US20050003986A1 - Useful mutations of bacterial alkaline protease - Google Patents

Useful mutations of bacterial alkaline protease Download PDF

Info

Publication number
US20050003986A1
US20050003986A1 US10/896,177 US89617704A US2005003986A1 US 20050003986 A1 US20050003986 A1 US 20050003986A1 US 89617704 A US89617704 A US 89617704A US 2005003986 A1 US2005003986 A1 US 2005003986A1
Authority
US
United States
Prior art keywords
subtilisin
substitution
modified subtilisin
gene
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/896,177
Inventor
Sven Hastrup
Sven Branner
Fanny Norris
Steffen Petersen
Leif Norskov-Lauridsen
Villy Jensen
Dorrit Aaslyng
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=8089323&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20050003986(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Novozymes AS filed Critical Novozymes AS
Priority to US10/896,177 priority Critical patent/US20050003986A1/en
Publication of US20050003986A1 publication Critical patent/US20050003986A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus

Definitions

  • the present invention relates to mutations of the subtilisin gene which result in changes in the chemical characteristics of subtilisin enzyme. Mutations at specific nucleic acids of the subtilisin gene result in amino acid substitutions and consequently, altered enzyme function. Some of these mutant enzymes exhibit physical properties advantageous to industrial applications, particularly in the detergent industry, providing subtilisins which are more stable to oxidation, possess greater protease activity, and exhibit improved washability.
  • Enzymes cleaving the amide linkages in protein substrates are classified as proteases, or (interchangeably) peptidases (See Walsh, 1979, Enzymatic Reaction Mechanisms, W. H. Freeman and Company, San Francisco, Chapter 3).
  • Bacteria of the Bacillus species secrete two extracellular species of protease, a neutral, or metalloprotease, and an alkaline protease which is functionally a serine endopeptidase, referred to as subtilisin. Secretion of these proteases has been linked to the bacterial growth cycle, with greatest expression of protease during the stationary phase, when sporulation also occurs. Joliffe et al. (1980, J. Bacterial. 141:1199-1208) has suggested that Bacillus proteases function in cell wall turnover.
  • a serine protease is an enzyme which catalyzes the hydrolysis of peptide bonds, in which there is an essential serine residue at the active site (White, Handler, and Smith, 1973, “Principles of Biochemistry,” Fifth Edition, McGraw-Hill Book Company, NY, pp. 271-272).
  • the serine proteases have molecular weights in the 25,000 to 30,000 range. They are inhibited by diisopropylfluorophosphate, but in contrast to metalloproteases, are resistant to ethylenediamine-tetra acetic acid (EDTA) (although they are stabilized at high temperatures by calcium ion). They hydrolyze simple terminal esters and are similar in activity to eukaryotic chymotrypsin, also a serine protease.
  • EDTA ethylenediamine-tetra acetic acid
  • alkaline protease reflects the high pH optimum of the serine proteases, from pH 9.0 to 11.0 (for review, see Priest, 1977, Bacteriological Rev. 41:711-753).
  • subtilisin is a serine protease produced by Gram-positive bacteria or fungi.
  • subtilisins A wide variety of subtilisins have been identified, and the amino acid sequences of at least eight subtilisins have been determined. These include six subtilisins from Bacillus strains, namely, subtilisin 168, subtilisin BPN′, subtilisin Carlsberg, subtilisin DY, subtilisin amylosacchariticus, and mesentericopeptidase (Kurihara et al., 1972, J. Biol. Chem. 247:29-5631; Stahl and Ferrari, 1984, J. Bacteriol. 158:411-418; Vasantha et al., 1984, J. Bacteriol.
  • subtilisins are well-characterized physically and chemically.
  • primary structure amino acid sequence
  • subtilisin amino acid sequence
  • over 50 high resolution X-ray structures of subtilisin have been determined which delineate the binding of substrate, transition state, products, three different protease inhibitors, and define the structural consequences for natural variation (Kraut, 1971, Ann. Rev. Biochem. 46:331-358).
  • Random and site-directed mutations of the subtilisin gene have both arisen from knowledge of the physical and chemical properties of the enzyme and contributed information relating to subtilisin's catalytic activity, substrate specificity, tertiary structure, etc. (Wells et al., 1987, Proc. Natl. Acad. Sci. U.S.A.
  • subtilisins have found much utility in industry, particularly detergent formulations, as they are useful for removing proteinaceous stains. To be effective, however, these enzymes must not only possess activity under washing conditions, but must also be compatible with other detergent components during storage.
  • subtilisin may be used in combination with amylases, which are active against starches; cellulases which will digest cellulosic materials; lipases, which are active against fats; peptidases, which are active on peptides, and ureases, which are effective against urine stains.
  • amylases which are active against starches
  • cellulases which will digest cellulosic materials
  • lipases which are active against fats
  • peptidases which are active on peptides, and ureases, which are effective against urine stains.
  • subtilisin must be stable with respect to the oxidizing power, calcium binding properties, detergency and high pH of nonenzymatic detergent components. The ability of the enzyme to remain stable in their presence is often referred to
  • the present invention relates to mutations of the subtilisin gene, some of which result in changes in the chemical characteristics of subtilisin enzyme. Mutations are created at specific nucleic acids of the subtilisin gene, and, in various specific embodiments, the mutant enzymes possess altered chemical properties including, but not limited to, increased stability to oxidation, augmented proteolytic ability, and improved washability.
  • the present invention also relates, but is not limited to the amino acid and DNA sequences for protease mutants derived from Bacillus lentus variants, subtilisin 147 and subtilisin 309, as well as mutations of these genes and the corresponding mutant enzymes.
  • Site-directed mutation can efficiently produce mutant subtilisin enzymes which can be tailored to suit a multitude of industrial applications particularly in the areas of detergent and food technology.
  • the present invention relates, in part, but is not limited to, mutants of the subtilisin 309 gene which exhibit improved stability to oxidation, augmented protease activity, and/or improved washability.
  • FIG. 1 illustrates the insertion of a subset of fragments, ranging from 1.5 kb to 6.5 kb in length, generated by partial digestion of Bacillus lentus strain 309 DNA with Sau 3A restriction endonuclease, into Bam HI cut plasmid pSx50.
  • the two resulting plasmids, pSx86 and pSx88, containing the subtilisin 309 gene in opposite orientations, are also shown.
  • FIG. 2 illustrates the insertion of Bacillus lentus strain 147 DNA fragments into plasmid pSX56. Partial digestion of strain 147 DNA was performed using Sau 3A restriction endonuclease. Fragments ranging in size from 1.5 to 6.5 kb were then ligated into Bam HI cleaved plasmid pSX56. The product, pSX94, contains the subtilisin 147 gene.
  • FIG. 3 illustrates gapped duplex mutagenesis, using the method of Morinaga et al. (1984, Biotechnology 2:636-639). It features two plasmids, pSX93 and pSX119, both derived from puCl3.
  • pSX93 contains an XbaI-HindIII fragment of the subtilisin 309 gene
  • pSX119 contains the remainder of the subtilisin 309 gene in an EcoRI-XbaI fragment.
  • plasmid pSX93 is cleaved with XbaI and ClaI, and the gapped molecules are mixed with pSX93 cut with ScaI, denatured, and allowed to reanneal so as to generate plasmids with a region of single-stranded DNA extending within the subtilisin 309 coding sequence.
  • a synthetic oligonucleotide, homologous to the subtilisin 309 gene but containing a mutation, is allowed to anneal to the single stranded gap, which is then filled in using the Klenow fragment of DNA polymerase I and T4 DNA ligase.
  • double-stranded mutants of the subtilisin 309 gene are generated.
  • the same procedure is performed in (B), using plasmid pSX119 and EcoRI and XbaI enzymes, to create mutations in the corresponding region of the subtilisin 309 gene.
  • FIG. 4 illustrates plasmid pSX92, which is a derivative of plasmid pSX62, bearing the subtilisin 309 gene. Mutated fragments (i.e., XbaI - ClaI, XbaI-HindIII, or EcoRI-XbaI), excised from mutation plasmid pSX93 or pSX119 (see FIG. 3 ) using the appropriate restriction endonucleases, were inserted into plasmid pSX92 for expression in B. subtilis strain DN 497.
  • Mutated fragments i.e., XbaI - ClaI, XbaI-HindIII, or EcoRI-XbaI
  • FIG. 5 illustrates plasmid pSXl43, which contains truncated forms of both subtilisin 309 and subtilisin 147 genes. In vivo recombination between homologous regions of the two genes can result in active protease.
  • the invention relates to mutations of the subtilisin gene, some of which result in changes in the chemical characteristics of subtilisin enzyme. Mutations at specific nucleic acids may be generated, and thus, forms of subtilisin can be designed so as to meet the needs of industrial application.
  • the invention is based, in part, upon the discovery that nutations of specific nucleic acids in the subtilisin gene can result in enzymes with altered properties.
  • enzymes with improved stability to oxidation, augmented protease activity, or improved washing ability can be generated.
  • subtilisins for purposes of clarity in description, and not by way of limitation, the invention will be described in four parts: (a) the chemical structure of known subtilisins and subtilisin 147 and 309; (b) methods for producing mutations in the subtilisin gene; (c) expression of mutants of subtilisin and (d) screening of subtilisin mutants for desirable chemical properties.
  • subtilisins from various sources can reveal the functional significance of the primary amino acid sequence, and can direct the creation of new mutants with deliberately modified functions. Comparing the amino acid sequence of different forms of subtilisin, while contrasting their physical or chemical properties, may reveal specific target regions which are likely to produce useful mutant enzymes.
  • subtilisins The amino acid sequences of at least eight subtilisins are known. These include six subtilisins from Bacillus strains, namely, subtilisin 168, subtilisin BPN′, subtilisin Carlsberg, subtilisin DY, subtilisin amylosacchariticus and mesentericopeptidase (Kurihara et al., 1972, J. Biol. Chem. 247:5629-5631; Stahl and Ferrari, 1984, J. Bacteriol. 158:411-418; Vasantha et al., 1984, J. Bacteriol. 159:811-819; Jacobs et al., 1985, Nucl. Acids Res. 13:8913-8926; Nedkov et al., 1985, Biol.
  • subtilisin 147 and 309 the amino acid and DNA sequences for two further serine proteases are revealed.
  • proteases were derived from two Bacillus lentus variants, C303 and C360, which have been deposited with NCIB and designated the accession numbers NCIB 10147 and NCIB 10309, respectively.
  • the proteases produced by these strains are designated subtilisin 147 and subtilisin 309, respectively, and the genes encoding these proteins are referred to as the subtilisin 147 and 309 genes.
  • subtilisin material refers to a proteinaceous material which contains a subtilisin as its active ingredient.
  • subtilisin material any serine protease is a subtilisin which has at least 30%, preferably 50%, and more preferably 80% amino acid sequence homology with the sequences referenced above for subtilisin 147, subtilisin 309, subtilisin 168, subtilisin BPN', subtilisin Carlsberg, subtilisin DY, subtilisin amylosacchariticus, mesentericopeptidase, thermitase, proteinase K and thermomycolase.
  • subtilisin material refers to a proteinaceous material which contains a subtilisin as its active ingredient.
  • any serine protease is a subtilisin which has at least 30%, preferably 50%, and more preferably 80% amino acid sequence homology with the sequences referenced above for subtilisin 147, subtilisin 309, subtilisin 168, subtilisin BPN', subtilisin Carlsberg, subtil
  • Table I compares the deduced amino acid sequences of subtilisin 309, subtilisin 147, subtilisin BPN', subtilisin Carlsberg and subtilisin 168 (Spizizen, et al., 1958, Proc. Natl. Acad. Sci. U.S.A. 44:1012-1078).
  • Table II presents the nucleic acid sequence of the subtilisin 309 gene
  • Table III presents the nucleic acid sequence of the subtilisin 147 gene.
  • the sequences of subtilisin 309 or 147, or their functional equivalents, can be used in accordance with the invention.
  • subtilisin 309 or 147 depicted in Tables I, II or III can be altered by substitutions, additions or deletions that provide for functionally equivalent molecules.
  • other DNA sequences which encode substantially the same amino acid sequence as depicted in Table I may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of the subtilisin 309 or 147 sequences depicted in Table II or III which are altered by the substitution of different codons that encode the same or a functionally equivalent amino acid residues within the sequence, thus producing a silent change.
  • one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine, and histidine.
  • the negatively charged (acidic) amino acids include aspartic and glutamic acid.
  • sequences determined for subtilisins 309 and 147 can be compared with sequences of known subtilisins (see Table I) or newly discovered subtilisins in order to deduce sites for desirable mutations. To do this, the closeness of relation of the subtilisins being compared must be determined.
  • subtilisins 309 and 147 were compared with one another and with the sequences of other subtilisins (see Table II). Residues that varied between subtilisin 309 or 147 and other subtilisins were identified.
  • subtilisin 309 contains a serine residue
  • subtilisin 147, subtilisin BPN′, Carlsberg and 168 contain an alanine residue. Therefore, if the serine 153 residue of subtilisin 309 were changed to an alanine residue, the physical properties of subtilisin 309 might be altered in a desired direction.
  • subtilisin 147 contains a serine residue at position 218, whereas the other subtilisins expressed an asparagine residue. Because subtilisin 147 has improved thermal stability relative to the other subtilisins, mutating the asparagine 218 of subtilisin 309 to a serine residue might improve the thermal stability of subtilisin 309.
  • subtilisin As another example, it was reasoned that, since Thr 71 is close to the active site, the introduction of a negatively charged amino acid, such as aspartic acid, might suppress oxidative attack by electrostatic repulsion.
  • the sites that are most likely to be relevant to the physical properties of subtilisin are those in which there is conservation of amino acid residues between most subtilisins, for example Asp-153 and Asn-218 discussed above, and also Trp-6, Arg-170, Pro-168, His-67, Met-175, Gly-219, Arg-275.
  • subtilisin substrate specificity The catalytic activities of various subtilisins can differ markedly against selected substrates.
  • Wells has shown that only three amino acid substitutions can cause B. amyloliquefaciens subtilisin substrate specificity to approach that of B. licheniformis subtilisin, enzymes that differ by factors of 10-50 in catalytic efficiency in their native state.
  • subtilisin 147 and 309 Comparison analysis between subtilisin 147 and 309 and other subtilisins has indicated that mutation of the following sites may alter the physical or chemical properties of subtilisin: 6, 9, 11-12, 19, 25, 36-38, 53-59, 67, 71, 89, 104, 111, 115, 120, 121-122, 124, 128, 131, 140, 153-166, 168, 169-170, 172, 175, 180, 182, 186, 187, 191, 194, 195, 199, 218, 219, 222, 226, 234-238, 241, 260-262, 265, 268, or 275.
  • Deletions occur at the following sites in subtilisins 147 and/or 309; insertion of appropriate amino acid residues into these sites might enhance the stability of the parent enzymes: 1, 36, 56, 159, 164-166. According to the method illustrated by these examples, which are not limiting, a number of potential mutation sites become apparent.
  • subtilisin genes Many methods for introducing mutations into genes are well known in the art. After a brief discussion of cloning subtilisin genes, methods for generating mutations in both random sites and specific sites within the subtilisin gene will be discussed.
  • subtilisin may be cloned from any Gram-positive bacteria or fungus by various methods well known in the art. First a genomic and/or cDNA library of DNA must be constructed using chromosomal DNA or messenger RNA from the organism that produces the subtilisin to be studied. Then, if the amino acid sequence of the subtilisin is known, homologous, labelled oligonucleotide probes may be synthesized and used to identify subtilisin-encoding clones from a genomic library of bacterial DNA, or from a fungal cDNA library.
  • a labelled oligonucleotide probe containing sequences homologous to subtilisin from another strain of bacteria or fungus could be used as a probe to identify subtilisin-encoding clones, using hybridization and washing conditions of lower stringency.
  • subtilisin-producing clones would involve inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming protease-negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar containing a substrate for subtilisin, such as skim milk. Those bacteria containing subtilisin-bearing plasmid will produce colonies surrounded by a halo of clear agar, due to digestion of the skim milk by excreted subtilisin.
  • an expression vector such as a plasmid
  • transforming protease-negative bacteria with the resulting genomic DNA library
  • subtilisin gene has been cloned into a suitable vector, such as a plasmid, several methods can be used to introduce random mutations into the gene.
  • One method would be to incorporate the cloned subtilisin gene, as part of a retrievable vector, into a mutator strain of Eschericia coli.
  • Another method would involve generating a single stranded form of the subtilisin gene, and then annealing the fragment of DNA containing the subtilisin gene with another DNA fragment such that a portion of the subtilisin gene remained single stranded.
  • This discrete, single stranded region could then be exposed to any of a number of mutagenizing agents, including, but not limited to, sodium bisulfite, hydroxylamine, nitrous acid, formic acid, or hydralazine.
  • mutagenizing agents including, but not limited to, sodium bisulfite, hydroxylamine, nitrous acid, formic acid, or hydralazine.
  • a specific example of this method for generating random mutations is described by Shortle and Nathans (1978, Proc. Natl. Acad. Sci. U.S.A., 75:2170-2174).
  • the plasmid bearing the subtilisin gene would be nicked by a restriction enzyme that cleaves within the gene. This nick would be widened into a gap using the exonuclease action of DNA polymerase I. The resulting single-stranded gap could then be mutagenized using any one of the above mentioned mutagenizing agents.
  • subtilisin gene from a Bacillus species including the natural promoter and other control sequences could be cloned into a plasmid vector containing replicons for both E. coli and B. subtilis , a selectable phenotypic marker and the M13 origin of replication for production of single-stranded plasmid DNA upon superinfection with helper phage IR1.
  • Single-stranded plasmid DNA containing the cloned subtilisin gene is isolated and annealed with a DNA fragment containing vector sequences but not the coding region of subtilisin, resulting in a gapped duplex molecule.
  • Mutations are introduced into the subtilisin gene either with sodium bisulfite, nitrous acid or formic acid or by replication in a mutator strain of E. coli as described above. Since sodium bisulfite reacts exclusively with cytosine in a single-stranded DNA, the mutations created with this mutagen are restricted only to the coding regions. Reaction time and bisulfite concentration are varied in different experiments such that from one to five mutations are created per subtilisin gene on average. Incubation of 10 micrograms of gapped duplex DNA in 4 M Na-bisulfite, pH 6.0, for 9 minutes at 37° C. in a reaction volume of 400 microliters, deaminates about 1% of cytosines in the single-stranded region. The coding region of mature subtilisin contains about 200 cytosines, depending on the DNA strand.
  • the reaction time is varied from about 4 minutes (to produce a mutation frequency of about one in 200) to about 20 minutes (about 5 in 200).
  • the gapped molecules are treated in vitro with DNA polymerase I (Klenow fragment) to make fully double-stranded molecules and to fix the mutations.
  • Competent E. coli are then transformed with the mutagenized DNA to produce an amplified library of mutant subtilisins.
  • Amplified mutant libraries can also be made by growing the plasmid DNA in a Mut D strain of E. coli which increases the range of mutations due to its error prone DNA polymerase.
  • the mutagens nitrous acid and formic acid may also be used to produce mutant libraries. Because these chemicals are not as specific for single-stranded DNA as sodium bisulfite, the mutagenesis reactions are performed according to the following procedure. The coding portion of the subtilisin gene is cloned in M13 phage by standard methods and single stranded phage DNA prepared. The single-stranded DNA is then reacted with 1 M nitrous acid pH 4.3 for 15-60 minutes at 23° C. or 2.4 M formic acid for 1-5 minutes at 23° C. These ranges of reaction times produce a mutation frequency of from 1 in 1000 to 5 in 1000.
  • a universal primer is annealed to the M13 DNA and duplex DNA is synthesized using the mutagenized single stranded DNA as a template so that the coding portion of the subtilisin gene becomes fully double-stranded.
  • the coding region can be cut out of the M13 vector with restriction enzymes and ligated into an unmutagenized expression vector so that mutations occur only in the restriction fragment (Myers et al., 1985, Science 229:242-257).
  • mutations can be generated by allowing two dissimilar forms of subtilisin to undergo recombination in vivo. According to this method, homologous regions within the two genes lead to a cross-over of corresponding regions resulting in the exchange of genetic information.
  • the generation of hybrid amylase molecules according to this technique is fully described in U.S. application Ser. No. 67,992, filed on Jun. 29, 1987, which is fully incorporated herein by reference.
  • An example of a plasmid which can generate hybrid forms of subtilisin is depicted in FIG. 5 . Both the subtilisin 309 and 147 genes, incorporated into plasmid pSX143, are truncated, and therefore cannot themselves lead to subtilisin expression.
  • subtilisin 309 if recombination occurs between the two genes so as to correct the defect produced by truncation, i.e., the N terminal region of the subtilisin 309 gene becomes linked to the C terminal region of the subtilisin 147 gene, then active, mutant subtilisin can be produced. If pSX143 is incorporated into a protease-negative strain of bacteria, and then bacteria that develop a protease positive phenotype are selected, then various mutants, subtilisin 309/147 chimeras, can be identified.
  • subtilisin gene Once the subtilisin gene has been cloned, and desirable sites for mutation identified, these mutations can be introduced using synthetic oligo nucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites; mutant nucleotides are inserted during oligonucleotide synthesis.
  • a single stranded gap of DNA, bridging the subtilisin gene is created in a vector bearing the subtilisin gene.
  • the synthetic nucleotide, bearing the desired mutation is annealed to a homologous portion of the single-stranded DNA. The remaining gap is then filled in by DNA polymerase I (Klenow fragment) and the construct is ligated using T4 ligase.
  • a fragment within the gene is removed using restriction endonuclease.
  • the vector/gene, now containing a gap is then denatured and hybridized to vector/gene which, instead of containing a gap, has been cleaved with another restriction endonuclease at a site outside the area involved in the gap.
  • a single-stranded region of the gene is then available for hybridization with mutated oligonucleotides, the remaining gap is filled in by the Klenow fragment of DNA polymerase I, the insertions are ligated with T4 DNA ligase, and, after one cycle of replication, a double-stranded plasmid bearing the desired mutation is produced.
  • the Morinaga method obviates the additional manipulation of construction new restriction sites, and therefore facilitates the generation of mutations at multiple sites.
  • a mutated subtilisin gene produced by methods described above, or any alternative methods known in the art can be expressed, in enzyme form, using an expression vector.
  • An expression vector generally falls under the definition of a cloning vector, since an expression vector usually includes the components of a typical cloning vector, namely, an element that permits autonomous replication of the vector in a microorganism independent of the genome of the microorganism, and one or more phenotypic markers for selection purposes.
  • An expression vector includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and, optionally, a repressor gene.
  • nucleotides encoding a “signal sequence” may be inserted prior to the coding sequence of the gene.
  • a target gene to be treated according to the invention is operably linked to the control sequences in the proper reading frame.
  • Promoter sequences that can be incorporated into plasmid vectors, and which can support the transcription of the mutant subtilisin gene include but are not limited to the prokaryotic beta-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731) and the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25). Further references can also be found in “Useful proteins from recombinant bacteria” in Scientific American, 1980, 242:74-94.
  • B. subtilis is transformed by an expression vector carrying the mutated DNA. If expression is to take place in a secreting microorganism such as B. subtilis a signal sequence may follow the translation initiation signal and precede the DNA sequence of interest. The signal sequence acts to transport the expression product to the cell wall where it is cleaved from the product upon secretion.
  • control sequences as defined above is intended to include a signal sequence, when it is present.
  • transformed B. subtilis can be cultivated in the presence of a filter material (such as nitrocellulose) to which the secreted expression product (e.g. enzyme) binds.
  • a filter material such as nitrocellulose
  • the secreted expression product e.g. enzyme
  • filter bound expression product is subjected to conditions which distinguish expression product of interest from wild-type expression product.
  • the filter-bound expression product can be subjected to conditions which would inactivate a wild-type product.
  • Preserved enzyme activity following adverse treatment suggests that the mutation confers enhanced stability on the enzyme, and is therefore a useful mutation.
  • screening for stable variants is accomplished using a protease deficient B. subtilis strain transformed with the variant plasmid and plated out as follows: a nitrocellulose filter is placed on a nutrient base in a petri dish, and a cellulose acetate filter is placed on top of the nitrocellulose. Colonies are grown on the cellulose acetate, and protease from individual colonies is secreted through the cellulose acetate onto the nitrocellulose filter where it is stably bound. Protease from hundreds of colonies is bound to a single filter allowing subsequent screening of thousands of different variants by processing multiple filters.
  • the filters can be incubated in buffer solutions at temperatures which would inactivate substantially all wild-type activity. Variants of enhanced stability or activity retain activity after this step.
  • the suitably treated filter then is soaked in a solution containing Tosyl-L-Arg methyl ester (TAME), Benzoly-Arg-ethyl-ester (BAEE), Acetyl-Tyr-ethyl-ester (ATEE) (Sigma) or similar compounds. Because TAME, BAEE, and ATEE are substrates for the proteases they are cleaved in zones on the filter containing variant subtilisins which remain active after treatment. As cleavage occurs, protons are released in the reaction and cause phenol red to change in color from red to yellow in areas retaining protease activity.
  • the filters could be treated at high temperature, at high pH, with denaturants, oxidizing agents, or under other conditions which normally inactivate an enzyme such as a protease to find resistant variants.
  • Variants with altered substrate specificity could be screened by replacing TAME, BAEE, or ATEE with other substrates which are normally not cleaved by wild-type subtilisin.
  • the colony from which the variant is derived is isolated and the altered subtilisin is purified.
  • Experiments can be performed on the purified enzyme to determine conditions of stability towards oxidation, thermal inactivation, denaturation temperature, kinetic parameters as well as other physical measurements.
  • the altered gene can also be sequenced to determine the amino acid changes responsible for the enhanced stability. Using this procedure, variants with increased washing abilities have been isolated.
  • B. subtilis 309 and 147 are variants of Bacillus lentus , deposited with the NCIB and accorded the accession numbers NCIB 10147 and NCIB 10309, and described in U.S. Pat. No. 3,723,250, issued Mar. 27, 1973, and fully incorporated herein by reference herein.
  • B. subtilis DN 497 is described in U.S. application Ser. No. 039,298 filed Apr. 17, 1987, which is also fully incorporated herein by reference, and is an aro + transformant of RUB 200 with chromosomal DNA from SL 438, a sporulation and protease deficient strain obtained from Dr. Kim Hardy of Biogen. E.
  • pSX50 (described in U.S. application Ser. No. 039,298, supra) is a derivative of plasmid pDN 1050, comprising the promoter-operator P 1 O 1 the B. pumilus xyn B gene and the B. subtilis xyl R gene.
  • pSX65 (described in U.S. application Ser. No. 039,298, supra) is a derivative of plasmid pDN 1050, comprising the promoter-operator P 2 O 2 , the B. pumilus xyn B gene, and the B. subtilis xyl R gene.
  • pSX93 shown in FIG. 3A , is puCl3 (Vieira and Messing, 1982, Gene 19:259-268) comprising a 0.7 kb XbaI-Hind III fragment of the subtilisin 309 gene including the terminator inserted in a polylinker sequence.
  • pSX119 is pUC13 harboring an EcoRI-XbaI fragment of the subtilisin 309 gene inserted into the polylinker.
  • pSX62 (described in U.S. application Ser. No. 039,298, supra) is a derivative of pSX52 (ibid), which comprises a fusion gene between the calf prochymosin gene and the B. pumilus xyn B gene inserted into pSX50 (supra) .
  • pSX62 was generated by inserting the E. coli rrn B terminator into pSX52 behind the prochymosin gene.
  • pSX92 was produced by cloning the subtilisin 309 gene into plasmid pSX62 (supra) cut at Cla I and Hind III and filled prior to the insertion of the fragments DraI-NheI and NheI-Hind III from the cloned subtilisin 309 gene.
  • the procedure relates to a typical purification of a 10 liter scale fermentation of subtilisin 147, subtilisin 309 or mutants thereof.
  • the filtrates were concentrated to approximately 400 ml using an Amicon CH2A UF unit equipped with an Amicon S1Y10 UF cartridge.
  • the UF concentrate was centrifuged and filtered prior to adsorption on a Bacitracin affinity column at pH 7.
  • the protease was eluted from the Bacitracin column using 25% 2-propanol and 1 M sodium chloride in a buffer solution with 0.01 M dimethylglutaric acid, 0.1 M boric acid and 0.002 M calcium chloride adjusted to pH 7.
  • the fractions with protease activity from the Bacitracin purification step were combined and applied to a 750 ml Sephadex G25 column (5 cm dia.) equilibrated with a buffer containing 0.01 M dimethylglutaric acid, 0.2 M boric acid and 0.002 M calcium chloride adjusted to pH 6.5.
  • protease was eluted using a linear gradient of 0-0.1 M sodium chloride in 2 liters of the same buffer (0-0.2 M sodium chloride in case of subtilisin 147).
  • protease containing fractions from the CM Sepharose column were combined and concentrated in an Amicon ultrafiltration cell equipped with a GR81P membrane (from the Danish Sugar Factories Inc.).
  • the purified enzyme is diluted to an enzyme content of approximately 0.1 mg/ml in 0.01 M dimethylglutaric acid pH 7 and in the same buffer with 0.01 M peracetic acid (pH 7).
  • Both sets of dilutions were heated to 50° C. for 20 minutes. Proteolytic activity was measured in the dilutions before and after the heat treatment.
  • Casein Protease Unit CPU
  • CPU Casein Protease Unit
  • reaction mixtures were kept for 20 minutes in the water bath, whereupon they were filtered through Whatman® 42 paper filters.
  • OPA o-phthaldialdehyde
  • Disodium tetraborate decahydrate (7.62 g) and sodium dodecylsulfate (2.0 g) was dissolved in 150 ml of water.
  • OPA 160 mg
  • 4 ml of methanol was then added together with 400 microliters of beta-mercaptoethanol, whereafter the solution was made up to 200 ml with water.
  • the OPA test was also performed with a serine standard containing 10 mg of serine in 100 ml of Britton-Robinson buffer (pH 9.5). The buffer was used as a blank.
  • CPU /g of enzyme preparation CPU/ml: b wherein OD t , OD b , OD Ser and OD B are the optical density of the test solution, blank, serine standard, and buffer, respectively, C Ser is the concentration of serine in mg/ml in the standard, MW Ser is the molecular weight of serine, Q is the dilution factor (in this instance equal to 8) for the enzyme solution, and t i is the incubation time in minutes.
  • Test cloths (7 cm ⁇ 7 cm, approximately 1 g) were produced by passing desized cotton (100% cotton, DS 71) Cloth through the vessel in a Mathis Washing and Drying Unit type TH (Werner Mathis A G, Zurich, Switzerland) containing spinach juice (produced from fresh spinach) and then through the pressure roll of the machine in order to remove excess spinach juice.
  • desized cotton 100% cotton, DS 71
  • TH Mathis Washing and Drying Unit type TH (Werner Mathis A G, Zurich, Switzerland) containing spinach juice (produced from fresh spinach) and then through the pressure roll of the machine in order to remove excess spinach juice.
  • Tests were performed at enzyme concentrations of: 0, 0.05 CPU/1, and 0.1 CPU/l, and two independent sets of tests were performed for each of the mutants.
  • Delta R As a measure of the washing ability differential remission, Delta R, was used, Delta R being equal to the remission after wash with enzyme added minus the remission after wash with no enzyme added.
  • thermostability of the mutants produced was estimated, by performing the test at temperatures of 40° C. and 60° C., respectively.
  • Chromosomal DNA from the “309” strain was isolated by treating a cell suspension with Lysozyme for 30 minutes at 37° C., and then with SDS for 5 minutes at 60° C. Subsequently, the suspension was extracted with phenolchloroform (50:50), precipitated with ethanol, and the precipitate redissolved in TE. This solution was treated with RNase for 1 hour at 37° C.
  • chromosomal DNA was partially digested with restriction enzyme Sau 3A (New England Biolabs) and fragments from about 1.5 kb to about 6.5 kb were isolated on DEAE cellulose paper from a 1% agarose gel (the subtilisin gene in other species is approximately 1.2 kb in length).
  • the cells were then spread on LB agar plates with 10 mM phosphate pH 7, 6 micrograms/ml chloramphenicol, and 0.2% xylose to induce the xyn-promoter in the plasmid.
  • the plates also contained 1% skim milk so the protease producing transformants could be detected by the clear halo where the skim milk had been degraded.
  • Protease expressing clones were produced at a frequency of 10 ⁇ 4 . Two clones were found that harbored plasmids carrying the gene for subtilisin 309, pSX86 and pSX88. The gene was then sequenced using the method of Maxam and Gilbert. The deduced nucleotide sequence of subtilisin 309 is presented in Table II.
  • subtilisin 147 The same procedure as above was used for the cloning of the subtilisin 147 gene except that the DNA fragments were ligated into the plasmid pSXS6 (also described in U.S. application Ser. No. 039,298 supra), which as indicated in FIG. 2 instead of the xyn promoter harbors the xyl promoter.
  • pSXS6 also described in U.S. application Ser. No. 039,298 supra
  • One clone was found harboring a plasmid, pSX94, carrying the gene for subtilisin 147. The sequence for this gene is shown in Table III below.
  • a 27-mer mismatch primer, Nor-237 which also generates a novel SacI restriction site 5′ CACAGTATGGGCGCAGGGCTTGACATTGTCGCACCA GG 3′ NOR-237 5′ GTATGGCGCA GAGCTCG ACATTTGTCGC 3′ SacI b) Gly-195-Asp:
  • a 23-mer mismatch primer, NOR-323 which also generates a novel BglII site AT 5′ CACAGTATGGGCGCAGGGCTTGACATTGTC 3′ 3′ CATACCGCG TCTAGA ACTGTAAC 5′ BglII c) Met-222-Cys:
  • a 23-mer mismatch primer, NOR-325 which also generates a novel MspI site TC 5′ TATGCCAGCTTAAACGGTACATCGATG 3′ NOR-324 3′ TACGGTCGAATA GGCC ATGTAGC 5′ MspI g) Thr-71-Asp:
  • pSX93 Gapped duplex mutagenesis was performed using the plasmid pSX93 as template.
  • pSX93 is shown in FIGS. 3A and 3B, and is pUC13 (Vieira, J. and Messing, J., 1982, Gene 19: 259-268) harboring an 0.7 kb XbaI-HindIII fragment of the subtilisin 309 gene including the terminator inserted in the polylinker. The terminator and the HindIII site are not shown in Table II.
  • pSX119 is pUC13 harboring an EcoRI-XbaI fragment of the subtilisin 309 gene inserted into the polylinker.
  • the templates pSX93 and pSX119 thus cover the whole of the subtilisin 309 gene.
  • the mutations a), b), and e) were performed by cutting pSX93 with XbaI and ClaI as indicated in FIG. 3A ; c), d), f), and h) were performed by cutting pSX93 with XbaI and HindIII as indicated in FIG. 3B .
  • Mutation g was performed correspondingly in pSX119 by cutting with EcoRI and XbaI.
  • the double mutants i) and j) were produced by cutting the 0.7 kb Xba-HindIII fragment from a) partially with HgiAI (HgiAI also cuts in SacI, which was introduced by the mutation). This 180 bp XbaI-HgiAI fragment and the 0.5 kb HgiAI fragment from the c) and d) mutants, respectively, were ligated to the large HindIII-XbaI fragment from pSX93.
  • the double mutant k) was produced as above by combining mutants e) and f).
  • Plasmid pSX92 is shown in FIG. 4 and was produced by cloning the subtilisin 309 gene into plasmid pSX62 cut at ClaI, filled in with the Klenow fragment of DNA polymerase I, and cut with HindIII prior to the insertion of the fragments DraI-NheI and NheI-HindIII from the cloned subtilisin 309 gene.
  • mutants the mutated fragments (XbaI-ClaI, XbaI-HindIII, or EcoRI-XbaI) were excised from the appropriate mutation plasmid pSX93 or pSX119, respectively, and inserted into pSX92.
  • the mutated pSX92 was then used to transform B. subtilis strain DN497, which was then grown in the same medium and under the same conditions as used for the cloning of the parent gene.
  • mutants a) and d) were tested for their oxidation stability in 0.01 M peracetic acid after 20 minutes at 50° C. and pH 7.
  • the parent strain NCIB 10309 protease was used as reference.
  • mutant d (Met 222 to Ala) exhibits superior oxidation stability realtive to the parent enzyme and mutant a.
  • mutants c), d), i), and j) (all Met-222) could resist 3-5 times more hypochlorite than the other mutants.
  • mutant f When tested in a liquid detergent of the usual built type it was found that mutant f) exhibited superior stability compared to both the other mutants and the “parent” enzyme.
  • mutant a exhibits enhanced activity compared to the parent. It is also seen that the Met-222 mutants have lower activity than the parent, but due to their improved oxidation stability their application in detergent compositions containing oxidants is not precluded.
  • TABLE V Proteolytic Activity of Mutant Subtilisins Mutant Relative Activity None 100 a) 120 b) 100 c) 30 d) 20 e) 100 f) 100 i) 20 j) 30
  • thermostability of mutant f was tested against the wild type enzyme by using the washability test at 40° C. and 60° C., respectively. The results are shown in Table VII.
  • mutant f) at 60° C shows a much improved washability compared to the wild type enzyme, whereas at 40° C. the washability of mutant f) is only slightly better than the wild type enzyme.
  • Subtilisin genes were cloned from the 147 and 309 variants of the bacterium Bacillus lentus , and the cloned genes were sequenced. By comparing the deduced amino acid sequences of subtilisins 147 and 309 one with the other and with sequences of other subtilisins, sites which, upon mutation, might alter the physical properties of the parent enzyme were identified. Site-directed mutagenesis was used to generate mutations at several of these sites in the subtilisin 309 gene. The resulting mutant enzymes were then expressed in a Bacillus strain, and tested against various physical and chemical parameters. Several of the mutants were shown to have improved stability to oxidation, increased proteolytic ability, or improved washability when compared with subtilisin 309. These mutants exhibit properties desirable in enzymes comprised in detergent compositions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Detergent Compositions (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Amplifiers (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to mutations of a subtilisin gene which result in changes in the chemical characteristics of subtilisin enzymes. Mutations at specific nucleic acids of the subtilisin gene result in amino acid substitutions and consequently, altered enzyme function. Some of these mutant enzymes exhibit physical properties advantageous to industrial applications, particularly in the detergent industry, providing subtilisin which is more stable to oxidation, possesses greater protease activity, and exhibits improved washability.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a continuation of application Ser. No. 10/306,089 filed Nov. 27, 2002, which is a continuation of application Ser. No. 08/486,846 filed Jun. 7, 1995, now U.S. Pat. No. 6,506,589, which is a division of application Ser. No. 07/294,241 filed Jan. 6, 1989, now abandoned, and claims priority of Danish application no. 64/88 filed Jan. 7, 1988, the contents of which are fully incorporated herein by reference.
  • BACKGROUND OF THE INVENTION
  • 1. Field of the Invention
  • The present invention relates to mutations of the subtilisin gene which result in changes in the chemical characteristics of subtilisin enzyme. Mutations at specific nucleic acids of the subtilisin gene result in amino acid substitutions and consequently, altered enzyme function. Some of these mutant enzymes exhibit physical properties advantageous to industrial applications, particularly in the detergent industry, providing subtilisins which are more stable to oxidation, possess greater protease activity, and exhibit improved washability.
  • 2. Description of Related Art
  • Bacillus Proteases
  • Enzymes cleaving the amide linkages in protein substrates are classified as proteases, or (interchangeably) peptidases (See Walsh, 1979, Enzymatic Reaction Mechanisms, W. H. Freeman and Company, San Francisco, Chapter 3). Bacteria of the Bacillus species secrete two extracellular species of protease, a neutral, or metalloprotease, and an alkaline protease which is functionally a serine endopeptidase, referred to as subtilisin. Secretion of these proteases has been linked to the bacterial growth cycle, with greatest expression of protease during the stationary phase, when sporulation also occurs. Joliffe et al. (1980, J. Bacterial. 141:1199-1208) has suggested that Bacillus proteases function in cell wall turnover.
  • Subtilisins
  • A serine protease is an enzyme which catalyzes the hydrolysis of peptide bonds, in which there is an essential serine residue at the active site (White, Handler, and Smith, 1973, “Principles of Biochemistry,” Fifth Edition, McGraw-Hill Book Company, NY, pp. 271-272).
  • The serine proteases have molecular weights in the 25,000 to 30,000 range. They are inhibited by diisopropylfluorophosphate, but in contrast to metalloproteases, are resistant to ethylenediamine-tetra acetic acid (EDTA) (although they are stabilized at high temperatures by calcium ion). They hydrolyze simple terminal esters and are similar in activity to eukaryotic chymotrypsin, also a serine protease. The alternative term, alkaline protease, reflects the high pH optimum of the serine proteases, from pH 9.0 to 11.0 (for review, see Priest, 1977, Bacteriological Rev. 41:711-753).
  • A subtilisin is a serine protease produced by Gram-positive bacteria or fungi. A wide variety of subtilisins have been identified, and the amino acid sequences of at least eight subtilisins have been determined. These include six subtilisins from Bacillus strains, namely, subtilisin 168, subtilisin BPN′, subtilisin Carlsberg, subtilisin DY, subtilisin amylosacchariticus, and mesentericopeptidase (Kurihara et al., 1972, J. Biol. Chem. 247:29-5631; Stahl and Ferrari, 1984, J. Bacteriol. 158:411-418; Vasantha et al., 1984, J. Bacteriol. 159:811-819, Jacobs et al., 1985, Nucl. Acids Res. 13:8913-8926; Nedkov et al., 1985, Biol. Chem. Hoppe-Seyler 366:421-430; Svendsen et al., 1986, FEBS Lett 196:228-232), and two fungal subtilisins, subtilisin thermitase from Thermoactinymyces vulgaris (Meloun et al., 1985, FEBS Lett. 183:195-200) and proteinase K from Tritirachium album (Jany and Mayer, 1985, Biol. Chem. Hoppe-Seyler 366:584-492).
  • Subtilisins are well-characterized physically and chemically. In addition to knowledge of the primary structure (amino acid sequence) of these enzymes, over 50 high resolution X-ray structures of subtilisin have been determined which delineate the binding of substrate, transition state, products, three different protease inhibitors, and define the structural consequences for natural variation (Kraut, 1971, Ann. Rev. Biochem. 46:331-358). Random and site-directed mutations of the subtilisin gene have both arisen from knowledge of the physical and chemical properties of the enzyme and contributed information relating to subtilisin's catalytic activity, substrate specificity, tertiary structure, etc. (Wells et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:1219-1223; Wells et al., 1986, Phil. Trans. R. Soc. Lond. A. 317:415-423; Hwang and Warshel, 1987, Biochem. 26:2669-2673; Rao et al., 1987, Nature 328:551-554).
  • Industrial Applications of Subtilisins
  • Subtilisins have found much utility in industry, particularly detergent formulations, as they are useful for removing proteinaceous stains. To be effective, however, these enzymes must not only possess activity under washing conditions, but must also be compatible with other detergent components during storage. For example, subtilisin may be used in combination with amylases, which are active against starches; cellulases which will digest cellulosic materials; lipases, which are active against fats; peptidases, which are active on peptides, and ureases, which are effective against urine stains. Not only must the formulation protect other enzymes from digestion by subtilisin, but subtilisin must be stable with respect to the oxidizing power, calcium binding properties, detergency and high pH of nonenzymatic detergent components. The ability of the enzyme to remain stable in their presence is often referred to as its washing ability or washability.
  • SUMMARY OF THE INVENTION
  • The present invention relates to mutations of the subtilisin gene, some of which result in changes in the chemical characteristics of subtilisin enzyme. Mutations are created at specific nucleic acids of the subtilisin gene, and, in various specific embodiments, the mutant enzymes possess altered chemical properties including, but not limited to, increased stability to oxidation, augmented proteolytic ability, and improved washability.
  • The present invention also relates, but is not limited to the amino acid and DNA sequences for protease mutants derived from Bacillus lentus variants, subtilisin 147 and subtilisin 309, as well as mutations of these genes and the corresponding mutant enzymes.
  • Site-directed mutation can efficiently produce mutant subtilisin enzymes which can be tailored to suit a multitude of industrial applications particularly in the areas of detergent and food technology. The present invention relates, in part, but is not limited to, mutants of the subtilisin 309 gene which exhibit improved stability to oxidation, augmented protease activity, and/or improved washability.
  • Abbreviations
  • A=Ala=Alanine
  • V=Val=Valine
  • L=Leu=Leucine
  • I=Ile=Isoleucine
  • P=Pro=Proline
  • F=Phe=Phenylalanine
  • W=Trp=Tryptophan
  • M=Met=Methionine
  • G=Gly=Glycine
  • S=Ser=Serine
  • T=Thr=Threonine
  • C=Cys=Cysteine
  • Y=Tyr=Tyrosine
  • N=Asn=Asparagine
  • Q=Gln=Glutamine
  • D=Asp=Aspartic Acid
  • E=Glu=Glutamic Acid
  • K=Lys=Lysine
  • R=Arg=Arginine
  • H=His=Histidine
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 illustrates the insertion of a subset of fragments, ranging from 1.5 kb to 6.5 kb in length, generated by partial digestion of Bacillus lentus strain 309 DNA with Sau 3A restriction endonuclease, into Bam HI cut plasmid pSx50. The two resulting plasmids, pSx86 and pSx88, containing the subtilisin 309 gene in opposite orientations, are also shown.
  • FIG. 2 illustrates the insertion of Bacillus lentus strain 147 DNA fragments into plasmid pSX56. Partial digestion of strain 147 DNA was performed using Sau 3A restriction endonuclease. Fragments ranging in size from 1.5 to 6.5 kb were then ligated into Bam HI cleaved plasmid pSX56. The product, pSX94, contains the subtilisin 147 gene.
  • FIG. 3 illustrates gapped duplex mutagenesis, using the method of Morinaga et al. (1984, Biotechnology 2:636-639). It features two plasmids, pSX93 and pSX119, both derived from puCl3. pSX93 contains an XbaI-HindIII fragment of the subtilisin 309 gene, and pSX119 contains the remainder of the subtilisin 309 gene in an EcoRI-XbaI fragment. In (A), plasmid pSX93 is cleaved with XbaI and ClaI, and the gapped molecules are mixed with pSX93 cut with ScaI, denatured, and allowed to reanneal so as to generate plasmids with a region of single-stranded DNA extending within the subtilisin 309 coding sequence. A synthetic oligonucleotide, homologous to the subtilisin 309 gene but containing a mutation, is allowed to anneal to the single stranded gap, which is then filled in using the Klenow fragment of DNA polymerase I and T4 DNA ligase. Upon replication of the plasmid, double-stranded mutants of the subtilisin 309 gene are generated. The same procedure is performed in (B), using plasmid pSX119 and EcoRI and XbaI enzymes, to create mutations in the corresponding region of the subtilisin 309 gene.
  • FIG. 4 illustrates plasmid pSX92, which is a derivative of plasmid pSX62, bearing the subtilisin 309 gene. Mutated fragments (i.e., XbaI - ClaI, XbaI-HindIII, or EcoRI-XbaI), excised from mutation plasmid pSX93 or pSX119 (see FIG. 3) using the appropriate restriction endonucleases, were inserted into plasmid pSX92 for expression in B. subtilis strain DN 497.
  • FIG. 5 illustrates plasmid pSXl43, which contains truncated forms of both subtilisin 309 and subtilisin 147 genes. In vivo recombination between homologous regions of the two genes can result in active protease.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The invention relates to mutations of the subtilisin gene, some of which result in changes in the chemical characteristics of subtilisin enzyme. Mutations at specific nucleic acids may be generated, and thus, forms of subtilisin can be designed so as to meet the needs of industrial application.
  • The invention is based, in part, upon the discovery that nutations of specific nucleic acids in the subtilisin gene can result in enzymes with altered properties. In various embodiments, enzymes with improved stability to oxidation, augmented protease activity, or improved washing ability can be generated.
  • For purposes of clarity in description, and not by way of limitation, the invention will be described in four parts: (a) the chemical structure of known subtilisins and subtilisin 147 and 309; (b) methods for producing mutations in the subtilisin gene; (c) expression of mutants of subtilisin and (d) screening of subtilisin mutants for desirable chemical properties.
  • Chemical Structures of Known Subtilisins and Subtilisin 147 and 309
  • Sequence analysis of subtilisins from various sources can reveal the functional significance of the primary amino acid sequence, and can direct the creation of new mutants with deliberately modified functions. Comparing the amino acid sequence of different forms of subtilisin, while contrasting their physical or chemical properties, may reveal specific target regions which are likely to produce useful mutant enzymes.
  • The amino acid sequences of at least eight subtilisins are known. These include six subtilisins from Bacillus strains, namely, subtilisin 168, subtilisin BPN′, subtilisin Carlsberg, subtilisin DY, subtilisin amylosacchariticus and mesentericopeptidase (Kurihara et al., 1972, J. Biol. Chem. 247:5629-5631; Stahl and Ferrari, 1984, J. Bacteriol. 158:411-418; Vasantha et al., 1984, J. Bacteriol. 159:811-819; Jacobs et al., 1985, Nucl. Acids Res. 13:8913-8926; Nedkov et al., 1985, Biol. Chem. Hoppe-Seyler 366:421-430; Svendsen et al., 1986, FEBS Lett. 196:228-232), and two fungal subtilisins, subtilisin thermitase from Thermoactinymyces vulgaris (Meloun et al., 1985, FEBS Lett. 183:195-200), and proteinase K from Tritirichium album limber (Janny and Mayer, 1985, Biol. Chem. Hoppe-Seyler 366:485-492).
  • In connection with this invention the amino acid and DNA sequences for two further serine proteases are revealed. These proteases were derived from two Bacillus lentus variants, C303 and C360, which have been deposited with NCIB and designated the accession numbers NCIB 10147 and NCIB 10309, respectively. For convenience the proteases produced by these strains are designated subtilisin 147 and subtilisin 309, respectively, and the genes encoding these proteins are referred to as the subtilisin 147 and 309 genes.
  • As used in this invention, the term “subtilisin material” refers to a proteinaceous material which contains a subtilisin as its active ingredient. As used herein, and under the definition of subtilisin material, any serine protease is a subtilisin which has at least 30%, preferably 50%, and more preferably 80% amino acid sequence homology with the sequences referenced above for subtilisin 147, subtilisin 309, subtilisin 168, subtilisin BPN', subtilisin Carlsberg, subtilisin DY, subtilisin amylosacchariticus, mesentericopeptidase, thermitase, proteinase K and thermomycolase. These serine proteases are also described herein as “homologous serine proteases”.
  • Table I compares the deduced amino acid sequences of subtilisin 309, subtilisin 147, subtilisin BPN', subtilisin Carlsberg and subtilisin 168 (Spizizen, et al., 1958, Proc. Natl. Acad. Sci. U.S.A. 44:1012-1078). Table II presents the nucleic acid sequence of the subtilisin 309 gene, and Table III presents the nucleic acid sequence of the subtilisin 147 gene. The sequences of subtilisin 309 or 147, or their functional equivalents, can be used in accordance with the invention. For example, the sequences of subtilisin 309 or 147 depicted in Tables I, II or III can be altered by substitutions, additions or deletions that provide for functionally equivalent molecules. For example, due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as depicted in Table I may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of the subtilisin 309 or 147 sequences depicted in Table II or III which are altered by the substitution of different codons that encode the same or a functionally equivalent amino acid residues within the sequence, thus producing a silent change. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent. Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine, and histidine. The negatively charged (acidic) amino acids include aspartic and glutamic acid.
  • Closeness of relation can be measured by comparison of amino acid sequences. There are many methods of aligning protein sequences, but the differences are only manifest when the degree of relatedness is quite small. The methods described in Atlas of Protein Sequence and Structure, Margaret O. Dayhoff editor, vol. 5, supplement 2, 1976, National Biomedical Research Foundation, Georgetown University Medical Center, Washington, D.C., p. 3 ff., entitled SEARCH and ALIGN, define relatedness. As is well known in the art, related proteins can differ in number of amino acids as well as identity of each amino acid along the chain. That is, there can be deletions or insertions when two structures are aligned for maximum identity. For example, subtilisin Carlsberg has only 274 amino acids while subtilisin BPN' has 275 amino acids. Aligning the two sequences shows that Carlsberg has no residue corresponding to Asn 56 of subtilisin BPN′. Thus the amino acid sequence of Carlsberg would appear very different from subtilisin BPN′ unless a gap is recorded at location 56. Therefore, one can predict with a high degree of confidence that substituting Ser for Asn at location 218 of subtilisin Carlsberg will increase thermal stability provided that the residues in Carlsberg are numbered by homology to subtilisin BPN′.
  • According to the invention, the sequences determined for subtilisins 309 and 147 can be compared with sequences of known subtilisins (see Table I) or newly discovered subtilisins in order to deduce sites for desirable mutations. To do this, the closeness of relation of the subtilisins being compared must be determined.
  • Experiments to determine the relationship between the primary structure of subtilisin and its physical properties have revealed the significance of the methionine-222 residue as well as the amino acids functional in the native site, namely, aspartic acid-32, histidine-64, and serine-221. Asparagine-155 and Serine-221 are within the oxyanion binding site. Mutations at these positions are likely to diminish proteolytic activity. According to the present invention, the amino acid sequences of subtilisins 309 and 147 were compared with one another and with the sequences of other subtilisins (see Table II). Residues that varied between subtilisin 309 or 147 and other subtilisins were identified. For example, at residue 153, subtilisin 309 contains a serine residue, whereas subtilisin 147, subtilisin BPN′, Carlsberg and 168 contain an alanine residue. Therefore, if the serine 153 residue of subtilisin 309 were changed to an alanine residue, the physical properties of subtilisin 309 might be altered in a desired direction. Likewise, subtilisin 147 contains a serine residue at position 218, whereas the other subtilisins expressed an asparagine residue. Because subtilisin 147 has improved thermal stability relative to the other subtilisins, mutating the asparagine 218 of subtilisin 309 to a serine residue might improve the thermal stability of subtilisin 309. As another example, it was reasoned that, since Thr 71 is close to the active site, the introduction of a negatively charged amino acid, such as aspartic acid, might suppress oxidative attack by electrostatic repulsion. The sites that are most likely to be relevant to the physical properties of subtilisin are those in which there is conservation of amino acid residues between most subtilisins, for example Asp-153 and Asn-218 discussed above, and also Trp-6, Arg-170, Pro-168, His-67, Met-175, Gly-219, Arg-275. By mutating the nucleic acid sequence such that an amino acid which differs from other subtilisins is substituted with an amino acid that conforms, a more stable form of subtilisin may result.
  • Wells et al. (1987, Proc. Natl. Acad. Sci. U.S.A. 84:1219-1223) have used comparison of amino acid sequences and site-directed mutation to engineer subtilisin substrate specificity. The catalytic activities of various subtilisins can differ markedly against selected substrates. Wells has shown that only three amino acid substitutions can cause B. amyloliquefaciens subtilisin substrate specificity to approach that of B. licheniformis subtilisin, enzymes that differ by factors of 10-50 in catalytic efficiency in their native state. Comparison analysis between subtilisin 147 and 309 and other subtilisins has indicated that mutation of the following sites may alter the physical or chemical properties of subtilisin: 6, 9, 11-12, 19, 25, 36-38, 53-59, 67, 71, 89, 104, 111, 115, 120, 121-122, 124, 128, 131, 140, 153-166, 168, 169-170, 172, 175, 180, 182, 186, 187, 191, 194, 195, 199, 218, 219, 222, 226, 234-238, 241, 260-262, 265, 268, or 275. Deletions occur at the following sites in subtilisins 147 and/or 309; insertion of appropriate amino acid residues into these sites might enhance the stability of the parent enzymes: 1, 36, 56, 159, 164-166. According to the method illustrated by these examples, which are not limiting, a number of potential mutation sites become apparent.
    TABLE I
    COMPARISON OF AMINO ACID SEQUENCE FOR VARIOUS PROTEASES
                      10                  20                  30
    a) A-Q-S-V-P-W-G-I-S-R-V-Q-A-P-A-A-H-N-R-G-L-T-G-S-G-V-K-V-A-V-
    b) *-Q-T-V-P-W-G-I-S-F-I-N-T-Q-Q-A-H-N-R-G-I-F-G-N-G-A-R-V-A-V-
    c) A-Q-S-V-P-Y-G-V-S-Q-I-K-A-P-A-L-H-S-Q-G-Y-T-G-S-N-V-K-V-A-V-
    d) A-Q-T-V-P-Y-G-I-P-L-I-K-A-D-K-V-Q-A-Q-G-F-K-G-A-N-V-K-V-A-V-
    e) A-Q-S-V-P-Y-G-I-S-Q-I-K-A-P-A-L-H-S-Q-G-Y-T-G-S-N-V-K-V-A-V-
                      40                  50                  60
    a) L-D-T-G-I-*-S-T-H-P-D-L-N-I-R-G-G-A-S-F-V-P-G-E-P-*-S-T-Q-D-
    b) L-D-T-G-I-*-A-T-H-P-D-L-R-I-A-G-G-A-S-F-I-S-S-E-P-*-S-Y-H-D-
    c) I-D-S-G-I-D-S-S-H-P-D-L-K-V-A-G-G-A-S-M-V-P-S-E-T-N-P-F-Q-D-
    d) L-D-T-G-I-Q-A-S-H-P-D-L-N-V-V-G-G-A-S-F-V-A-G-E-A-*-Y-N-T-D-
    e) L-D-S-G-I-D-S-S-H-P-D-L-N-V-R-G-G-A-S-F-V-A-S-E-T-N-P-Y-Q-D-
                      70                  80                  90
    a) G-N-G-H-G-T-H-V-A-G-T-I-A-A-L-N-N-S-I-G-V-L-G-V-A-P-S-A-E-L-
    b) N-N-G-H-G-T-H-V-A-G-T-I-A-A-L-N-N-S-I-G-V-L-G-V-A-P-S-A-D-L-
    c) N-N-S-H-G-T-H-V-A-G-T-V-A-A-L-N-N-S-I-G-V-L-G-V-A-P-S-A-S-L-
    d) G-N-G-H-G-T-H-V-A-G-T-V-A-A-L-D-N-T-T-G-V-L-G-V-A-P-S-V-S-L-
    e) G-S-S-H-G-T-H-V-A-G-T-I-A-A-L-N-N-S-I-G-V-L-G-V-S-P-S-A-S-L-
                      100                 110                 120
    a) Y-A-V-K-V-L-G-A-S-G-S-G-S-V-S-S-I-A-Q-G-L-E-W-A-G-N-N-G-M-H-
    b) Y-A-V-K-V-L-D-R-N-G-S-G-S-L-A-S-V-A-Q-G-I-E-W-A-I-N-N-N-M-H-
    c) Y-A-V-K-V-L-G-A-D-G-S-G-Q-Y-S-W-I-I-N-G-I-E-W-A-I-A-N-N-M-D-
    d) Y-A-V-K-V-L-N-S-S-G-S-G-T-Y-S-G-I-V-S-G-I-E-W-A-T-T-N-G-M-D-
    e) Y-A-V-K-V-L-D-S-T-G-S-G-Q-Y-S-W-I-I-N-G-I-E-W-A-I-S-N-N-M-D
                      130                 140                 150
    a) V-A-N-L-S-L-G-S-P-S-P-S-A-T-L-E-Q-A-V-N-S-A-T-S-R-G-V-L-V-V-
    b) I-I-N-M-S-L-G-S-T-S-G-S-S-T-L-E-L-A-V-N-R-A-N-N-A-G-I-L-L-V-
    c) V-I-N-M-S-L-G-G-P-S-P-S-A-A-L-K-A-A-V-D-K-A-V-A-S-G-V-V-V-V-
    d) V-I-N-M-S-L-G-G-P-S-G-S-T-A-M-K-Q-A-V-D-N-A-Y-A-R-G-V-V-V-V-
    e) V-I-N-M-S-L-G-G-P-T-G-S-A-A-L-K-T-V-V-D-K-A-V-S-S-G-I-L-V-A-
                      160                 170                 180
    a) A-A-S-G-N-S-G-A-*-G-S-I-S-*-*-*-Y-P-A-R-Y-A-N-A-M-A-V-G-A-T-
    b) G-A-A-G-N-T-G-R-*-Q-G-V-N-*-*-*-Y-P-A-R-Y-S-G-V-M-A-V-A-A-V-
    c) A-A-A-G-N-E-G-T-S-G-S-S-S-T-V-G-Y-P-G-K-Y-P-S-V-I-A-V-G-A-V-
    d) A-A-A-G-N-S-G-S-S-G-N-T-N-T-I-G-Y-P-A-K-Y-D-S-V-I-A-V-G-A-V-
    e) A-A-A-G-N-E-G-S-S-G-S-S-S-T-V-G-Y-P-A-K-Y-P-S-T-I-A-V-G-A-V-
                      190                 200                 210
    a) D-Q-N-N-N-R-A-S-F-S-Q-Y-G-A-G-L-D-I-V-A-P-G-V-N-V-Q-S-T-Y-P-
    b) D-Q-N-G-Q-P-P-S-F-S-T-Y-G-P-E-I-E-I-S-A-P-G-V-N-V-N-S-T-Y-T-
    c) D-S-S-N-Q-R-A-S-F-S-S-V-G-P-E-L-D-V-M-A-P-G-V-S-I-Q-S-T-L-P-
    d) D-S-N-S-N-R-A-S-F-S-S-V-G-A-E-L-E-V-M-A-P-G-A-G-V-Y-S-T-Y-P-
    e) N-S-S-N-Q-R-A-S-F-S-S-A-G-S-E-L-D-V-M-A-P-G-V-S-I-Q-S-T-L-P-
                      220                  230                240
    a) G-S-T-Y-A-S-L-N-G-T-S-M-A-T-P-H-V-A-G-A-A-A-L-V-K-Q-K-N-P-S-
    b) G-N-R-Y-V-S-L-S-G-T-S-M-A-T-P-H-V-A-G-V-A-A-L-V-K-S-R-Y-P-S-
    c) G-N-K-Y-G-A-Y-N-G-T-S-M-A-S-P-H-V-A-G-A-A-A-L-I-L-S-K-H-P-N-
    d) T-S-T-Y-A-T-L-N-G-T-S-M-A-S-P-H-V-A-G-A-A-A-L-I-L-S-K-H-P-N-
    e) G-G-T-Y-G-A-Y-N-G-T-S-M-A-T-P-H-V-A-G-A-A-A-L-I-L-S-K-H-P-T-
                      250                 260                 270
    a) W-S-N-V-Q-I-R-N-H-L-K-N-T-A-T-S-L-G-S-T-N-L-Y-G-S-G-L-V-N-A-
    b) Y-T-N-N-Q-I-R-Q-R-I-N-Q-T-A-T-Y-L-G-S-P-S-L-Y-G-N-G-L-V-H-A-
    c) W-T-N-T-Q-V-R-S-S-L-E-N-T-T-T-K-L-G-D-S-F-Y-Y-G-K-G-L-I-N-V-
    d) L-S-A-S-Q-V-R-N-R-L-S-S-T-A-T-Y-L-G-S-S-F-Y-Y-G-K-G-L-I-N-V-
    e) W-T-N-A-Q-V-R-D-R-L-E-S-T-A-T-Y-L-G-N-S-F-Y-Y-G-K-G-L-I-N-V-
    a) E-A-A-T-R
    b) G-R-A-T-Q
    c) Q-A-A-A-Q
    d) E-A-A-A-Q
    e) Q-A-A-A-Q

    a = subtilisin 309

    b = subtilisin 147

    c = subtilisin BPN′

    d = subtilisin Carlsberg

    e = subtilisin 168

    * = assigned deletion

    Methods for Producing Mutations in Subtilisin Genes
  • Many methods for introducing mutations into genes are well known in the art. After a brief discussion of cloning subtilisin genes, methods for generating mutations in both random sites and specific sites within the subtilisin gene will be discussed.
  • Cloning a Subtilisin Gene
  • The gene encoding subtilisin may be cloned from any Gram-positive bacteria or fungus by various methods well known in the art. First a genomic and/or cDNA library of DNA must be constructed using chromosomal DNA or messenger RNA from the organism that produces the subtilisin to be studied. Then, if the amino acid sequence of the subtilisin is known, homologous, labelled oligonucleotide probes may be synthesized and used to identify subtilisin-encoding clones from a genomic library of bacterial DNA, or from a fungal cDNA library. Alternatively, a labelled oligonucleotide probe containing sequences homologous to subtilisin from another strain of bacteria or fungus could be used as a probe to identify subtilisin-encoding clones, using hybridization and washing conditions of lower stringency.
  • Yet another method for identifying subtilisin-producing clones would involve inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming protease-negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar containing a substrate for subtilisin, such as skim milk. Those bacteria containing subtilisin-bearing plasmid will produce colonies surrounded by a halo of clear agar, due to digestion of the skim milk by excreted subtilisin.
  • Generation of Random Mutations in the Subtilisin Gene
  • Once the subtilisin gene has been cloned into a suitable vector, such as a plasmid, several methods can be used to introduce random mutations into the gene.
  • One method would be to incorporate the cloned subtilisin gene, as part of a retrievable vector, into a mutator strain of Eschericia coli.
  • Another method would involve generating a single stranded form of the subtilisin gene, and then annealing the fragment of DNA containing the subtilisin gene with another DNA fragment such that a portion of the subtilisin gene remained single stranded. This discrete, single stranded region could then be exposed to any of a number of mutagenizing agents, including, but not limited to, sodium bisulfite, hydroxylamine, nitrous acid, formic acid, or hydralazine. A specific example of this method for generating random mutations is described by Shortle and Nathans (1978, Proc. Natl. Acad. Sci. U.S.A., 75:2170-2174). According to the Shortle and Nathans method, the plasmid bearing the subtilisin gene would be nicked by a restriction enzyme that cleaves within the gene. This nick would be widened into a gap using the exonuclease action of DNA polymerase I. The resulting single-stranded gap could then be mutagenized using any one of the above mentioned mutagenizing agents.
  • Alternatively, the subtilisin gene from a Bacillus species including the natural promoter and other control sequences could be cloned into a plasmid vector containing replicons for both E. coli and B. subtilis, a selectable phenotypic marker and the M13 origin of replication for production of single-stranded plasmid DNA upon superinfection with helper phage IR1. Single-stranded plasmid DNA containing the cloned subtilisin gene is isolated and annealed with a DNA fragment containing vector sequences but not the coding region of subtilisin, resulting in a gapped duplex molecule. Mutations are introduced into the subtilisin gene either with sodium bisulfite, nitrous acid or formic acid or by replication in a mutator strain of E. coli as described above. Since sodium bisulfite reacts exclusively with cytosine in a single-stranded DNA, the mutations created with this mutagen are restricted only to the coding regions. Reaction time and bisulfite concentration are varied in different experiments such that from one to five mutations are created per subtilisin gene on average. Incubation of 10 micrograms of gapped duplex DNA in 4 M Na-bisulfite, pH 6.0, for 9 minutes at 37° C. in a reaction volume of 400 microliters, deaminates about 1% of cytosines in the single-stranded region. The coding region of mature subtilisin contains about 200 cytosines, depending on the DNA strand. Advantageously, the reaction time is varied from about 4 minutes (to produce a mutation frequency of about one in 200) to about 20 minutes (about 5 in 200).
  • After mutagenesis the gapped molecules are treated in vitro with DNA polymerase I (Klenow fragment) to make fully double-stranded molecules and to fix the mutations. Competent E. coli are then transformed with the mutagenized DNA to produce an amplified library of mutant subtilisins. Amplified mutant libraries can also be made by growing the plasmid DNA in a Mut D strain of E. coli which increases the range of mutations due to its error prone DNA polymerase.
  • The mutagens nitrous acid and formic acid may also be used to produce mutant libraries. Because these chemicals are not as specific for single-stranded DNA as sodium bisulfite, the mutagenesis reactions are performed according to the following procedure. The coding portion of the subtilisin gene is cloned in M13 phage by standard methods and single stranded phage DNA prepared. The single-stranded DNA is then reacted with 1 M nitrous acid pH 4.3 for 15-60 minutes at 23° C. or 2.4 M formic acid for 1-5 minutes at 23° C. These ranges of reaction times produce a mutation frequency of from 1 in 1000 to 5 in 1000. After mutagenesis, a universal primer is annealed to the M13 DNA and duplex DNA is synthesized using the mutagenized single stranded DNA as a template so that the coding portion of the subtilisin gene becomes fully double-stranded. At this point the coding region can be cut out of the M13 vector with restriction enzymes and ligated into an unmutagenized expression vector so that mutations occur only in the restriction fragment (Myers et al., 1985, Science 229:242-257).
  • By yet another method, mutations can be generated by allowing two dissimilar forms of subtilisin to undergo recombination in vivo. According to this method, homologous regions within the two genes lead to a cross-over of corresponding regions resulting in the exchange of genetic information. The generation of hybrid amylase molecules according to this technique is fully described in U.S. application Ser. No. 67,992, filed on Jun. 29, 1987, which is fully incorporated herein by reference. An example of a plasmid which can generate hybrid forms of subtilisin is depicted in FIG. 5. Both the subtilisin 309 and 147 genes, incorporated into plasmid pSX143, are truncated, and therefore cannot themselves lead to subtilisin expression. However, if recombination occurs between the two genes so as to correct the defect produced by truncation, i.e., the N terminal region of the subtilisin 309 gene becomes linked to the C terminal region of the subtilisin 147 gene, then active, mutant subtilisin can be produced. If pSX143 is incorporated into a protease-negative strain of bacteria, and then bacteria that develop a protease positive phenotype are selected, then various mutants, subtilisin 309/147 chimeras, can be identified.
  • Generation of Site Directed Mutations in the Subtilisin Gene
  • Once the subtilisin gene has been cloned, and desirable sites for mutation identified, these mutations can be introduced using synthetic oligo nucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites; mutant nucleotides are inserted during oligonucleotide synthesis. In a preferred method, a single stranded gap of DNA, bridging the subtilisin gene, is created in a vector bearing the subtilisin gene. Then the synthetic nucleotide, bearing the desired mutation, is annealed to a homologous portion of the single-stranded DNA. The remaining gap is then filled in by DNA polymerase I (Klenow fragment) and the construct is ligated using T4 ligase. A specific example of this method is described in Morinaga et al. (1984, Biotechnology 2:636-639). According to Morinaga et al., a fragment within the gene is removed using restriction endonuclease. The vector/gene, now containing a gap, is then denatured and hybridized to vector/gene which, instead of containing a gap, has been cleaved with another restriction endonuclease at a site outside the area involved in the gap. A single-stranded region of the gene is then available for hybridization with mutated oligonucleotides, the remaining gap is filled in by the Klenow fragment of DNA polymerase I, the insertions are ligated with T4 DNA ligase, and, after one cycle of replication, a double-stranded plasmid bearing the desired mutation is produced. The Morinaga method obviates the additional manipulation of construction new restriction sites, and therefore facilitates the generation of mutations at multiple sites. U.S. Pat. No. 4,760,025, by Estelle et al., issued Jul. 26, 1988, is able to introduce oligonucleotides bearing multiple mutations by performing minor alterations of the cassette, however, an even greater variety of mutations can be introduced at any one time by the Morinaga method, because a multitude of oligonucleotides, of various lengths, can be introduced.
  • Expression of Subtilisin Mutants
  • According to the invention, a mutated subtilisin gene produced by methods described above, or any alternative methods known in the art, can be expressed, in enzyme form, using an expression vector. An expression vector generally falls under the definition of a cloning vector, since an expression vector usually includes the components of a typical cloning vector, namely, an element that permits autonomous replication of the vector in a microorganism independent of the genome of the microorganism, and one or more phenotypic markers for selection purposes. An expression vector includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and, optionally, a repressor gene. To permit the secretion of the expressed protein, nucleotides encoding a “signal sequence” may be inserted prior to the coding sequence of the gene. For expression under the direction of control sequences, a target gene to be treated according to the invention is operably linked to the control sequences in the proper reading frame. Promoter sequences that can be incorporated into plasmid vectors, and which can support the transcription of the mutant subtilisin gene, include but are not limited to the prokaryotic beta-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731) and the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25). Further references can also be found in “Useful proteins from recombinant bacteria” in Scientific American, 1980, 242:74-94.
  • According to one embodiment B. subtilis is transformed by an expression vector carrying the mutated DNA. If expression is to take place in a secreting microorganism such as B. subtilis a signal sequence may follow the translation initiation signal and precede the DNA sequence of interest. The signal sequence acts to transport the expression product to the cell wall where it is cleaved from the product upon secretion. The term “control sequences” as defined above is intended to include a signal sequence, when it is present.
  • Screening of Mutant Subtilisins
  • For screening mutants, transformed B. subtilis can be cultivated in the presence of a filter material (such as nitrocellulose) to which the secreted expression product (e.g. enzyme) binds. In order to screen for an expression product having a desired characteristic, filter bound expression product is subjected to conditions which distinguish expression product of interest from wild-type expression product. For example, the filter-bound expression product can be subjected to conditions which would inactivate a wild-type product. Preserved enzyme activity following adverse treatment suggests that the mutation confers enhanced stability on the enzyme, and is therefore a useful mutation.
  • In one embodiment of the invention, screening for stable variants is accomplished using a protease deficient B. subtilis strain transformed with the variant plasmid and plated out as follows: a nitrocellulose filter is placed on a nutrient base in a petri dish, and a cellulose acetate filter is placed on top of the nitrocellulose. Colonies are grown on the cellulose acetate, and protease from individual colonies is secreted through the cellulose acetate onto the nitrocellulose filter where it is stably bound. Protease from hundreds of colonies is bound to a single filter allowing subsequent screening of thousands of different variants by processing multiple filters.
  • To identify colonies producing subtilisin of enhanced thermal stability, the filters can be incubated in buffer solutions at temperatures which would inactivate substantially all wild-type activity. Variants of enhanced stability or activity retain activity after this step. The suitably treated filter then is soaked in a solution containing Tosyl-L-Arg methyl ester (TAME), Benzoly-Arg-ethyl-ester (BAEE), Acetyl-Tyr-ethyl-ester (ATEE) (Sigma) or similar compounds. Because TAME, BAEE, and ATEE are substrates for the proteases they are cleaved in zones on the filter containing variant subtilisins which remain active after treatment. As cleavage occurs, protons are released in the reaction and cause phenol red to change in color from red to yellow in areas retaining protease activity.
  • This procedure can be used to screen for different classes of variants with only slight modifications. For example, the filters could be treated at high temperature, at high pH, with denaturants, oxidizing agents, or under other conditions which normally inactivate an enzyme such as a protease to find resistant variants. Variants with altered substrate specificity could be screened by replacing TAME, BAEE, or ATEE with other substrates which are normally not cleaved by wild-type subtilisin.
  • Once a variant of enhanced stability is identified by screening, the colony from which the variant is derived is isolated and the altered subtilisin is purified. Experiments can be performed on the purified enzyme to determine conditions of stability towards oxidation, thermal inactivation, denaturation temperature, kinetic parameters as well as other physical measurements. The altered gene can also be sequenced to determine the amino acid changes responsible for the enhanced stability. Using this procedure, variants with increased washing abilities have been isolated.
  • EXAMPLES
  • Site-Specific Mutation of the Subtilisin Gene Generates Mutants With Useful Chemical Characteristics
  • Materials And Methods
  • Bacterial Strains
  • B. subtilis 309 and 147 are variants of Bacillus lentus, deposited with the NCIB and accorded the accession numbers NCIB 10147 and NCIB 10309, and described in U.S. Pat. No. 3,723,250, issued Mar. 27, 1973, and fully incorporated herein by reference herein. B. subtilis DN 497 is described in U.S. application Ser. No. 039,298 filed Apr. 17, 1987, which is also fully incorporated herein by reference, and is an aro+ transformant of RUB 200 with chromosomal DNA from SL 438, a sporulation and protease deficient strain obtained from Dr. Kim Hardy of Biogen. E. coli MC 1000 rm+ (Casa-daban, M. J. and Cohen, S. N. (1980), J. Mol. Biol. 138:179-207, was made rm+ by conventional methods and is also described in U.S. application Ser. No. 039,298, supra.
  • Plasmids
  • pSX50 (described in U.S. application Ser. No. 039,298, supra) is a derivative of plasmid pDN 1050, comprising the promoter-operator P1O1the B. pumilus xyn B gene and the B. subtilis xyl R gene.
  • pSX65 (described in U.S. application Ser. No. 039,298, supra) is a derivative of plasmid pDN 1050, comprising the promoter-operator P2O2, the B. pumilus xyn B gene, and the B. subtilis xyl R gene.
  • pSX93, shown in FIG. 3A, is puCl3 (Vieira and Messing, 1982, Gene 19:259-268) comprising a 0.7 kb XbaI-Hind III fragment of the subtilisin 309 gene including the terminator inserted in a polylinker sequence.
  • pSX119 is pUC13 harboring an EcoRI-XbaI fragment of the subtilisin 309 gene inserted into the polylinker.
  • pSX62 (described in U.S. application Ser. No. 039,298, supra) is a derivative of pSX52 (ibid), which comprises a fusion gene between the calf prochymosin gene and the B. pumilus xyn B gene inserted into pSX50 (supra) . pSX62 was generated by inserting the E. coli rrn B terminator into pSX52 behind the prochymosin gene.
  • pSX92 was produced by cloning the subtilisin 309 gene into plasmid pSX62 (supra) cut at Cla I and Hind III and filled prior to the insertion of the fragments DraI-NheI and NheI-Hind III from the cloned subtilisin 309 gene.
  • Purification of Subtilisins
  • The procedure relates to a typical purification of a 10 liter scale fermentation of subtilisin 147, subtilisin 309 or mutants thereof.
  • Approximately 8 liters of fermentation broth were centrifuged at 5000 rpm for 35 minutes in 1 liter beakers. The supernatants were adjusted to pH 6.5 using 10% acetic acid and filtered on Seitz Supra S100 filter plates.
  • The filtrates were concentrated to approximately 400 ml using an Amicon CH2A UF unit equipped with an Amicon S1Y10 UF cartridge. The UF concentrate was centrifuged and filtered prior to adsorption on a Bacitracin affinity column at pH 7. The protease was eluted from the Bacitracin column using 25% 2-propanol and 1 M sodium chloride in a buffer solution with 0.01 M dimethylglutaric acid, 0.1 M boric acid and 0.002 M calcium chloride adjusted to pH 7.
  • The fractions with protease activity from the Bacitracin purification step were combined and applied to a 750 ml Sephadex G25 column (5 cm dia.) equilibrated with a buffer containing 0.01 M dimethylglutaric acid, 0.2 M boric acid and 0.002 M calcium chloride adjusted to pH 6.5.
  • Fractions with proteolytic activity from the Sephadex G25 column were combined and applied to a 150 ml CM Sepharose CL 6B cation exchange column (5 cm dia.) equilibrated with a buffer containing 0.01 M dimethylglutaric acid, 0.2 M boric acid and 0.002 M calcium chloride adjusted to pH 6.5.
  • The protease was eluted using a linear gradient of 0-0.1 M sodium chloride in 2 liters of the same buffer (0-0.2 M sodium chloride in case of subtilisin 147).
  • In a final purification step protease containing fractions from the CM Sepharose column were combined and concentrated in an Amicon ultrafiltration cell equipped with a GR81P membrane (from the Danish Sugar Factories Inc.).
  • Subtillisin 309 and Mutants
      • Met 222 to Ala
      • Gly 195 to Glu
      • Asn 218 to Ser
      • Arg 170 to Tyr
      • Gly 195 to Glu, Arg 170 to Tyr
      • Gly 195 to Glu, Met 222 to Ala
        were purified by this procedure.
  • Oligonucledotide Synthesis
  • All mismatch primers were synthesized on an Applied Biosystems 380 A DNA synthesizer and purified by polyacrylamide gel electrophoresis (PAGE).
  • Determination of Oxidation Stability
  • The purified enzyme is diluted to an enzyme content of approximately 0.1 mg/ml in 0.01 M dimethylglutaric acid pH 7 and in the same buffer with 0.01 M peracetic acid (pH 7).
  • Both sets of dilutions were heated to 50° C. for 20 minutes. Proteolytic activity was measured in the dilutions before and after the heat treatment.
  • Assay For Proteolytic Activity
  • OPA-Casein Method
  • Proteolytic activity was determined using casein as the substrate. One Casein Protease Unit (CPU) is defined as the amount of enzyme liberating 1 millimole of primary amino groups (determined by comparison with a serine standard) per minute under standard conditions, i.e. incubation for 30 minutes at 25° C. and pH 9.5.
  • A 2% (w/v) solution of casein (Hammarstein, supplied by Merck A. G., West Germany) was prepared with the Universal Buffer described by Britton and Robinson (Journ. Chem. Soc. 1931, p. 1451), adjusted to pH 9.5.
  • Two ml of substrate solution was preincubated in a water bath for 10 minutes at 25° C. One ml of enzyme solution containing about 0.2-0.3 CPU/ml of Britton-Robinson buffer (pH 9.5), was added. After 30 minutes of incubation at 25° C. the reaction was terminated by the addition of a stopping agent (5 ml of a solution containing trichloroacetic acid (17.9 g), sodium acetate (29.9 g), and acetic acid (19.8 g), filled up to 500 ml with deionized water). A blank was prepared in the same manner as the test solution, except that the stopping agent was added prior to the enzyme solution.
  • The reaction mixtures were kept for 20 minutes in the water bath, whereupon they were filtered through Whatman® 42 paper filters.
  • Primary amino groups were determined by their color development with o-phthaldialdehyde (OPA).
  • Disodium tetraborate decahydrate (7.62 g) and sodium dodecylsulfate (2.0 g) was dissolved in 150 ml of water. OPA (160 mg) dissolved in 4 ml of methanol was then added together with 400 microliters of beta-mercaptoethanol, whereafter the solution was made up to 200 ml with water.
  • To the OPA reagent (3 ml) was added 40 μl of the above-mentioned filtrates with mixing. The optical density (OD) at 340 nm was measured after about 5 minutes.
  • The OPA test was also performed with a serine standard containing 10 mg of serine in 100 ml of Britton-Robinson buffer (pH 9.5). The buffer was used as a blank.
  • The protease activity was calculated from the optical density measurements by means of the following formula:
    CPU/g of enzyme solution=[OD t −OD bC Ser ×Q]/[(OD Ser −OD BMW Ser ×t i]
    CPU/g of enzyme preparation=CPU/ml: b
    wherein ODt, ODb, ODSer and ODB are the optical density of the test solution, blank, serine standard, and buffer, respectively, CSer is the concentration of serine in mg/ml in the standard, MWSer is the molecular weight of serine, Q is the dilution factor (in this instance equal to 8) for the enzyme solution, and ti is the incubation time in minutes.
  • In the following Table V, results from the above assay are shown relative to the parent enzyme.
  • Assay for Washability
  • Test cloths (7 cm×7 cm, approximately 1 g) were produced by passing desized cotton (100% cotton, DS 71) Cloth through the vessel in a Mathis Washing and Drying Unit type TH (Werner Mathis A G, Zurich, Switzerland) containing spinach juice (produced from fresh spinach) and then through the pressure roll of the machine in order to remove excess spinach juice.
  • Finally the cloth was dried in a strong air stream at room temperature, stored at room temperature for 3 weeks, and subsequently kept at −18° C. prior to use.
  • The tests were performed in a Terg-O-tometer test washing machine (described in Jay C. Harris −Detergency Evaluation and Testing”, Interscience Publishers Ltd., 1954, p.60-61) isothermally for 10 minutes at 100 rpm. As detergent the following standard powder detergent was used:
    Nansa S 80 0.40 g/l
    AE, Berol 0 65 0.15 g/l
    Soap 0.15 g/l
    STPP 1.75 g/l
    Sodium silicate 0.40 g/l
    CMC 0.05 g/l
    EDTA 0.01 g/l
    Na2SO4 2.10 g/l
    Perborate 1.00 g/l
    TAED 0.10 g/l

    TAED=N,N,N′,N″-tetraacetyl-ethylene diamine; pH was adjusted with 4 N NAOH to 9.5. The water used was ca. 9° GH (German Hardness).
  • Tests were performed at enzyme concentrations of: 0, 0.05 CPU/1, and 0.1 CPU/l, and two independent sets of tests were performed for each of the mutants.
  • Eight cloths were used for each testing using one beaker (800 ml) of detergent. Of the cloths, four were clean and four were stained with spinach juice. Subsequent to the washing the cloths were flushed in running water for 25 minutes in a bucket.
  • The cloths were then air dryed overnight (protected against day light) and the remission, R, determined on a E1REPHO 2000 spectrophotometer from Datacolor S.A., Dietkikon, Switzerland at 460 nm.
  • As a measure of the washing ability differential remission, Delta R, was used, Delta R being equal to the remission after wash with enzyme added minus the remission after wash with no enzyme added.
  • Assay for Thermostability
  • The same procedure as above for washability was used for estimating the thermostability of the mutants produced, by performing the test at temperatures of 40° C. and 60° C., respectively.
  • Results
  • Cloning of the Subtilisin 309 and 147 Genes
  • Chromosomal DNA from the “309” strain was isolated by treating a cell suspension with Lysozyme for 30 minutes at 37° C., and then with SDS for 5 minutes at 60° C. Subsequently, the suspension was extracted with phenolchloroform (50:50), precipitated with ethanol, and the precipitate redissolved in TE. This solution was treated with RNase for 1 hour at 37° C.
  • Approximately 30 micrograms of the chromosomal DNA was partially digested with restriction enzyme Sau 3A (New England Biolabs) and fragments from about 1.5 kb to about 6.5 kb were isolated on DEAE cellulose paper from a 1% agarose gel (the subtilisin gene in other species is approximately 1.2 kb in length).
  • As outlined in FIG. 1 the fragments were annealed and ligated to BamHI cut plasmid pSX50 (described in U.S. patent application Ser. No. 039,298 filed Apr. 17, 1987, is which is hereby included for reference). The plasmids were then transformed into competent B. subtilis DN 497.
  • The cells were then spread on LB agar plates with 10 mM phosphate pH 7, 6 micrograms/ml chloramphenicol, and 0.2% xylose to induce the xyn-promoter in the plasmid. The plates also contained 1% skim milk so the protease producing transformants could be detected by the clear halo where the skim milk had been degraded.
  • Protease expressing clones were produced at a frequency of 10−4. Two clones were found that harbored plasmids carrying the gene for subtilisin 309, pSX86 and pSX88. The gene was then sequenced using the method of Maxam and Gilbert. The deduced nucleotide sequence of subtilisin 309 is presented in Table II.
    TABLE II
    THE SUBTILISIN
    309 GENE
    Signal
    ATGAAGAAACCG TTGGGGAAAATT GTCGCAAGCACC GCACTACTCATT TCTGTTGCTTTT
    1
                          PRO
    AGTTCATCGATC GCATCGGCTGCT GAAGAAGCAAAA GAAAAATATTTA ATTGGCTTTAAT
                           82
    GAGCAGGAAGCT GTCAGTGAGTTT GTAGAACAAGTA GAGGCAAATGAC GAGGTCGCCATT
    CTCTCTGAGGAA GAGGAAGTCGAA ATTGAATTGCTT CATGAATTTGAA ACGATTCCTGTT
    TTATCCGTTGAG TTAAGCCCAGAA GATGTGGACGCG CTTGAACTCGAT CCAGCGATTTCT
                                       Mature
    TATATTGAAGAG GATGCAGAAGTA ACGACAATGGCG CAATCAGTGCCA TGGGGAATTAGC
                                       334
    CGTGTGCAAGCC CCAGCTGCCCAT AACCGTGGATTG ACAGGTTCTGGT GTAAAAGTTGCT
    GTCCTCGATACA GGTATTTCCACT CATCCAGACTTA AATATTCGTGGT GGCGCTAGCTTT
    GTACCAGGGGAA CCATCCACTCAA GATGGGAATGGG CATGGCACGCAT GTGGCCGGGACG
    ATTGCTGCTTTA AACAATTCGATT GGCGTTCTTGGC GTAGCGCCGAGC GCGGAACTATAC
    GCTGTTAAAGTA TTAGGGGCGAGC GGTTCAGGTTCG GTCAGCTCGATT GCCCAAGGATTG
    GAATGGGCAGGG AACAATGGCATG CACGTTGCTAAT TTGAGTTTAGGA AGCCCTTCGCCA
                                              XbaI
    AGTGCCACACTT GAGCAAGCTGTT AATAGCGCGACT TCTAGAGGCGTT CTTGTTGTAGCG
    GCATCTGGGAAT TCAGGTGCAGGC TCAATCAGCTAT CCGGCCCGTTAT GCGAACGCAATG
    GCAGTCGGAGCT ACTGACCAAAAC AACAACCGCGCC AGCTTTTCACAG TATGGCGCAGGG
    CTTGACATTGTC GCACCAGGTGTA AACGTGCAGAGC ACATACCCAGGT TCAACGTATGCC
                     ClaI
    AGCTTAAACGGT ACATCGATGGCT ACTCCTCATGTT GCAGGTGCAGCA GCCCTTGTTAAA
    CAAAAGAACCCA TCTTGGTCCAAT GTACAAATCCGC AATCATCTAAAG AATACGGCAACG
    AGCTTAGGAAGC ACGAACTTGTAT GGAAGCGGACTT GTCAATGCAGAA GCGGCAACACGC
    Stop
    TAA
    1141
  • The same procedure as above was used for the cloning of the subtilisin 147 gene except that the DNA fragments were ligated into the plasmid pSXS6 (also described in U.S. application Ser. No. 039,298 supra), which as indicated in FIG. 2 instead of the xyn promoter harbors the xyl promoter. One clone was found harboring a plasmid, pSX94, carrying the gene for subtilisin 147. The sequence for this gene is shown in Table III below.
    TABLE III
    THE SUBTILISIN
    147 GENE
    Signal
    ATGAGACAAAGT CTAAAAGTTATG GTTTTGTCAACA GTGGCATTGCTT TTCATGGCAAAC
    1
                 Pro
    CCAGCAGCAGCA GGCGGGGAGAAA AAGGAATATTTG ATTGTCGTCGAA CCTGAAGAAGTT
                 73
    TCTGCTCAGAGT GTCGAAGAAAGT TATGATGTGGAC GTCATCCATGAA TTTGAAGAGATT
    CCAGTCATTCAT GCAGAACTAACT AAAAAAGAATTG AAAAAATTAAAG AAAGATCCGAAC
                                              Mature
    GTAAAAGCCATC GAAGAGAATGCA GAAGTAACCATC AGTCAAACGGTT CCTTGGGGAATT
                                              280
    TCATTCATTAAT ACGCAGCAAGCG CACAACCGCGGT ATTTTTGGTAAC GGTGCTCGAGTC
    GCTGTCCTTGAT ACAGGAATTGCT TCACACCCAGAC TTACGAATTGCA GGGGGAGCGAGC
    TTTATTTCAAGC GAGCCTTCCTAT CATGACAATAAC GGACACGGAACT CACGTGGCTGGT
    ACAATCGCTGCG TTAAACAATTCA ATCGGTGTGCTT GGTGTACGACCA TCGGCTGACTTG
    TACGCTCTCAAA GTTCTTGATCGG AATGGAAGTGGT TCGCTTGCTTCT GTAGCTCAAGGA
    ATCGAATGGGCA ATTAACAACAAC ATGCACATTATT AATATGAGCCTT GGAAGCACGAGT
    GGTTCTAGCACG TTAGAGTTAGCT GTCAACCGAGCA AACAATGCTGGT ATTCTCTTAGTA
    GGGGCAGCAGGT AATACGGGTAGA CAAGGAGTTAAC TATCCTGCTAGA TACTCTGGTGTT
    ATGGCGGTTGCA GCAGTTGATCAA AATGGTCAACGC GCAAGCTTCTCT ACGTATGGCCCA
    GAAATTGAAATT TCTGCACCTGGT GTCAACGTAAAC AGCACGTACACA GGCAATCGTTAC
    GTATCGCTTTCT GGAACATCTATG GCAACACCACAC GTTGCTGGAGTT GCTGCACTTGTG
    AAGAGCAGATAT CCTAGCTATACG AACAACCAAATT CGCCAGCGTATT AATCAAACAGCA
    ACGTATCTAGGT TCTCCTAGCCTT TATGGCAATGGA TTAGTACATGCT GGACGTGCAACA
      Stop
    CAATAA
      1084
  • Generation of Site-Specific Mutations of the Subtilisin 309 Gene
  • Site specific mutations were performed by the method of Morinaga et al. (Biotechnology, supra). The following oligonucleotides were used for introducing the mutations:
  • a) Gly-195-Glu:
  • A 27-mer mismatch primer, Nor-237, which also generates a novel SacI restriction site
    5′ CACAGTATGGGCGCAGGGCTTGACATTGTCGCACCA
    GG 3′
    NOR-237 5′ GTATGGCGCAGAGCTCGACATTTGTCGC 3′
                  SacI

    b) Gly-195-Asp:
  • A 23-mer mismatch primer, NOR-323, which also generates a novel BglII site
                   AT
    5′ CACAGTATGGGCGCAGGGCTTGACATTGTC 3′
    3′ CATACCGCGTCTAGAACTGTAAC 5′
                BglII

    c) Met-222-Cys:
  • A 24-mer mismatch primer, NOR-236
                ClaI
    5′ AGCTTAA{overscore (ACGGTACA)}TCGATGGCTACTCCTCATGTT 3′
    NOR-236 5′ ACGGTACATCGTGCGCTACTCCTC 3′

    d) Met-222-Ala:
  • A 22-mer mismatch primer, NOR-235
                 ClaI
    5′ AGCTTAAACGGTACATCGATGGCTACTCCTCATGTT 3′
    NOR-235 5′ CGGTACATCGGCGGCTACTCCT 3′

    Both of these primers destroy the unique ClaI site.
    e) Ser-153-Ala:
  • An 18-mer mismatch primer, NOR-324, which also generates a novel PvuII site
                   G
    5′ CTTGTAGCGGCATCTGGGAATTCAGGT 3′
    NOR-324 3′ CATCGCCGTCGACCCTTA 5′
              PvuII

    f) Asn-218-Ser:
  • A 23-mer mismatch primer, NOR-325, which also generates a novel MspI site
                   TC
    5′ TATGCCAGCTTAAACGGTACATCGATG 3′
    NOR-324 3′ TACGGTCGAATAGGCCATGTAGC 5′
                   MspI

    g) Thr-71-Asp:
  • A 23-mer mismatch primer, NOR-483,
                  GAC
    5′ TGTGGCCCGGGACGATTGCTGCTT 3′
    NOR-483 3′ ACACCGGCCCCCTGTAACGACGAA 5′

    h) Met-222-Cys and Gly-219-Cys:
  • A 32-mer mismatch, NOR-484,
                 T        TGT
    5′ CAGCTTAAACGGTACATCGATGGCTACTCCTC 3′
                 219      222
    NOR-484 3′ GTCGAATTTGACATGTAGCACACGATGAGGAG 5′

    i+j) Gly-195-Glu and Met-222-Ala or Met-222-Cys:
  • For these double mutants combinations of NOR-237 and NOR-235 or NOR-236 were performed by joining the single mutant DNA-fragments.
  • k) Ser-153-Ala and Asn-218-Ser:
  • A combination of NOR-324 and NOR-325 was performed in analogy with the above.
  • Gapped duplex mutagenesis was performed using the plasmid pSX93 as template. pSX93 is shown in FIGS. 3A and 3B, and is pUC13 (Vieira, J. and Messing, J., 1982, Gene 19: 259-268) harboring an 0.7 kb XbaI-HindIII fragment of the subtilisin 309 gene including the terminator inserted in the polylinker. The terminator and the HindIII site are not shown in Table II.
  • For the introduction of mutations in the N-terminal part of the enzyme the plasmid pSX119 was used. pSX119 is pUC13 harboring an EcoRI-XbaI fragment of the subtilisin 309 gene inserted into the polylinker. The templates pSX93 and pSX119 thus cover the whole of the subtilisin 309 gene.
  • The mutations a), b), and e) were performed by cutting pSX93 with XbaI and ClaI as indicated in FIG. 3A; c), d), f), and h) were performed by cutting pSX93 with XbaI and HindIII as indicated in FIG. 3B.
  • Mutation g) was performed correspondingly in pSX119 by cutting with EcoRI and XbaI.
  • The double mutants i) and j) were produced by cutting the 0.7 kb Xba-HindIII fragment from a) partially with HgiAI (HgiAI also cuts in SacI, which was introduced by the mutation). This 180 bp XbaI-HgiAI fragment and the 0.5 kb HgiAI fragment from the c) and d) mutants, respectively, were ligated to the large HindIII-XbaI fragment from pSX93.
  • The double mutant k) was produced as above by combining mutants e) and f).
  • Subsequent to annealing, filling and ligation the mixture was used to transform E. coli MC 1000 rm+. Mutants among the transformants were screened for by colony hybridization as described in Vlasuk et al., 1983, J. Biol. Chem., 258:7141-7148 and in Vlasuk, G. P. and Inouye, S., p. 292-303 in ‘Experimental Manipulation of Gene Expression’ Inouye, M. (ed.) Academic Press, New York. The mutations were confirmed by DNA sequencing.
  • Expression of Mutant Subtilisins
  • Subsequent to a sequence confirmation of the correct mutation the mutated DNA fragments were inserted into plasmid pSX92, which was used for producing the mutants.
  • Plasmid pSX92 is shown in FIG. 4 and was produced by cloning the subtilisin 309 gene into plasmid pSX62 cut at ClaI, filled in with the Klenow fragment of DNA polymerase I, and cut with HindIII prior to the insertion of the fragments DraI-NheI and NheI-HindIII from the cloned subtilisin 309 gene.
  • To express the mutants the mutated fragments (XbaI-ClaI, XbaI-HindIII, or EcoRI-XbaI) were excised from the appropriate mutation plasmid pSX93 or pSX119, respectively, and inserted into pSX92.
  • The mutated pSX92 was then used to transform B. subtilis strain DN497, which was then grown in the same medium and under the same conditions as used for the cloning of the parent gene.
  • After appropriate growth the mutated enzymes were recovered and purified.
  • Oxidation Stability of Mutant Subtilisins
  • The mutants a) and d) were tested for their oxidation stability in 0.01 M peracetic acid after 20 minutes at 50° C. and pH 7. The parent strain NCIB 10309 protease was used as reference.
  • The results are indicated in Table IV below, which presents the residual proteolytic activity in the heat treated samples relative to samples untreated by oxidant or heat.
    TABLE IV
    Oxidation Stability Towards Peracetic Acid
    Residual Activity after
    20 min. at 50° C.
    Enzyme without oxidant with oxidant
    Subtilisin
    309 89% 48%
    mutant a 83% 45%
    mutant d 92% 93%
  • It is concluded that mutant d (Met 222 to Ala) exhibits superior oxidation stability realtive to the parent enzyme and mutant a.
  • All the mutants except g) and h) have also been tested qualitatively in 100-500 ppm hypochlorite at room temperature and 35° C., pH 6.5 and 9.0, for from 15 minutes to 2 hours.
  • These tests showed that mutants c), d), i), and j) (all Met-222) could resist 3-5 times more hypochlorite than the other mutants.
  • When tested in a liquid detergent of the usual built type it was found that mutant f) exhibited superior stability compared to both the other mutants and the “parent” enzyme.
  • Proteolytic Activity Of Mutant Subtilisins
  • The proteolytic activity of various mutants was tested against casein as protein substrate, according to methods detailed supra. The results are presented in Table V.
  • From the table it is seen that mutant a) exhibits enhanced activity compared to the parent. It is also seen that the Met-222 mutants have lower activity than the parent, but due to their improved oxidation stability their application in detergent compositions containing oxidants is not precluded.
    TABLE V
    Proteolytic Activity of Mutant Subtilisins
    Mutant Relative Activity
    None 100
    a) 120
    b) 100
    c) 30
    d) 20
    e) 100
    f) 100
    i) 20
    j) 30
  • Washability of Mutant Subtilisins
  • The washability of various mutants was tested against spinach juice according to methods detailed supra. The results are presented in Table VI.
  • From the table it is seen that all of the tested mutants exhibited an improved washing ability compared to the parent enzyme, and that mutants c), d), i), and j) are markedly superior.
    TABLE VI
    Washability of Mutant
    Delta R
    Mutant Concentration (CPU/l)
    0.05 0.1
    none 14.4 20.4
    a) 18.8 21.5
    b) 16.9 19.7
    c) 21.8 23.8
    d 22.2 23.4
    e) 15.4 21.8
    f) 16.6 19.3
    i) 21.6 22.1
    j) 20.6 22.6

    95% confidence interval: +/−0.9
  • Thermostability Of Mutant Subtilisins
  • The thermostability of mutant f) was tested against the wild type enzyme by using the washability test at 40° C. and 60° C., respectively. The results are shown in Table VII.
  • From the table it is seen that mutant f) at 60° C shows a much improved washability compared to the wild type enzyme, whereas at 40° C. the washability of mutant f) is only slightly better than the wild type enzyme.
    TABLE VII
    Washability at Different Temperatures
    Delta R
    Mutant Concentration (CPU/l)
    0.05 0.1
    none (40° C.) 14.4 20.4
    f) (40° C.) 16.6 19.3
    none (60° C.) 15.1 24.9
    f) (60° C.) 30.4 31.3

    95% confidence interval +/−0.9 (40° C.) and +/−0.7 (60° C.)

    Discussion
  • Subtilisin genes were cloned from the 147 and 309 variants of the bacterium Bacillus lentus, and the cloned genes were sequenced. By comparing the deduced amino acid sequences of subtilisins 147 and 309 one with the other and with sequences of other subtilisins, sites which, upon mutation, might alter the physical properties of the parent enzyme were identified. Site-directed mutagenesis was used to generate mutations at several of these sites in the subtilisin 309 gene. The resulting mutant enzymes were then expressed in a Bacillus strain, and tested against various physical and chemical parameters. Several of the mutants were shown to have improved stability to oxidation, increased proteolytic ability, or improved washability when compared with subtilisin 309. These mutants exhibit properties desirable in enzymes comprised in detergent compositions.

Claims (43)

1. A modified subtilisin 309, comprising a substitution at one or more of the following positions:
53, 67, 124, 128, 131, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 168, 169, 170, 172, 218, 219, and 222
wherein each position corresponds to the position of the amino acid sequence of the mature subtilisin BPN′ as depicted in Table I(c):
2. The modified subtilisin of claim 1, which has augmented protease activity or improved washing ability.
3. The modified subtilisin of claim 1, comprising a substitution at position 53.
4. The modified subtilisin of claim 1, comprising a substitution at position 67.
5. The modified subtilisin of claim 1, wherein the substitution is with aspartic acid or glutamic acid.
6. The modified subtilisin of claim 1, comprising a substitution at position 124.
7. The modified subtilisin of claim 1, comprising a substitution at position 128.
8. The modified subtilisin of claim 1, comprising a substitution at position 131.
9. The modified subtilisin of claim 1, comprising a substitution at position 154.
10. The modified subtilisin of claim 1, comprising a substitution at position 155.
11. The modified subtilisin of claim 1, comprising a substitution at position 156.
12. The modified subtilisin of claim 1, comprising a substitution at position 157.
13. The modified subtilisin of claim 1, comprising a substitution at position 158.
14. The modified subtilisin of claim 1, comprising a substitution at position 159.
15. The modified subtilisin of claim 1, comprising a substitution at position 160.
16. The modified subtilisin of claim 1, comprising a substitution at position 161.
17. The modified subtilisin of claim 1, comprising a substitution at position 162.
18. The modified subtilisin of claim 1, comprising a substitution at position 163.
19. The modified subtilisin of claim 1, comprising a substitution at position 164.
20. The modified subtilisin of claim 1, comprising a substitution at position 165.
21. The modified subtilisin of claim 1, comprising a substitution at position 166.
22. The modified subtilisin of claim 1, comprising a substitution at position 168.
23. The modified subtilisin of claim 22, wherein the substitution is with alanine.
24. The modified subtilisin of claim 1, comprising a substitution at position 169.
25. The modified subtilisin of claim 1, comprising a substitution at position 170.
26. The modified subtilisin of claim 25, wherein the substitution is with tyrosine.
27. The modified subtilisin of claim 1, comprising a substitution at position 172.
28. The modified subtilisin of claim 1, comprising a substitution at position 218.
29. The modified subtilisin of claim 28, wherein the substitution is with serine.
30. The modified subtilisin of claim 1, comprising a substitution at position 219.
31. The modified subtilisin of claim 30, wherein the substitution is with methionine.
32. The modified subtilisin of claim 1, comprising a substitution at position 222.
33. The modified subtilisin of claim 32, wherein the substitution is with cysteine or alanine.
34. A detergent composition comprising a modified subtilisin of claim 1 and a surfactant.
35. A modified subtilisin 309, comprising an insertion at one or more of the following positions:
36, 56, 159, 164, 165 and 166
wherein each position corresponds to the position of the amino acid sequence of the mature subtilisin BPN′ as depicted in Table I(c).
36. The modified subtilisin of claim 35, which has augmented protease activity or improved washing ability.
37. The modified subtilisin of claim 35, comprising an insertion at position 6.
38. The modified subtilisin of claim 35, comprising an insertion at position 56.
39. The modified subtilisin of claim 35, comprising an insertion at position 159.
40. The modified subtilisin of claim 35, comprising an insertion at position 164.
41. The modified subtilisin of claim 35, comprising an insertion at position 165.
42. The modified subtilisin of claim 35, comprising an insertion at position 166.
43. A detergent composition comprising a modified subtilisin of claim 35 and a surfactant.
US10/896,177 1988-01-07 2004-07-21 Useful mutations of bacterial alkaline protease Abandoned US20050003986A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/896,177 US20050003986A1 (en) 1988-01-07 2004-07-21 Useful mutations of bacterial alkaline protease

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
DK64/88 1988-01-07
DK006488A DK6488D0 (en) 1988-01-07 1988-01-07 ENZYMES
US29424189A 1989-01-06 1989-01-06
US08/486,846 US6506589B1 (en) 1988-01-07 1995-06-07 Useful mutations of bacterial alkaline protease
US10/306,089 US6808913B2 (en) 1988-01-07 2002-11-27 Useful mutations of bacterial alkaline protease
US10/896,177 US20050003986A1 (en) 1988-01-07 2004-07-21 Useful mutations of bacterial alkaline protease

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/306,089 Continuation US6808913B2 (en) 1988-01-07 2002-11-27 Useful mutations of bacterial alkaline protease

Publications (1)

Publication Number Publication Date
US20050003986A1 true US20050003986A1 (en) 2005-01-06

Family

ID=8089323

Family Applications (6)

Application Number Title Priority Date Filing Date
US08/486,415 Expired - Lifetime US5741694A (en) 1988-01-07 1995-06-07 Useful mutations of bacterial alkaline protease
US08/486,846 Expired - Lifetime US6506589B1 (en) 1988-01-07 1995-06-07 Useful mutations of bacterial alkaline protease
US10/306,089 Expired - Fee Related US6808913B2 (en) 1988-01-07 2002-11-27 Useful mutations of bacterial alkaline protease
US10/310,730 Expired - Fee Related US6835821B2 (en) 1988-01-07 2002-12-05 Useful mutations of bacterial alkaline protease
US10/313,853 Expired - Fee Related US6908991B2 (en) 1988-01-07 2002-12-06 Useful mutations of bacterial alkaline protease
US10/896,177 Abandoned US20050003986A1 (en) 1988-01-07 2004-07-21 Useful mutations of bacterial alkaline protease

Family Applications Before (5)

Application Number Title Priority Date Filing Date
US08/486,415 Expired - Lifetime US5741694A (en) 1988-01-07 1995-06-07 Useful mutations of bacterial alkaline protease
US08/486,846 Expired - Lifetime US6506589B1 (en) 1988-01-07 1995-06-07 Useful mutations of bacterial alkaline protease
US10/306,089 Expired - Fee Related US6808913B2 (en) 1988-01-07 2002-11-27 Useful mutations of bacterial alkaline protease
US10/310,730 Expired - Fee Related US6835821B2 (en) 1988-01-07 2002-12-05 Useful mutations of bacterial alkaline protease
US10/313,853 Expired - Fee Related US6908991B2 (en) 1988-01-07 2002-12-06 Useful mutations of bacterial alkaline protease

Country Status (7)

Country Link
US (6) US5741694A (en)
EP (4) EP1498481A1 (en)
JP (3) JPH0675504B2 (en)
AT (1) ATE136329T1 (en)
DE (1) DE68926163T2 (en)
DK (3) DK6488D0 (en)
WO (1) WO1989006279A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040248273A1 (en) * 2000-10-13 2004-12-09 Novozymes A/S Subtilase variants
US20070270574A1 (en) * 2000-04-03 2007-11-22 Novozymes A/S Subtilisin variants
WO2013138288A1 (en) 2012-03-16 2013-09-19 Monosol, Llc. Water soluble compositions incorporating enzymes, and method of making same
WO2013158364A1 (en) 2012-04-16 2013-10-24 Monosol, Llc Powdered pouch and method of making same
US11104497B2 (en) 2014-10-03 2021-08-31 Monosol, Llc Degradable materials and packaging made from same

Families Citing this family (747)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185258A (en) * 1984-05-29 1993-02-09 Genencor International, Inc. Subtilisin mutants
DK6488D0 (en) * 1988-01-07 1988-01-07 Novo Industri As ENZYMES
US6287841B1 (en) 1988-02-11 2001-09-11 Genencor International, Inc. High alkaline serine protease
WO1994002618A1 (en) * 1992-07-17 1994-02-03 Gist-Brocades N.V. High alkaline serine proteases
CN1056187C (en) * 1988-02-11 2000-09-06 金克克国际有限公司 Proteolytic enzymes and their use in detergents
US5324653A (en) * 1988-02-11 1994-06-28 Gist-Brocades N.V. Recombinant genetic means for the production of serine protease muteins
US5116741A (en) * 1988-04-12 1992-05-26 Genex Corporation Biosynthetic uses of thermostable proteases
ES2227508T3 (en) * 1989-06-26 2005-04-01 Unilever N.V. ENZYMATIC DETERGENT COMPOSITIONS.
EP0405902A1 (en) * 1989-06-26 1991-01-02 Unilever Plc Enymatic detergent compositions
DK316989D0 (en) * 1989-06-26 1989-06-26 Novo Nordisk As ENZYMES
US5665587A (en) * 1989-06-26 1997-09-09 Novo Nordisk A/S Modified subtilisins and detergent compositions containing same
US5658871A (en) * 1989-07-07 1997-08-19 Lever Brothers Company, Division Of Conopco, Inc. Microbial lipase muteins and detergent compositions comprising same
DE69033388T2 (en) * 1989-08-25 2000-05-11 Henkel Research Corp., Santa Rosa ALKALINE PROTEOLYTIC ENZYME AND METHOD FOR PRODUCING THE SAME
US5352603A (en) * 1989-08-31 1994-10-04 Kali-Chemie Ag Highly alkaline proteases
DE4023458A1 (en) * 1989-08-31 1991-03-07 Kali Chemie Ag NEW HIGH ALKALINE PROTEASES
US6271012B1 (en) * 1989-10-11 2001-08-07 Genencor International, Inc. Protease muteins and their use in detergents
US5541062A (en) * 1990-02-23 1996-07-30 Arch Development Corporation Methods and compositions for preparing protein processing enzymes
DK97190D0 (en) * 1990-04-19 1990-04-19 Novo Nordisk As OXIDATION STABLE DETERGENT ENZYMER
US5733473A (en) * 1990-11-14 1998-03-31 The Procter & Gamble Company Liquid detergent composition containing lipase and protease
DK271490D0 (en) * 1990-11-14 1990-11-14 Novo Nordisk As detergent composition
KR100237968B1 (en) * 1990-12-05 2000-01-15 한센 핀 베네드 Proteins with changed epitopes and methods for the production thereof
US6967080B1 (en) * 1990-12-05 2005-11-22 Novozymes A/S Proteins with changed epitopes and methods for the production thereof
US5766898A (en) * 1990-12-05 1998-06-16 Novo Nordisk A/S Proteins with changed epitopes and methods for the production thereof
EP0563169B2 (en) * 1990-12-21 2006-04-12 Novozymes A/S ENZYME MUTANTS HAVING A LOW DEGREE OF VARIATION OF THE MOLECULAR CHARGE OVER A pH RANGE
GB9027836D0 (en) * 1990-12-21 1991-02-13 Unilever Plc Enzymes and enzymatic detergent compositions
US5482849A (en) * 1990-12-21 1996-01-09 Novo Nordisk A/S Subtilisin mutants
US5340735A (en) * 1991-05-29 1994-08-23 Cognis, Inc. Bacillus lentus alkaline protease variants with increased stability
US5646028A (en) * 1991-06-18 1997-07-08 The Clorox Company Alkaline serine protease streptomyces griseus var. alkaliphus having enhanced stability against urea or guanidine
EP0525610A3 (en) * 1991-07-27 1993-03-24 Solvay Enzymes Gmbh & Co. Kg Process for increasing the stability of enzymes and stabilized enzymes
US5275945A (en) * 1991-10-08 1994-01-04 Vista Chemical Company Alkaline proteases stable in heavy-duty detergent liquids
AU2591992A (en) * 1991-10-16 1993-05-21 Unilever Plc Aqueous enzymatic detergent compositions
US5371198A (en) * 1991-12-16 1994-12-06 Novo Nordisk A/S Method for protection of proteolysis-susceptible protein during protein production in a fluid medium
US5623059A (en) * 1992-03-09 1997-04-22 Novo Nordisk A/S Method for protection of proteolysis-susceptible protein during protein production in a fluid medium
DE69333463D1 (en) * 1992-05-18 2004-05-06 Genencor Int Bacteria producing alkaline proteases, and process for producing these alkaline proteases
JPH0763377B2 (en) * 1992-09-03 1995-07-12 大阪府 Heat-resistant alkaline protease gene, recombinant plasmid pABT17, Bacillus subtilis plasmid vector pABTts14 and transformant of the Bacillus subtilis plasmid vector pABTts14
DE4231726A1 (en) * 1992-09-23 1994-03-24 Cognis Bio Umwelt Mutated subtilisin-like serine proteases
GB9220669D0 (en) * 1992-09-30 1992-11-11 Unilever Plc Detergent composition
US6440717B1 (en) 1993-09-15 2002-08-27 The Procter & Gamble Company BPN′ variants having decreased adsorption and increased hydrolysis
US6436690B1 (en) 1993-09-15 2002-08-20 The Procter & Gamble Company BPN′ variants having decreased adsorption and increased hydrolysis wherein one or more loop regions are substituted
AU1253695A (en) * 1993-10-14 1995-05-04 Procter & Gamble Company, The Bleaching compositions comprising protease enzymes
CA2173105C (en) * 1993-10-14 2003-05-27 Andre Baeck Protease-containing cleaning compositions
MA23346A1 (en) 1993-10-14 1995-04-01 Genencor Int VARIANTS OF THE SUB-USE
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6335160B1 (en) 1995-02-17 2002-01-01 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6406855B1 (en) 1994-02-17 2002-06-18 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6599730B1 (en) * 1994-05-02 2003-07-29 Procter & Gamble Company Subtilisin 309 variants having decreased adsorption and increased hydrolysis
WO1996000277A1 (en) * 1994-06-23 1996-01-04 Unilever N.V. Dishwashing compositions
US6066611A (en) * 1994-10-13 2000-05-23 The Procter & Gamble Company Bleaching compositions comprising protease enzymes
US6455295B1 (en) 1995-03-08 2002-09-24 The Procter & Gamble Company Subtilisin Carlsberg variants having decreased adsorption and increased hydrolysis
IL117350A0 (en) 1995-03-09 1996-07-23 Procter & Gamble Proteinase k variants having decreased adsorption and increased hydrolysis
US6475765B1 (en) 1995-03-09 2002-11-05 Procter & Gamble Company Subtilisin DY variants having decreased adsorption and increased hydrolysis
BR9608149B1 (en) * 1995-05-05 2012-01-24 processes for effecting mutation in DNA encoding a subtilase enzyme or its pre- or pre-enzyme and for the manufacture of a mutant subtilase enzyme.
US5837517A (en) 1995-05-05 1998-11-17 Novo Nordisk A/S Protease variants and compositions
US6682924B1 (en) 1995-05-05 2004-01-27 Novozymes A/S Protease variants and compositions
US20120165241A1 (en) * 1995-05-05 2012-06-28 Unilever Plc Subtilase Variants
US6936289B2 (en) 1995-06-07 2005-08-30 Danisco A/S Method of improving the properties of a flour dough, a flour dough improving composition and improved food products
CN1530443A (en) * 1996-11-04 2004-09-22 ŵ����÷�����޹�˾ subtilase variants and compositions
AU4772697A (en) 1996-11-04 1998-05-29 Novo Nordisk A/S Subtilase variants and compositions
US6077662A (en) * 1996-11-27 2000-06-20 Emory University Virus-like particles, methods and immunogenic compositions
EP0977869B2 (en) * 1997-04-09 2008-11-12 Danisco A/S Lipase and use of same for improving doughs and baked products
US6140475A (en) 1997-04-11 2000-10-31 Altus Biologics Inc. Controlled dissolution crosslinked protein crystals
KR20010023468A (en) 1997-08-29 2001-03-26 한센 핀 베네드, 안네 제헤르, 웨이콥 마리안느 Protease variants and compositions
DE69839076T2 (en) * 1997-08-29 2009-01-22 Novozymes A/S PROTEASE VERSIONS AND COMPOSITIONS
EP0913458B1 (en) * 1997-10-22 2004-06-16 The Procter & Gamble Company Liquid hard-surface cleaning compositions
ES2368718T3 (en) * 1997-10-23 2011-11-21 Danisco Us Inc. SUBTILISINE VARIATIONS WITH MULTIPLE SUBSTITUTIONS.
MA25044A1 (en) * 1997-10-23 2000-10-01 Procter & Gamble WASHING COMPOSITIONS CONTAINING MULTISUBSTITUTED PROTEASE VARIANTS.
US6773907B2 (en) 1997-11-21 2004-08-10 Peter Kamp Hansen Subtilase enzymes
BR9814236A (en) 1997-11-21 2000-10-03 Novo Nordisk As Subtilase enzyme, its variant, isolated DNA sequence, expression vector, host microbial cell, process to produce a subtilase or a subtilase variant, composition, and use of a subtilase or a subtilase variant.
US6780629B2 (en) 1997-11-21 2004-08-24 Novozymes A/S Subtilase enzymes
US6642011B2 (en) 1998-04-15 2003-11-04 Genencor International, Inc. Human protease and use of such protease for pharmaceutical applications and for reducing the allergenicity of non-human proteins
US6936249B1 (en) 1998-04-15 2005-08-30 Genencor International, Inc. Proteins producing an altered immunogenic response and methods of making and using the same
US6835550B1 (en) 1998-04-15 2004-12-28 Genencor International, Inc. Mutant proteins having lower allergenic response in humans and methods for constructing, identifying and producing such proteins
DE69904941T3 (en) 1998-07-21 2008-01-31 Danisco A/S FOOD
US6461849B1 (en) * 1998-10-13 2002-10-08 Novozymes, A/S Modified polypeptide
US6376450B1 (en) 1998-10-23 2002-04-23 Chanchal Kumar Ghosh Cleaning compositions containing multiply-substituted protease variants
US6831053B1 (en) 1998-10-23 2004-12-14 The Procter & Gamble Company Bleaching compositions comprising multiply-substituted protease variants
EP2302043A3 (en) 1998-11-27 2011-07-20 Novozymes A/S Lipolytic enzyme variants
AU3115300A (en) 1998-12-08 2000-06-26 Children's Hospital And Regional Medical Center Polymorphic loci that differentiate escherichia coli 0157:h7 from other strains
ATE504651T1 (en) 1998-12-18 2011-04-15 Novozymes As SUBTILASE ENZYMES OF THE I-S1 AND I-S2 SUBGROUPS WITH AN ADDITIONAL AMINO ACID RESIDUE IN AN ACTIVE LOOP REGION
ES2532606T3 (en) 1999-03-31 2015-03-30 Novozymes A/S Polypeptides with alkaline alpha-amylase activity and nucleic acids encoding them
ES2322426T3 (en) 1999-03-31 2009-06-22 Novozymes A/S POLYPEPTIDES WITH ALFA-AMYLASE ACTIVITY AND NUCLEIC ACIDS THAT CODIFY THEMSELVES.
KR20000065867A (en) 1999-04-09 2000-11-15 손경식 Alkaline Protease Vapk Useful as Washing Detergent, vapk Gene, Recombinant Expression Vector, and Transformed Microorganism
AU4392500A (en) 1999-05-20 2000-12-12 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additionalamino acid residue between positions 132 and 133
ATE408680T1 (en) 1999-05-20 2008-10-15 Novozymes As SUBTILASE ENZYMES OF THE I-S1 AND I-S2 SUBGROUPS WITH AT LEAST ONE ADDITIONAL AMINO ACID BETWEEN POSITIONS 128 AND 129
DE60040285D1 (en) 1999-05-20 2008-10-30 Novozymes As SUBTILASE ENZYMES OF I-S1 AND I-S2 SUB-GROUPS WITH AT LEAST ONE ADDITIONAL AMINO ACID BETWEEN ITEM 127 AND 128
ATE408678T1 (en) 1999-05-20 2008-10-15 Novozymes As SUBTILASE ENZYMES OF THE I-S1 AND I-S2 SUBGROUPS WITH AT LEAST ONE ADDITIONAL AMINO ACID BETWEEN POSITIONS 129 AND 130
WO2000071688A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 126 and 127
EP1183343B2 (en) 1999-05-20 2013-11-27 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 125 and 126
CZ2002212A3 (en) * 1999-07-22 2002-07-17 The Procter & Gamble Company Variants of subtilisin protease having amino acid substitutions in defined epitope regions
EP1214426A2 (en) 1999-08-31 2002-06-19 Novozymes A/S Novel proteases and variants thereof
US6727085B2 (en) 1999-12-15 2004-04-27 Fanoe Tina Sejersgaard Subtilase variants having an improved wash performance on egg stains
US6777218B1 (en) 2000-03-14 2004-08-17 Novozymes A/S Subtilase enzymes having an improved wash performance on egg stains
EP2258853B1 (en) * 2000-04-28 2016-06-08 Novozymes A/S Lipolytic enzyme variant
CA2419896C (en) 2000-08-21 2014-12-09 Novozymes A/S Subtilase enzymes
US6541234B1 (en) * 2000-09-11 2003-04-01 University Of Maryland Biotechnology Institute Calcium free subtilisin mutants
US6541235B1 (en) * 2000-09-29 2003-04-01 University Of Maryland Biotechnology Institute Calcium free subtilisin mutants
CA2424434A1 (en) 2000-10-13 2002-04-18 Novozymes A/S Subtilase variants
US20040091994A1 (en) 2000-10-13 2004-05-13 Carsten Andersen Alpha-amylase variant with altered properties
US6673580B2 (en) 2000-10-27 2004-01-06 Genentech, Inc. Identification and modification of immunodominant epitopes in polypeptides
AU758744B2 (en) * 2000-10-31 2003-03-27 F. Hoffmann-La Roche Ag Methods for the analysis of non-proteinaceous components using a protease from a bacillus strain
EP1201752A1 (en) * 2000-10-31 2002-05-02 Roche Diagnostics GmbH Methods for the analysis of non-proteinaceous components using a protease from a Bacillus strain
EP1201753B1 (en) * 2000-10-31 2008-04-23 Boehringer Mannheim Gmbh Methods for the analysis of non-proteinaceous components using a protease from a bacillus strain
US7303907B2 (en) 2001-01-08 2007-12-04 Health Protection Agency Degradation and detection of TSE infectivity
CA2441595C (en) 2001-03-23 2012-07-03 Genencor International, Inc. Proteins producing an altered immunogenic response and methods of making and using the same
DE10121463A1 (en) * 2001-05-02 2003-02-27 Henkel Kgaa New alkaline protease variants and washing and cleaning agents containing these new alkaline protease variants
EP2159279A3 (en) 2001-05-15 2010-05-12 Novozymes A/S Alpha-amylase variant with altered properties
NZ528260A (en) 2001-05-18 2005-09-30 Danisco Method of improving dough and bread quality with the addition of an enzyme that hydrolyses a glycolipid and a phospholipid and incapable of hydrolysing a triglyceride or monoglyceride
ES2533923T3 (en) 2001-06-26 2015-04-16 Novozymes A/S Polypeptides with cellobiohydrolase I activity and polynucleotides encoding them
DK200101090A (en) * 2001-07-12 2001-08-16 Novozymes As Subtilase variants
DE10153792A1 (en) 2001-10-31 2003-05-22 Henkel Kgaa New alkaline protease variants and washing and cleaning agents containing these new alkaline protease variants
DE10162727A1 (en) 2001-12-20 2003-07-10 Henkel Kgaa New alkaline protease from Bacillus gibsonii (DSM 14391) and washing and cleaning agents containing this new alkaline protease
DE10162728A1 (en) 2001-12-20 2003-07-10 Henkel Kgaa New alkaline protease from Bacillus gibsonii (DSM 14393) and washing and cleaning agents containing this new alkaline protease
DE10163884A1 (en) 2001-12-22 2003-07-10 Henkel Kgaa New alkaline protease from Bacillus sp. (DSM 14392) and detergents and cleaning agents containing this new alkaline protease
JP2005535284A (en) 2001-12-31 2005-11-24 ジェネンコー・インターナショナル・インク Protease that produces a change in immune response, and method for producing and using the same
EP1523553B1 (en) * 2002-01-16 2009-12-02 Genencor International, Inc. Multiply-substituted protease variants
US20050170488A1 (en) 2002-01-16 2005-08-04 Poulose Ayrookaran J. Multiply-substituted protease variants
NZ534198A (en) 2002-02-26 2005-11-25 Genencor Int Population based assessments and means to rank the relative immunogenicity of proteins
CN100386434C (en) 2002-03-27 2008-05-07 诺和酶股份有限公司 Granules with a silky coating
EP1495128B1 (en) 2002-03-29 2014-05-07 Genencor International, Inc. Ehanced protein expression in bacillus
CN100529066C (en) 2002-07-01 2009-08-19 诺维信公司 Mpg added to fermentation
CN1684657A (en) 2002-07-30 2005-10-19 金克克国际有限公司 Formulations with reduced aerosol generation
ES2359382T3 (en) 2002-10-01 2011-05-23 Novozymes A/S GH-61 FAMILY POLIPEPTIDES.
CN104630192A (en) * 2002-10-02 2015-05-20 催化剂生物科学有限公司 Methods of generating and screenign for porteases with altered specificity
US7888093B2 (en) * 2002-11-06 2011-02-15 Novozymes A/S Subtilase variants
TWI319007B (en) 2002-11-06 2010-01-01 Novozymes As Subtilase variants
AU2003302905A1 (en) 2002-12-11 2004-06-30 Novozymes A/S Detergent composition comprising endo-glucanase
EP1578964B2 (en) 2002-12-20 2013-09-04 Novozymes A/S Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
MXPA05007653A (en) 2003-01-17 2005-09-30 Danisco Method.
US7955814B2 (en) 2003-01-17 2011-06-07 Danisco A/S Method
US20050196766A1 (en) * 2003-12-24 2005-09-08 Soe Jorn B. Proteins
ATE461276T1 (en) 2003-01-27 2010-04-15 Novozymes As ENZYME STABILIZATION
US7294499B2 (en) 2003-01-30 2007-11-13 Novozymes A/S Subtilases
CN1751116A (en) 2003-02-18 2006-03-22 诺和酶股份有限公司 Detergent compositions
DK2228440T3 (en) 2003-05-02 2013-01-02 Novozymes Inc Variants of beta-glucosidases
DE602004016314D1 (en) 2003-05-07 2008-10-16 Maxygen Inc ENZYM VARIANTS OF SUBTILISIN (SUBTILASES)
CA2538349C (en) 2003-06-25 2014-08-12 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
EP2617826B1 (en) 2003-08-25 2015-08-12 Novozymes Inc. Variants of glycoside hydrolases
CN1871344A (en) 2003-10-23 2006-11-29 诺和酶股份有限公司 Protease with improved stability in detergents
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
DE602004022967D1 (en) 2003-10-30 2009-10-15 Novozymes As CARBOHYDRATE-BONDING MODULES
US7906307B2 (en) 2003-12-24 2011-03-15 Danisco A/S Variant lipid acyltransferases and methods of making
US7718408B2 (en) * 2003-12-24 2010-05-18 Danisco A/S Method
GB0716126D0 (en) 2007-08-17 2007-09-26 Danisco Process
EP1709165B1 (en) 2004-01-06 2014-04-23 Novozymes A/S Polypeptides of alicyclobacillus
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP1713919A2 (en) 2004-02-13 2006-10-25 Novozymes A/S Protease variants
GB0405637D0 (en) * 2004-03-12 2004-04-21 Danisco Protein
US7824896B2 (en) * 2004-04-02 2010-11-02 Novozymes A/S Subtilase variants having altered lmmunogenicity
JP2007532114A (en) * 2004-04-09 2007-11-15 ジェネンコー・インターナショナル・インク PckA modification and enhanced protein expression in Bacillus
US7148404B2 (en) 2004-05-04 2006-12-12 Novozymes A/S Antimicrobial polypeptides
ATE557090T1 (en) * 2004-05-20 2012-05-15 Aes Chemunex S A POLYNUCLEOTIDES FOR DETECTING ESCHERICHIA COLI O157:H7 AND ESCHERICHIA COLI O157:NM VEROTOXIN PRODUCERS
US20090060933A1 (en) * 2004-06-14 2009-03-05 Estell David A Proteases producing an altered immunogenic response and methods of making and using the same
CA2854912A1 (en) 2004-07-05 2006-01-12 Novozymes A/S Alpha-amylase variants with altered properties
EP2267108A1 (en) 2004-07-16 2010-12-29 Danisco A/S Enzymatic oil-degumming method
JP5345781B2 (en) 2004-09-10 2013-11-20 ノボザイムス ノース アメリカ,インコーポレイティド Biofilm prevention, removal, reduction or destruction methods
EP1794296B1 (en) 2004-09-21 2012-04-18 Novozymes A/S Subtilases
US7741095B2 (en) 2004-09-21 2010-06-22 Novozymes A/S Subtilases
ATE499439T1 (en) 2004-09-21 2011-03-15 Novozymes As SUBTILATE
CN101084307B (en) 2004-09-30 2011-06-01 诺维信股份有限公司 Polypeptides having lipase activity and polynucleotides encoding same
CA2606475C (en) 2005-04-27 2015-06-16 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
CN101218343B (en) 2005-07-08 2013-11-06 诺维信公司 subtilisin variant
BRPI0614869A2 (en) 2005-08-16 2012-12-04 Novozymes As functional polypeptides, isolated functional mature polypeptide, enzyme, composition, method for preparing a composition, nucleic acid construct, recombinant expression vector, recombinant host cell, method for producing the polypeptide, storage medium, and process
CN101243182B (en) 2005-08-16 2014-08-06 诺维信公司 Subtilases
NZ566984A (en) 2005-09-30 2011-12-22 Novozymes Inc Methods for enhancing the degradation or conversion of cellulosic material
JP5209478B2 (en) 2005-09-30 2013-06-12 ノボザイムス アクティーゼルスカブ Immobilization of enzyme
WO2007107573A1 (en) 2006-03-22 2007-09-27 Novozymes A/S Use of polypeptides having antimicrobial activity
WO2007113241A1 (en) 2006-03-31 2007-10-11 Novozymes A/S A stabilized liquid enzyme composition
CA2649267C (en) 2006-04-14 2014-08-12 Genencor International, Inc. One-step treatment of textiles
JP2009534022A (en) 2006-04-20 2009-09-24 ノボザイムス アクティーゼルスカブ A sabinase variant with improved detergency against egg stains
EP2041278B1 (en) 2006-06-21 2017-08-09 Novozymes North America, Inc. Desizing and scouring process
CA2658610A1 (en) 2006-07-21 2008-05-15 Novozymes, Inc. Methods of increasing secretion of polypeptides having biological activity
CA2660645C (en) 2006-08-11 2016-04-05 Novozymes Biologicals, Inc. Bacillus cultures for use in washing, cleaning, stain removal, or degrading waste materials
US20080057528A1 (en) * 2006-08-30 2008-03-06 Kimberly-Clark Worldwide, Inc. Detection of hydrogen peroxide released by enzyme-catalyzed oxidation of an analyte
EP2074205B2 (en) 2006-10-06 2016-11-23 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
US20080090745A1 (en) * 2006-10-13 2008-04-17 Fox Bryan P Expression of Streptomyces subtilism inhibitor (SSI) proteins in Bacillus and Streptomyces sp.
ES2534471T3 (en) * 2006-10-27 2015-04-23 E.I. Du Pont De Nemours And Company Prion Decontamination Method
JP2010512787A (en) 2006-12-21 2010-04-30 ダニスコ・ユーエス・インク、ジェネンコー・ディビジョン Composition and use of Bacillus sp. 195 alpha-amylase polypeptide.
PL2405007T3 (en) 2007-01-25 2014-04-30 Dupont Nutrition Biosci Aps Production of a lipid acyltransferase from transformed Bacillus licheniformis cells
US20100011511A1 (en) 2007-02-20 2010-01-21 Novozymes A/S Enzyme Foam Treatment For Laundry
EP2428572A3 (en) 2007-03-09 2012-12-12 Danisco US, Inc., Genencor Division Alkaliphilic Bacillus species alpha-amylase variants, compositions comprising alpha-amylase variants, and methods of use
WO2008112258A2 (en) 2007-03-12 2008-09-18 Danisco Us Inc. Modified proteases
DK2500325T3 (en) 2007-03-23 2014-10-06 Novozymes Biologicals Inc Prevention and reduction of biofilm formation and plankton propagation
DE102007016139A1 (en) 2007-03-30 2008-10-02 Jenabios Gmbh Method for regioselective oxygenation of N-heterocycles
EP2147098B1 (en) 2007-04-30 2013-07-17 Danisco US Inc. Use of protein hydrolysates to stabilize metalloprotease detergent formulations
WO2008141281A1 (en) 2007-05-10 2008-11-20 Danisco Us Inc., Genencor Division A modified secretion system to increase expression of polypeptides in bacteria
SG148934A1 (en) 2007-06-11 2009-01-29 Novozymes As A process for combined biopolishing and bleach clean-up
DE102007047433A1 (en) * 2007-10-04 2009-04-09 Lanxess Deutschland Gmbh Liquid washing and liquid cleaning agents
MX2010004674A (en) 2007-11-05 2010-05-20 Danisco Us Inc ALFA-AMYLASE VARIANTS WITH ALTERED PROPERTIES.
AU2008325250B2 (en) 2007-11-05 2013-06-13 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
RU2515112C2 (en) 2007-12-21 2014-05-10 ДАНИСКО ЮЭс ИНК. Improved production of protein in bacillus
WO2009095425A1 (en) 2008-02-01 2009-08-06 Novozymes A/S Liquid enzyme composition
BRPI0908768A2 (en) 2008-02-04 2015-07-28 Danisco Us Inc Ts23 olfa amylase variants with altered properties
AR070497A1 (en) * 2008-02-29 2010-04-07 Procter & Gamble DETERGENT COMPOSITION THAT LIPASA INCLUDES
MX2010009457A (en) * 2008-02-29 2010-09-24 Procter & Gamble Detergent composition comprising lipase.
EP3725797A1 (en) 2008-03-26 2020-10-21 Novozymes A/S Stabilized liquid enzyme compositions
CA2719314A1 (en) 2008-03-28 2009-10-01 Danisco Us Inc. Method for amplifying locus in bacterial cell
WO2009134670A2 (en) 2008-04-30 2009-11-05 Danisco Us Inc., Genencor Division New chimeric alpha-amylase variants
EP2285944B1 (en) 2008-05-14 2013-03-13 Novozymes A/S Liquid detergent compositions
JP5599113B2 (en) 2008-06-06 2014-10-01 ダニスコ・ユーエス・インク Saccharification enzyme composition and saccharification method thereof
US9040278B2 (en) 2008-06-06 2015-05-26 Danisco Us Inc. Production of glucose from starch using alpha-amylases from Bacillus subtilis
BRPI0913402B1 (en) 2008-06-06 2019-07-02 Danisco Us Inc. ALPHA AMYLASES (AMYS) VARIANTS OF GEOBACILLUS STEAROTHERMOPHILUS WITH IMPROVED PROPERTIES
US9090887B2 (en) 2008-06-06 2015-07-28 Danisco Us Inc. Variant alpha-amylases from Bacillus subtilis and methods of use, thereof
JP5661621B2 (en) 2008-07-07 2015-01-28 ビーエーエスエフ ソシエタス・ヨーロピアBasf Se Enzyme composition comprising enzyme-containing polymer particles
EP2149786A1 (en) 2008-08-01 2010-02-03 Unilever PLC Improvements relating to detergent analysis
CN202181298U (en) 2008-09-12 2012-04-04 荷兰联合利华有限公司 Dispenser and preconditioner for viscous liquids
MX2011003178A (en) 2008-09-25 2011-04-21 Danisco Inc Alpha-amylase blends and methods for using said blends.
WO2010059413A2 (en) 2008-11-20 2010-05-27 Novozymes, Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
CA2745760A1 (en) 2008-12-04 2010-06-10 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2376527A1 (en) 2008-12-12 2011-10-19 Novozymes Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2202290A1 (en) 2008-12-23 2010-06-30 Unilever PLC A flowable laundry composition and packaging therefor
EP2213723A1 (en) 2009-01-30 2010-08-04 Novozymes A/S Isomaltose for fungus fermentation
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
US20120172275A1 (en) 2009-03-10 2012-07-05 Danisco Us Inc. Bacillus Megaterium Strain DSM90-Related Alpha-Amylases, and Methods of Use, Thereof
MX2011010040A (en) 2009-04-01 2011-11-18 Danisco Us Inc Cleaning system comprising an alpha-amylase and a protease.
BRPI1012590A2 (en) 2009-04-08 2015-09-22 Danisco Us Inc Genencor Div halomonas strain wdg-195-related alpha-amylases and methods of using them
AR076941A1 (en) 2009-06-11 2011-07-20 Danisco Us Inc BACILLUS CEPA FOR A GREATER PROTEIN PRODUCTION
US8569581B2 (en) 2009-09-17 2013-10-29 Novozymes, Inc Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CA2775045A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants for use in detergent and cleaning compositions
US20120252106A1 (en) 2009-09-25 2012-10-04 Novozymes A/S Use of Protease Variants
CA2775358A1 (en) 2009-09-29 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US20120202265A1 (en) 2009-10-23 2012-08-09 Vivek Sharma Methods for reducing blue saccharide
US20110150955A1 (en) 2009-12-23 2011-06-23 Shannon Elizabeth Klingman Products and Methods for Reducing Malodor from the Pudendum
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
JP2013517762A (en) 2010-01-22 2013-05-20 デュポン ニュートリション バイオサイエンシーズ エーピーエス Process for producing amino-substituted glycolipid compounds
CN102884197A (en) 2010-01-29 2013-01-16 诺维信公司 Biogas production process with enzymatic pre-treatment
US8859259B2 (en) 2010-02-14 2014-10-14 Ls9, Inc. Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols
CN102782126A (en) 2010-02-18 2012-11-14 丹尼斯科美国公司 Amylase from nesterenkonia and methods of use, thereof
CN102858968B (en) 2010-02-25 2015-07-01 诺维信公司 Variants of a lysozyme and polynucleotides encoding same
US9107433B2 (en) 2010-04-26 2015-08-18 Novozymes A/S Enzyme granules
US9267182B2 (en) 2010-06-22 2016-02-23 Novozymes A/S Dehairing of skins and hides
WO2012022777A1 (en) 2010-08-19 2012-02-23 Novozymes A/S Induced sporulation screening method
KR20130102536A (en) 2010-08-30 2013-09-17 노보자임스 에이/에스 A concentrated soak wash
EP2611897A1 (en) 2010-08-30 2013-07-10 Novozymes A/S A two-soak wash
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
GB201015672D0 (en) 2010-09-20 2010-10-27 Unilever Plc Improvements relating to fabric treatment compositions comprising targeted benefit agents
DK2622068T3 (en) 2010-09-30 2016-10-17 Novozymes Inc Variants of polypeptides having cellulolytic enhancing ACTIVITY AND POLYNUCLEOTIDES ENCODING THEM
CN103237891B (en) 2010-09-30 2017-07-14 诺维信股份有限公司 Polypeptide variants having cellulolytic enhancing activity and polynucleotides encoding the same
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN103339260A (en) 2011-01-04 2013-10-02 诺维信公司 Process for producing biogas from pectin and lignocellulose containing materials
WO2012101149A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Storage-stable enzyme granules
CN103339251B (en) 2011-01-31 2016-05-04 诺维信公司 Brownization glucose is as the purposes of charging matrix
EP3431581B1 (en) 2011-02-15 2022-04-06 Novozymes Biologicals, Inc. Mitigation of odor in cleaning machines and cleaning processes
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
JP2014506945A (en) 2011-02-16 2014-03-20 ノボザイムス アクティーゼルスカブ Detergent composition containing metalloprotease
JP2014511409A (en) 2011-02-16 2014-05-15 ノボザイムス アクティーゼルスカブ Detergent composition containing metalloprotease
GB201102857D0 (en) 2011-02-18 2011-04-06 Danisco Feed additive composition
GB201102865D0 (en) 2011-02-18 2011-04-06 Danisco Feed additive composition
BR112013016830A2 (en) 2011-02-23 2017-03-01 Novozymes Inc isolated polypeptide, isolated polynucleotide, method of producing the polypeptide, producing a parent cell mutant, inhibiting expression of a polypeptide, producing a protein, degrading or converting a cellulosic material, producing a fermentation product and ferment a cellulosic material, transgenic plant, plant part or plant cell transformed with a polynucleotide, double-stranded rna molecule, composition, and full broth formulation or cell culture composition
US9410136B2 (en) 2011-03-31 2016-08-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
MX2013011617A (en) 2011-04-08 2013-11-21 Danisco Us Inc Compositions.
DE102011007313A1 (en) * 2011-04-13 2012-10-18 Henkel Ag & Co. Kgaa expression methods
EP2702162B1 (en) 2011-04-29 2020-02-26 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
MX351761B (en) 2011-06-20 2017-10-26 Novozymes As Particulate composition.
EP2537918A1 (en) 2011-06-20 2012-12-26 The Procter & Gamble Company Consumer products with lipase comprising coated particles
EP2723858B1 (en) 2011-06-24 2017-04-12 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
MX2013014236A (en) 2011-06-28 2014-01-23 Novozymes As Biogas from enzyme-treated bagasse.
EP4026901B1 (en) 2011-06-30 2025-01-22 Novozymes A/S Method for screening alpha-amylases
WO2013001078A1 (en) 2011-06-30 2013-01-03 Novozymes A/S Alpha-amylase variants
BR112013033816A2 (en) 2011-07-01 2017-02-14 Novozymes A / S boron free liquid detergent composition
KR101956895B1 (en) 2011-07-01 2019-03-12 노보자임스 에이/에스 Stabilized subtilisin composition
WO2013007594A1 (en) 2011-07-12 2013-01-17 Novozymes A/S Storage-stable enzyme granules
CN109022518A (en) 2011-07-22 2018-12-18 诺维信北美公司 For pre-treating cellulosic material and the method for improving its hydrolysis
US9000138B2 (en) 2011-08-15 2015-04-07 Novozymes A/S Expression constructs comprising a Terebella lapidaria nucleic acid encoding a cellulase, host cells, and methods of making the cellulase
JP2014530598A (en) 2011-09-22 2014-11-20 ノボザイムスアクティーゼルスカブ Polypeptide having protease activity and polynucleotide encoding the same
EP2748372B1 (en) 2011-09-23 2019-04-17 Novozymes A/S Color modification of textile
HK1201559A1 (en) 2011-10-28 2015-09-04 Danisco Us Inc. Variant maltohexaose-forming alpha-amylase variants
EP3219794B1 (en) 2011-11-21 2019-09-11 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
MX2014006205A (en) 2011-11-25 2014-07-14 Novozymes As Subtilase variants and polynucleotides encoding same.
AU2012342456B2 (en) 2011-11-25 2016-11-24 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013083801A2 (en) 2011-12-09 2013-06-13 Novozymes A/S Biogas from substrates comprising animal manure and enzymes
DK2791330T3 (en) 2011-12-16 2017-11-06 Novozymes Inc Polypeptides with laccase activity and polynucleotides encoding them
RU2014129789A (en) 2011-12-19 2016-02-10 Новозимс Биоаг А/С BIOPESTICIDAL METHODS AND COMPOSITIONS
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
CN104011204A (en) 2011-12-20 2014-08-27 诺维信公司 Subtilase Variants And Polynucleotides Encoding Same
CN104066838A (en) 2011-12-22 2014-09-24 丹尼斯科美国公司 Variant alpha-amylases and methods of use thereof
WO2013096653A1 (en) 2011-12-22 2013-06-27 Danisco Us Inc. Compositions and methods comprising a lipolytic enzyme variant
DK2798053T3 (en) 2011-12-29 2018-08-13 Novozymes As DETERGENT COMPOSITIONS WITH LIPASE VARIATIONS
CN104350149A (en) 2012-01-26 2015-02-11 诺维信公司 Use of polypeptides having protease activity in animal feed and detergents
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
EP2628785B1 (en) 2012-02-17 2016-05-18 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
US20150064773A1 (en) 2012-03-07 2015-03-05 Novozymes A/S Detergent Composition and Substitution of Optical Brighteners in Detergent Composition
EP2831215B1 (en) 2012-03-29 2018-08-08 Novozymes A/S Use of enzymes for preparing water soluble films
CA2868308A1 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
ES2643216T3 (en) 2012-05-07 2017-11-21 Novozymes A/S Polypeptides with degradation activity of xanthan and polynucleotides encoding it
JP2015518707A (en) 2012-05-11 2015-07-06 ダニスコ・ユーエス・インク Use of ASPERGILLUSCLAVATUS-derived alpha amylase for saccharification
MX2014013727A (en) 2012-05-16 2015-02-10 Novozymes As Compositions comprising lipase and methods of use thereof.
ES3035568T3 (en) 2012-06-08 2025-09-04 Danisco Us Inc Variant alpha amylases with enhanced activity on starch polymers
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
AU2013279440B2 (en) 2012-06-20 2016-10-06 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
US9150841B2 (en) 2012-06-29 2015-10-06 Shire Human Genetic Therapies, Inc. Cells for producing recombinant iduronate-2-sulfatase
KR101380740B1 (en) 2012-06-29 2014-04-11 쉐어 휴먼 제네텍 세러피스, 인코포레이티드 Purification of iduronate-2-sulfatase
WO2014028434A2 (en) 2012-08-16 2014-02-20 Danisco Us Inc. Method of using alpha-amylase from aspergillus clavatus and pullulanase for saccharification
PT2885405T (en) 2012-08-16 2019-07-19 Novozymes As Method for treating textile with endoglucanase
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
CN104619838A (en) 2012-08-22 2015-05-13 诺维信公司 Metalloprotease from exiguobacterium
WO2014068083A1 (en) 2012-11-01 2014-05-08 Novozymes A/S Method for removal of dna
US20180112203A1 (en) 2012-11-20 2018-04-26 Danisco Us Inc. Amylase with maltogenic properties
MX381779B (en) 2012-12-07 2025-03-13 Novozymes As PREVENTION OF BACTERIAL ADHESION.
WO2014092960A1 (en) 2012-12-11 2014-06-19 Danisco Us Inc. Trichoderma reesei host cells expressing a glucoamylase from aspergillus fumigatus and methods of use thereof
EP2931911A1 (en) 2012-12-14 2015-10-21 Danisco US Inc. Method of using alpha-amylase from aspergillus fumigatus and isoamylase for saccharification
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
US20160010128A1 (en) 2012-12-20 2016-01-14 Danisco Us Inc. Method of using alpha-amylase from aspergillus terreus and pullulanase for saccharification
EP2934177B1 (en) 2012-12-21 2017-10-25 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014099525A1 (en) 2012-12-21 2014-06-26 Danisco Us Inc. Paenibacillus curdlanolyticus amylase, and methods of use, thereof
EP2935575B1 (en) 2012-12-21 2018-04-18 Danisco US Inc. Alpha-amylase variants
EP2941485B1 (en) 2013-01-03 2018-02-21 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
ES2676895T5 (en) 2013-03-11 2022-04-27 Danisco Us Inc Combinatorial variants of alpha-amylase
CN105189724A (en) 2013-03-14 2015-12-23 诺维信公司 Enzyme and inhibitor containing water-soluble films
CN105164147B (en) 2013-04-23 2020-03-03 诺维信公司 Liquid automatic dishwashing detergent compositions with stabilized subtilisin protease
CN105164244B (en) 2013-05-03 2019-08-20 诺维信公司 Microencapsulation of detergent enzymes
CN115521831A (en) 2013-05-14 2022-12-27 诺维信公司 Detergent composition
US20160083703A1 (en) 2013-05-17 2016-03-24 Novozymes A/S Polypeptides having alpha amylase activity
US20160122690A1 (en) 2013-05-30 2016-05-05 Novozymes A/S Particulate Enzyme Composition
CN118813589A (en) 2013-06-06 2024-10-22 诺维信公司 Alpha-amylase variants and polynucleotides encoding the same
BR112015031099B1 (en) 2013-06-12 2023-01-17 Earth Alive Clean Technologies Inc DUST SUPPRESSION COMPOSITION, AND METHOD FOR REDUCING OR SUPPRESSING DUST ON AN UNPAVED ROAD
WO2014200657A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from streptomyces xiamenensis
WO2014200658A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from promicromonospora vindobonensis
WO2014200656A1 (en) 2013-06-13 2014-12-18 Danisco Us Inc. Alpha-amylase from streptomyces umbrinus
WO2014204596A1 (en) 2013-06-17 2014-12-24 Danisco Us Inc. Alpha-amylase from bacillaceae family member
CN105874067A (en) 2013-06-27 2016-08-17 诺维信公司 Subtilase variants and polynucleotides encoding same
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
RU2696500C9 (en) 2013-07-03 2019-10-31 Басф Се Gel-like polymer composition obtained by polymerisation of acid group-containing monomer in presence of polyether compound
CN105358670A (en) 2013-07-04 2016-02-24 诺维信公司 Polypeptides with xanthan lyase activity having anti-redeposition effect and polynucleotides encoding same
WO2015004102A1 (en) 2013-07-09 2015-01-15 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3022299B1 (en) 2013-07-19 2020-03-18 Danisco US Inc. Compositions and methods comprising a lipolytic enzyme variant
CN105358686A (en) 2013-07-29 2016-02-24 诺维信公司 Protease variants and polynucleotides encoding same
CN105358684A (en) 2013-07-29 2016-02-24 诺维信公司 Protease variants and polynucleotides encoding same
EP3339436B1 (en) 2013-07-29 2021-03-31 Henkel AG & Co. KGaA Detergent composition comprising protease variants
EP3052622B1 (en) 2013-10-03 2018-09-19 Danisco US Inc. Alpha-amylases from a subset of exiguobacterium, and methods of use, thereof
EP3060659B1 (en) 2013-10-03 2019-05-29 Danisco US Inc. Alpha-amylases from exiguobacterium, and methods of use, thereof
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
UA119331C2 (en) 2013-11-08 2019-06-10 Новозімес Біоаґ А/С COMPOSITIONS AND METHODS FOR TREATMENT OF PESTS
US20160272957A1 (en) 2013-11-20 2016-09-22 Danisco Us Inc. Variant alpha-amylases having reduced susceptibility to protease cleavage, and methods of use, thereof
AR098482A1 (en) 2013-11-20 2016-06-01 Novozymes Bioag As COMPOSITIONS AND METHODS THAT INCLUDE CHROMOBACTERIUM FOR THE CONTROL OF NEMATODES AND INSECTS PLANT PESTS
WO2015094809A1 (en) 2013-12-19 2015-06-25 Danisco Us Inc. Chimeric fungal alpha-amylases comprising carbohydrate binding module and the use thereof
EP3453757B1 (en) 2013-12-20 2020-06-17 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
US10287591B2 (en) 2013-12-31 2019-05-14 Danisco Us Inc Enhanced protein expression
US10463701B2 (en) 2013-12-31 2019-11-05 DuPont Nutrition BioScience ApS Blends of Bacillus strains and enzymes
WO2015109972A1 (en) 2014-01-22 2015-07-30 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
CN106062271A (en) 2014-03-05 2016-10-26 诺维信公司 Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase
CN106062270A (en) 2014-03-05 2016-10-26 诺维信公司 Compositions and methods for improving the properties of non-cellulosic textile materials using endo-xyloglucan glycosyltransferases
CN111500552A (en) 2014-03-12 2020-08-07 诺维信公司 Polypeptides with lipase activity and polynucleotides encoding them
US20170114091A1 (en) * 2014-03-28 2017-04-27 Novozymes A/S Resolubilization of protein crystals at low ph
CN106103708A (en) 2014-04-01 2016-11-09 诺维信公司 There is the polypeptide of alpha amylase activity
CN106164236B (en) 2014-04-11 2021-02-02 诺维信公司 Detergent composition
WO2015158237A1 (en) 2014-04-15 2015-10-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
AR100606A1 (en) 2014-05-27 2016-10-19 Novozymes As VARIANTS OF LIPASES AND POLINUCLEOTIDES CODING THEM
EP3149160B1 (en) 2014-05-27 2021-02-17 Novozymes A/S Methods for producing lipases
CN106414729A (en) 2014-06-12 2017-02-15 诺维信公司 Alpha-amylase variants and polynucleotides encoding same
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP3164486B1 (en) 2014-07-04 2020-05-13 Novozymes A/S Subtilase variants and polynucleotides encoding same
CA2950380A1 (en) * 2014-07-04 2016-01-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
CN107075534A (en) 2014-10-24 2017-08-18 丹尼斯科美国公司 The method that alcohol is prepared using three peptidyl peptidases
WO2016079110A2 (en) 2014-11-19 2016-05-26 Novozymes A/S Use of enzyme for cleaning
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
CA2965231A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
ES3017699T3 (en) 2014-12-15 2025-05-13 Henkel Ag & Co Kgaa Detergent composition comprising subtilase variants
US10683528B2 (en) 2014-12-16 2020-06-16 Danisco Us Inc Enhanced protein expression
CN107002049A (en) 2014-12-16 2017-08-01 诺维信公司 Polypeptide with N acerylglucosamine oxidase actives
EP3741849A3 (en) 2014-12-19 2021-03-17 Novozymes A/S Protease variants and polynucleotides encoding same
US10400230B2 (en) 2014-12-19 2019-09-03 Novozymes A/S Protease variants and polynucleotides encoding same
JP2017538433A (en) 2014-12-19 2017-12-28 ダニスコ・ユーエス・インク Increased protein expression
EP3804532B1 (en) 2015-03-30 2024-12-25 Société des Produits Nestlé S.A. Milk-based protein hydrolysates and compositions made thereof
CN107529770B (en) 2015-04-06 2021-04-09 杜邦营养生物科学有限公司 Protease for high protein fermented milk products
CN107636134A (en) 2015-04-10 2018-01-26 诺维信公司 Detergent composition
EP3280791A1 (en) 2015-04-10 2018-02-14 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016184944A1 (en) 2015-05-19 2016-11-24 Novozymes A/S Odor reduction
TR201906836T4 (en) 2015-06-02 2019-05-21 Unilever Nv Laundry detergent composition.
EP3287513A1 (en) 2015-06-04 2018-02-28 The Procter & Gamble Company Hand dishwashing liquid detergent composition
ES2670044T3 (en) 2015-06-04 2018-05-29 The Procter & Gamble Company Liquid detergent composition for dishwashing by hand
EP3101107B1 (en) 2015-06-05 2019-04-24 The Procter and Gamble Company Compacted liquid laundry detergent composition
EP3101100B1 (en) 2015-06-05 2018-02-07 The Procter and Gamble Company Compacted liquid laundry detergent composition
EP3101102B2 (en) 2015-06-05 2023-12-13 The Procter & Gamble Company Compacted liquid laundry detergent composition
US10941372B2 (en) 2015-06-11 2021-03-09 Conopco, Inc. Laundry detergent composition
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
US10717576B2 (en) 2015-06-17 2020-07-21 Novozymes A/S Container for polypeptide
WO2016206837A1 (en) 2015-06-26 2016-12-29 Unilever Plc Laundry detergent composition
US20180171271A1 (en) 2015-06-30 2018-06-21 Novozymes A/S Laundry detergent composition, method for washing and use of composition
CA2987160C (en) 2015-07-01 2022-12-13 Novozymes A/S Methods of reducing odor
CN114292829A (en) 2015-07-06 2022-04-08 诺维信公司 Lipase variants and polynucleotides encoding them
CN108026487B (en) 2015-09-17 2021-04-30 汉高股份有限及两合公司 Detergent compositions comprising polypeptides having xanthan degrading activity
CA2991114A1 (en) 2015-09-17 2017-03-23 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2017055205A1 (en) 2015-10-01 2017-04-06 Unilever Plc Powder laundry detergent composition
EP3359658A2 (en) 2015-10-07 2018-08-15 Novozymes A/S Polypeptides
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
MX388896B (en) 2015-10-28 2025-03-20 Novozymes As DETERGENT COMPOSITION INCLUDING VARIANTS OF AMYLASE AND PROTEASE.
WO2017083196A1 (en) 2015-11-09 2017-05-18 Dupont Nutrition Biosciences Aps Feed additive composition
EP3380608A1 (en) 2015-11-24 2018-10-03 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
CN108431217B (en) 2015-12-01 2022-06-21 诺维信公司 Method for producing lipase
WO2017100720A1 (en) 2015-12-09 2017-06-15 Danisco Us Inc. Alpha-amylase combinatorial variants
EP4218992A3 (en) 2015-12-09 2023-08-09 Basf Se Method of purifying a protein from fermentation solids under desorbing conditions
WO2017117089A1 (en) 2015-12-28 2017-07-06 Novozymes Bioag A/S Heat priming of bacterial spores
CA3006607A1 (en) 2015-12-30 2017-07-06 Novozymes A/S Enzyme variants and polynucleotides encoding the same
MX2018008051A (en) 2016-01-29 2018-08-23 Novozymes As Beta-glucanase variants and polynucleotides encoding same.
EP3205392A1 (en) 2016-02-12 2017-08-16 Basf Se Microcapsules and process for preparation of microcapsules
EP3205393A1 (en) 2016-02-12 2017-08-16 Basf Se Process for preparation of microcapsules
EP3417039B1 (en) 2016-02-17 2019-07-10 Unilever PLC Whitening composition
CN108603140B (en) 2016-02-17 2020-09-08 荷兰联合利华有限公司 whitening composition
BR112018068068B1 (en) 2016-03-21 2023-04-18 Unilever Ip Holdings B.V. LIQUID AQUEOUS COMPOSITION OF DETERGENT FOR WASHING CLOTHES AND DOMESTIC METHOD OF TREATMENT OF A FABRIC
EP3433347B1 (en) 2016-03-23 2020-05-06 Novozymes A/S Use of polypeptide having dnase activity for treating fabrics
WO2017173324A2 (en) 2016-04-01 2017-10-05 Danisco Us Inc. Alpha-amylases, compositions & methods
WO2017173190A2 (en) 2016-04-01 2017-10-05 Danisco Us Inc. Alpha-amylases, compositions & methods
BR112018070468B1 (en) 2016-04-08 2022-07-12 Unilever Ip Holdings B.V AQUEOUS LIQUID DETERGENT COMPOSITION FOR WASHING CLOTHES AND DOMESTIC FABRIC TREATMENT METHOD
CN114480035B (en) 2016-04-08 2024-10-11 诺维信公司 Detergent composition and use thereof
WO2017182295A1 (en) 2016-04-18 2017-10-26 Basf Se Liquid cleaning compositions
EP3448978B1 (en) 2016-04-29 2020-03-11 Novozymes A/S Detergent compositions and uses thereof
EP3452497B1 (en) 2016-05-03 2021-02-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
CA3022121A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
EP3464538A1 (en) 2016-05-31 2019-04-10 Novozymes A/S Stabilized liquid peroxide compositions
US11001787B2 (en) 2016-06-23 2021-05-11 Novozymes A/S Use of enzymes, composition and method for removing soil
CN117721095A (en) 2016-06-30 2024-03-19 诺维信公司 Lipase variants and compositions comprising surfactants and lipase variants
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
US10662417B2 (en) 2016-07-05 2020-05-26 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
WO2018011276A1 (en) 2016-07-13 2018-01-18 The Procter & Gamble Company Bacillus cibi dnase variants and uses thereof
BR112018077483A2 (en) 2016-07-14 2019-04-02 Basf Se fermentation medium, methods for cultivating a microorganism and for producing a compound of interest, trace element solution for a fermentation process, and use of a chelating agent.
US11326152B2 (en) 2016-07-18 2022-05-10 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
US20190177665A1 (en) 2016-08-08 2019-06-13 Basf Se Liquid laundry formulation
EP3284805B1 (en) 2016-08-17 2020-02-19 The Procter & Gamble Company Cleaning composition comprising enzymes
US11512300B2 (en) 2016-08-24 2022-11-29 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
US11072765B2 (en) 2016-08-24 2021-07-27 Novozymes A/S GH9 endoglucanase variants and polynucleotides encoding same
KR102483218B1 (en) 2016-08-24 2023-01-02 헨켈 아게 운트 코. 카게아아 Detergent composition comprising xanthan lyase variant I
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
BR112019006017A2 (en) 2016-09-27 2019-06-18 Unilever Nv washing method
US20200140786A1 (en) 2016-09-29 2020-05-07 Novozymes A/S Use of enzyme for washing, method for washing and warewashing composition
CN109996859B (en) 2016-09-29 2021-11-30 诺维信公司 Spore-containing particles
EP3532592A1 (en) 2016-10-25 2019-09-04 Novozymes A/S Detergent compositions
US11753605B2 (en) 2016-11-01 2023-09-12 Novozymes A/S Multi-core granules
MX2019006425A (en) 2016-12-01 2019-08-14 Basf Se Stabilization of enzymes in compositions.
US20190292493A1 (en) 2016-12-12 2019-09-26 Novozymes A/S Use of polypeptides
CN110023469A (en) 2016-12-15 2019-07-16 荷兰联合利华有限公司 Laundry detergent composition
EP3585910B1 (en) 2017-02-24 2024-03-20 Danisco US Inc. Compositions and methods for increased protein production in bacillus licheniformis
CN110651040A (en) 2017-03-31 2020-01-03 诺维信公司 Polypeptides with DNase activity
WO2018178061A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having rnase activity
EP3601553B1 (en) 2017-03-31 2025-12-03 Danisco US Inc. Alpha-amylase combinatorial variants
CN110651041A (en) 2017-03-31 2020-01-03 诺维信公司 Polypeptides having DNase activity
US11053483B2 (en) 2017-03-31 2021-07-06 Novozymes A/S Polypeptides having DNase activity
US20200109388A1 (en) 2017-04-03 2020-04-09 Novozymes A/S Recovery Process
US20200109354A1 (en) 2017-04-04 2020-04-09 Novozymes A/S Polypeptides
CN110651029B (en) 2017-04-04 2022-02-15 诺维信公司 glycosyl hydrolase
WO2018185152A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptide compositions and uses thereof
EP3385361B1 (en) 2017-04-05 2019-03-27 Henkel AG & Co. KGaA Detergent compositions comprising bacterial mannanases
EP3385362A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising fungal mannanases
US10968416B2 (en) 2017-04-06 2021-04-06 Novozymes A/S Cleaning compositions and uses thereof
CA3058519A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions comprosing a dnase and a protease
EP3607043A1 (en) 2017-04-06 2020-02-12 Novozymes A/S Cleaning compositions and uses thereof
US20200032170A1 (en) 2017-04-06 2020-01-30 Novozymes A/S Cleaning compositions and uses thereof
US11499121B2 (en) 2017-04-06 2022-11-15 Novozymes A/S Detergent compositions and uses thereof
ES2763561T3 (en) 2017-04-06 2020-05-29 Novozymes As Cleaning compositions and their uses
US20200190437A1 (en) 2017-04-06 2020-06-18 Novozymes A/S Cleaning compositions and uses thereof
WO2018184818A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018202846A1 (en) 2017-05-05 2018-11-08 Novozymes A/S Compositions comprising lipase and sulfite
WO2018206535A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Carbohydrate-binding domain and polynucleotides encoding the same
EP3622064B1 (en) 2017-05-08 2025-05-14 Novozymes A/S Mannanase variants and polynucleotides encoding same
EP3401385A1 (en) 2017-05-08 2018-11-14 Henkel AG & Co. KGaA Detergent composition comprising polypeptide comprising carbohydrate-binding domain
WO2018206302A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018224544A1 (en) 2017-06-08 2018-12-13 Novozymes A/S Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions
CN111108183A (en) 2017-06-30 2020-05-05 诺维信公司 Enzyme slurry composition
CN110869480B (en) 2017-07-07 2021-08-13 联合利华知识产权控股有限公司 whitening composition
BR112020000205B1 (en) 2017-07-07 2023-10-31 Unilever Ip Holdings B.V. CLEANING COMPOSITION FOR WASHING FABRICS AND HOUSEHOLD METHOD OF TREATING A FABRIC
AR112778A1 (en) 2017-08-07 2019-12-11 Novozymes As FERMENTER EQUIPPED WITH EJECTOR
BR112020002605A2 (en) 2017-08-07 2020-07-28 Novozymes A/S use of ph-based fca control
EP3668973A2 (en) 2017-08-18 2020-06-24 Danisco US Inc. Alpha-amylase variants
EP3655537A1 (en) 2017-08-23 2020-05-27 Danisco US Inc. Methods and compositions for efficient genetic modifications of bacillus licheniformis strains
US20210130744A1 (en) 2017-08-24 2021-05-06 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase variants ii
WO2019038059A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent compositions comprising gh9 endoglucanase variants ii
WO2019038058A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
US11359188B2 (en) 2017-08-24 2022-06-14 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
JP7218985B2 (en) 2017-09-13 2023-02-07 ダニスコ・ユーエス・インク Modified 5'-untranslated region (UTR) sequences for increased protein production in Bacillus
US20200277553A1 (en) 2017-09-20 2020-09-03 Novozymes A/S Use of Enzymes for Improving Water Absorption And/Or Whiteness
US11414814B2 (en) 2017-09-22 2022-08-16 Novozymes A/S Polypeptides
BR112020006224A2 (en) 2017-09-27 2020-10-13 Novozymes A/S lipase variants and microcapsule compositions comprising such lipase variants
WO2019067390A1 (en) 2017-09-27 2019-04-04 The Procter & Gamble Company Detergent compositions comprising lipases
US11732221B2 (en) 2017-10-02 2023-08-22 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
EP3692147A1 (en) 2017-10-02 2020-08-12 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019076800A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Cleaning compositions and uses thereof
WO2019076833A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Low dusting granules
EP3697880B1 (en) 2017-10-16 2024-07-24 Novozymes A/S Low dusting granules
US11866748B2 (en) 2017-10-24 2024-01-09 Novozymes A/S Compositions comprising polypeptides having mannanase activity
ES2908667T3 (en) 2017-10-27 2022-05-03 Procter & Gamble Detergent compositions comprising polypeptide variants
US20230416706A1 (en) 2017-10-27 2023-12-28 Novozymes A/S Dnase Variants
BR112020008711A2 (en) 2017-11-01 2020-11-10 Novozymes A/S polypeptides and compositions comprising such polypeptides
EP4379029A1 (en) 2017-11-01 2024-06-05 Novozymes A/S Polypeptides and compositions comprising such polypeptides
DE102017125560A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE III
DE102017125559A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE II
DE102017125558A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANING COMPOSITIONS CONTAINING DISPERSINE I
WO2019086532A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Methods for cleaning medical devices
EP3703661A1 (en) 2017-11-02 2020-09-09 Danisco US Inc. Freezing point depressed solid matrix compositions for melt granulation of enzymes
US20210214709A1 (en) 2017-11-09 2021-07-15 Basf Se Coatings of enzyme particles comprising organic white pigments
MX2020005661A (en) 2017-11-29 2020-08-20 Basf Se Storage-stable enzyme preparations, their production and use.
EP3717616B1 (en) 2017-11-30 2021-10-13 Unilever IP Holdings B.V. Detergent composition comprising protease
CN111670248A (en) 2017-12-04 2020-09-15 诺维信公司 Lipase variants and polynucleotides encoding the same
KR102715197B1 (en) 2018-01-03 2024-10-08 다니스코 유에스 인크. Mutant and genetically modified bacillus cells for increased protein production and methods thereof
CN111868239A (en) 2018-02-08 2020-10-30 诺维信公司 Lipase, lipase variants and compositions thereof
WO2019154955A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
EP3755793A1 (en) 2018-02-23 2020-12-30 Henkel AG & Co. KGaA Detergent composition comprising xanthan lyase and endoglucanase variants
WO2019175240A1 (en) 2018-03-13 2019-09-19 Novozymes A/S Microencapsulation using amino sugar oligomers
EP3775190A1 (en) 2018-03-29 2021-02-17 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2019201793A1 (en) 2018-04-17 2019-10-24 Novozymes A/S Polypeptides comprising carbohydrate binding activity in detergent compositions and their use in reducing wrinkles in textile or fabric.
WO2019201783A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
EP3781680A1 (en) 2018-04-19 2021-02-24 Novozymes A/S Stabilized cellulase variants
BR112020021692A2 (en) 2018-04-26 2021-01-26 Basf Se polypeptide having lipase activity, hybrid polypeptide, composition, polynucleotide variant, method for making the polypeptide variant, and, use of the polypeptide
WO2019211143A1 (en) 2018-05-03 2019-11-07 Basf Se Amylase enzymes
EP3775127B1 (en) 2018-05-17 2022-07-20 Unilever IP Holdings B.V. Cleaning composition
WO2019238761A1 (en) 2018-06-15 2019-12-19 Basf Se Water soluble multilayer films containing wash active chemicals and enzymes
US12270012B2 (en) 2018-06-28 2025-04-08 Novozymes A/S Detergent compositions and uses thereof
US20210071116A1 (en) 2018-06-29 2021-03-11 Novozymes A/S Detergent Compositions and Uses Thereof
US20210189297A1 (en) 2018-06-29 2021-06-24 Novozymes A/S Subtilase variants and compositions comprising same
WO2020007863A1 (en) 2018-07-02 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
ES3027666T3 (en) 2018-07-03 2025-06-16 Henkel Ag & Co Kgaa Cleaning compositions and uses thereof
WO2020008024A1 (en) 2018-07-06 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
EP3818140A1 (en) 2018-07-06 2021-05-12 Novozymes A/S Cleaning compositions and uses thereof
US20230174962A1 (en) 2018-07-31 2023-06-08 Danisco Us Inc Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid
WO2020030623A1 (en) 2018-08-10 2020-02-13 Basf Se Packaging unit comprising a detergent composition containing an enzyme and at least one chelating agent
WO2020058024A1 (en) 2018-09-17 2020-03-26 Unilever Plc Detergent composition
WO2020070063A2 (en) 2018-10-01 2020-04-09 Novozymes A/S Detergent compositions and uses thereof
EP3861094A1 (en) 2018-10-02 2021-08-11 Novozymes A/S Cleaning composition
WO2020070014A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition comprising anionic surfactant and a polypeptide having rnase activity
WO2020070209A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition
EP3861008A1 (en) 2018-10-03 2021-08-11 Novozymes A/S Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same
WO2020070249A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Cleaning compositions
WO2020069915A1 (en) 2018-10-05 2020-04-09 Basf Se Compounds stabilizing hydrolases in liquids
JP7531964B2 (en) 2018-10-05 2024-08-13 ベーアーエスエフ・エスエー Compounds that stabilize amylase in liquids
MX2021003932A (en) 2018-10-05 2021-06-04 Basf Se Compounds stabilizing hydrolases in liquids.
EP3677676A1 (en) 2019-01-03 2020-07-08 Basf Se Compounds stabilizing amylases in liquids
US20220033739A1 (en) 2018-10-11 2022-02-03 Novozymes A/S Cleaning compositions and uses thereof
WO2020077331A2 (en) 2018-10-12 2020-04-16 Danisco Us Inc Alpha-amylases with mutations that improve stability in the presence of chelants
EP3647398B1 (en) 2018-10-31 2024-05-15 Henkel AG & Co. KGaA Cleaning compositions containing dispersins v
EP3647397A1 (en) 2018-10-31 2020-05-06 Henkel AG & Co. KGaA Cleaning compositions containing dispersins iv
WO2020099491A1 (en) 2018-11-14 2020-05-22 Novozymes A/S Oral care composition comprising a polypeptide having dnase activity
WO2020104231A1 (en) 2018-11-19 2020-05-28 Basf Se Powders and granules containing a chelating agent and an enzyme
EP3884023B1 (en) 2018-11-20 2024-07-17 Unilever Global Ip Limited Detergent composition
EP3884024B1 (en) 2018-11-20 2024-08-07 Unilever Global Ip Limited Detergent composition
CA3120360A1 (en) 2018-11-20 2020-05-28 Dupont Nutrition Biosciences Aps Engineered robust high tm-phytase clade polypeptides and fragments thereof
BR112021009785A2 (en) 2018-11-20 2021-08-17 Unilever Ip Holdings B.V. detergent composition, method of treating a fabric substrate and use of an enzyme
CN113056548B (en) 2018-11-20 2023-05-02 联合利华知识产权控股有限公司 Detergent composition
CN113056549B (en) 2018-11-20 2023-03-10 联合利华知识产权控股有限公司 detergent composition
CN113302270A (en) 2018-12-03 2021-08-24 诺维信公司 Low pH powder detergent compositions
US20220056379A1 (en) 2018-12-03 2022-02-24 Novozymes A/S Powder Detergent Compositions
CN113330101A (en) 2018-12-21 2021-08-31 诺维信公司 Detergent pouch comprising metalloprotease
EP3898962A2 (en) 2018-12-21 2021-10-27 Novozymes A/S Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same
US20220186177A1 (en) 2019-02-20 2022-06-16 Basf Se Industrial fermentation process for bacillus using defined medium and magnesium feed
CN114127256A (en) 2019-02-20 2022-03-01 巴斯夫欧洲公司 Industrial fermentation process of bacillus by using defined medium and trace element for feeding
EP3702452A1 (en) 2019-03-01 2020-09-02 Novozymes A/S Detergent compositions comprising two proteases
CN113454214A (en) 2019-03-21 2021-09-28 诺维信公司 Alpha-amylase variants and polynucleotides encoding same
US20220170001A1 (en) 2019-03-25 2022-06-02 Basf Se Amylase Enzymes
WO2020193535A2 (en) 2019-03-25 2020-10-01 Basf Se Amylase enzymes
US20220162528A1 (en) * 2019-04-02 2022-05-26 Novozymes A/S Liquid Dishwashing Detergent Compositions
CN113785039B (en) 2019-04-03 2024-06-18 诺维信公司 Polypeptides having beta-glucanase activity, polynucleotides encoding the same, and their use in cleaning and detergent compositions
EP3953462A1 (en) 2019-04-10 2022-02-16 Novozymes A/S Polypeptide variants
EP3953463B1 (en) 2019-04-12 2025-08-06 Novozymes A/S Stabilized glycoside hydrolase variants
WO2020229480A1 (en) 2019-05-14 2020-11-19 Basf Se Compounds stabilizing hydrolases in liquids
CN113874484A (en) 2019-05-16 2021-12-31 联合利华知识产权控股有限公司 Laundry compositions
WO2020229535A1 (en) 2019-05-16 2020-11-19 Unilever Plc Laundry composition
WO2020249546A1 (en) 2019-06-13 2020-12-17 Basf Se Method of recovering a protein from fermentation broth using a divalent cation
WO2020249706A1 (en) 2019-06-14 2020-12-17 Basf Se Aqueous polymer dispersions suitable as opacifiers in liquid formulations
US20220372408A1 (en) 2019-06-28 2022-11-24 Conopco, Inc., D/B/A Unilever Detergent composition
CN114008183B (en) 2019-06-28 2024-12-13 联合利华知识产权控股有限公司 Detergent composition
WO2020259947A1 (en) 2019-06-28 2020-12-30 Unilever Plc Detergent composition
WO2020260006A1 (en) 2019-06-28 2020-12-30 Unilever Plc Detergent compositions
US20220372400A1 (en) 2019-06-28 2022-11-24 Conopco, Inc., D/B/A Unilever Detergent composition
CN114008184B (en) 2019-06-28 2024-12-06 联合利华知识产权控股有限公司 Detergent composition
JP2022538360A (en) 2019-07-01 2022-09-01 ビーエーエスエフ ソシエタス・ヨーロピア Peptide acetals to stabilize enzymes
EP3994255A1 (en) 2019-07-02 2022-05-11 Novozymes A/S Lipase variants and compositions thereof
EP3994273A1 (en) 2019-07-02 2022-05-11 Basf Se Method for preparing a fermentation medium
ES2955800T3 (en) 2019-07-05 2023-12-07 Basf Se Industrial fermentation procedure of microbial cells using fed-batch preculture
CA3146541A1 (en) 2019-07-09 2021-01-14 Dupont Nutrition Biosciences Aps Fat coated particulate enzyme compositions
CN114364778B (en) 2019-07-12 2024-08-13 诺维信公司 Enzymatic emulsions for detergents
WO2021034660A1 (en) 2019-08-16 2021-02-25 Dupont Nutrition Biosciences Aps Compositions for gut health comprising combinations of lactobacillus strains
MX2022002182A (en) 2019-08-22 2022-03-11 Basf Se AMYLASE VARIANTS.
EP4022020A1 (en) 2019-08-27 2022-07-06 Novozymes A/S Composition comprising a lipase
US20220325204A1 (en) 2019-08-27 2022-10-13 Novozymes A/S Detergent composition
CN114364776A (en) 2019-09-02 2022-04-15 联合利华知识产权控股有限公司 detergent composition
WO2021046073A1 (en) 2019-09-05 2021-03-11 Dupont Nutrition Biosciences Aps Feed composition
EP4031644A1 (en) 2019-09-19 2022-07-27 Novozymes A/S Detergent composition
CN114423851A (en) 2019-09-19 2022-04-29 联合利华知识产权控股有限公司 Detergent composition
US20220340843A1 (en) 2019-10-03 2022-10-27 Novozymes A/S Polypeptides comprising at least two carbohydrate binding domains
AR120142A1 (en) 2019-10-07 2022-02-02 Unilever Nv DETERGENT COMPOSITION
CN114585718A (en) 2019-10-18 2022-06-03 巴斯夫欧洲公司 Storage-stable hydrolases-containing liquids
BR112022007613A2 (en) 2019-10-21 2022-08-23 Dupont Nutrition Biosci Aps COMPOSITION FOR INTESTINE HEALTH
BR112022007697A2 (en) 2019-10-24 2022-07-12 Danisco Us Inc VARIANT ALPHA-AMYLASE THAT FORMS MALTOPENTAOSE/MALTOHEXAOSE
US20230009832A1 (en) 2019-11-20 2023-01-12 Dupont Nutrition Biosciences Aps Thermostable phytase variants
WO2021105330A1 (en) 2019-11-29 2021-06-03 Basf Se Compositions and polymers useful for such compositions
WO2021115912A1 (en) 2019-12-09 2021-06-17 Basf Se Formulations comprising a hydrophobically modified polyethyleneimine and one or more enzymes
US20230038728A1 (en) 2019-12-19 2023-02-09 Leon MARCHAL Diet formulations
EP4077619A1 (en) 2019-12-20 2022-10-26 Henkel AG & Co. KGaA Cleaning composition coprising a dispersin and a carbohydrase
EP4077617A1 (en) 2019-12-20 2022-10-26 Novozymes A/S Stabilized liquid boron-free enzyme compositions
US20220411773A1 (en) 2019-12-20 2022-12-29 Novozymes A/S Polypeptides having proteolytic activity and use thereof
KR20220119607A (en) 2019-12-20 2022-08-30 헨켈 아게 운트 코. 카게아아 Cleaning Composition Comprising Dispersin IX
AU2020404593A1 (en) 2019-12-20 2022-08-18 Henkel Ag & Co. Kgaa Cleaning compositions comprising dispersins VI
WO2021146411A1 (en) 2020-01-15 2021-07-22 Danisco Us Inc Compositions and methods for enhanced protein production in bacillus licheniformis
BR112022015120A2 (en) 2020-01-29 2022-12-13 Unilever Ip Holdings B V TRANSPARENT PLASTIC CONTAINER AND TRANSPARENT PLASTIC CONTAINER MANUFACTURING PROCESS
CN115052981A (en) 2020-01-31 2022-09-13 诺维信公司 Mannanase variants and polynucleotides encoding same
WO2021152120A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
US20230138517A1 (en) 2020-02-07 2023-05-04 Dupont Nutrition Biosciences Aps Feed compositions for animal health
BR112022015985A2 (en) 2020-02-14 2022-10-11 Basf Se MANANASE VARIANT, POLYNUCLEOTIDE, EXPRESSION CONSTRUCTION, HOST CELL, METHODS FOR EXPRESSING A MANANASE VARIANT, TO INCREASE STABILITY IN THE SURFACTANT OF A MANANASE AND TO PROVIDE A DETERGENT FORMULATION, LIQUID ENZYMATIC PREPARATION, FORMULATION, WASHING, OR CLEANING METHOD E, USE OF A MANANASE
US20230240334A1 (en) 2020-02-28 2023-08-03 Dupont Nutrition Biosciences Aps Feed compositions
EP3892708A1 (en) 2020-04-06 2021-10-13 Henkel AG & Co. KGaA Cleaning compositions comprising dispersin variants
CN115210371A (en) 2020-04-08 2022-10-18 诺维信公司 carbohydrate binding module variants
US20230167384A1 (en) 2020-04-21 2023-06-01 Novozymes A/S Cleaning compositions comprising polypeptides having fructan degrading activity
EP3907271A1 (en) 2020-05-07 2021-11-10 Novozymes A/S Cleaning composition, use and method of cleaning
US20230212548A1 (en) 2020-05-26 2023-07-06 Novozymes A/S Subtilase variants and compositions comprising same
EP4162018B1 (en) 2020-06-08 2024-01-31 Unilever IP Holdings B.V. Method of improving protease activity
US20230235250A1 (en) 2020-06-18 2023-07-27 Basf Se Compositions and Their Use
EP4172298A1 (en) 2020-06-24 2023-05-03 Novozymes A/S Use of cellulases for removing dust mite from textile
EP3936593A1 (en) 2020-07-08 2022-01-12 Henkel AG & Co. KGaA Cleaning compositions and uses thereof
ES2983195T3 (en) 2020-07-09 2024-10-22 Basf Se Compositions and their applications
WO2022008732A1 (en) 2020-07-10 2022-01-13 Basf Se Enhancing the activity of antimicrobial preservatives
WO2022023250A1 (en) 2020-07-27 2022-02-03 Unilever Ip Holdings B.V. Use of an enzyme and surfactant for inhibiting microorganisms
JP2023539234A (en) 2020-08-24 2023-09-13 ノボザイムス アクティーゼルスカブ Oral care composition containing fructanase
CN116323889B (en) 2020-08-25 2025-11-04 诺维信公司 Family 44 xyloglucanase variant
US20230287300A1 (en) 2020-08-28 2023-09-14 Conopco, Inc., D/B/A Unilever Surfactant and detergent composition
BR112023001773A2 (en) 2020-08-28 2023-03-28 Unilever Ip Holdings B V DETERGENT COMPOSITION AND METHOD
BR112023002979A2 (en) 2020-08-28 2023-04-04 Unilever Ip Holdings B V DETERGENT COMPOSITION AND TREATMENT METHOD OF A TEXTILE ARTICLE
WO2022042977A1 (en) 2020-08-28 2022-03-03 Unilever Ip Holdings B.V. Detergent composition
WO2022043547A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Protease variants with improved solubility
WO2022043042A1 (en) 2020-08-28 2022-03-03 Unilever Ip Holdings B.V. Detergent composition
US20230354850A1 (en) 2020-09-15 2023-11-09 Novozymes A/S Animal feed comprising insects or insect meal
BR112023005106A2 (en) 2020-09-22 2023-04-18 Basf Se LIQUID COMPOSITION, LIQUID DETERGENT FORMULATION, AND USES OF AT LEAST ONE DIOL (EXCEPT 1,2-PROANODIOL) AND DETERGENT FORMULATIONS
WO2022074037A2 (en) 2020-10-07 2022-04-14 Novozymes A/S Alpha-amylase variants
WO2022081947A1 (en) 2020-10-16 2022-04-21 Dupont Nutrition Biosciences Feed compositions for animal health
EP4232539A2 (en) 2020-10-20 2023-08-30 Novozymes A/S Use of polypeptides having dnase activity
WO2022083949A1 (en) 2020-10-20 2022-04-28 Basf Se Compositions and their use
EP4237525A1 (en) 2020-10-28 2023-09-06 Novozymes A/S Use of lipoxygenase
JP2023547450A (en) 2020-10-29 2023-11-10 ノボザイムス アクティーゼルスカブ Lipase variants and compositions comprising such lipase variants
US12529017B2 (en) 2020-11-13 2026-01-20 Novozymes A/S Detergent composition comprising a lipase
WO2022106400A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of immunochemically different proteases
US20240010950A1 (en) 2020-12-07 2024-01-11 Conopco Inc., D/B/A Unilever Detergent compositions
EP4256019A1 (en) 2020-12-07 2023-10-11 Unilever IP Holdings B.V. Detergent compositions
EP4015629A1 (en) 2020-12-18 2022-06-22 Basf Se Polymer mixtures for increasing stability and performance of hydrolase-containing detergents
EP4032966A1 (en) 2021-01-22 2022-07-27 Novozymes A/S Liquid enzyme composition with sulfite scavenger
US20240124805A1 (en) 2021-01-28 2024-04-18 Novozymes A/S Lipase with low malodor generation
WO2022169933A2 (en) 2021-02-03 2022-08-11 Dupont Nutrition Biosciences Aps Compositions for gut health
EP4039806A1 (en) 2021-02-04 2022-08-10 Henkel AG & Co. KGaA Detergent composition comprising xanthan lyase and endoglucanase variants with im-proved stability
WO2022171872A1 (en) 2021-02-12 2022-08-18 Novozymes A/S Stabilized biological detergents
WO2022171780A2 (en) 2021-02-12 2022-08-18 Novozymes A/S Alpha-amylase variants
US20240301328A1 (en) 2021-03-12 2024-09-12 Novozymes A/S Polypeptide variants
EP4060036A1 (en) 2021-03-15 2022-09-21 Novozymes A/S Polypeptide variants
US20240060061A1 (en) 2021-03-15 2024-02-22 Novozymes A/S Dnase variants
WO2022199418A1 (en) 2021-03-26 2022-09-29 Novozymes A/S Detergent composition with reduced polymer content
WO2022268885A1 (en) 2021-06-23 2022-12-29 Novozymes A/S Alpha-amylase polypeptides
WO2023023644A1 (en) 2021-08-20 2023-02-23 Danisco Us Inc. Polynucleotides encoding novel nucleases, compositions thereof and methods thereof for eliminating dna from protein preparations
CN117957300A (en) 2021-09-20 2024-04-30 联合利华知识产权控股有限公司 Detergent composition
MX2024003691A (en) 2021-09-27 2024-06-26 Int N&H Denmark Aps Feed additive compositions and methods for using the same.
WO2023061827A1 (en) 2021-10-13 2023-04-20 Basf Se Compositions comprising polymers, polymers, and their use
WO2023066741A1 (en) 2021-10-20 2023-04-27 Basf Se Phosphate-free composition and methods for their manufacture and use
WO2023088777A1 (en) 2021-11-22 2023-05-25 Basf Se Compositions comprising polymers, polymers, and their use
US20250002705A1 (en) 2021-11-22 2025-01-02 Basf Se Compositions comprising polymers, polymers, and their use
US20250236815A1 (en) 2021-11-22 2025-07-24 Basf Se Compositions comprising polymers, polymers, and their use
WO2023114988A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2023110599A2 (en) 2021-12-17 2023-06-22 Basf Se Compositions and their applications
WO2023116569A1 (en) 2021-12-21 2023-06-29 Novozymes A/S Composition comprising a lipase and a booster
EP4206309A1 (en) 2021-12-30 2023-07-05 Novozymes A/S Protein particles with improved whiteness
JP2025505571A (en) 2022-02-04 2025-02-28 ビーエーエスエフ ソシエタス・ヨーロピア Compositions containing polymers, polymers and uses thereof
EP4234664A1 (en) 2022-02-24 2023-08-30 Evonik Operations GmbH Composition comprising glucolipids and enzymes
US20250179393A1 (en) 2022-03-02 2025-06-05 Novozymes A/S Use of xyloglucanase for improvement of sustainability of detergents
US20250179449A1 (en) 2022-03-04 2025-06-05 Novozymes A/S DNase Variants and Compositions
CN118974228A (en) 2022-04-08 2024-11-15 诺维信公司 Hexosaminidase variants and compositions
WO2023227421A1 (en) 2022-05-27 2023-11-30 Unilever Ip Holdings B.V. Laundry liquid composition comprising a surfactant, an alkoxylated zwitterionic polyamine polymer, and a fragrance
EP4532652B1 (en) 2022-05-27 2025-12-03 Unilever IP Holdings B.V. Composition comprising a specific methyl ester ethoxylate surfactant and a lipase
CN119173619A (en) 2022-05-27 2024-12-20 联合利华知识产权控股有限公司 Laundry liquid composition comprising surfactant, alkoxylated zwitterionic polyamine polymer and protease
CN119365577A (en) 2022-05-27 2025-01-24 联合利华知识产权控股有限公司 Compositions comprising enzymes
US20250354088A1 (en) 2022-05-27 2025-11-20 Conopco Inc., D/B/A Unilever Composition
EP4532659B1 (en) 2022-05-27 2025-12-17 Unilever IP Holdings B.V. Laundry liquid composition comprising a surfactant, an aminocarboxylate, an organic acid and a fragrance
CN114836408B (en) * 2022-05-28 2023-09-19 湖北大学 Alkaline protease containing propeptide mutant and application thereof
WO2023233025A1 (en) 2022-06-03 2023-12-07 Unilever Ip Holdings B.V. Liquid detergent product
CN119677844A (en) 2022-06-21 2025-03-21 诺维信公司 Mannanase variants and polynucleotides encoding them
EP4544015A2 (en) 2022-06-24 2025-04-30 Novozymes A/S Lipase variants and compositions comprising such lipase variants
US20250376642A1 (en) 2022-07-15 2025-12-11 Basf Se Alkanolamine formates for enzyme stabilization in liquid formulations
WO2024056334A1 (en) 2022-09-13 2024-03-21 Unilever Ip Holdings B.V. Washing machine and washing method
CN119895017A (en) 2022-09-13 2025-04-25 联合利华知识产权控股有限公司 Washing machine and washing method
WO2024056333A1 (en) 2022-09-13 2024-03-21 Unilever Ip Holdings B.V. Washing machine and washing method
EP4587545A1 (en) 2022-09-13 2025-07-23 Unilever IP Holdings B.V. Washing machine and washing method
EP4349948A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Laundry liquid composition
EP4349946A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Unit dose fabric treatment product
EP4349947A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Laundry liquid composition
EP4349944A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Laundry liquid composition
EP4349942A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Laundry liquid composition
EP4349945A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Laundry liquid composition
EP4349943A1 (en) 2022-10-05 2024-04-10 Unilever IP Holdings B.V. Laundry liquid composition
WO2024083589A1 (en) 2022-10-18 2024-04-25 Basf Se Detergent compositions, polymers and methods of manufacturing the same
AU2023369590A1 (en) 2022-10-25 2025-04-03 Unilever Global Ip Limited Composition
CN120092075A (en) 2022-10-25 2025-06-03 联合利华知识产权控股有限公司 Composition
EP4361239A1 (en) 2022-10-25 2024-05-01 Unilever IP Holdings B.V. Laundry liquid composition
EP4627028A1 (en) 2022-11-29 2025-10-08 Unilever IP Holdings B.V. Composition
WO2024115754A1 (en) 2022-12-02 2024-06-06 Basf Se Aqueous compositions containing polyalkoxylates, polyalkoxylates, and use
EP4630529A1 (en) 2022-12-05 2025-10-15 Novozymes A/S A composition comprising a lipase and a peptide
AU2023390250A1 (en) 2022-12-09 2025-06-12 International N&H Denmark Aps Feed formulations comprising a phytase for dairy ruminant animals
AU2023393689A1 (en) 2022-12-14 2025-05-01 Novozymes A/S Improved lipase (gcl1) variants
EP4389864A1 (en) 2022-12-20 2024-06-26 Basf Se Cutinases
WO2024133344A1 (en) 2022-12-20 2024-06-27 Novozymes A/S A method for providing a candidate biological sequence and related electronic device
JP2026501223A (en) 2022-12-23 2026-01-14 ノボザイムス アクティーゼルスカブ Detergent composition containing catalase and amylase
EP4655371A1 (en) 2023-01-23 2025-12-03 Novozymes A/S Cleaning compositions and uses thereof
EP4680710A1 (en) 2023-03-17 2026-01-21 Unilever IP Holdings B.V. Composition
EP4680708A1 (en) 2023-03-17 2026-01-21 Unilever IP Holdings B.V. Machine dishwash filter cleaner
WO2024194098A1 (en) 2023-03-21 2024-09-26 Unilever Ip Holdings B.V. Detergent unit dose
WO2024194245A1 (en) 2023-03-21 2024-09-26 Novozymes A/S Detergent compositions based on biosurfactants
WO2024213376A1 (en) 2023-04-11 2024-10-17 Unilever Ip Holdings B.V. Composition
CN120835924A (en) 2023-04-11 2025-10-24 联合利华知识产权控股有限公司 Composition
WO2024213428A1 (en) 2023-04-11 2024-10-17 Unilever Ip Holdings B.V. Composition
WO2024213430A1 (en) 2023-04-11 2024-10-17 Unilever Ip Holdings B.V. Composition
CN120882844A (en) 2023-04-11 2025-10-31 联合利华知识产权控股有限公司 Composition
KR20250174069A (en) 2023-04-12 2025-12-11 노보자임스 에이/에스 Composition comprising a polypeptide having alkaline phosphatase activity
WO2024223218A1 (en) 2023-04-25 2024-10-31 Unilever Ip Holdings B.V. Composition
WO2024226643A1 (en) 2023-04-25 2024-10-31 International N&H Denmark Aps Animal diet comprising phytase, thereby obviating the need for mineral supplementation
WO2024226828A2 (en) 2023-04-26 2024-10-31 Novozymes A/S Cleaning composition and cleaning method
EP4461795A1 (en) 2023-05-10 2024-11-13 Novozymes A/S Detergent composition comprising laccase
EP4461796A1 (en) 2023-05-10 2024-11-13 Novozymes A/S Detergent composition comprising laccase
WO2024231483A1 (en) 2023-05-11 2024-11-14 Novozymes A/S Automatic dishwashing detergent compositions comprising a lipase
WO2024256175A1 (en) 2023-06-13 2024-12-19 Basf Se Stabilized cleaning compositions comprising edds and enzymes and their use
CN121358834A (en) 2023-06-28 2026-01-16 诺维信公司 Detergent compositions comprising lipase
WO2025011933A1 (en) 2023-07-07 2025-01-16 Novozymes A/S Washing method for removing proteinaceous stains
WO2025011886A1 (en) 2023-07-11 2025-01-16 Unilever Ip Holdings B.V. Method for treating fabric
WO2025011808A1 (en) 2023-07-11 2025-01-16 Unilever Ip Holdings B.V. Method for treating fabric
WO2025012293A1 (en) 2023-07-13 2025-01-16 Unilever Ip Holdings B.V. Washing machine and method
WO2025016669A1 (en) 2023-07-19 2025-01-23 Unilever Ip Holdings B.V. Laundry capsule
WO2025026734A1 (en) 2023-08-02 2025-02-06 Unilever Ip Holdings B.V. Composition
WO2025031752A1 (en) 2023-08-04 2025-02-13 Unilever Ip Holdings B.V. Composition
WO2025031925A1 (en) 2023-08-04 2025-02-13 Unilever Ip Holdings B.V. Composition
WO2025031865A1 (en) 2023-08-08 2025-02-13 Basf Se Improved bacillus cell with inactivated metalloprotease
WO2025036643A1 (en) 2023-08-15 2025-02-20 Evonik Operations Gmbh Biosurfactant for washing wool
EP4509589A1 (en) 2023-08-16 2025-02-19 Unilever IP Holdings B.V. Unit dose product
WO2025059013A1 (en) 2023-09-11 2025-03-20 International N&H Denmark Aps Bacillus-based components for inhibiting or delaying the growth of enterococcus spp. in animals
WO2025088003A1 (en) 2023-10-24 2025-05-01 Novozymes A/S Use of xyloglucanase for replacement of optical brightener
WO2025093368A1 (en) 2023-11-02 2025-05-08 Basf Se Enzyme stabilization in compositions containing a protease inhibitor
WO2025103765A1 (en) 2023-11-17 2025-05-22 Novozymes A/S Lytic polysaccharide monooxygenases and their use in detergent
WO2025114053A1 (en) 2023-11-30 2025-06-05 Novozymes A/S Biopolymers for use in detergent
EP4570890A1 (en) 2023-12-14 2025-06-18 Unilever IP Holdings B.V. Composition
WO2025124811A1 (en) 2023-12-14 2025-06-19 Unilever Ip Holdings B.V. Composition
WO2025132258A1 (en) 2023-12-20 2025-06-26 Basf Se Stabilized enzyme composition comprising a protease
WO2025153644A1 (en) 2024-01-18 2025-07-24 Unilever Ip Holdings B.V. Composition
WO2025153645A1 (en) 2024-01-18 2025-07-24 Unilever Ip Holdings B.V. Use for fabric shape retention
WO2025214720A1 (en) 2024-04-11 2025-10-16 Unilever Ip Holdings B.V. Washing machine and washing method
WO2025214659A1 (en) 2024-04-11 2025-10-16 Unilever Ip Holdings B.V. Washing method
WO2025257254A1 (en) 2024-06-12 2025-12-18 Novozymes A/S Lipases and lipase variants and the use thereof
EP4663738A1 (en) 2024-06-13 2025-12-17 Unilever IP Holdings B.V. Laundry unit dose product
EP4663729A1 (en) 2024-06-13 2025-12-17 Unilever IP Holdings B.V. Method for treating fabrics
EP4663728A1 (en) 2024-06-13 2025-12-17 Unilever IP Holdings B.V. Method for treating fabrics
EP4663737A1 (en) 2024-06-13 2025-12-17 Unilever IP Holdings B.V. Laundry unit dose product
WO2026012789A1 (en) 2024-07-08 2026-01-15 Unilever Ip Holdings B.V. Composition
WO2026012788A1 (en) 2024-07-08 2026-01-15 Unilever Ip Holdings B.V. Composition
WO2026017636A1 (en) 2024-07-17 2026-01-22 Novozymes A/S Compositions comprising combination of enzymes

Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3723250A (en) * 1967-10-03 1973-03-27 Novo Terapeutisk Labor As Proteolytic enzymes, their production and use
US4752585A (en) * 1985-12-17 1988-06-21 Cetus Corporation Oxidation-resistant muteins
US4760025A (en) * 1984-05-29 1988-07-26 Genencor, Inc. Modified enzymes and methods for making same
US4914031A (en) * 1987-04-10 1990-04-03 Amgen, Inc. Subtilisin analogs
US4980288A (en) * 1986-02-12 1990-12-25 Genex Corporation Subtilisin with increased thermal stability
US5116741A (en) * 1988-04-12 1992-05-26 Genex Corporation Biosynthetic uses of thermostable proteases
US5122449A (en) * 1988-10-07 1992-06-16 Eastman Kodak Company Use of a protease in the extraction of chlamydial, gonococcal and herpes antigens
US5208158A (en) * 1990-04-19 1993-05-04 Novo Nordisk A/S Oxidation stable detergent enzymes
US5399283A (en) * 1986-01-15 1995-03-21 Amgen Inc. Thermally stable and pH stable subtilisin analogs and method for production thereof
US5665587A (en) * 1989-06-26 1997-09-09 Novo Nordisk A/S Modified subtilisins and detergent compositions containing same
US5700676A (en) * 1984-05-29 1997-12-23 Genencor International Inc. Modified subtilisins having amino acid alterations
US5741694A (en) * 1988-01-07 1998-04-21 Novo Nordisk A/S Useful mutations of bacterial alkaline protease
US5766898A (en) * 1990-12-05 1998-06-16 Novo Nordisk A/S Proteins with changed epitopes and methods for the production thereof
US5837517A (en) * 1995-05-05 1998-11-17 Novo Nordisk A/S Protease variants and compositions
US5858757A (en) * 1991-05-01 1999-01-12 Novo Nordisk A/S Stabilized enzymes and detergent compositions
US6300116B1 (en) * 1996-11-04 2001-10-09 Novozymes A/S Modified protease having improved autoproteolytic stability
US6555355B1 (en) * 1997-08-29 2003-04-29 Novozymes, A/S Protease variants and compositions
US6558938B1 (en) * 1997-08-29 2003-05-06 Novozymes, A/S Protease variants and compositions
US6605458B1 (en) * 1997-11-21 2003-08-12 Novozymes A/S Protease variants and compositions
US6682924B1 (en) * 1995-05-05 2004-01-27 Novozymes A/S Protease variants and compositions
US20040147008A1 (en) * 2002-11-06 2004-07-29 Novozymes A/S Subtilase variants
US6773907B2 (en) * 1997-11-21 2004-08-10 Peter Kamp Hansen Subtilase enzymes
US6777218B1 (en) * 2000-03-14 2004-08-17 Novozymes A/S Subtilase enzymes having an improved wash performance on egg stains
US6780629B2 (en) * 1997-11-21 2004-08-24 Novozymes A/S Subtilase enzymes
US20040197894A1 (en) * 2001-07-12 2004-10-07 Fano Tina Sejersgard Subtilase variants
US20040203130A1 (en) * 2000-04-03 2004-10-14 Novozymes A/S Subtilisin variants
US20040241820A1 (en) * 2000-08-21 2004-12-02 Novozymes A/S Subtilase enzymes
US20040248273A1 (en) * 2000-10-13 2004-12-09 Novozymes A/S Subtilase variants
US20050181446A1 (en) * 2000-04-28 2005-08-18 Novozymes A/S Protein variants having modified immunogenicity
US20070161531A1 (en) * 2005-07-08 2007-07-12 Novozymes A/S Subtilase variants

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3929887A (en) 1970-05-18 1975-12-30 Endo Lab Alkylenepoly(aralkylamines) and the salts thereof
IE81141B1 (en) * 1983-06-24 2000-04-05 Genencor Int Procaryotic carbonyl hydrolases
US5972682A (en) * 1984-05-29 1999-10-26 Genencor International, Inc. Enzymatically active modified subtilisins
US4990452A (en) * 1986-02-12 1991-02-05 Genex Corporation Combining mutations for stabilization of subtilisin
US5013657A (en) * 1988-04-12 1991-05-07 Bryan Philip N Subtilisin mutations
JPS63502959A (en) * 1986-02-12 1988-11-02 ジェネックス、コ−ポレ−ション Mutagenesis and screening methods and products
SG30639G (en) * 1986-04-30 1995-09-01 Genencor Int Non-human carbonyl hydrolase mutants DNA sequences and vectors encoding same and hosts transformed with said vectors
JP3026567B2 (en) * 1987-02-27 2000-03-27 ジェネンコー インターナショナル インコーポレイテッド Molecular cloning and expression of genes encoding proteolytic enzymes
EP0479396B1 (en) * 1987-02-27 1999-06-09 Genencor International, Inc. Transformation of alkalophilic bacillus strains
JP3155984B2 (en) * 1987-04-06 2001-04-16 ノヴォザイムズ・アクティーゼルスカブ Manipulating electrostatic interactions at metal ion binding sites for protein stabilization
US6799287B1 (en) 2000-05-01 2004-09-28 Hewlett-Packard Development Company, L.P. Method and apparatus for verifying error correcting codes

Patent Citations (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3723250A (en) * 1967-10-03 1973-03-27 Novo Terapeutisk Labor As Proteolytic enzymes, their production and use
US4760025A (en) * 1984-05-29 1988-07-26 Genencor, Inc. Modified enzymes and methods for making same
US5700676A (en) * 1984-05-29 1997-12-23 Genencor International Inc. Modified subtilisins having amino acid alterations
US4752585A (en) * 1985-12-17 1988-06-21 Cetus Corporation Oxidation-resistant muteins
US5399283A (en) * 1986-01-15 1995-03-21 Amgen Inc. Thermally stable and pH stable subtilisin analogs and method for production thereof
US4980288A (en) * 1986-02-12 1990-12-25 Genex Corporation Subtilisin with increased thermal stability
US4914031A (en) * 1987-04-10 1990-04-03 Amgen, Inc. Subtilisin analogs
US5741694A (en) * 1988-01-07 1998-04-21 Novo Nordisk A/S Useful mutations of bacterial alkaline protease
US6808913B2 (en) * 1988-01-07 2004-10-26 Novozymes A/S Useful mutations of bacterial alkaline protease
US6506589B1 (en) * 1988-01-07 2003-01-14 Novozymes, A/S Useful mutations of bacterial alkaline protease
US5116741A (en) * 1988-04-12 1992-05-26 Genex Corporation Biosynthetic uses of thermostable proteases
US5122449A (en) * 1988-10-07 1992-06-16 Eastman Kodak Company Use of a protease in the extraction of chlamydial, gonococcal and herpes antigens
US5665587A (en) * 1989-06-26 1997-09-09 Novo Nordisk A/S Modified subtilisins and detergent compositions containing same
US5208158A (en) * 1990-04-19 1993-05-04 Novo Nordisk A/S Oxidation stable detergent enzymes
US5766898A (en) * 1990-12-05 1998-06-16 Novo Nordisk A/S Proteins with changed epitopes and methods for the production thereof
US5858757A (en) * 1991-05-01 1999-01-12 Novo Nordisk A/S Stabilized enzymes and detergent compositions
US6190900B1 (en) * 1995-05-05 2001-02-20 Novo Nordisk A/S Subtilase variants
US5837517A (en) * 1995-05-05 1998-11-17 Novo Nordisk A/S Protease variants and compositions
US6682924B1 (en) * 1995-05-05 2004-01-27 Novozymes A/S Protease variants and compositions
US20040023355A1 (en) * 1995-05-05 2004-02-05 Novozymes A/S Subtilase variants
US20020102702A1 (en) * 1996-11-04 2002-08-01 Novozymes A/S Protease variants and compositions
US6300116B1 (en) * 1996-11-04 2001-10-09 Novozymes A/S Modified protease having improved autoproteolytic stability
US7098017B2 (en) * 1996-11-04 2006-08-29 Novozymes A/S Protease variants and compositions
US6555355B1 (en) * 1997-08-29 2003-04-29 Novozymes, A/S Protease variants and compositions
US6558938B1 (en) * 1997-08-29 2003-05-06 Novozymes, A/S Protease variants and compositions
US20050239185A1 (en) * 1997-08-29 2005-10-27 Novozymes A/S Protease variants and compositions
US6921657B2 (en) * 1997-08-29 2005-07-26 Novozymes A/S Protease variants and compositions
US20030180933A1 (en) * 1997-11-21 2003-09-25 Novozymes A/S Protease variants and compositions
US6605458B1 (en) * 1997-11-21 2003-08-12 Novozymes A/S Protease variants and compositions
US6780629B2 (en) * 1997-11-21 2004-08-24 Novozymes A/S Subtilase enzymes
US7026153B2 (en) * 1997-11-21 2006-04-11 Novozymes A/S Protease variants and compositions
US6773907B2 (en) * 1997-11-21 2004-08-10 Peter Kamp Hansen Subtilase enzymes
US6777218B1 (en) * 2000-03-14 2004-08-17 Novozymes A/S Subtilase enzymes having an improved wash performance on egg stains
US7220566B2 (en) * 2000-04-03 2007-05-22 Novozymes A/S Subtilisin variants
US20040203130A1 (en) * 2000-04-03 2004-10-14 Novozymes A/S Subtilisin variants
US6902922B2 (en) * 2000-04-03 2005-06-07 Novozymes A/S Subtilisin variants
US20050181446A1 (en) * 2000-04-28 2005-08-18 Novozymes A/S Protein variants having modified immunogenicity
US7109016B2 (en) * 2000-08-21 2006-09-19 Novozymes A/S Subtilase enzymes
US20040241820A1 (en) * 2000-08-21 2004-12-02 Novozymes A/S Subtilase enzymes
US6893855B2 (en) * 2000-10-13 2005-05-17 Novozymes A/S Subtilase variants
US7192757B2 (en) * 2000-10-13 2007-03-20 Novozymes A/S Subtilase variants
US20040248273A1 (en) * 2000-10-13 2004-12-09 Novozymes A/S Subtilase variants
US20040197894A1 (en) * 2001-07-12 2004-10-07 Fano Tina Sejersgard Subtilase variants
US20040147008A1 (en) * 2002-11-06 2004-07-29 Novozymes A/S Subtilase variants
US20070161531A1 (en) * 2005-07-08 2007-07-12 Novozymes A/S Subtilase variants

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070270574A1 (en) * 2000-04-03 2007-11-22 Novozymes A/S Subtilisin variants
US7605115B2 (en) * 2000-04-03 2009-10-20 Novozymas Als Subtilisin variants
US20040248273A1 (en) * 2000-10-13 2004-12-09 Novozymes A/S Subtilase variants
US7192757B2 (en) * 2000-10-13 2007-03-20 Novozymes A/S Subtilase variants
US10087401B2 (en) 2012-03-16 2018-10-02 Monosol, Llc Water soluble compositions incorporating enzymes, and method of making same
EP3354716A1 (en) 2012-03-16 2018-08-01 Monosol, LLC Water soluble compositions incorporating enzymes, and method of making same
WO2013138288A1 (en) 2012-03-16 2013-09-19 Monosol, Llc. Water soluble compositions incorporating enzymes, and method of making same
WO2013158364A1 (en) 2012-04-16 2013-10-24 Monosol, Llc Powdered pouch and method of making same
US9394092B2 (en) 2012-04-16 2016-07-19 Monosol, Llc Powdered pouch and method of making same
US9908675B2 (en) 2012-04-16 2018-03-06 Monosol, Llc Powdered pouch and method of making same
US10696460B2 (en) 2012-04-16 2020-06-30 Monosol, Llc Powdered pouch and method of making same
US11753222B2 (en) 2012-04-16 2023-09-12 Monosol, Llc Powdered pouch and method of making same
US11104497B2 (en) 2014-10-03 2021-08-31 Monosol, Llc Degradable materials and packaging made from same
US11884467B2 (en) 2014-10-03 2024-01-30 Monosol, Llc Degradable materials and packaging made from same
US12434891B2 (en) 2014-10-03 2025-10-07 Monosol, Llc Degradable materials and packaging made from same

Also Published As

Publication number Publication date
WO1989006279A1 (en) 1989-07-13
JPH03503477A (en) 1991-08-08
JPH10113179A (en) 1998-05-06
EP0396608B1 (en) 1996-04-03
EP1538204A2 (en) 2005-06-08
EP0675196A3 (en) 1995-11-22
US5741694A (en) 1998-04-21
DK176102B1 (en) 2006-06-12
US6808913B2 (en) 2004-10-26
DK175697B1 (en) 2005-01-24
DE68926163D1 (en) 1996-05-09
US20030175933A1 (en) 2003-09-18
JP2726799B2 (en) 1998-03-11
US6908991B2 (en) 2005-06-21
EP0396608A1 (en) 1990-11-14
EP1538204A3 (en) 2007-07-04
EP1498481A1 (en) 2005-01-19
JPH0675504B2 (en) 1994-09-28
ATE136329T1 (en) 1996-04-15
US20030186378A1 (en) 2003-10-02
US20030148495A1 (en) 2003-08-07
DE68926163T2 (en) 1996-10-02
DK161290A (en) 1990-09-07
DK6488D0 (en) 1988-01-07
DK161290D0 (en) 1990-07-04
JPH06292577A (en) 1994-10-21
DK36196A (en) 1996-03-29
US6835821B2 (en) 2004-12-28
US6506589B1 (en) 2003-01-14
EP0675196A2 (en) 1995-10-04

Similar Documents

Publication Publication Date Title
US6808913B2 (en) Useful mutations of bacterial alkaline protease
EP0328229B2 (en) Novel proteolytic enzymes and their use in detergents
JP3471797B2 (en) Stabilizing enzymes and detergents
DE69033644T2 (en) MUTTED SUBTILISIN PROTEASE
US5324653A (en) Recombinant genetic means for the production of serine protease muteins
JP2014204719A (en) Subtilase enzymes of the i-s1 and i-s2 subgroups having an additional amino acid residue in an active site loop region
AU772347B2 (en) Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region
KR100767710B1 (en) Subtilase enzymes of subgroups I-S1 and I-S2 having at least one additional amino acid residue between positions 97 and 98
CA2355576C (en) Subtilase enzymes of the i-s1 and i-s2 sub-groups having an additional amino acid residue in an active site loop region
EP1141260A1 (en) Subtilase enzymes of the i-s1 and i-s2 sub-groups having an additional amino acid residue in an active site loop region

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION