antagomir-16 does not have the ability to cross the blood-brain barrier.
  • Local injections of small amounts of antagomir-16 efficiently reduced expression of this miR-16 in the cortex. This inhibition was specific since the expression of other miRNAs was not affected and no alteration in miR-16 levels were measured in the contra-lateral hemisphere that was injected with PBS.
  • miRNA function in vivo Typically, gene expression profiling, bioinformatics analysis, metabolic profiling, and biochemical target validation is performed. Using methods discussed elsewhere herein, miR-122 was observed to regulate levels of many target genes ( FIG. 23 ). Moreover, miR-122 was observed to regulate the expression of cholesterol biosynthesis genes ( FIG. 24 ). Based on the genes observed to be regulated by miR-122, metabolic parameters of antagomir-122 treated mice were evaluated. The results demonstrated that mice treated with antagomir-122 exhibited a decreased levels of at least cholesterol as compared with mice treated with mm-antagomir ( FIG. 25 ). The results presented herein characterize the inhibition of miRNAs with antagomirs in vivo and their therapeutic use with respect to cholesterol levels.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
US11/657,341 2005-08-10 2007-01-24 Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof Abandoned US20070213292A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US11/657,341 US20070213292A1 (en) 2005-08-10 2007-01-24 Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
PCT/US2008/001027 WO2008091703A2 (fr) 2007-01-24 2008-01-24 Oligonucléotides chimiquement modifiés utilisés pour une modulation de micro-arn ainsi que leurs utilisations
US12/714,863 US8541385B2 (en) 2005-08-10 2010-03-01 Chemically modified oligonucleotides for use in modulation micro RNA and uses thereof
US14/011,387 US20140073684A1 (en) 2005-08-10 2013-08-27 Chemically modified oligonucleotides for use in modulating micro rna and uses thereof

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US70686605P 2005-08-10 2005-08-10
US73155405P 2005-10-28 2005-10-28
US76320106P 2006-01-26 2006-01-26
US11/502,158 US20070123482A1 (en) 2005-08-10 2006-08-10 Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
US11/657,341 US20070213292A1 (en) 2005-08-10 2007-01-24 Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US11/502,158 Continuation-In-Part US20070123482A1 (en) 2005-08-10 2006-08-10 Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/714,863 Continuation US8541385B2 (en) 2005-08-10 2010-03-01 Chemically modified oligonucleotides for use in modulation micro RNA and uses thereof

Publications (1)

Publication Number Publication Date
US20070213292A1 true US20070213292A1 (en) 2007-09-13

Family

ID=39645514

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/657,341 Abandoned US20070213292A1 (en) 2005-08-10 2007-01-24 Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
US12/714,863 Active 2027-07-20 US8541385B2 (en) 2005-08-10 2010-03-01 Chemically modified oligonucleotides for use in modulation micro RNA and uses thereof
US14/011,387 Abandoned US20140073684A1 (en) 2005-08-10 2013-08-27 Chemically modified oligonucleotides for use in modulating micro rna and uses thereof

Family Applications After (2)

Application Number Title Priority Date Filing Date
US12/714,863 Active 2027-07-20 US8541385B2 (en) 2005-08-10 2010-03-01 Chemically modified oligonucleotides for use in modulation micro RNA and uses thereof
US14/011,387 Abandoned US20140073684A1 (en) 2005-08-10 2013-08-27 Chemically modified oligonucleotides for use in modulating micro rna and uses thereof

Country Status (2)

Country Link
US (3) US20070213292A1 (fr)
WO (1) WO2008091703A2 (fr)

Cited By (154)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050227256A1 (en) * 2003-11-26 2005-10-13 Gyorgy Hutvagner Sequence-specific inhibition of small RNA function
US20080171715A1 (en) * 2004-11-12 2008-07-17 David Brown Methods and compositions involving mirna and mirna inhibitor molecules
US20090017124A1 (en) * 2007-04-17 2009-01-15 Baxter International Inc. Nucleic Acid Microparticles for Pulmonary Delivery
US20090163435A1 (en) * 2006-09-19 2009-06-25 Bader Andreas G miR-200 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
WO2009091982A1 (fr) * 2008-01-18 2009-07-23 Alnylam Pharmaceuticals, Inc. Agoniste de mir-22
WO2009149182A1 (fr) 2008-06-04 2009-12-10 The Board Of Regents Of The University Of Texas System Modulation de l'expression génique par ciblage d'un petit arn endogène de promoteurs de gènes
WO2009108856A3 (fr) * 2008-02-28 2010-01-14 The Ohio State University Research Foundation Signatures de microarn associées à la leucémie lymphoïde chronique humaine (llc) et leurs utilisations
WO2010065961A2 (fr) 2008-12-05 2010-06-10 Whitehead Institute For Biomedical Research Compositions et procédés concernant le mir-31
WO2010065662A3 (fr) * 2008-12-04 2010-09-30 Curna, Inc. Traitement de maladies liées à sirtuine 1 (sirt1) par inhibition d'un transcrit antisens naturel de sirtuine 1
WO2010065671A3 (fr) * 2008-12-04 2010-09-30 Curna, Inc. Traitement de maladies apparentées au facteur de croissance de l'endothélium vasculaire (vegf) par inhibition de la transcription antisens naturelle en vegf
WO2010065787A3 (fr) * 2008-12-04 2010-10-14 Curna, Inc. Traitement de maladies liées à un gène suppresseur de tumeur par inhibition d'un transcrit antisens naturel du gène
WO2010124231A2 (fr) 2009-04-24 2010-10-28 The Board Of Regents Of The University Of Texas System Modulation de l'expression d'un gène au moyen d'oligomères ciblant les séquences géniques situées en aval des séquences 3' non traduites
WO2010126551A1 (fr) 2009-04-30 2010-11-04 Immunogen, Inc. Conjugués puissants et séquences de liaison hydrophiles
US20100317713A1 (en) * 2007-11-09 2010-12-16 Eric Olson Micro-rnas of the mir-15 family modulate cardiomyocyte survival and cardiac repair
WO2010107733A3 (fr) * 2009-03-16 2011-01-13 Curna, Inc. Traitement de maladies associées au facteur nucléaire 2 similaire au dérivé d'érythroïde 2 (nrf2) par inhibition de produit de transcription antisens naturel pour nrf2
WO2010107740A3 (fr) * 2009-03-17 2011-01-13 Curna, Inc. Traitement des maladies associées à l'homologue du delta-like 1 (dlk1) par inhibition du transcrit antisens naturel de dlk1
US20110034538A1 (en) * 2008-02-28 2011-02-10 The Ohio State University Research Foundation MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Gastric Cancer
WO2011017697A1 (fr) 2009-08-07 2011-02-10 New York University Compositions et méthodes pour traiter des troubles inflammatoires
US7888010B2 (en) 2004-05-28 2011-02-15 Asuragen, Inc. Methods and compositions involving microRNA
US20110071211A1 (en) * 2008-02-27 2011-03-24 Julius Maximilians-Universität Würzburg MicroRNA (miRNA) And Downstream Targets For Diagnostic And Therapeutic Purposes
WO2011035065A1 (fr) 2009-09-17 2011-03-24 Nektar Therapeutics Chitosanes monoconjugués en tant qu'agents de distribution pour de petits acides nucléiques interférents
US20110105585A1 (en) * 2009-04-23 2011-05-05 Northwestern University METHODS FOR DIAGNOSING AND TREATING SQUAMOUS CELL CARCINOMA UTILIZING miRNA-205 AND INHIBITORS THEREOF
WO2011053994A1 (fr) 2009-11-02 2011-05-05 Alnylam Pharmaceuticals, Inc. Modulation de l'expression du récepteur ldl avec des arn double brin ciblant le promoteur du gène du récepteur ldl
US7943318B2 (en) 2006-01-05 2011-05-17 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
WO2011075656A1 (fr) 2009-12-18 2011-06-23 The University Of British Columbia Procédés et compositions pour l'administration d'acides nucléiques
WO2011011700A3 (fr) * 2009-07-24 2011-06-23 Curna, Inc. Traitement des maladies associées à une sirtuine (sirt) par inhibition du produit de transcription anti-sens naturel chez une sirtuine (sirt)
US7985584B2 (en) 2006-03-20 2011-07-26 The Ohio State University Research Foundation MicroRNA fingerprints during human megakaryocytopoiesis
WO2011100403A1 (fr) 2010-02-10 2011-08-18 Immunogen, Inc Anticorps anti-cd20 et utilisations de ceux-ci
US20110213013A1 (en) * 2008-08-19 2011-09-01 Nektar Therapeutics Complexes of Small-Interfering Nucleic Acids
US8034560B2 (en) 2007-01-31 2011-10-11 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia (AML)
US8053186B2 (en) 2007-06-15 2011-11-08 The Ohio State University Research Foundation Oncogenic ALL-1 fusion proteins for targeting Drosha-mediated microRNA processing
WO2011139387A1 (fr) * 2010-05-03 2011-11-10 Opko Curna, Llc Traitement de maladies liées à une sirtuine (sirt) par inhibition de la transcription antisens naturelle pour donner une sirtuine (sirt)
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
US8071292B2 (en) 2006-09-19 2011-12-06 The Ohio State University Research Foundation Leukemia diagnostic methods
US8084199B2 (en) 2006-07-13 2011-12-27 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using microRNA-21
WO2012016184A2 (fr) 2010-07-30 2012-02-02 Alnylam Pharmaceuticals, Inc. Procédés et compositions pour la délivrance d'agents actifs
WO2012016188A2 (fr) 2010-07-30 2012-02-02 Alnylam Pharmaceuticals, Inc. Procédés et compositions pour l'administration d'agents actifs
WO2012019024A2 (fr) 2010-08-04 2012-02-09 Immunogen, Inc. Molécules se liant à her3 et leurs immunoconjugués
US8148069B2 (en) 2006-01-05 2012-04-03 The Ohio State University MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers
US8153606B2 (en) 2008-10-03 2012-04-10 Opko Curna, Llc Treatment of apolipoprotein-A1 related diseases by inhibition of natural antisense transcript to apolipoprotein-A1
WO2012099755A1 (fr) 2011-01-11 2012-07-26 Alnylam Pharmaceuticals, Inc. Lipides pégylés et leur utilisation pour une administration de médicament
US8252538B2 (en) 2006-11-01 2012-08-28 The Ohio State University MicroRNA expression signature for predicting survival and metastases in hepatocellular carcinoma
US8258111B2 (en) 2008-05-08 2012-09-04 The Johns Hopkins University Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8288354B2 (en) 2005-12-28 2012-10-16 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
WO2013003112A1 (fr) 2011-06-27 2013-01-03 The Jackson Laboratory Procédés et compositions pour le traitement du cancer et d'une maladie auto-immune
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US8367632B2 (en) 2007-07-31 2013-02-05 Ohio State University Research Foundation Methods for reverting methylation by targeting methyltransferases
US8389210B2 (en) 2006-01-05 2013-03-05 The Ohio State University Research Foundation MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors
EP2568046A1 (fr) 2011-09-06 2013-03-13 Centre National de la Recherche Scientifique (C.N.R.S) Micro ARN de l'herpèsvirus humain type 6
WO2013049328A1 (fr) 2011-09-27 2013-04-04 Alnylam Pharmaceuticals, Inc. Lipides di-aliphatiques pegylés substitués
US8465918B2 (en) 2007-08-03 2013-06-18 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US8466119B2 (en) 2007-08-22 2013-06-18 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of EPHA7 and ERK phosphorylation in human acute leukemias
US8465917B2 (en) 2007-06-08 2013-06-18 The Ohio State University Research Foundation Methods for determining heptocellular carcinoma subtype and detecting hepatic cancer stem cells
US8481505B2 (en) 2005-09-12 2013-07-09 The Ohio State University Research Foundation Compositions and methods for the diagnosis and therapy of BCL2-associated cancers
WO2013142114A1 (fr) 2012-03-19 2013-09-26 The Brigham And Women's Hosptial, Inc. Facteur de différenciation de croissance (gdf) destiné au traitement d'insuffisance cardiaque diastolique
US20130296402A1 (en) * 2010-11-05 2013-11-07 Miragen Therapeutics Base modified oligonucleotides
US8658370B2 (en) 2005-08-01 2014-02-25 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
US8664192B2 (en) 2011-03-07 2014-03-04 The Ohio State University Mutator activity induced by microRNA-155 (miR-155) links inflammation and cancer
US20140080894A1 (en) * 2011-03-02 2014-03-20 David L. McElligott Enhanced biodistribution of oligomers
US8790649B2 (en) 2010-10-29 2014-07-29 Immunogen, Inc. EGFR-binding molecules and immunoconjugates thereof
US8791085B2 (en) 2009-05-28 2014-07-29 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US8791087B2 (en) 2009-08-21 2014-07-29 Curna, Inc. Treatment of ‘C terminus of HSP70-interacting protein’ (CHIP)related diseases by inhibition of natural antisense transcript to CHIP
US8859202B2 (en) 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US8859515B2 (en) 2009-06-24 2014-10-14 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
WO2014168973A2 (fr) 2013-04-08 2014-10-16 President And Fellows Of Harvard College Procédés et compositions pour rajeunir des cellules souches de muscle squelettique
US8871737B2 (en) 2010-09-22 2014-10-28 Alios Biopharma, Inc. Substituted nucleotide analogs
US8895528B2 (en) 2010-05-26 2014-11-25 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US8895527B2 (en) 2009-05-22 2014-11-25 Curna, Inc. Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2(IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US8911998B2 (en) 2007-10-26 2014-12-16 The Ohio State University Methods for identifying fragile histidine triad (FHIT) interaction and uses thereof
US8912157B2 (en) 2010-01-06 2014-12-16 Curna, Inc. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
WO2014201143A1 (fr) 2013-06-11 2014-12-18 President And Fellows Of Harvard College Procédés et compositions pour augmenter la neurogenèse et l'angiogenèse
US8916533B2 (en) 2009-11-23 2014-12-23 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
US8916538B2 (en) 2012-03-21 2014-12-23 Vertex Pharmaceuticals Incorporated Solid forms of a thiophosphoramidate nucleotide prodrug
US8921329B2 (en) 2008-12-04 2014-12-30 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US8921330B2 (en) 2009-06-26 2014-12-30 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US8921334B2 (en) 2009-12-29 2014-12-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
WO2015006740A2 (fr) 2013-07-11 2015-01-15 Alnylam Pharmaceuticals, Inc. Conjugués ligands d'oligonucléotides et procédé pour leur préparation
US8940708B2 (en) 2009-12-23 2015-01-27 Curna, Inc. Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US8946182B2 (en) 2010-01-25 2015-02-03 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
US8946181B2 (en) 2010-01-04 2015-02-03 Curna, Inc. Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US8951981B2 (en) 2009-06-16 2015-02-10 Curna, Inc. Treatment of paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US8957037B2 (en) 2009-05-18 2015-02-17 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
WO2015023503A2 (fr) 2013-08-14 2015-02-19 Primeradx, Inc. Compositions et méthodes pour l'analyse multimodale d'acides nucléiques cmet
WO2015023433A1 (fr) 2013-08-14 2015-02-19 Primeradx, Inc. Compositions et procédés d'analyse multiplex d'acides nucléiques nras et braf
US8962586B2 (en) 2010-02-22 2015-02-24 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
US8962585B2 (en) 2009-12-29 2015-02-24 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US8980858B2 (en) 2010-05-26 2015-03-17 Curna, Inc. Treatment of methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
US8980857B2 (en) 2010-05-14 2015-03-17 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US8980865B2 (en) 2011-12-22 2015-03-17 Alios Biopharma, Inc. Substituted nucleotide analogs
US8980856B2 (en) 2010-04-02 2015-03-17 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US8980860B2 (en) 2010-07-14 2015-03-17 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US8987225B2 (en) 2010-11-23 2015-03-24 Curna, Inc. Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
US8993533B2 (en) 2010-10-06 2015-03-31 Curna, Inc. Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
US9012139B2 (en) 2009-05-08 2015-04-21 Curna, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US9012427B2 (en) 2012-03-22 2015-04-21 Alios Biopharma, Inc. Pharmaceutical combinations comprising a thionucleotide analog
US9023822B2 (en) 2009-08-25 2015-05-05 Curna, Inc. Treatment of 'IQ motif containing GTPase activating protein' (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US9044494B2 (en) 2010-04-09 2015-06-02 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9044493B2 (en) 2009-08-11 2015-06-02 Curna, Inc. Treatment of Adiponectin related diseases by inhibition of natural antisense transcript to an Adiponectin
US9057068B1 (en) * 2012-04-01 2015-06-16 The Ohio State University Methods and compositions using miR-3151 in the diagnosis and treatment of cancer
US9068183B2 (en) 2009-12-23 2015-06-30 Curna, Inc. Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
US9074210B2 (en) 2009-02-12 2015-07-07 Curna, Inc. Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US9125923B2 (en) 2008-06-11 2015-09-08 The Ohio State University Use of MiR-26 family as a predictive marker for hepatocellular carcinoma and responsiveness to therapy
US9155754B2 (en) 2009-05-06 2015-10-13 Curna, Inc. Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1
US9163235B2 (en) 2012-06-21 2015-10-20 MiRagen Therapeutics, Inc. Inhibitors of the miR-15 family of micro-RNAs
US9163285B2 (en) 2009-05-06 2015-10-20 Curna, Inc. Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9173895B2 (en) 2009-12-16 2015-11-03 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
WO2015175545A1 (fr) 2014-05-12 2015-11-19 The Johns Hopkins University Plate-formes de vecteurs de gènes biodégradables très stables pour surmonter des barrières biologiques
WO2015175539A1 (fr) 2014-05-12 2015-11-19 The Johns Hopkins University Fabrication de vecteurs génétiques synthétiques pénétrant le cerveau
US9200276B2 (en) 2009-06-01 2015-12-01 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent RNA interference, compositions and methods of use thereof
US9200277B2 (en) 2010-01-11 2015-12-01 Curna, Inc. Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcript to SHBG
WO2015187541A1 (fr) 2014-06-02 2015-12-10 Children's Medical Center Corporation Procédés et compositions pour une immunomodulation
US9222088B2 (en) 2010-10-22 2015-12-29 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9234199B2 (en) 2009-08-05 2016-01-12 Curna, Inc. Treatment of insulin gene (INS) related diseases by inhibition of natural antisense transcript to an insulin gene (INS)
US9233171B2 (en) 2011-11-21 2016-01-12 Immunogen, Inc. Method of treatment of tumors that are resistant to EGFR antibody therapies by EGFR antibody cytotoxic agent conjugate
US9238690B2 (en) 2010-10-29 2016-01-19 Immunogen, Inc. Non-antagonistic EGFR-binding molecules and immunoconjugates thereof
US9243246B2 (en) 2010-08-24 2016-01-26 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US9249468B2 (en) 2011-10-14 2016-02-02 The Ohio State University Methods and materials related to ovarian cancer
US9481885B2 (en) 2011-12-13 2016-11-01 Ohio State Innovation Foundation Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
US20160355815A1 (en) * 2014-09-08 2016-12-08 MiRagen Therapeutics, Inc. miR-29 Mimics and Uses Thereof
US9556432B2 (en) 2012-01-10 2017-01-31 The Research Foundation For The State University Of New York Method of treating hyperlipidemia and atherosclerosis with miR-30C
US9593330B2 (en) 2011-06-09 2017-03-14 Curna, Inc. Treatment of frataxin (FXN) related diseases by inhibition of natural antisense transcript to FXN
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US9657360B2 (en) 2011-09-13 2017-05-23 Commonwealth Scientific And Industrial Research Organisation Detection of viral infection
US9677074B2 (en) 2009-12-31 2017-06-13 Curna, Inc. Treatment of insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to IRS2 and transcription factor E3 (TFE3)
US9725479B2 (en) 2010-04-22 2017-08-08 Ionis Pharmaceuticals, Inc. 5′-end derivatives
WO2017156015A2 (fr) 2016-03-07 2017-09-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Micro-arn et leurs procédés d'utilisation
US9771579B2 (en) 2010-06-23 2017-09-26 Curna, Inc. Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to SCNA
EP3266469A2 (fr) 2008-04-30 2018-01-10 ImmunoGen, Inc. Agents de réticulation et leurs utilisations
US10000752B2 (en) 2010-11-18 2018-06-19 Curna, Inc. Antagonat compositions and methods of use
US10113166B2 (en) 2009-09-25 2018-10-30 Curna, Inc. Treatment of filaggrin (FLG) related diseases by modulation of FLG expression and activity
US10214745B2 (en) 2012-03-15 2019-02-26 The Scripps Research Institute Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US20190071672A1 (en) * 2006-04-03 2019-03-07 Roche Innovation Center Copenhagen A/S Pharmaceutical Composition
EP3480202A1 (fr) 2009-06-03 2019-05-08 ImmunoGen, Inc. Procédés de conjugaison
US10370657B2 (en) 2009-06-16 2019-08-06 Curna, Inc. Treatment of Collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
WO2019157381A1 (fr) 2018-02-10 2019-08-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Composite nanoparticule-hydrogel pour l'administration de molécules d'acides nucléiques
WO2019180153A1 (fr) 2018-03-22 2019-09-26 Hummingbird Diagnostics Gmbh Composés de modulation de mir-34a dans la thérapie de maladies
US10583128B2 (en) 2011-09-06 2020-03-10 Curna, Inc. Treatment of diseases related to alpha subunits of sodium channels, voltage-gated (SCNxA) with small molecules
EP3620467A1 (fr) 2010-03-12 2020-03-11 Debiopharm International SA Molécules de liaison cd37 et immunoconjugués correspondants
US10731157B2 (en) 2015-08-24 2020-08-04 Halo-Bio Rnai Therapeutics, Inc. Polynucleotide nanoparticles for the modulation of gene expression and uses thereof
US10758619B2 (en) 2010-11-15 2020-09-01 The Ohio State University Controlled release mucoadhesive systems
WO2020261227A1 (fr) 2019-06-26 2020-12-30 Biorchestra Co., Ltd. Nanoparticules micellaires et utilisations associées
EP3797789A1 (fr) 2015-01-20 2021-03-31 The Children's Medical Center Corporation Composés anti-net pour traiter ou prévenir la fibrose et pour faciliter la cicatrisation des plaies
EP3831843A1 (fr) 2019-12-08 2021-06-09 Royal College Of Surgeons In Ireland Agent hémostatique et ses utilisations
WO2021155139A1 (fr) 2020-01-31 2021-08-05 Regeneron Pharmaceuticals, Inc. Utilisation de la chromatographie liquide et de la spectrométrie de masse pour caractériser des oligonucléotides
DE112020003843T5 (de) 2019-08-14 2022-05-19 Acuitas Therapeutics, Inc. Verbesserte Lipid-Nanopartikel zur Zuführung von Nukleinsäuren
WO2022171899A1 (fr) 2021-02-15 2022-08-18 Institut Pasteur Micro-arn à codage viral destiné à être utilisé dans le diagnostic, le pronostic et le traitement d'une infection par sars-cov-2 et maladie associée
US11499152B2 (en) * 2018-03-14 2022-11-15 Beth Israel Deaconess Medical Center Inhibitors of micro-RNA 22
WO2023014938A1 (fr) 2021-08-05 2023-02-09 Sanegene Bio Usa Inc. Dérivés de ribose modifiés par 1'-alkyle et procédés d'utilisation
WO2023049258A1 (fr) 2021-09-22 2023-03-30 Sanegene Bio Usa Inc. Dérivés de ribose modifiés par 2'-alkyle ou 3'-alkyle destinés à être utilisés dans l'administration in vivo d'oligonucléotides
WO2023059695A1 (fr) 2021-10-05 2023-04-13 Sanegene Bio Usa Inc. Dérivés de cyclopentane polyhydroxylés et procédés d'utilisation
WO2023118150A1 (fr) 2021-12-22 2023-06-29 Royal College Of Surgeons In Ireland Conjugué destiné à être utilisé dans la localisation d'une molécule dans l'endothélium vasculaire
WO2023164464A1 (fr) 2022-02-22 2023-08-31 Sanegene Bio Usa Inc. Dérivés de ribonucléotides carbocycliques modifiés en position 5' et procédés d'utilisation
WO2024015796A1 (fr) 2022-07-11 2024-01-18 Sanegene Bio Usa Inc. Dérivés du ribose modifié en 2' optimisés et procédés d'utilisation

Families Citing this family (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005013901A2 (fr) 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Composes oligomeres et compositions utilisables pour moduler des petits arn non-codants
CA2564503C (fr) 2004-05-04 2015-12-29 The Board Of Trustees Of The Leland Stanford Junior University Inhibition de mir-122 dans des sujets et des cellules infectes par le virus de l'hepatite c
ATE494372T1 (de) * 2005-08-29 2011-01-15 Regulus Therapeutics Inc Verfahren für mir-122a-modulation
EA201100813A1 (ru) 2006-04-03 2012-06-29 Сантарис Фарма А/С Фармацевтическая композиция
ES2463665T3 (es) 2007-10-04 2014-05-28 Stella Aps Tratamiento de combinación para el tratamiento de infección por virus de la hepatitis C
US8361980B2 (en) 2008-03-07 2013-01-29 Santaris Pharma A/S Pharmaceutical compositions for treatment of microRNA related diseases
US9217155B2 (en) 2008-05-28 2015-12-22 University Of Massachusetts Isolation of novel AAV'S and uses thereof
ES2541442T3 (es) 2008-08-01 2015-07-20 Roche Innovation Center Copenhagen A/S Modulación mediada por microARN de factores estimulantes de colonias
EP2421970B1 (fr) 2009-04-24 2016-09-07 Roche Innovation Center Copenhagen A/S Compositions pharmaceutiques pour le traitement de patients souffrant du vhc ne réagissant pas aux interférons
WO2010138263A2 (fr) 2009-05-28 2010-12-02 University Of Massachusetts Nouveaux virus adéno-associés (aav) et leurs utilisations
ES2698203T3 (es) 2010-04-23 2019-02-01 Univ Massachusetts Vectores de AAV que se dirigen al SNC y métodos de uso de los mismos
US9546369B2 (en) 2010-04-23 2017-01-17 University Of Massachusetts Multicistronic expression constructs
EP3444346B1 (fr) 2010-04-23 2022-07-27 University of Massachusetts Traitement de troubles liés au cholestérol basé sur aav
US20120053227A1 (en) 2010-08-27 2012-03-01 New York University miR-33 INHIBITORS AND USES THEREOF
DK2633052T3 (en) * 2010-10-27 2018-07-16 Curna Inc TREATMENT OF INTERFERON-RELATED DEVELOPMENT REGULATOR 1 (IFRD1) -RELATED DISEASES BY INHIBITION OF NATURAL ANTISENCE TRANSCRIPT TO IFRD1
EP3318634A1 (fr) 2011-04-21 2018-05-09 University of Massachusetts Compositions à base de raav et procédés pour traiter des maladies causées par des mutations dominantes négatives ou gains de fonction
US9241950B2 (en) 2011-04-28 2016-01-26 New York University MiR-33 inhibitors and uses thereof to decrease inflammation
US20140127159A1 (en) 2011-06-23 2014-05-08 Stella Aps HCV Combination Therapy
US20140113958A1 (en) 2011-06-30 2014-04-24 Stella Aps HCV Combination Therapy
KR20140058536A (ko) 2011-06-30 2014-05-14 스텔라 에이피에스 Hcv 조합 치료
EP2731422B1 (fr) * 2011-07-12 2017-08-09 Mart Saarma Antagonistes de miARN par traitement des maladies neurodégéneratives au moyen d'expression enlevé de GDNF
EP3524679B1 (fr) 2011-08-04 2021-10-06 Yeda Research and Development Co., Ltd. Micro arn mir-19 et compositions les comprenant pour le traitement d'états médicaux dans lesquels le niveau d'adrénaline faible ou de noradrénaline est bénéfique thérapeutiquement
CA2853328A1 (fr) 2011-11-07 2013-05-16 Stella Aps Methode pronostique d'evaluation de l'efficacite d'inhibiteurs de microarn-122 chez des patients positifs au vhc
EP4141116A1 (fr) 2011-11-18 2023-03-01 Alnylam Pharmaceuticals, Inc. Agents d'arni modifiés
US20150246069A1 (en) * 2012-07-25 2015-09-03 Ann-Joy Cheng Method of using sequence of antagomir for developing medicine for inhibiting oral cancer cells from spreading
CN104837996A (zh) 2012-11-15 2015-08-12 罗氏创新中心哥本哈根有限公司 抗apob反义缀合物化合物
WO2014179446A2 (fr) * 2013-05-01 2014-11-06 Regulus Therapeutics Inc. Composés microarn et procédés permettant la modulation de l'activité de mir-122
AU2014259953B2 (en) 2013-05-01 2020-07-02 Regulus Therapeutics Inc. Compounds and methods for enhanced cellular uptake
CN111733231A (zh) 2014-02-05 2020-10-02 耶达研究及发展有限公司 用于治疗和诊断的微rna和包含所述微rna的组合物
US10072251B2 (en) 2014-02-19 2018-09-11 University Of Massachusetts Recombinant AAVS having useful transcytosis properties
WO2015143078A1 (fr) 2014-03-18 2015-09-24 University Of Massachusetts Compositions à base de virus adéno-associé recombinant raav et méthodes de traitement de la sclérose latérale amyotrophique
EP3134522B1 (fr) 2014-04-25 2021-10-06 University of Massachusetts Vecteurs de virus adéno-associés recombinants utiles pour réduire une immunité contre des produits transgéniques
WO2016042561A2 (fr) 2014-09-21 2016-03-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Freination du mir-132 pour le traitement de troubles lipidiques
WO2016054554A1 (fr) 2014-10-03 2016-04-07 University Of Massachusetts Virus adéno-associés greffés au moyen de peptides de ciblage hétérologues
US10711270B2 (en) 2014-10-03 2020-07-14 University Of Massachusetts High efficiency library-identified AAV vectors
AU2015335923B2 (en) 2014-10-21 2021-04-29 University Of Massachusetts Recombinant AAV variants and uses thereof
EP3250279B1 (fr) * 2015-01-30 2020-08-19 The Regents of the University of California Système de délivrance de gènes sous-pial spinal
US10688285B2 (en) * 2015-01-30 2020-06-23 The Regents Of The University Of California Spinal subpial gene delivery system
US10584321B2 (en) 2015-02-13 2020-03-10 University Of Massachusetts Compositions and methods for transient delivery of nucleases
AU2016226414B2 (en) 2015-03-02 2021-09-09 180 Therapeutics Lp Method of treating a localized fibrotic disorder using an IL-33 antagonist
CA3021949C (fr) 2015-04-24 2023-10-17 University Of Massachusetts Constructions d'aav modifiees et utilisations de celles-ci
ES2965461T3 (es) 2015-08-03 2024-04-15 Biokine Therapeutics Ltd Inhibidor de CXCR4 para el tratamiento del cáncer
WO2017136536A1 (fr) 2016-02-02 2017-08-10 University Of Massachusetts Procédé pour améliorer l'efficacité de l'administration au système nerveux central d'un gène aav par voie systémique
EP3413928B1 (fr) 2016-02-12 2022-04-20 University of Massachusetts Agents thérapeutiques à base de micro-arn anti-angiogéniques pour l'inhibition de la néovascularisation cornéenne
KR102489437B1 (ko) 2016-03-28 2023-01-16 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 뉴런 과흥분성 치료를 위한 방법 및 조성물
JP7211933B2 (ja) * 2016-07-15 2023-01-24 アイオーニス ファーマシューティカルズ， インコーポレーテッド 転写プロセシングの調節のための化合物及び方法
US10457940B2 (en) 2016-09-22 2019-10-29 University Of Massachusetts AAV treatment of Huntington's disease
CA3040483A1 (fr) 2016-10-13 2018-04-19 University Of Massachusetts Conceptions de capsides de vaa
EP3558328A4 (fr) 2016-12-22 2020-08-26 Ohio State Innovation Foundation Compositions et procédés pour la reprogrammation de cellules somatiques en cellules vasculogéniques induites
WO2018208972A1 (fr) 2017-05-09 2018-11-15 University Of Massachusetts Méthodes de traitement de la sclérose latérale amyotrophique (sla)
AU2018327253B2 (en) 2017-09-08 2024-05-16 The Regents Of The University Of California Method and composition for treating neuropathic pain
JP7397488B2 (ja) 2017-09-22 2023-12-13 ユニバーシティ オブ マサチューセッツ Ｓｏｄ１二重発現ベクターおよびその使用
US11591597B2 (en) * 2018-04-20 2023-02-28 Texas Tech University System MicroRNAs as therapeutic targets for ischemic stroke
CN113260317B (zh) 2019-01-10 2024-05-07 加利福尼亚大学董事会 软膜下递送系统和使用方法
USD963164S1 (en) 2020-01-09 2022-09-06 The Regents Of The University Of California Surgical needle
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing
CA3234547A1 (fr) * 2021-10-08 2023-04-13 Regulus Therapeutics Inc. Methodes et compositions pour le traitement de la polykystose renale
CN118043462A (zh) * 2021-10-08 2024-05-14 莱古路斯治疗法股份有限公司 用于避免脱靶效应的方法和组合物

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5256775A (en) * 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5595760A (en) * 1994-09-02 1997-01-21 Delab Sustained release of peptides from pharmaceutical compositions
US5672659A (en) * 1993-01-06 1997-09-30 Kinerton Limited Ionic molecular conjugates of biodegradable polyesters and bioactive polypeptides
US5902880A (en) * 1994-08-19 1999-05-11 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
US6107094A (en) * 1996-06-06 2000-08-22 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US6146886A (en) * 1994-08-19 2000-11-14 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
US6395713B1 (en) * 1997-07-23 2002-05-28 Ribozyme Pharmaceuticals, Inc. Compositions for the delivery of negatively charged molecules
US6727064B2 (en) * 1999-04-08 2004-04-27 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of STAT3 expression
US20040266707A1 (en) * 2003-04-02 2004-12-30 Devin Leake Stabilized polynucleotides for use in RNA interference
US7232806B2 (en) * 2001-09-28 2007-06-19 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. MicroRNA molecules

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0642589A4 (fr) 1992-05-11 1997-05-21 Ribozyme Pharm Inc Procede et reactif d'inhibition de la replication virale.
EP0786522A2 (fr) 1992-07-17 1997-07-30 Ribozyme Pharmaceuticals, Inc. Molécules de RNA enzymatiques pour le traitement de conditions sténotiques
US5753613A (en) 1994-09-30 1998-05-19 Inex Pharmaceuticals Corporation Compositions for the introduction of polyanionic materials into cells
US5820873A (en) 1994-09-30 1998-10-13 The University Of British Columbia Polyethylene glycol modified ceramide lipids and liposome uses thereof
US5885613A (en) 1994-09-30 1999-03-23 The University Of British Columbia Bilayer stabilizing components and their use in forming programmable fusogenic liposomes
JP2002537828A (ja) 1999-03-10 2002-11-12 フォゲン リミティド 細胞への物質のデリバリー
GB9927444D0 (en) 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
WO2005013901A2 (fr) * 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Composes oligomeres et compositions utilisables pour moduler des petits arn non-codants
CA2564503C (fr) 2004-05-04 2015-12-29 The Board Of Trustees Of The Leland Stanford Junior University Inhibition de mir-122 dans des sujets et des cellules infectes par le virus de l'hepatite c
ATE494372T1 (de) * 2005-08-29 2011-01-15 Regulus Therapeutics Inc Verfahren für mir-122a-modulation

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5256775A (en) * 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5672659A (en) * 1993-01-06 1997-09-30 Kinerton Limited Ionic molecular conjugates of biodegradable polyesters and bioactive polypeptides
US5902880A (en) * 1994-08-19 1999-05-11 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
US6146886A (en) * 1994-08-19 2000-11-14 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
US5595760A (en) * 1994-09-02 1997-01-21 Delab Sustained release of peptides from pharmaceutical compositions
US6107094A (en) * 1996-06-06 2000-08-22 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US6395713B1 (en) * 1997-07-23 2002-05-28 Ribozyme Pharmaceuticals, Inc. Compositions for the delivery of negatively charged molecules
US6727064B2 (en) * 1999-04-08 2004-04-27 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of STAT3 expression
US7232806B2 (en) * 2001-09-28 2007-06-19 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. MicroRNA molecules
US20040266707A1 (en) * 2003-04-02 2004-12-30 Devin Leake Stabilized polynucleotides for use in RNA interference

Cited By (303)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050227256A1 (en) * 2003-11-26 2005-10-13 Gyorgy Hutvagner Sequence-specific inhibition of small RNA function
US11359196B2 (en) 2003-11-26 2022-06-14 University Of Massachusetts Sequence-specific inhibition of small RNA function
US8598143B2 (en) 2003-11-26 2013-12-03 University Of Massachusetts Sequence-specific inhibition of small RNA function
US20090083873A1 (en) * 2003-11-26 2009-03-26 Uinversity Of Massachusetts Sequence-specific inhibition of small rna function
US8685946B2 (en) 2003-11-26 2014-04-01 Universiy of Massachusetts Sequence-specific inhibition of small RNA function
US9334497B2 (en) 2003-11-26 2016-05-10 University Of Massachusetts Sequence-specific inhibition of small RNA function
US8003320B2 (en) 2004-05-28 2011-08-23 Asuragen, Inc. Methods and compositions involving MicroRNA
US7919245B2 (en) 2004-05-28 2011-04-05 Asuragen, Inc. Methods and compositions involving microRNA
US8465914B2 (en) 2004-05-28 2013-06-18 Asuragen, Inc. Method and compositions involving microRNA
US7888010B2 (en) 2004-05-28 2011-02-15 Asuragen, Inc. Methods and compositions involving microRNA
US8568971B2 (en) 2004-05-28 2013-10-29 Asuragen, Inc. Methods and compositions involving microRNA
US10047388B2 (en) 2004-05-28 2018-08-14 Asuragen, Inc. Methods and compositions involving MicroRNA
US8765709B2 (en) 2004-11-12 2014-07-01 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US7960359B2 (en) 2004-11-12 2011-06-14 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8946177B2 (en) 2004-11-12 2015-02-03 Mima Therapeutics, Inc Methods and compositions involving miRNA and miRNA inhibitor molecules
US8173611B2 (en) 2004-11-12 2012-05-08 Asuragen Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9506061B2 (en) 2004-11-12 2016-11-29 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9447414B2 (en) 2004-11-12 2016-09-20 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8058250B2 (en) 2004-11-12 2011-11-15 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US20080171715A1 (en) * 2004-11-12 2008-07-17 David Brown Methods and compositions involving mirna and mirna inhibitor molecules
US8658370B2 (en) 2005-08-01 2014-02-25 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
US8481505B2 (en) 2005-09-12 2013-07-09 The Ohio State University Research Foundation Compositions and methods for the diagnosis and therapy of BCL2-associated cancers
US10472627B2 (en) 2005-12-28 2019-11-12 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US9803195B2 (en) 2005-12-28 2017-10-31 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US8288354B2 (en) 2005-12-28 2012-10-16 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US7943318B2 (en) 2006-01-05 2011-05-17 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
US8361710B2 (en) 2006-01-05 2013-01-29 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer using miR-21
US8148069B2 (en) 2006-01-05 2012-04-03 The Ohio State University MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers
US8389210B2 (en) 2006-01-05 2013-03-05 The Ohio State University Research Foundation MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors
US8377637B2 (en) 2006-01-05 2013-02-19 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer using miR-17-3P
US9017940B2 (en) 2006-01-05 2015-04-28 The Ohio State University Methods for diagnosing colon cancer using MicroRNA signatures
US8486912B2 (en) 2006-03-20 2013-07-16 The Ohio State University Research Foundation MicroRNA fingerprints during human megakaryocytopoiesis
US8492083B2 (en) 2006-03-20 2013-07-23 The Ohio State University MicroRNA fingerprints during human megakaryocytopoiesis
US7985584B2 (en) 2006-03-20 2011-07-26 The Ohio State University Research Foundation MicroRNA fingerprints during human megakaryocytopoiesis
US8354224B2 (en) 2006-03-20 2013-01-15 The Ohio State University MicroRNA fingerprints during human megakaryocytopoiesis
US8486913B2 (en) 2006-03-20 2013-07-16 The Ohio State University MicroRNA fingerprints during human megakaryocytopoiesis
US8865885B2 (en) 2006-03-20 2014-10-21 The Ohio State University Research Foundation MicroRNA fingerprints during human megakaryocytopoiesis
US20190071672A1 (en) * 2006-04-03 2019-03-07 Roche Innovation Center Copenhagen A/S Pharmaceutical Composition
US8084199B2 (en) 2006-07-13 2011-12-27 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using microRNA-21
US8518647B2 (en) 2006-07-13 2013-08-27 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-16b
US8338106B2 (en) 2006-07-13 2012-12-25 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-29a
US8338103B2 (en) 2006-07-13 2012-12-25 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-106a
US8349568B2 (en) 2006-07-13 2013-01-08 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using let-7g
US8338105B2 (en) 2006-07-13 2012-12-25 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-203
US8343725B2 (en) 2006-07-13 2013-01-01 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-10a
US8338102B2 (en) 2006-07-13 2012-12-25 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-181b
US8338104B2 (en) 2006-07-13 2012-12-25 The Ohio State University Research Foundation Method of diagnosing poor survival prognosis colon cancer using miR-103-2
US8071292B2 (en) 2006-09-19 2011-12-06 The Ohio State University Research Foundation Leukemia diagnostic methods
US20090163435A1 (en) * 2006-09-19 2009-06-25 Bader Andreas G miR-200 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US8252538B2 (en) 2006-11-01 2012-08-28 The Ohio State University MicroRNA expression signature for predicting survival and metastases in hepatocellular carcinoma
US8034560B2 (en) 2007-01-31 2011-10-11 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia (AML)
US20090017124A1 (en) * 2007-04-17 2009-01-15 Baxter International Inc. Nucleic Acid Microparticles for Pulmonary Delivery
US8808747B2 (en) 2007-04-17 2014-08-19 Baxter International Inc. Nucleic acid microparticles for pulmonary delivery
US8465917B2 (en) 2007-06-08 2013-06-18 The Ohio State University Research Foundation Methods for determining heptocellular carcinoma subtype and detecting hepatic cancer stem cells
US8361722B2 (en) 2007-06-15 2013-01-29 The Ohio State University Research Foundation Method for diagnosing acute lymphomic leukemia (ALL) using miR-221
US8053186B2 (en) 2007-06-15 2011-11-08 The Ohio State University Research Foundation Oncogenic ALL-1 fusion proteins for targeting Drosha-mediated microRNA processing
US8349560B2 (en) 2007-06-15 2013-01-08 The Ohio State University Research Method for diagnosing acute lymphomic leukemia (ALL) using miR-222
US8367632B2 (en) 2007-07-31 2013-02-05 Ohio State University Research Foundation Methods for reverting methylation by targeting methyltransferases
US9085804B2 (en) 2007-08-03 2015-07-21 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US8465918B2 (en) 2007-08-03 2013-06-18 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US8466119B2 (en) 2007-08-22 2013-06-18 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of EPHA7 and ERK phosphorylation in human acute leukemias
US9080215B2 (en) 2007-09-14 2015-07-14 Asuragen, Inc. MicroRNAs differentially expressed in cervical cancer and uses thereof
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US8911998B2 (en) 2007-10-26 2014-12-16 The Ohio State University Methods for identifying fragile histidine triad (FHIT) interaction and uses thereof
US8513209B2 (en) 2007-11-09 2013-08-20 The Board Of Regents, The University Of Texas System Micro-RNAS of the MIR-15 family modulate cardiomyocyte survival and cardiac repair
US20100317713A1 (en) * 2007-11-09 2010-12-16 Eric Olson Micro-rnas of the mir-15 family modulate cardiomyocyte survival and cardiac repair
US9078919B2 (en) 2007-11-09 2015-07-14 The Board Of Regents, The University Of Texas System Micro-RNAs of the miR-15 family modulate cardiomyocyte survival and cardiac repair
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
US20110118339A1 (en) * 2008-01-18 2011-05-19 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides and uses thereof
WO2009091982A1 (fr) * 2008-01-18 2009-07-23 Alnylam Pharmaceuticals, Inc. Agoniste de mir-22
US10028974B2 (en) 2008-02-27 2018-07-24 Julius-Maximilians-Universitat Wurzburg MicroRNA (miRNA) and downstream targets for diagnostic and therapeutic purposes
US20110071211A1 (en) * 2008-02-27 2011-03-24 Julius Maximilians-Universität Würzburg MicroRNA (miRNA) And Downstream Targets For Diagnostic And Therapeutic Purposes
EA020335B1 (ru) * 2008-02-27 2014-10-30 Юлиус Максимилианс-Универзитет Вюрцбург МИКРО-РНК (mi-РНК) И МИШЕНИ СИГНАЛЬНОГО ПУТИ ДЛЯ ДИАГНОСТИЧЕСКИХ И ТЕРАПЕВТИЧЕСКИХ ЦЕЛЕЙ
US8592389B2 (en) 2008-02-27 2013-11-26 Julius-Maximilians-Universitat Wurzburg MicroRNA (miRNA) and downstream targets for diagnostic and therapeutic purposes
US10434117B2 (en) 2008-02-27 2019-10-08 Julius-Maximilians-Universitat Wurzburg MicroRNA (miRNA) and downstream targets for diagnostic and therapeutic purposes
US9663788B2 (en) 2008-02-27 2017-05-30 Julius-Maximilans-Universitat Wurzburg MicroRNA (miRNA) and downstream targets for diagnostic and therapeutic purposes
US9220722B2 (en) 2008-02-27 2015-12-29 Julius-Maximilians-Universitat Wurzburg Microrna (miRNA) and downstream targets for diagnostic and therapeutic purposes
US8236777B2 (en) 2008-02-27 2012-08-07 Julius-Maximilians-Universitat Wurzburg MicroRNA (miRNA) and downstream targets for diagnostic and therapeutic purposes
WO2009108856A3 (fr) * 2008-02-28 2010-01-14 The Ohio State University Research Foundation Signatures de microarn associées à la leucémie lymphoïde chronique humaine (llc) et leurs utilisations
US20110034538A1 (en) * 2008-02-28 2011-02-10 The Ohio State University Research Foundation MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Gastric Cancer
EP3266469A2 (fr) 2008-04-30 2018-01-10 ImmunoGen, Inc. Agents de réticulation et leurs utilisations
US8258111B2 (en) 2008-05-08 2012-09-04 The Johns Hopkins University Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US9365852B2 (en) 2008-05-08 2016-06-14 Mirna Therapeutics, Inc. Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
WO2009149182A1 (fr) 2008-06-04 2009-12-10 The Board Of Regents Of The University Of Texas System Modulation de l'expression génique par ciblage d'un petit arn endogène de promoteurs de gènes
US9125923B2 (en) 2008-06-11 2015-09-08 The Ohio State University Use of MiR-26 family as a predictive marker for hepatocellular carcinoma and responsiveness to therapy
US9433684B2 (en) 2008-08-19 2016-09-06 Nektar Therapeutics Conjugates of small-interfering nucleic acids
US9089610B2 (en) 2008-08-19 2015-07-28 Nektar Therapeutics Complexes of small-interfering nucleic acids
US20110213013A1 (en) * 2008-08-19 2011-09-01 Nektar Therapeutics Complexes of Small-Interfering Nucleic Acids
US8153606B2 (en) 2008-10-03 2012-04-10 Opko Curna, Llc Treatment of apolipoprotein-A1 related diseases by inhibition of natural antisense transcript to apolipoprotein-A1
US8921329B2 (en) 2008-12-04 2014-12-30 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
WO2010065662A3 (fr) * 2008-12-04 2010-09-30 Curna, Inc. Traitement de maladies liées à sirtuine 1 (sirt1) par inhibition d'un transcrit antisens naturel de sirtuine 1
RU2551234C2 (ru) * 2008-12-04 2015-05-20 КьюРНА,Инк.,US Лечение сиртуин 1 (sirt1)-связанных заболеваний путем ингибирования натурального антисмыслового транскрипта
JP2012510816A (ja) * 2008-12-04 2012-05-17 オーピーケーオー・クルナ・エルエルシー Ｖｅｇｆに対する天然アンチセンス転写物の抑制による血管内皮増殖因子（ｖｅｇｆ）関連疾患の治療
CN102361985A (zh) * 2008-12-04 2012-02-22 欧科库尔纳有限责任公司 通过抑制肿瘤抑制基因的天然反义转录物治疗肿瘤抑制基因相关性疾病
US9765336B2 (en) 2008-12-04 2017-09-19 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US10358645B2 (en) 2008-12-04 2019-07-23 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US10358646B2 (en) 2008-12-04 2019-07-23 Curna, Inc. Treatment of tumor suppressor gene related diseases by inhibition of natural antisense transcript to the gene
KR101761424B1 (ko) 2008-12-04 2017-07-26 큐알엔에이, 인크. Ｖｅｇｆ에 대한 천연 안티센스 전사체의 억제에 의해 맥관 내피 성장 인자(ｖｅｇｆ) 관련된 질환의 치료
RU2569182C2 (ru) * 2008-12-04 2015-11-20 КьюРНА,Инк.,US Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
KR101749352B1 (ko) * 2008-12-04 2017-06-20 큐알엔에이, 인크. Ｓｉｒｔ1에 대한 천연 안티센스 전사체의 억제에 의해 ｓｉｒｔ1 관련된 질환의 치료
WO2010065787A3 (fr) * 2008-12-04 2010-10-14 Curna, Inc. Traitement de maladies liées à un gène suppresseur de tumeur par inhibition d'un transcrit antisens naturel du gène
CN102361985B (zh) * 2008-12-04 2017-06-20 库尔纳公司 通过抑制肿瘤抑制基因的天然反义转录物治疗肿瘤抑制基因相关性疾病
US8927511B2 (en) 2008-12-04 2015-01-06 Curna, Inc. Treatment of vascular endothelial growth factor (VEGF) related diseases by inhibition of natural antisense transcript to VEGF
US11697814B2 (en) 2008-12-04 2023-07-11 Curna, Inc. Treatment of tumor suppressor gene related diseases by inhibition of natural antisense transcript to the gene
US9410155B2 (en) 2008-12-04 2016-08-09 Curna, Inc. Treatment of vascular endothelial growth factor (VEGF) related diseases by inhibition of natural antisense transcript to VEGF
WO2010065671A3 (fr) * 2008-12-04 2010-09-30 Curna, Inc. Traitement de maladies apparentées au facteur de croissance de l'endothélium vasculaire (vegf) par inhibition de la transcription antisens naturelle en vegf
WO2010065961A2 (fr) 2008-12-05 2010-06-10 Whitehead Institute For Biomedical Research Compositions et procédés concernant le mir-31
US9074210B2 (en) 2009-02-12 2015-07-07 Curna, Inc. Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US10519448B2 (en) 2009-02-12 2019-12-31 Curna, Inc. Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
CN102482677A (zh) * 2009-03-16 2012-05-30 欧科库尔纳有限责任公司 通过抑制nrf2的天然反义转录物治疗核因子(红细胞衍生2)-样2(nrf2)相关疾病
US9464287B2 (en) 2009-03-16 2016-10-11 Curna, Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2
WO2010107733A3 (fr) * 2009-03-16 2011-01-13 Curna, Inc. Traitement de maladies associées au facteur nucléaire 2 similaire au dérivé d'érythroïde 2 (nrf2) par inhibition de produit de transcription antisens naturel pour nrf2
CN102482677B (zh) * 2009-03-16 2017-10-17 库尔纳公司 通过抑制nrf2的天然反义转录物治疗核因子(红细胞衍生2)‑样2(nrf2)相关疾病
US10995334B2 (en) 2009-03-16 2021-05-04 Curna Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2
US9708604B2 (en) 2009-03-17 2017-07-18 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
WO2010107740A3 (fr) * 2009-03-17 2011-01-13 Curna, Inc. Traitement des maladies associées à l'homologue du delta-like 1 (dlk1) par inhibition du transcrit antisens naturel de dlk1
US9834769B2 (en) 2009-03-17 2017-12-05 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
US20110105585A1 (en) * 2009-04-23 2011-05-05 Northwestern University METHODS FOR DIAGNOSING AND TREATING SQUAMOUS CELL CARCINOMA UTILIZING miRNA-205 AND INHIBITORS THEREOF
WO2010124231A2 (fr) 2009-04-24 2010-10-28 The Board Of Regents Of The University Of Texas System Modulation de l'expression d'un gène au moyen d'oligomères ciblant les séquences géniques situées en aval des séquences 3' non traduites
WO2010126551A1 (fr) 2009-04-30 2010-11-04 Immunogen, Inc. Conjugués puissants et séquences de liaison hydrophiles
US9957503B2 (en) 2009-05-06 2018-05-01 Curna, Inc. Treatment of LCAT gene related diseases by inhibition of a natural antisense transcript to LCAT
US9155754B2 (en) 2009-05-06 2015-10-13 Curna, Inc. Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1
US10604755B2 (en) 2009-05-06 2020-03-31 Curna, Inc. Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene
US9163285B2 (en) 2009-05-06 2015-10-20 Curna, Inc. Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9611477B2 (en) 2009-05-06 2017-04-04 Curna, Inc. Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9012139B2 (en) 2009-05-08 2015-04-21 Curna, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US9533004B2 (en) 2009-05-08 2017-01-03 Curna, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US8957037B2 (en) 2009-05-18 2015-02-17 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US10487327B2 (en) 2009-05-18 2019-11-26 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US9914923B2 (en) 2009-05-18 2018-03-13 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US9725717B2 (en) 2009-05-22 2017-08-08 Curna, Inc. Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US8895527B2 (en) 2009-05-22 2014-11-25 Curna, Inc. Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2(IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US9133456B2 (en) 2009-05-28 2015-09-15 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US9512427B2 (en) 2009-05-28 2016-12-06 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US8791085B2 (en) 2009-05-28 2014-07-29 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US9200276B2 (en) 2009-06-01 2015-12-01 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent RNA interference, compositions and methods of use thereof
US9957505B2 (en) 2009-06-01 2018-05-01 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent RNA interference, compositions and methods of use thereof
EP3480202A1 (fr) 2009-06-03 2019-05-08 ImmunoGen, Inc. Procédés de conjugaison
US9714423B2 (en) 2009-06-16 2017-07-25 Curna, Inc. Treatment of Paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US8951981B2 (en) 2009-06-16 2015-02-10 Curna, Inc. Treatment of paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US10370657B2 (en) 2009-06-16 2019-08-06 Curna, Inc. Treatment of Collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
US11339394B2 (en) 2009-06-16 2022-05-24 Curna, Inc. Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
US8859515B2 (en) 2009-06-24 2014-10-14 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
US9771593B2 (en) 2009-06-24 2017-09-26 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
US10876117B2 (en) 2009-06-26 2020-12-29 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US10450567B2 (en) 2009-06-26 2019-10-22 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US10036014B2 (en) 2009-06-26 2018-07-31 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US8921330B2 (en) 2009-06-26 2014-12-30 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US10563202B2 (en) 2009-07-24 2020-02-18 GuRNA, Inc. Treatment of Sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a Sirtuin (SIRT)
WO2011011700A3 (fr) * 2009-07-24 2011-06-23 Curna, Inc. Traitement des maladies associées à une sirtuine (sirt) par inhibition du produit de transcription anti-sens naturel chez une sirtuine (sirt)
US9234199B2 (en) 2009-08-05 2016-01-12 Curna, Inc. Treatment of insulin gene (INS) related diseases by inhibition of natural antisense transcript to an insulin gene (INS)
WO2011017697A1 (fr) 2009-08-07 2011-02-10 New York University Compositions et méthodes pour traiter des troubles inflammatoires
US9044493B2 (en) 2009-08-11 2015-06-02 Curna, Inc. Treatment of Adiponectin related diseases by inhibition of natural antisense transcript to an Adiponectin
US9909126B2 (en) 2009-08-11 2018-03-06 Curna, Inc. Treatment of Adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an Adiponectin (ADIPOQ)
US10316317B2 (en) 2009-08-11 2019-06-11 Curna, Inc. Treatment of adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an adiponectin (ADIPOQ)
US9290766B2 (en) 2009-08-11 2016-03-22 Curna, Inc. Treatment of adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an adiponectin (ADIPOQ)
US8791087B2 (en) 2009-08-21 2014-07-29 Curna, Inc. Treatment of ‘C terminus of HSP70-interacting protein’ (CHIP)related diseases by inhibition of natural antisense transcript to CHIP
US9725756B2 (en) 2009-08-21 2017-08-08 Curna, Inc. Treatment of ‘C terminus of HSP7O-interacting protein’ (CHIP) related diseases by inhibition of natural antisense transcript to CHIP
US9528110B2 (en) 2009-08-25 2016-12-27 Curna, Inc. Treatment of ‘IQ motif containing gtpase activating protein’ (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US9023822B2 (en) 2009-08-25 2015-05-05 Curna, Inc. Treatment of 'IQ motif containing GTPase activating protein' (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US8916693B2 (en) 2009-09-17 2014-12-23 Nektar Therapeutics Monoconjugated chitosans as delivery agents for small interfering nucleic acids
WO2011035065A1 (fr) 2009-09-17 2011-03-24 Nektar Therapeutics Chitosanes monoconjugués en tant qu'agents de distribution pour de petits acides nucléiques interférents
US10113166B2 (en) 2009-09-25 2018-10-30 Curna, Inc. Treatment of filaggrin (FLG) related diseases by modulation of FLG expression and activity
US11390868B2 (en) 2009-09-25 2022-07-19 Curna, Inc. Treatment of filaggrin (FLG) related diseases by modulation of FLG expression and activity
WO2011053994A1 (fr) 2009-11-02 2011-05-05 Alnylam Pharmaceuticals, Inc. Modulation de l'expression du récepteur ldl avec des arn double brin ciblant le promoteur du gène du récepteur ldl
US8916533B2 (en) 2009-11-23 2014-12-23 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
US9173895B2 (en) 2009-12-16 2015-11-03 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
US9879264B2 (en) 2009-12-16 2018-01-30 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
WO2011075656A1 (fr) 2009-12-18 2011-06-23 The University Of British Columbia Procédés et compositions pour l'administration d'acides nucléiques
EP3494963A1 (fr) 2009-12-18 2019-06-12 The University of British Columbia Procédés et compositions d'administration d'acides nucléiques
US9068183B2 (en) 2009-12-23 2015-06-30 Curna, Inc. Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
US9879256B2 (en) 2009-12-23 2018-01-30 Curna, Inc. Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US8940708B2 (en) 2009-12-23 2015-01-27 Curna, Inc. Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US10221413B2 (en) 2009-12-23 2019-03-05 Curna, Inc. Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
US8962585B2 (en) 2009-12-29 2015-02-24 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US9663785B2 (en) 2009-12-29 2017-05-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
US8921334B2 (en) 2009-12-29 2014-12-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
US9732339B2 (en) 2009-12-29 2017-08-15 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US9677074B2 (en) 2009-12-31 2017-06-13 Curna, Inc. Treatment of insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to IRS2 and transcription factor E3 (TFE3)
US9834767B2 (en) 2010-01-04 2017-12-05 Curna, Inc. Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US8946181B2 (en) 2010-01-04 2015-02-03 Curna, Inc. Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US8912157B2 (en) 2010-01-06 2014-12-16 Curna, Inc. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US9267136B2 (en) 2010-01-06 2016-02-23 Curna, Inc. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US9200277B2 (en) 2010-01-11 2015-12-01 Curna, Inc. Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcript to SHBG
US10696966B2 (en) 2010-01-11 2020-06-30 Curna, Inc. Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcript to SHBG
US8946182B2 (en) 2010-01-25 2015-02-03 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US10337013B2 (en) 2010-01-25 2019-07-02 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US9745582B2 (en) 2010-01-25 2017-08-29 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
WO2011100403A1 (fr) 2010-02-10 2011-08-18 Immunogen, Inc Anticorps anti-cd20 et utilisations de ceux-ci
US9902995B2 (en) 2010-02-22 2018-02-27 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related disease by inhibition of natural antisense transcript to PYCR1
US8962586B2 (en) 2010-02-22 2015-02-24 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
US9382543B2 (en) 2010-02-22 2016-07-05 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
EP3620467A1 (fr) 2010-03-12 2020-03-11 Debiopharm International SA Molécules de liaison cd37 et immunoconjugués correspondants
US9382538B2 (en) 2010-04-02 2016-07-05 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US8980856B2 (en) 2010-04-02 2015-03-17 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US9920369B2 (en) 2010-04-02 2018-03-20 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisene transcript to CSF3
US9745580B2 (en) 2010-04-09 2017-08-29 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9044494B2 (en) 2010-04-09 2015-06-02 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US10337011B2 (en) 2010-04-09 2019-07-02 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9725479B2 (en) 2010-04-22 2017-08-08 Ionis Pharmaceuticals, Inc. 5′-end derivatives
US11408004B2 (en) 2010-05-03 2022-08-09 Curna, Inc. Treatment of Sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a Sirtuin (SIRT)
WO2011139387A1 (fr) * 2010-05-03 2011-11-10 Opko Curna, Llc Traitement de maladies liées à une sirtuine (sirt) par inhibition de la transcription antisens naturelle pour donner une sirtuine (sirt)
US9089588B2 (en) 2010-05-03 2015-07-28 Curna, Inc. Treatment of sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a sirtuin (SIRT)
US8980857B2 (en) 2010-05-14 2015-03-17 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US9745584B2 (en) 2010-05-14 2017-08-29 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US10100315B2 (en) 2010-05-14 2018-10-16 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US9970008B2 (en) 2010-05-26 2018-05-15 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US10174324B2 (en) 2010-05-26 2019-01-08 Curna, Inc. Treatment of Methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
US10253320B2 (en) 2010-05-26 2019-04-09 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US8980858B2 (en) 2010-05-26 2015-03-17 Curna, Inc. Treatment of methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
US8895528B2 (en) 2010-05-26 2014-11-25 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US9624493B2 (en) 2010-05-26 2017-04-18 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US10793857B2 (en) 2010-06-23 2020-10-06 Curna, Inc. Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to SCNA
US9771579B2 (en) 2010-06-23 2017-09-26 Curna, Inc. Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to SCNA
US9394542B2 (en) 2010-07-14 2016-07-19 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US8980860B2 (en) 2010-07-14 2015-03-17 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US9902958B2 (en) 2010-07-14 2018-02-27 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
WO2012016188A2 (fr) 2010-07-30 2012-02-02 Alnylam Pharmaceuticals, Inc. Procédés et compositions pour l'administration d'agents actifs
WO2012016184A2 (fr) 2010-07-30 2012-02-02 Alnylam Pharmaceuticals, Inc. Procédés et compositions pour la délivrance d'agents actifs
WO2012019024A2 (fr) 2010-08-04 2012-02-09 Immunogen, Inc. Molécules se liant à her3 et leurs immunoconjugués
US9845466B2 (en) 2010-08-24 2017-12-19 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US9243246B2 (en) 2010-08-24 2016-01-26 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US10584335B2 (en) 2010-08-24 2020-03-10 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US8871737B2 (en) 2010-09-22 2014-10-28 Alios Biopharma, Inc. Substituted nucleotide analogs
US9278990B2 (en) 2010-09-22 2016-03-08 Alios Biopharma, Inc. Substituted nucleotide analogs
US8993533B2 (en) 2010-10-06 2015-03-31 Curna, Inc. Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
US9222088B2 (en) 2010-10-22 2015-12-29 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9873873B2 (en) 2010-10-22 2018-01-23 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US8790649B2 (en) 2010-10-29 2014-07-29 Immunogen, Inc. EGFR-binding molecules and immunoconjugates thereof
US9238690B2 (en) 2010-10-29 2016-01-19 Immunogen, Inc. Non-antagonistic EGFR-binding molecules and immunoconjugates thereof
US9125896B2 (en) 2010-10-29 2015-09-08 Immunogen, Inc. EGFR-binding molecules and immunoconjugates thereof
US9416360B2 (en) * 2010-11-05 2016-08-16 MiRagen Therapeutics, Inc. Base modified oligonucleotides
US20130296402A1 (en) * 2010-11-05 2013-11-07 Miragen Therapeutics Base modified oligonucleotides
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
US11679157B2 (en) 2010-11-15 2023-06-20 The Ohio State University Controlled release mucoadhesive systems
US10758619B2 (en) 2010-11-15 2020-09-01 The Ohio State University Controlled release mucoadhesive systems
US10000752B2 (en) 2010-11-18 2018-06-19 Curna, Inc. Antagonat compositions and methods of use
US8987225B2 (en) 2010-11-23 2015-03-24 Curna, Inc. Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
US9809816B2 (en) 2010-11-23 2017-11-07 Curna, Inc. Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
WO2012099755A1 (fr) 2011-01-11 2012-07-26 Alnylam Pharmaceuticals, Inc. Lipides pégylés et leur utilisation pour une administration de médicament
EP3202760A1 (fr) 2011-01-11 2017-08-09 Alnylam Pharmaceuticals, Inc. Lipides pégylés et leur utilisation pour l'administration de médicaments
US20140080894A1 (en) * 2011-03-02 2014-03-20 David L. McElligott Enhanced biodistribution of oligomers
US8664192B2 (en) 2011-03-07 2014-03-04 The Ohio State University Mutator activity induced by microRNA-155 (miR-155) links inflammation and cancer
US9593330B2 (en) 2011-06-09 2017-03-14 Curna, Inc. Treatment of frataxin (FXN) related diseases by inhibition of natural antisense transcript to FXN
US9902959B2 (en) 2011-06-09 2018-02-27 Curna, Inc. Treatment of Frataxin (FXN) related diseases by inhibition of natural antisense transcript to FXN
WO2013003112A1 (fr) 2011-06-27 2013-01-03 The Jackson Laboratory Procédés et compositions pour le traitement du cancer et d'une maladie auto-immune
EP2568046A1 (fr) 2011-09-06 2013-03-13 Centre National de la Recherche Scientifique (C.N.R.S) Micro ARN de l'herpèsvirus humain type 6
US10583128B2 (en) 2011-09-06 2020-03-10 Curna, Inc. Treatment of diseases related to alpha subunits of sodium channels, voltage-gated (SCNxA) with small molecules
US10655184B2 (en) 2011-09-13 2020-05-19 Interpace Diagnostics, Llc Methods and compositions involving miR-135b for distinguishing pancreatic cancer from benign pancreatic disease
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US9657360B2 (en) 2011-09-13 2017-05-23 Commonwealth Scientific And Industrial Research Organisation Detection of viral infection
EP3456317A1 (fr) 2011-09-27 2019-03-20 Alnylam Pharmaceuticals, Inc. Lipides di-aliphatiques pegylés substitués
WO2013049328A1 (fr) 2011-09-27 2013-04-04 Alnylam Pharmaceuticals, Inc. Lipides di-aliphatiques pegylés substitués
US9249468B2 (en) 2011-10-14 2016-02-02 The Ohio State University Methods and materials related to ovarian cancer
US9233171B2 (en) 2011-11-21 2016-01-12 Immunogen, Inc. Method of treatment of tumors that are resistant to EGFR antibody therapies by EGFR antibody cytotoxic agent conjugate
US9481885B2 (en) 2011-12-13 2016-11-01 Ohio State Innovation Foundation Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
US8980865B2 (en) 2011-12-22 2015-03-17 Alios Biopharma, Inc. Substituted nucleotide analogs
US9605018B2 (en) 2011-12-22 2017-03-28 Alios Biopharma, Inc. Substituted nucleotide analogs
US9556432B2 (en) 2012-01-10 2017-01-31 The Research Foundation For The State University Of New York Method of treating hyperlipidemia and atherosclerosis with miR-30C
US9434995B2 (en) 2012-01-20 2016-09-06 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US8859202B2 (en) 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US10214745B2 (en) 2012-03-15 2019-02-26 The Scripps Research Institute Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
WO2013142114A1 (fr) 2012-03-19 2013-09-26 The Brigham And Women's Hosptial, Inc. Facteur de différenciation de croissance (gdf) destiné au traitement d'insuffisance cardiaque diastolique
US8916538B2 (en) 2012-03-21 2014-12-23 Vertex Pharmaceuticals Incorporated Solid forms of a thiophosphoramidate nucleotide prodrug
US9394330B2 (en) 2012-03-21 2016-07-19 Alios Biopharma, Inc. Solid forms of a thiophosphoramidate nucleotide prodrug
US9856284B2 (en) 2012-03-21 2018-01-02 Alios Biopharma, Inc. Solid forms of a thiophosphoramidate nucleotide prodrug
US9012427B2 (en) 2012-03-22 2015-04-21 Alios Biopharma, Inc. Pharmaceutical combinations comprising a thionucleotide analog
US9057068B1 (en) * 2012-04-01 2015-06-16 The Ohio State University Methods and compositions using miR-3151 in the diagnosis and treatment of cancer
US9163235B2 (en) 2012-06-21 2015-10-20 MiRagen Therapeutics, Inc. Inhibitors of the miR-15 family of micro-RNAs
EP4140497A1 (fr) 2013-04-08 2023-03-01 President and Fellows of Harvard College Compositions pour rajeunir des cellules souches de muscle squelettique
WO2014168973A2 (fr) 2013-04-08 2014-10-16 President And Fellows Of Harvard College Procédés et compositions pour rajeunir des cellules souches de muscle squelettique
WO2014201143A1 (fr) 2013-06-11 2014-12-18 President And Fellows Of Harvard College Procédés et compositions pour augmenter la neurogenèse et l'angiogenèse
EP3881859A1 (fr) 2013-06-11 2021-09-22 President and Fellows of Harvard College Procédés et compositions pour augmenter la neurogenèse et l'angiogenèse
EP4039278A1 (fr) 2013-07-11 2022-08-10 Alnylam Pharmaceuticals, Inc. Conjugués d'oligonucléotides et de ligands, et procédé pour leur préparation
WO2015006740A2 (fr) 2013-07-11 2015-01-15 Alnylam Pharmaceuticals, Inc. Conjugués ligands d'oligonucléotides et procédé pour leur préparation
WO2015023433A1 (fr) 2013-08-14 2015-02-19 Primeradx, Inc. Compositions et procédés d'analyse multiplex d'acides nucléiques nras et braf
WO2015023503A2 (fr) 2013-08-14 2015-02-19 Primeradx, Inc. Compositions et méthodes pour l'analyse multimodale d'acides nucléiques cmet
US10695442B2 (en) 2014-05-12 2020-06-30 The Johns Hopkins University Engineering synthetic brain penetrating gene vectors
WO2015175539A1 (fr) 2014-05-12 2015-11-19 The Johns Hopkins University Fabrication de vecteurs génétiques synthétiques pénétrant le cerveau
WO2015175545A1 (fr) 2014-05-12 2015-11-19 The Johns Hopkins University Plate-formes de vecteurs de gènes biodégradables très stables pour surmonter des barrières biologiques
US9937270B2 (en) 2014-05-12 2018-04-10 The John Hopkins University Engineering synthethic brain penetrating gene vectors
WO2015187541A1 (fr) 2014-06-02 2015-12-10 Children's Medical Center Corporation Procédés et compositions pour une immunomodulation
US9994847B2 (en) * 2014-09-08 2018-06-12 MiRagen Therapeutics, Inc. miR-29 mimics and uses thereof
US20160355815A1 (en) * 2014-09-08 2016-12-08 MiRagen Therapeutics, Inc. miR-29 Mimics and Uses Thereof
EP3797789A1 (fr) 2015-01-20 2021-03-31 The Children's Medical Center Corporation Composés anti-net pour traiter ou prévenir la fibrose et pour faciliter la cicatrisation des plaies
US10731157B2 (en) 2015-08-24 2020-08-04 Halo-Bio Rnai Therapeutics, Inc. Polynucleotide nanoparticles for the modulation of gene expression and uses thereof
WO2017156015A2 (fr) 2016-03-07 2017-09-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Micro-arn et leurs procédés d'utilisation
WO2019157381A1 (fr) 2018-02-10 2019-08-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Composite nanoparticule-hydrogel pour l'administration de molécules d'acides nucléiques
US11499152B2 (en) * 2018-03-14 2022-11-15 Beth Israel Deaconess Medical Center Inhibitors of micro-RNA 22
WO2019180153A1 (fr) 2018-03-22 2019-09-26 Hummingbird Diagnostics Gmbh Composés de modulation de mir-34a dans la thérapie de maladies
WO2020261227A1 (fr) 2019-06-26 2020-12-30 Biorchestra Co., Ltd. Nanoparticules micellaires et utilisations associées
US11839624B2 (en) 2019-06-26 2023-12-12 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof
DE112020003843T5 (de) 2019-08-14 2022-05-19 Acuitas Therapeutics, Inc. Verbesserte Lipid-Nanopartikel zur Zuführung von Nukleinsäuren
EP3831843A1 (fr) 2019-12-08 2021-06-09 Royal College Of Surgeons In Ireland Agent hémostatique et ses utilisations
WO2021115886A1 (fr) 2019-12-08 2021-06-17 Royal College Of Surgeons In Ireland Agent hémostatique et utilisations de ce dernier
WO2021155139A1 (fr) 2020-01-31 2021-08-05 Regeneron Pharmaceuticals, Inc. Utilisation de la chromatographie liquide et de la spectrométrie de masse pour caractériser des oligonucléotides
WO2022171899A1 (fr) 2021-02-15 2022-08-18 Institut Pasteur Micro-arn à codage viral destiné à être utilisé dans le diagnostic, le pronostic et le traitement d'une infection par sars-cov-2 et maladie associée
WO2023014938A1 (fr) 2021-08-05 2023-02-09 Sanegene Bio Usa Inc. Dérivés de ribose modifiés par 1'-alkyle et procédés d'utilisation
WO2023049258A1 (fr) 2021-09-22 2023-03-30 Sanegene Bio Usa Inc. Dérivés de ribose modifiés par 2'-alkyle ou 3'-alkyle destinés à être utilisés dans l'administration in vivo d'oligonucléotides
WO2023059695A1 (fr) 2021-10-05 2023-04-13 Sanegene Bio Usa Inc. Dérivés de cyclopentane polyhydroxylés et procédés d'utilisation
WO2023118150A1 (fr) 2021-12-22 2023-06-29 Royal College Of Surgeons In Ireland Conjugué destiné à être utilisé dans la localisation d'une molécule dans l'endothélium vasculaire
WO2023164464A1 (fr) 2022-02-22 2023-08-31 Sanegene Bio Usa Inc. Dérivés de ribonucléotides carbocycliques modifiés en position 5' et procédés d'utilisation
WO2024015796A1 (fr) 2022-07-11 2024-01-18 Sanegene Bio Usa Inc. Dérivés du ribose modifié en 2' optimisés et procédés d'utilisation

Also Published As

Publication number Publication date
WO2008091703A3 (fr) 2008-11-13
WO2008091703A2 (fr) 2008-07-31
US20100222413A1 (en) 2010-09-02
US8541385B2 (en) 2013-09-24
US20140073684A1 (en) 2014-03-13

Similar Documents

Publication Publication Date Title
US8541385B2 (en) Chemically modified oligonucleotides for use in modulation micro RNA and uses thereof
EP1919512B1 (fr) Oligonucléotides chimiquement modifiés pouvant être employés dans la modulation de micro-arn et applications
US20190264203A1 (en) Glycoconjugates of rna interference agents
US20220125823A1 (en) Extrahepatic delivery
US20110257244A1 (en) Chemically modified oligonucleotides and small molecules for use in reducing micro rna activity levels and uses thereof
US20110065774A1 (en) Chemically modified oligonucleotides and uses thereof
US20110118339A1 (en) Chemically modified oligonucleotides and uses thereof
US20220307024A1 (en) Delivery of oligonucleotides to the striatum
EP3856907A1 (fr) Compositions d'arni de la transthyrétine (ttr) et leurs procédés d'utilisation pour traiter ou prévenir des maladies oculaires associées à la ttr
WO2022147214A2 (fr) Promédicaments oligonucléotidiques à base de phosphate modifiés par un disulfure cyclique
US20230257745A1 (en) Circular siRNAs
EP3385272A1 (fr) Nouveaux conjugués de ligand d'oligonucléotide
US12005074B2 (en) Extrahepatic delivery
US20240009225A1 (en) Extrahepatic delivery
AU2012211398A1 (en) Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
WO2024073732A1 (fr) Agents arn double brin modifiés
WO2023220744A2 (fr) Oligonucléotides à boucle simple brin

Legal Events

Date Code Title Description
AS Assignment

Owner name: ALNYLAM PHARMACEUTICALS, INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MANOHARAN, MUTHIAH, MR.;RAJEEV, KALLANTHOTTATHIL G, MR.;REEL/FRAME:019292/0884;SIGNING DATES FROM 20070206 TO 20070207

Owner name: THE ROCKEFELLER UNIVERSITY, NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:STOFFEL, MARKUS, MR.;REEL/FRAME:019292/0873

Effective date: 20070322

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: REGULUS THERAPEUTICS INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ALNYLAM PHARMACEUTICALS, INC.;REEL/FRAME:034437/0620

Effective date: 20141204

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:ROCKEFELLER UNIVERSITY;REEL/FRAME:035242/0043

Effective date: 20150312

AS Assignment

Owner name: THE NATIONAL INSTITUTES OF HEALTH -DIRECTOR DEITR,

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:THE ROCKEFELLER UNIVERSITY;REEL/FRAME:050461/0418

Effective date: 20190916