US20030199463A1 - DNA enzyme to inhibit plasminogen activator inhibitor-1 - Google Patents

DNA enzyme to inhibit plasminogen activator inhibitor-1 Download PDF

Info

Publication number
US20030199463A1
US20030199463A1 US10/128,706 US12870602A US2003199463A1 US 20030199463 A1 US20030199463 A1 US 20030199463A1 US 12870602 A US12870602 A US 12870602A US 2003199463 A1 US2003199463 A1 US 2003199463A1
Authority
US
United States
Prior art keywords
pai
subject
nucleotides
nucleic acid
catalytic nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/128,706
Other languages
English (en)
Inventor
Silviu Itescu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US10/128,706 priority Critical patent/US20030199463A1/en
Priority to PCT/US2003/012767 priority patent/WO2003091456A1/en
Priority to CA2483007A priority patent/CA2483007C/en
Priority to US10/512,496 priority patent/US7662794B2/en
Priority to ZA200408776A priority patent/ZA200408776B/en
Priority to AT03724216T priority patent/ATE477324T1/de
Priority to EP03724216A priority patent/EP1501948B1/en
Priority to AU2003231089A priority patent/AU2003231089B2/en
Priority to JP2003587981A priority patent/JP4574992B2/ja
Priority to CN038147149A priority patent/CN1662663B/zh
Priority to DE60333747T priority patent/DE60333747D1/de
Publication of US20030199463A1 publication Critical patent/US20030199463A1/en
Priority to IL164674A priority patent/IL164674A/en
Priority to AU2009201027A priority patent/AU2009201027B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/02—Non-specific cardiovascular stimulants, e.g. drugs for syncope, antihypotensives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121—Serpins
    • C07K14/8132—Plasminogen activator inhibitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates

Definitions

  • plasmin which is derived from plasminogen through activation by urokinase-type plasminogen activator (u-PA) expressed on the surface of the infiltrating bone-marrow derived cells (1-3). More recently, it has been suggested that the role of cell surface u-PA may be to facilitate exposure of cryptic cell attachment sites necessary for cell migration (4).
  • PAI-1 plasminogen activator inhibitor-1
  • u-PA plasminogen activator inhibitor-1
  • u-PA plasminogen activator inhibitor-1
  • a proteinase such as u-PA
  • u-PA plasminogen activator inhibitor-1
  • Removal of PAI-1 from vitronectin exposes the epitope on vitronectin necessary for binding to another of its ligands, the integrin alpha v beta 3 (4,7).
  • Antisense oligonucleotides hybridize with their complementary target site in mRNA, blocking translation to protein by sterically inhibiting ribosome movement or by triggering cleavage by endogenous RNAse H (10). Although current constructs are made more resistant to degradation by serum through phosphorothioate linkages, non-specific biological effects due to “irrelevant cleavage” of non-targeted mRNA remains a major concern (11).
  • Ribozymes are naturally-occurring RNA molecules that contain catalytic sites, making them more potent agents than antisense oligonucleotides.
  • wider use of ribozymes has been hampered by their susceptibility to chemical and enzymatic degradation and restricted target site specificity (12).
  • RNA molecules with catalytic activity for specific RNA sequences (13-16). These DNA enzymes exhibit greater catalytic efficiency than hammerhead ribozymes, producing a rate enhancement of approximately 10 million-fold over the spontaneous rate of RNA cleavage, offer greater substrate specificity, are more resistant to chemical and enzymatic degradation, and are far cheaper to synthesize.
  • This invention provides a catalytic nucleic acid that specifically cleaves an mRNA encoding a Plasminogen Activator Inhibitor-1 (PAI-1) comprising, in 5′ to 3′ order:
  • sequence of the nucleotides in each binding domain is complementary to a sequence of ribonucleotides in the PAI-1-encoding mRNA and wherein the catalytic nucleic acid hybridizes to and specifically cleaves the PAI-1-encoding mRNA.
  • This invention further provides a pharmaceutical composition comprising the instant catalytic nucleic acid and a pharmaceutically acceptable carrier.
  • This invention further provides method of specifically inhibiting the expression of PAI-1 in a cell that would otherwise express PAI-1, comprising contacting the cell with the instant catalytic nucleic acid so as to specifically inhibit the expression of PAI-1 in the cell.
  • This invention further provides a method of specifically inhibiting the expression of PAI-1 in a subject's cells comprising administering to the subject an amount of the instant catalytic nucleic acid effective to specifically inhibit the expression of PAI-1 in the subject's cells.
  • This invention further provides a method of specifically inhibiting the expression of PAI-1 in a subject's cells comprising administering to the subject an amount of the instant pharmaceutical composition effective to specifically inhibit the expression of PAI-1 in the subject's cells.
  • This invention further provides a method of treating a cardiovascular disease in a subject involving apoptosis of a cardiomyocyte in the subject which comprises administering to the subject an amount of the instant pharmaceutical composition effective to inhibit apoptosis of the cardiomyocyte in the subject so as to thereby treat the cardiovascular disease.
  • This invention further provides a method of treating a fibrotic disease in a subject involving fibrogenesis which comprises administering to the subject an amount of the instant pharmaceutical composition effective to inhibit fibrogenesis in the subject so as to thereby treat the fibrotic disease.
  • This invention further provides an oligonucleotide comprising consecutive nucleotides that hybridizes with a PAI-1-encoding mRNA under conditions of high stringency and is between 8 and 40 nucleotides in length.
  • This invention further provides the instant oligonucleotide, wherein the human PAI-1-encoding mRNA comprises consecutive nucleotides, the sequence of which is set forth in SEQ ID NO:5.
  • This invention further provides a method of treating a subject which comprises administering to the subject an amount of the instant oligonucleotide of effective to inhibit expression of a PAI-1 in the subject so as to thereby treat the subject.
  • This invention further provides a method of treating a cardiovascular disease in a subject involving apoptosis of a cardiomyocyte in the subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit apoptosis of the cardiomyocyte in the subject so as to thereby treat the cardiovascular disease.
  • This invention further provides a method of treating a fibrotic disease in a subject involving fibrogenesis in the subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit fibrogenesis in the subject so as to thereby treat the fibrotic disease.
  • E1 SEQ ID NO:2
  • E3 SEQ ID NO:3
  • This figure also shows the control DNA enzyme E0 (SEQ ID NO:7), an oligonucleotide S1 (SEQ ID NO:8), an oligonucleotide transcript (SEQ ID NO:9) and oligonucleotide S2 (SEQ ID NO:10).
  • E0 SEQ ID NO:7
  • SEQ ID NO:8 an oligonucleotide S1
  • SEQ ID NO:9 oligonucleotide transcript
  • S2 oligonucleotide S2
  • (C) This figure shows E1 also cleaved larger 32P-labeled fragments of human PAI-1 mRNA, prepared by in vitro transcription, in a time- and concentration-dependent manner.
  • (D) This figure shows the sequence-specific nature of the DNA enzymatic cleavage: the control DNA enzyme E0, containing an identical catalytic domain to E1 and E3, but scrambled sequences in the flanking arms, caused no cleavage of human PAI-1 mRNA transcripts.
  • A This figure shows that the DNA enzyme E2 cleaved the 23-base oligonucleotide S2 (SEQ ID NO:10), synthesized from the sequence of rat PAI-1 mRNA, in a dose- and time-dependent manner.
  • B This figure shows that E2 also cleaved a rat PAI-1 mRNA transcript in a dose-dependent manner by 2-4 hours to give the 156 nucleotide cleavage product.
  • C This figure shows the rat S2 PAI-1 mRNA transcript (SEQ ID NO:10) differs by only one nucleotide from the human mRNA PAI-1 transcript (SEQ ID NO:9) which can be cleaved by E3.
  • (B) This figure shows the effect of endothelial cell transfection with E2 DNA enzyme on TGF-beta mediated induction of PAI-1 protein. Endothelial cells transfected with scrambled DNA enzyme demonstrated approximately 50% increase in cytoplasmic PAI-1 E0 protein as detected by Western blot. In contrast, this effect was almost completely abrogated by transfection with the PAI-1 DNA enzyme E2.
  • (C) This figure shows that whereas the DNA enzyme was almost completely degraded within 6 hours of cell culture in medium containing 20% serum, it remained intact during the entire 24 hours of cell culture with medium containing 2% serum.
  • FIGS. 5 A-C (A) This figure shows inhibition of cardiomyocyte apoptosis in the peri-infarct region by E2. (B) This figure shows the percentage recovery in left ventricular ejection fraction (LVEF) after treatment with E2 and after treatment with E2 and angioblasts.
  • LVEF left ventricular ejection fraction
  • FIG. 6 This figure shows the DNA sequence encoding human Plasminogen Activator Inhibitor-1 protein (SEQ ID NO:5).
  • FIG. 7 This figure shows the DNA sequence encoding rat Plasminogen Activator Inhibitor-1 protein (SEQ ID NO:15).
  • FIG. 8 This figure shows the amino acid sequence of human Plasminogen Activator Inhibitor-1 protein (SEQ ID NO:6).
  • FIG. 9 This figure shows the amino acid sequence of rat Plasminogen Activator Inhibitor-1 protein (SEQ ID NO:16).
  • FIG. 10 This figure shows possible 5′-AT-3′ cleavage sites on human PAI-1 mRNA (shown as corresponding DNA, SEQ ID NO:5) for catalytic deoxyribonucleic acids. Bold indicates the protein coding region, capital letters indicate consensus cleavage sites.
  • FIG. 11 This figure shows possible 5′-AC-3′ cleavage sites on human PAI-1 mRNA (shown as corresponding DNA, SEQ ID NO:5) for catalytic deoxyribonucleic acids. Bold indicates the protein coding region, capital letters indicate consensus cleavage sites.
  • FIG. 12 This figure shows possible cleavage sites on human PAI-1 mRNA coding region (shown as corresponding DNA, SEQ ID NO:17) for catalytic hammerhead ribonucleic acids.
  • Uppercase “T” represents cleavage site.
  • administering shall mean any of the various methods and delivery systems known to those skilled in the art.
  • the administering can be performed, for example, via implant, transmucosally, transdermally and subcutaneously, orally, parenterally, topically, by cardiac injection, by inhalation, by catheter e.g. retrograde ureteric catheter, by intra-arterial injection.
  • Catalytic shall mean the functioning of an agent as a catalyst, i.e. an agent that increases the rate of a chemical reaction without itself undergoing a permanent structural change.
  • Consensus sequence shall mean a nucleotide sequence of at least two residues in length between which catalytic nucleic acid cleavage occurs.
  • consensus sequences include for catalytic deoxyribonucleic acids are purine:pyrimidine e.g. “A:U” and “G:U”.
  • “Plasminogen Activator Inhibitor-1 Protein” shall mean the protein encoded by the nucleotide sequence identified as (SEQ ID NO:5) and having the amino acid sequence shown in SEQ ID NO:6, when identified as human and the protein encoded by the nucleotide sequence identified as SEQ ID NO:15 and having the amino acid sequence shown in SEQ ID NO:16 when identified as originating from rat, and any variants of either thereof, whether artificial or naturally occurring. Variants include, without limitation, homologues, post-translational modifications, mutants and polymorphisms.
  • Plasminogen Activator Inhibitor-1 mRNA shall mean a mRNA molecule comprising a sequence which encodes Plasminogen Activator Inhibitor-1 Protein.
  • Plasminogen Activator Inhibitor-1 mRNA includes, without limitation, protein-encoding sequences as well as the 5′ and 3′ non-protein-encoding sequences.
  • Hybridize shall mean the annealing of one single-stranded nucleic acid molecule to another nucleic acid molecule based on sequence complementarity.
  • the propensity for hybridization between nucleic acids depends on the temperature and ionic strength of their milieu, the length of the nucleic acids and the degree of complementarity. The effect of these parameters on hybridization is well known in the art (see 38).
  • “Inhibit” shall mean to slow, stop or otherwise impede.
  • “Stringent conditions” or “Stringency”, shall refer to the conditions for hybridization as defined by the nucleic acid, salt, and temperature. These conditions are well known in the art and may be altered. Numerous equivalent conditions comprising either low or high stringency depend on factors such as the length and nature of the sequence (DNA, RNA, base composition), nature of the target (DNA, RNA, base composition), milieu (in solution or immobilized on a solid substrate), concentration of salts and other components (e.g., formamide, dextran sulfate and/or polyethylene glycol), and temperature of the reactions (within a range from about 5° C. below the melting temperature of the probe to about 20° C. to 25° C. below the melting temperature).
  • salts and other components e.g., formamide, dextran sulfate and/or polyethylene glycol
  • One or more factors be may be varied to generate conditions of either low or high stringency different from, but equivalent to, the above listed conditions.
  • the stringency of hybridization may be altered in order to identify or detect identical or related polynucleotide sequences.
  • Nucleic acid shall include any nucleic acid, including, without limitation, DNA, RNA, oligonucleotides, or polynucleotides, and analogs or derivatives thereof.
  • the nucleotides that form the nucleic acid may be nucleotide analogs or derivatives thereof.
  • the nucleic acid may incorporate non nucleotides.
  • Nucleotides shall include without limitation nucleotides and analogs or derivatives thereof.
  • nucleotides may comprise the bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art, and are exemplified in PCR Systems, Reagents and Consumables (Perkin Elmer Catalogue 1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J., USA).
  • “Pharmaceutically acceptable carrier” shall mean any of the various carriers known to those skilled in the art.
  • cleave when referring to the action of one of the instant catalytic deoxyribonucleic acid molecules on a target mRNA molecule, shall mean to cleave the target mRNA molecule without cleaving another mRNA molecule lacking a sequence complementary to either of the catalytic deoxyribonucleic acid molecule's two binding domains.
  • Subject shall mean any animal, such as a human, a primate, a mouse, a rat, a guinea pig or a rabbit.
  • DNA enzyme DNA enzyme
  • DNAzyme DNAzyme
  • catalytic deoxyribonucleic acid catalytic deoxyribonucleic acid
  • Vector shall include, without limitation, a nucleic acid molecule that can be used to stably introduce a specific nucleic acid sequence into the genome of an organism.
  • This invention provides a catalytic nucleic acid that specifically cleaves an mRNA encoding a Plasminogen Activator Inhibitor-1 (PAI-1) comprising, in 5′ to 3′ order:
  • sequence of the nucleotides in each binding domain is complementary to a sequence of ribonucleotides in the PAI-1-encoding mRNA and wherein the catalytic nucleic acid hybridizes to and specifically cleaves the PAI-1-encoding mRNA.
  • the catalytic deoxyribonucleic acid molecules can cleave the PAI-1-encoding mRNA at the linkage between 5′-A (or G) and U(T)-3′ (or C) i.e. at purine:pyrimidine consensus sequences.
  • the catalytic deoxyribonucleic acid molecules cleaves the PAI-1 mRNA at the linkage of any 5′-AU-3′; 5′-AC-3′; 5′-GU-3′; or 5′-GC-3′ site within the mRNA.
  • catalytic nucleic acids can be designed based on the consensus cleavage sites 5′-purine:pyrimidine-3′ in the mRNA sequence (GenBank Accession#: M16006) (36). Those potential cleavage sites located on an open loop of the mRNA according to RNA folding software e.g. RNAdraw 2.1 are particularly preferred as targets (22).
  • the DNA based catalytic nucleic acids can utilize the structure where two sequence-specific arms are attached to a catalytic core (SEQ ID NO:1) based on the PAI-1-encoding mRNA sequence (corresponding DNA shown as SEQ ID NO:5). Further examples of catalytic DNA structure are detailed in (23) and (24).
  • Commercially available mouse brain polyA-RNA (Ambion) can serve as a template in the in vitro cleavage reaction to test the efficiency of the catalytic deoxyribonucleic acids.
  • Catalytic nucleic acid molecules can cleave PAI-1-encoding mRNA at each and any of the consensus sequences therein. Since catalytic ribo- and deoxyribo-nucleic acid consensus sequences are known, and the PAI-1-encoding mRNA sequence is known, one of ordinary skill could readily construct a catalytic ribo- or deoxyribo nucleic acid molecule directed to any of the PAI-1-encoding mRNA consensus sequences based on the instant specification. In preferred embodiments of this invention the catalytic deoxyribonucleic acids include the 10-23 structure.
  • Cleavage of PAI-1 mRNA by DNAzyme may occur at 264 cleavage sites in the coding region of human PAI-1-encoding mRNA, including 51 5′-AT-3′ (-AU-) sites, 76 -AC- sites, 53 -GT- (-GU-) sites and 84 -GC- sites. See FIGS. 10 and 11 for AT and AC cleavage sites respectively, represented on the DNA sequence corresponding to the PAI-1-encoding mRNA.
  • cleavage sites include nucleotide 76, 82, 152, 159, 254, 277, 316, 328, 333, 340, 344, 355, 374, 391, 399, 410, 415, 433, 449, 472, 543, 547, 550, 554, 583, 586, 644, 717, 745, 748, 773, 794, 800, 811, 847, 853, 866, 901, 919, 939, 1027, 1036, 1120, 1125, 1168, 1183, 1198, 1201, 1204, 1261, and 1273 of SEQ ID NO:5.
  • catalytic ribonucleic acids include hairpin and hammerhead ribozymes.
  • the catalytic ribonucleic acid molecule is formed in a hammerhead (25) or hairpin motif (26,27,28), but may also be formed in the motif of a hepatitis delta virus (29), group I intron (35), RNaseP RNA (in association with an RNA guide sequence) (30,31) or Neurospora VS RNA (32,33,34).
  • Hammerhead ribozymes can cleave any 5′-NUH-3′ triplets of a mRNA, where U is conserved and N is any nucleotide and H can be C,U,A, but not G. For example, there are 151 sites which can be cleaved by a hammerhead ribozyme in human PAI-1-encoding mRNA coding region. See FIG. 12.
  • Cleaving of PAI-1-encoding mRNA with catalytic nucleic acids interferes with one or more of the normal functions of PAI-1-encoding mRNA.
  • the functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.
  • nucleotides of the first binding domain comprise at least one deoxyribonucleotide. In another embodiment the nucleotides of the second binding domain comprise at least one deoxyribonucleotide. In one embodiment the nucleotides of the first binding domain comprise at least one deoxyribonucleotide derivative. In another embodiment the nucleotides of the second binding domain comprise at least one deoxyribonucleotide derivative. In one embodiment the nucleotides of the first binding domain comprise at least one ribonucleotide. In another embodiment the nucleotides of the second binding domain comprise at least one ribonucleotide.
  • nucleotides of the first binding domain comprise at least one ribonucleotide derivative. In another embodiment the nucleotides of the second binding domain comprise at least one ribonucleotide derivative. In one embodiment the nucleotides of the first binding domain comprise at least one modified base. In another embodiment the nucleotides of the second binding domain comprise at least one modified base.
  • the nucleotides may comprise other bases such as inosine, deoxyinosine, hypoxanthine may be used.
  • isoteric purine 2′deoxy-furanoside analogs, 2′-deoxynebularine or 2′deoxyxanthosine, or other purine or pyrimidine analogs may also be used.
  • inosine may be used to reduce hybridization specificity
  • diaminopurines may be used to increase hybridization specificity.
  • Adenine and guanine may be modified at positions N3, N7, N9, C2, C4, C5, C6, or C8 and still maintain their hydrogen bonding abilities.
  • Cytosine, thymine and uracil may be modified at positions N1, C2, C4, C5, or C6 and still maintain their hydrogen bonding abilities.
  • Some base analogs have different hydrogen bonding attributes than the naturally occurring bases. For example, 2-amino-2′-dA forms three (3), instead of the usual two (2), hydrogen bonds to thymine (T).
  • Examples of base analogs that have been shown to increase duplex stability include, but are not limited to, 5-fluoro-2′-dU, 5-bromo-2′-dU, 5-methyl-2′-dC, 5-propynyl-2′-dC, 5-propynyl-2′-dU, 2-amino-2′-dA, 7-deazaguanosine, 7-deazadenosine, and N2-Imidazoylpropyl-2′-dG.
  • Nucleotide analogs may be created by modifying and/or replacing a sugar moiety.
  • the sugar moieties of the nucleotides may also be modified by the addition of one or more substituents.
  • one or more of the sugar moieties may contain one or more of the following substituents: amino, alkylamino, araalkyl, heteroalkyl, heterocycloalkyl, aminoalkylamino, O, H, an alkyl, polyalkylamino, substituted silyl, F, Cl, Br, CN, CF 3 , OCF 3 , OCN, O-alkyl, S-alkyl, SOMe, SO 2 Me, ONO 2 , NH-alkyl, OCH 2 CH ⁇ CH 2 , OCH 2 CCH, OCCHO, allyl, O-allyl, NO 2 , N 3 , and NH 2 .
  • the 2′ position of the sugar may be modified to contain one of the following groups: H, OH, OCN, O-alkyl, F, CN, CF 3 , allyl, O-allyl, OCF 3 , S-alkyl, SOMe, SO 2 Me, ONO 2 , NO 2 , N 3 , NH 2 , NH-alkyl, or OCH ⁇ CH 2 , OCCH, wherein the alkyl may be straight, branched, saturated, or unsaturated.
  • the nucleotide may have one or more of its sugars modified and/or replaced so as to be a ribose or hexose (i.e. glucose, galactose) or have one or more anomeric sugars.
  • the nucleotide may also have one or more L-sugars.
  • the sugar may be modified to contain one or more linkers for attachment to other chemicals such as fluorescent labels.
  • the sugar is linked to one or more aminoalkyloxy linkers.
  • the sugar contains one or more alkylamino linkers. Aminoalkyloxy and alkylamino linkers may be attached to biotin, cholic acid, fluorescein, or other chemical moieties through their amino group.
  • Nucleotide analogs or derivatives may have pendant groups attached.
  • Pendant groups serve a variety of purposes which include, but are not limited to, increasing cellular uptake of the molecule, enhancing degradation of the target nucleic acid, and increasing hybridization affinity.
  • Pendant groups can be linked to the binding domains of the catalytic nucleic acid. Examples of pendant groups include, but are not limited to: acridine derivatives (i.e.
  • cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II), o-phenanthroline-Cu(I), and porphyrin-Fe(II); alkylating moieties; nucleases such as amino-1-hexanolstaphylococcal nuclease and alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; amino; mercapto groups; radioactive markers; nonradioactive markers such as dyes; and polylysine or other polyamines.
  • cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin
  • artificial endonucleases such as EDTA-Fe(II), o
  • the nucleic acid comprises an oligonucleotide conjugated to a carbohydrate, sulfated carbohydrate, or gylcan.
  • Conjugates may be regarded as a way as to introduce a specificity into otherwise unspecific DNA binding molecules by covalently linking them to a selectively hybridizing oligonucleotide.
  • the binding domains of the catalytic nucleic acid may have one or more of their sugars modified or replaced so as to be ribose, glucose, sucrose, or galactose, or any other sugar. Alternatively, they may have one or more sugars substituted or modified in its 2′ position, i.e. 2′allyl or 2′-O-allyl. An example of a 2′-O-allyl sugar is a 2′-O-methylribonucleotide. Further, the nucleotides of the binding domain may have one or more of their sugars substituted or modified to form an ⁇ -anomeric sugar.
  • a catalytic nucleic acid binding domain may include non-nucleotide substitution.
  • the non-nucleotide substitution includes either abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid or polyhydrocarbon compounds.
  • abasic or “abasic nucleotide” as used herein encompasses sugar moieties lacking a base or having other chemical groups in place of base at the 1′ position.
  • the nucleotides of the first binding domain comprise at least one modified internucleoside bond.
  • the nucleotides of the second binding domain comprise at least one modified internucleoside bond.
  • the modified internucleoside bond is a phosphorothioate bond.
  • the nucleic acid may comprise modified bonds.
  • the bonds between nucleotides of the catalytic nucleic acid may comprise phosphorothioate linkages.
  • the nucleic acid may comprise nucleotides having moiety may be modified by replacing one or both of the two bridging oxygen atoms of the linkage with analogues such as —NH, —CH 2 , or —S. Other oxygen analogues known in the art may also be used.
  • the phosphorothioate bonds may be stereo regular or stereo random.
  • the PAI-1-encoding mRNA encodes human PAI-1.
  • the human PAI-1-encoding mRNA has the sequence set forth in SEQ ID NO:5.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the instant catalytic nucleic acid and a pharmaceutically acceptable carrier.
  • the following pharmaceutically acceptable carriers are set forth, in relation to their most commonly associated delivery systems, by way of example, notwithstanding the fact that the instant pharmaceutical compositions are preferably delivered dermally.
  • Dermal delivery systems include, for example, aqueous and nonaqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and nonaqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone).
  • the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer.
  • liposomes which can be used in this invention include the following: (1) CellFectin, 1:1.5 (M/M) liposome formulation of the cationic lipid N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII-tetrapalmity-spermine and dioleoyl phosphatidylethanolamine (DOPE)(GIBCO BRL); (2) Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid and DOPE (Glen Research); (3) DOTAP (N-[1-(2,3-dioleoyloxy)-N,N,N-tri-methyl-ammoniumethyl sulfate) (Boehringer Manheim); and (4) Lipofectamine, 3:1 (M/M) liposome formulation of the polycationic lipid DOSPA and the neutral lipid DOPE (GIBCO BRL).
  • DOPE dioleoyl phosphatidylethanolamine
  • Transmucosal delivery systems include patches, tablets, suppositories, pessaries, gels and creams, and can contain excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other vehicles (e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid).
  • solubilizers and enhancers e.g., propylene glycol, bile salts and amino acids
  • other vehicles e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid.
  • Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGA's).
  • Implantable systems include rods and discs, and can contain excipients such as PLGA and polycaprylactone.
  • Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc).
  • excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.
  • This invention provides a method of specifically inhibiting the expression of PAI-1 in a cell that would otherwise express PAI-1, comprising contacting the cell with the instant catalytic nucleic acid so as to specifically inhibit the expression of PAI-1 in the cell.
  • This invention provides a method of specifically inhibiting the expression of PAI-1 in a subject's cells comprising administering to the subject an amount of the instant catalytic nucleic acid effective to specifically inhibit the expression of PAI-1 in the subject's cells.
  • This invention provides a method of specifically inhibiting the expression of PAI-1 in a subject's cells comprising administering to the subject an amount of the instant pharmaceutical composition effective to specifically inhibit the expression of PAI-1 in the subject's cells.
  • This invention provides a method of treating a cardiovascular disease in a subject involving apoptosis of a cardiomyocyte in the subject which comprises administering to the subject an amount of the instant pharmaceutical composition effective to inhibit apoptosis of the cardiomyocyte in the subject so as to thereby treat the cardiovascular disease.
  • the cardiovascular disease is congestive heart failure. In another embodiment the cardiovascular disease is myocardial infarct. In another embodiment the cardiovascular disease is angina. In another embodiment the cardiovascular disease is myocardial ischemia. In another embodiment the cardiovascular disease is a cardiomyopathy.
  • This invention provides a method of treating a fibrotic disease in a subject involving fibrogenesis which comprises administering to the subject an amount of the instant pharmaceutical composition effective to inhibit fibrogenesis in the subject so as to thereby treat the fibrotic disease.
  • the fibrotic disease is a renal disease, a hepatic disease, a disease of the lung, a disease of the skin, or a disease of the eye.
  • the fibrotic disease of the skin is scleroderma or psorasis.
  • an “effective amount” is an amount at least sufficient to treat, reduce, reverse or otherwise inhibit the given disease state.
  • fibrotic diseases this means an amount sufficient to reduce, reverse or otherwise inhibit fibrogenesis.
  • cardiovascular diseases this means an amount sufficient to reduce, reverse or otherwise inhibit cardiomyocyte apoptosis.
  • the effective amount of the instant pharmaceutical compositions can be done based on animal data using routine computational methods.
  • the effective amount contains between about 10 ng and about 100 ⁇ g of the instant nucleic acid molecules per kg body mass. In another embodiment, the effective amount contains between about 100 ng and about 10 ⁇ g of the nucleic acid molecules per kg body mass. In a further embodiment, the effective amount contains between about 1 ⁇ g and about 5 ⁇ g of the nucleic acid molecules per kg body mass. In another embodiment the effective amount contains between about 10 ⁇ g and about 100 ⁇ g of the nucleic acid molecules per kg body mass. In a preferred embodiment the effective amount contains between about 100 ⁇ g and 500 ⁇ g of the nucleic acid molecules per kg body mass. In another embodiment the effective amount contains between about 500 ⁇ g and 1000 ⁇ g of the nucleic acid molecules per kg body mass. In another embodiment the effective amount contains between about 1 mg and 2 mg of the nucleic acid molecules per kg body mass.
  • the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. Pat. Nos.
  • catalytic nucleic acids it is preferred to administer catalytic nucleic acids to mammals suffering from a cardiovascular disease or a fibrotic disease, in either native form or suspended in a carrier medium in amounts and upon treatment schedules which are effective to therapeutically treat the mammals to reduce the detrimental effects of cardiovascular disease or fibrotic disease.
  • One or more different catalytic nucleic acids or antisense oligonucleotides or analogs thereof targeting different sections of the nucleic acid sequence of PAI-1-encoding mRNA may be administered together in a single dose or in different doses and at different amounts and times depending upon the desired therapy.
  • the catalytic nucleic acids can be administered to mammals in a manner capable of getting the nucleic acids initially into the blood stream and subsequently into cells, or alternatively in a manner so as to directly introduce the catalytic nucleic acids into the cells or groups of cells, for example cardiomyocytes, by such means by electroporation or by direct injection into the heart or by catheter into renal tissue. It is within the scale of a person's skill in the art to determine optimum dosages and treatment schedules for such treatment regimens.
  • the effective amount of catalytic nucleic acid is administered to a human patient in need of inhibition of PAI-1 expression (or inhibition of fibrogenesis) from 1-8 or more times daily or every other day. Dosage is dependent on severity and responsiveness of the effects of the cardiovascular or fibrotic disease to be treated, with a course of treatment lasting from several days to months or until a cure is effected or a reduction of the effects is achieved.
  • the actual effective amount, or dosage, administered may take into account the size and weight of the patient, whether the nature of the treatment is prophylactic, therapeutic in nature, the age, weight, health and sex of the patient, the route of administration, and other factors.
  • compositions may contain suitable excipients and auxiliaries which facilitate processing of the catalytic nucleic acids into preparations which can be used pharmaceutically.
  • the preparations particularly those which can be administered orally and which can be used for the preferred type of administration, such as tablets, dragees, and capsules, and preparations which can be administered rectally, such as suppositories, as well as suitable solutions for administration parenterally or orally, and compositions which can be administered bucally or sublingually, including inclusion compounds, contain from about 0.1 to about 99 percent by weight of active ingredients, together with the excipient.
  • the pharmaceutical preparations of the present invention are manufactured in a manner which is itself well known in the art.
  • the pharmaceutical preparations may be made by means of conventional mixing, granulating, dragee-making, dissolving, or lyophilizing processes.
  • the process to be used will depend ultimately on the physical properties of the active ingredient used.
  • Suitable excipients are, in particular, fillers such as sugars, for example, lactose or sucrose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example, tricalcium phosphate or calcium hydrogen phosphate as well as binders such as starch, paste, using, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and/or polyvinyl pyrrolidone.
  • fillers such as sugars, for example, lactose or sucrose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example, tricalcium phosphate or calcium hydrogen phosphate as well as binders such as starch, paste, using, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
  • disintegrating agents may be added, such as the above-mentioned starches as well as carboxymethyl-starch, cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate.
  • Auxiliaries are flow-regulating agents and lubricants, for example, such as silica, talc, stearic acid or salts thereof, such as magnesium stearate or calcium stearate, and/or polyethylene glycol.
  • Dragee cores may be provided with suitable coatings which, if desired, may be resistant to gastric juices.
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, polyethylene, glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable cellulose preparations such as acetyl-cellulose phthalate or hydroxypropylmethycellulose phthalate, are used.
  • Dyestuffs and pigments may be added to the tablets of dragee coatings, for example, for identification or in order to characterize different combinations of active compound doses.
  • Other pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol.
  • the push-fit capsules can contain the active compounds in the form of granules which may be mixed with filters such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and optionally, stabilizers.
  • the active compounds are preferably dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added.
  • Possible pharmaceutical preparations which can be used rectally include, for example, suppositories, which consist of a combination of the active compounds with a suppository base.
  • Suitable suppository bases are, for example, natural or synthetic triglycerides, paraffin hydrocarbons, polyethylene glycols or higher alkanols.
  • gelatin rectal capsules which consist of a combination of the active compounds with a base.
  • Possible base materials include, for example liquid triglycerides, polyethylene glycols, or paraffin hydrocarbons.
  • Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble or water-dispersible form.
  • suspensions of the active compounds as appropriate oily injection suspensions may be administered.
  • Suitable lipophilic solvents or vehicles include fatty oils, for example, ethyl oleate or triglycerides.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
  • the suspension may also contain stabilizers.
  • catalytic nucleic acids of the present invention may also be administered encapsulated in liposomes or immunoliposomes, which are pharmaceutical compositions wherein the active ingredient is contained either dispersed or variously present in corpuscles consisting of aqueous concentric layers adherent to lipidic layers.
  • liposomes are especially active in targeting the oligonucleotides to liver cells.
  • the active ingredient depending upon its solubility, may be present both in the aqueous layer and in the lipidic layer, or in what is generally termed a liposomic suspension.
  • the hydrophobic layer generally but not exclusively, comprises phospholipids such as lecithin and sphingomyelin, steroids such as cholesterol, more or less ionic surfactants such as dicetylphosphate, stearylamine, or phosphatidic acid, and/or other materials of a hydrophobic nature.
  • the diameters of the liposomes generally range from about 15 nm to about 5 microns.
  • This invention also provides an oligonucleotide comprising consecutive nucleotides that hybridizes with a PAI-1-encoding mRNA under conditions of high stringency and is between 8 and 40 nucleotides in length. In different embodiments the oligonucleotide is between 40 and 80 nucleotides in length.
  • the hybridization of antisense oligonucleotides with PAI-1-encoding mRNA interferes with one or more of the normal functions of PAI-1-encoding mRNA.
  • the functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.
  • a human PAI-1 antisense oligonucleotide specifically hybridizes under given stringent conditions with targets on the human PAI-1 mRNA molecule and in doing so inhibits the translation thereof into PAI-1 protein.
  • the functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.
  • a PAI-1 antisense oligonucleotide specifically hybridizes under given stringent conditions with targets on the PAI-1-encoding mRNA molecule and in doing so inhibits the translation thereof into PAI-1.
  • messenger RNA includes not only the information to encode a protein using the three letter genetic code, but also associated ribonucleotides which form a region known to such persons as the 5′-untranslated region, the 3′-untranslated region, the 5′ cap region and intron/exon junction ribonucleotides.
  • catalytic nucleic acids or antisense oligonucleotides may be formulated in accordance with this invention which are targeted wholly or in part to these associated ribonucleotides as well as to the informational ribonucleotides.
  • the antisense oligonucleotides may therefore be specifically hybridizable with a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region.
  • the catalytic nucleic acids may specifically cleave a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region.
  • the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule).
  • 5′-AUG in transcribed mRNA molecules
  • 5′-ATG in the corresponding DNA molecule
  • a minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo.
  • the term “translation initiation codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes.
  • translation initiation codon refers to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding PAI-1, regardless of the sequence(s) of such codons.
  • a translation termination codon of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • the term “translation initiation codon region” refers to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. This region is one preferred target region.
  • translation termination codon region refers to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. This region is also one preferred target region.
  • Other preferred target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene.
  • 5′UTR 5′ untranslated region
  • 3′UTR 3′ untranslated region
  • mRNA splice sites may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions may also be preferred targets.
  • antisense oligonucleotides can be chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired disruption of the function of the molecule.
  • “Hybridization”, in the context of this invention means hydrogen bonding, also known as Watson-Crick base pairing, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them.
  • Specifically hybridizable and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the antisense oligonucleotide.
  • catalytic nucleic acids are synthesized once cleavage target sites on the PAI-1 mRNA molecule have been identified, e.g. any purine:pyrimidine consensus sequences in the case of DNA enzymes.
  • Catalytic nucleic acids and antisense oligonucleotides targeted to disrupting polymorphisms and mutants of the PAI-1 maybe similarly made as described above based on the polymorphic or mutant PAI-1 mRNA sequence.
  • At least one internucleoside linkage within the instant oligonucleotide comprises a phosphorothioate linkage.
  • Antisense oligonucleotide molecules synthesized with a phosphorothioate backbone have proven particularly resistant to exonuclease damage compared to standard deoxyribonucleic acids, and so they are used in preference.
  • a phosphorothioate antisense oligonucleotide for PAI-1 mRNA can be synthesized on an Applied Biosystems (Foster City, Calif.) model 380B DNA synthesizer by standard methods.
  • oligodeoxynucleotides can be base deblocked in ammonium hydroxide at 60° C. for 8 h and purified by reversed-phase HPLC [0.1M triethylammonium bicarbonate/acetonitrile; PRP-1 support]. Oligomers can be detritylated in 3% acetic acid and precipitated with 2% lithiumperchlorate/acetone, dissolved in sterile water and reprecipitated as the sodium salt from 1 M NaCl/ethanol. Concentrations of the full length species can be determined by UV spectroscopy. Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3T-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage.
  • Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos.
  • nucleotides of the instant oligonucleoptide comprise at least one deoxyribonucleotide. In another embodiment the nucleotides comprise at least one ribonucleotide. Such deoxyribonucleotides or ribonucleotides can be modified or derivatized as described hereinabove.
  • the PAI-1-encoding mRNA encodes human PAI-1.
  • the human PAI-1-encoding mRNA comprises consecutive nucleotides, the sequence of which is set forth in SEQ ID NO:5.
  • This invention further provides a method of treating a subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit expression of a PAI-1 in the subject so as to thereby treat the subject.
  • This invention further provides a method of treating a cardiovascular disease in a subject involving apoptosis of a cardiomyocyte in the subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit apoptosis of the cardiomyocyte in the subject so as to thereby treat the cardiovascular disease.
  • This invention further provides a method of treating a fibrotic disease in a subject involving fibrogenesis in the subject which comprises administering to the subject an amount of the instant oligonucleotide effective to inhibit fibrogenesis in the subject so as to thereby treat the fibrotic disease.
  • Antisense oligonucleotides can be administered by intravenous injection, intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, orally or rectally. Human pharmacokinetics of certain antisense oligonucleotides have been studied. See (37) incorporated by reference in its entirety.
  • This invention provides all of the instant methods wherein the subject is a mammal.
  • the mammal is a human being.
  • E1 SEQ ID NO:2
  • E2 SEQ ID NO:4
  • E3 SEQ ID NO:3
  • SEQ ID NO:1 15-nucleotide catalytic domains
  • E0 SEQ ID NO:7
  • the nucleotide sequence in the two flanking arms of E2 was scrambled without altering the catalytic domain (FIG. 1 a ).
  • the 3′ terminus of each molecule was capped with an inverted 3′-3′-linked thymidine for resistance to 3′-to-5′ exonuclease digestion.
  • the 21-base oligonucleotide S1 (SEQ ID NO:8), synthesized from human PAI-1 mRNA and labeled at the 5′ end with 32P, was cleaved within 2 minutes when cultured with E1 at 10:1 substrate:enzyme excess, with maximal cleavage occurring by 2 hours.
  • the 10-nucleotide cleavage product is consistent with the size of the 32P-labeled fragment at the 5′ end.
  • E1 also cleaved larger 32P-labeled fragments of human PAI-1 mRNA, prepared by in vitro transcription, in a time- and concentration-dependent manner, FIG. 1 c .
  • a 520 nucleotide transcript was maximally cleaved by 2-4 hours to expected cleavage products of 320 and 200 nucleotides.
  • a similar dose-dependency was seen with E3, with maximal cleavage of human PAI-1 mRNA transcripts occurring at the highest concentration used, 20 ⁇ M.
  • the sequence-specific nature of the DNA enzymatic cleavage is shown in FIG. 1 d , where the control DNA enzyme E0, containing an identical catalytic domain to E1 and E3, but scrambled sequences in the flanking arms, caused no cleavage of human PAI-1 mRNA transcripts. Pre-heating the transcript to 72° C. for 10 minutes prior to incubation with E1, but not E0, further increased cleavage.
  • FIG. 2 a The DNA enzyme E2 cleaved the 23-base oligonucleotide S2, synthesized from the sequence of rat PAI-1 mRNA, in a dose- and time-dependent manner, FIG. 2 a .
  • E2 also cleaved a rat PAI-1 mRNA transcript in a dose-dependent manner by 2-4 hours to give the 156 nucleotide cleavage product, FIG. 2 b .
  • neither the scrambled control DNA enzyme E0 nor E3 cleaved the rat PAI-1 mRNA transcript.
  • 3 b shows the effect of endothelial cell transfection with E2 DNA enzyme on TGF-beta mediated induction of PAI-1 protein.
  • Endothelial cells transfected with scrambled DNA enzyme demonstrated approximately 50% increase in cytoplasmic PAI-1 protein as detected by Western blot. In contrast, this effect was almost completely is abrogated by transfection with the PAI-1 DNA enzyme E2.
  • DNA enzymes with a thymidine in the correct orientation at the 3′ end are significantly degraded by factors in serum (1-5% concentration) within 24 hours (14), we investigated the protective effect of an inverted thymidine at the 3′ end on serum-dependent nucleolytic degradation of PAI-1 DNA enzymes.
  • the DNA enzyme E1 was labeled with 32P and incubated for 3-24 hours with human umbilical vein endothelial cell (HUVEC) monolayers cultured in medium containing physiologic (2%) or supraphysiologic (20%) serum concentrations As shown in FIG.
  • HUVEC human umbilical vein endothelial cell
  • PAI-1 expression in infarcted rat hearts was dramatically altered, with 71% reduction in PAI-1 expression by macrophages at the peri-infarct region (p ⁇ 0.01), FIG. 4 a .
  • Inhibition of PAI-1 expression at this site was highly specific since PAI-1 expression within macrophages in the center of the infarct zone remained unaffected after E2 injection, and injection with the scrambled DNA enzyme E0 did not reduce peri-infarct PAI-1 expression.
  • E2 Protects Cardiomyocytes at the Peri-Infarct Region Against Apoptosis.
  • the renin-angiotensin system (RAS) in progressive renal disease has been extensively investigated, indicating multiple actions beyond hemodynamic and salt/water homeostasis.
  • the RAS is now recognized to be linked to induction of plasminogen activator inhibitor-1 (PAI-1) likely via both the type 1 (AT1) and type 4 (AT4) receptors, thus, promoting both thrombosis and fibrosis (39).
  • Plasminogen activator inhibitor type 1 is thus a suitable target in renal fibrogenesis.
  • the progression of renal lesions to fibrosis involves several mechanisms, among which the inhibition of extracellular matrix (ECM) degradation appears to play an important role.
  • ECM extracellular matrix
  • PAI-1 as the main inhibitor of plasminogen activation, regulates fibrinolysis and the plasmin-mediated matrix metalloproteinase activation. PAI-1 is also a component of the ECM, where it binds to vitronectin. PAI-1 is not expressed in the normal human kidney but is strongly induced in various forms of kidney diseases, leading to renal fibrosis and terminal renal failure. Thrombin, angiotensin II, and transforming growth factor-beta are potent in vitro and in vivo agonists in increasing PAI-1 synthesis.
  • Several experimental and clinical studies support a role for PAI-1 in the renal fibrogenic process occurring in chronic glomerulonephritis, diabetic nephropathy, focal segmental glomerulosclerosis, and other fibrotic renal diseases (40).
  • End-stage renal disease comprises an enormous public health burden, with an incidence and prevalence that are increasingly on the rise. This escalating prevalence suggests that newer therapeutic interventions and strategies are needed to complement current therapeutic approaches. Although much evidence demonstrates conclusively that angiotensin II mediates progressive renal disease, recent evidence also implicates aldosterone as an important pathogenetic factor in progressive renal disease.
  • Aldosterone may promote fibrosis by several mechanisms, including plasminogen activator inhibitor-1 (PAI-1) expression and consequent alterations of vascular ribrinolysis, by stimulation of transforming growth factor-betal (TGF-betal), and by stimulation of reactive oxygen species (ROS) (41). Therefore it is expected that PAI-1 is a suitable target for therapeutic intervention into renal fibrosis.
  • PAI-1 plasminogen activator inhibitor-1
  • TGF-betal transforming growth factor-betal
  • ROS reactive oxygen species
  • PAI-1 plasminogen activator inhibitor-1
  • TGF-beta transforming growth factor beta
  • HSCs myofibroblast-like cells derived from hepatic stellate cells
  • PAI-1 plasminogen activator inhibitor type 1
  • COL1A2 alpha2(I) procollagen
  • Increased PAI-1 together with uPA, uPAR and tPA are associated with overall inhibition of matrix degradation in cirrhotic liver.
  • Hepatic stellate cells are an important source of PAI-1 during liver fibrosis.
  • PAI-1 levels in bronchoalveolar lavage (BAL) supernatant fluids are significantly higher in idiopathic pulmonary fibrosis (IPF) patients than in normal subjects. Increased procoagulant and antifibrinolytic activities in the lungs with idiopathic pulmonary fibrosis. Therefore it is expected that PAI-1 is a suitable target for therapeutic intervention into fibrosis of the lung.
  • BAL bronchoalveolar lavage
  • IPF idiopathic pulmonary fibrosis
  • cataracts of the eye may be treated by reversing the symptomatic fibrosis that occurs, thought to be due to ischemia, by the mechanism described hereinabove.
  • DNA enzymes and RNA substrates DNA enzymes with 3′-3′ inverted thymidine were synthesized by Integrated DNA technologies (Coralville, Iowa) and purified by RNase-free IE-HPLC or RP-HPLC. The short RNA substrates corresponding to target DNA enzyme sequences were chemically synthesized followed by RNAse-free PAGE purification and also made by in vitro transcription from a DNA template.
  • a 32P-labeled-nucleotide human PAI-1 RNA transcript was prepared by in vitro transcription (SP6 polymerase, Promega). 20 ml transcription reaction consisted of 4 ⁇ l 5 ⁇ buffer, 2 ⁇ l DTT, 1 ⁇ l RNasin inhibitor, 4 ⁇ l NTP mixture (1 ⁇ l A,G,C, and 1 ul H 2 O), 100 ⁇ M UTP, 2 ⁇ l template (0.3 ⁇ g/ ⁇ l), a-32P-UTP (10 ⁇ ci/ ⁇ l) and 1 ⁇ l SP6 polymerase (20 u/ ⁇ l). Reaction time was 1 hour at 32° C. Unincorporated label and short nucleotides ( ⁇ 350base) were seperated from radiolabeled species by centrigugation on Chromaspin-200 columns (Clontech, Palo Alto, Calif.).
  • Cleavage reactions synthetic RNA substrate was end-labeled with 32P using T4 polynucleotide kinase.
  • Cleavage reaction system included 60 mM Tris-HCl (pH 7.5), 10 mM MgCl 2 , 150 mM NaCl, 0.5 ⁇ M 32p-labled RNA oligo., 0.05-5 ⁇ M DNA enzyme.
  • reaction system contained 1% of PAI-1 transcripts, 25 mM Tris-HCl (pH 7.5), 5 mM MgCl 2 , 100 mM NaCl and 0.2-20 ⁇ M DNA enzyme. Reactions were allowed to proceed at 37° C.
  • DNA enzyme stability in serum DAN enzymes were radiolabled using T4 polynucleotide kinase.
  • Labeling reaction (20 ⁇ l of volume) consists of 1 ⁇ l 20 ⁇ M DNA enzyme, 2 ⁇ l 10 ⁇ kinase buffer, 1 ⁇ l T4 PNK (10 u/ ⁇ l), 10 ⁇ l H 2 O, and 6 ⁇ l 32P-ATP (3000 uCi/mmol, 10 uCi/ ⁇ l). Reaction time is 30 minutes at 37° C.
  • HUVEC were cultured in media (Clonetic) containing 2% or 20% FCS, and radiolabeled oligomers were added at a final concentration of 100 nM.
  • HUVEC endothelial cells were obtained from Clonetic (USA) and grown in medium containing 2%FCS, 100 ug/ml streptomycin and 100 IU/ml penicillin at 37° C. in a humidified atmosphere of 5% CO2. HUVEC were used in experiments between passage 6 and 8. For transfection of DNA enzyme, rat endothelial cells (EC) were harvested and seeded into each well of 6-well plates ( ⁇ 1 ⁇ 10 5 cells/well).
  • Subconfluent (70-80%) EC were washed twice with 1 ml HEPES buffer (pH 7.4) and transfected using 0.5 ml of serum-free medium containing 1 ⁇ M test molecule (E2 or E0) and 20 ⁇ g/ml cationic lipids (DOTAP). 3 hours after incubation, 0.5 ml of 2% serum medium were added to each well; 3 hours later, TGFb was added to half the wells at a final concentration of 1.8 ng/ml. Transfected cells continued to be incubated for 8 hrs and were lysed to isolate RNA (for RT-PCR) and Protein (for Western blot) using Trizol reagent (Life Technologies).
  • RT-PCR Total RNA from each well of 6-well plates were isolated using 1 ml Trizol reagent and dissolved in 20 ⁇ l Depc-treated H 2 O. 2 ⁇ l samples were used to perform reverse transcription in 20 ⁇ l reaction system, and 4 ⁇ l products were then used as templates to amplify PAI-1 or human GAPDH in 50 ⁇ l PCR system (5 ⁇ l 10 ⁇ buffer, 1 ⁇ l dNTP, 0.25 ⁇ l Taq polymerase, 1 ⁇ l forward and reverse primer, 38 ⁇ l H 2 O, 2 ⁇ l 32pdCTP (3000 ci/mmol, 10 uci/ul).
  • the reaction conditions were 95° C.-2 min (predenatured), 95° C.-0.5 min, 58° C.-1 min, 72° C.-2 min, 35 cycles, 72° C.-10 min.
  • Human GAPDH was used as internal control (forward Primer 5′TGAAGGTCGGAGTCAACGGATTTG3′; SEQ ID NO:13, reverse primer 5′CATGTGGGCCATGAGGTCCACCAC3′; SEQ ID NO:14), its PCR products being 452 base.
  • proteins were transferred to nitrocellulose membrane (Protran, Schleicler & Schuell) by electrotransfer and blocked for at least one hour at room temperature with 5% (W/V) BSA in TBS-T buffer (0.1M Tris-base (pH 7.5), 0.15M Nacl and 0.1% Tween-20) Following this step, membranes were immunoblotted with goat IgG polyclonal anti-PAI antibodies (Santa Cruz biotech) and then visualised by the ECL-system (Amershan) using horseradish peroxidase conjugated anti-goat IgG (Sigma).
  • tissue sections were then digested with Proteinase K (10 ⁇ g/ml in Tris/HCL) for 30 minutes at 37° C.
  • the slides were then washed 3 times in PBS and incubated with 50 ⁇ l of the TUNEL reaction mixture (TdT and fluorescein-labeled dUTP) and incubated in a humid atmosphere for 60 minutes at 37° C.
  • TdT was eliminated from the reaction mixture.
  • the sections were then incubated for 30 minutes with an antibody specific for fluorescein-conjugated alkaline phosphatase (AP) (Boehringer Mannheim, Mannheim, Germany).
  • AP fluorescein-conjugated alkaline phosphatase
  • the TUNEL stain was visualized with a substrate system in which nuclei with DNA fragmentation stained blue, (BCIP/NBT substrate system, DAKO, Carpinteria, Calif.). The reaction was terminated following three minutes of exposure with PBS. To determine the proportion of blue-staining apoptotic nuclei within myocytes, tissue was counterstained with a monoclonal antibody specific for desmin. Endogenous peroxidase was blocked by using a 3% hydrogen perioxidase solution in PBS for 15 minutes, followed by washing with 20% goat serum solution. An anti-desmin antibody (Sigma, Saint Louis, Mo.) was incubated overnight (1:100) at 40° C.
  • BCIP/NBT substrate system DAKO, Carpinteria, Calif.
  • the percentage of apoptotic myocytes was determined by means of an apoptotic index; the apoptotic index was calculated by dividing the number of positive staining myocyte nuclei by the total number of myocyte nuclei and multiplying by 100. Stained cells at the edges of the tissue were not counted. An apoptotic index of 1 or less was considered to indicate the absence of apoptosis.
  • RNAdraw an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows. Comput Appl Biosci 12:247-9.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cardiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Hematology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Diabetes (AREA)
  • Dermatology (AREA)
US10/128,706 2002-04-23 2002-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1 Abandoned US20030199463A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
US10/128,706 US20030199463A1 (en) 2002-04-23 2002-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1
AU2003231089A AU2003231089B2 (en) 2002-04-23 2003-04-23 A DNA enzyme to inhibit plasminogen activator inhibitor-1
JP2003587981A JP4574992B2 (ja) 2002-04-23 2003-04-23 プラスミノーゲンアクチベーター阻害剤−１を阻害するためのｄｎａ酵素
US10/512,496 US7662794B2 (en) 2002-04-23 2003-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1
ZA200408776A ZA200408776B (en) 2002-04-23 2003-04-23 A DNA enzyme to inhibit plasminogen activator inhibitor-1
AT03724216T ATE477324T1 (de) 2002-04-23 2003-04-23 Dna-enzym zur hemmung von plasminogenaktivator- inhibitor-1
EP03724216A EP1501948B1 (en) 2002-04-23 2003-04-23 A dna enzyme to inhibit plasminogen activator inhibitor-1
PCT/US2003/012767 WO2003091456A1 (en) 2002-04-23 2003-04-23 A dna enzyme to inhibit plasminogen activator inhibitor-1
CA2483007A CA2483007C (en) 2002-04-23 2003-04-23 A dna enzyme to inhibit plasminogen activator inhibitor-1
CN038147149A CN1662663B (zh) 2002-04-23 2003-04-23 抑制纤溶酶原激活物抑制剂-1的dna酶
DE60333747T DE60333747D1 (de) 2002-04-23 2003-04-23 Dna-enzym zur hemmung von plasminogenaktivator-inhibitor-1
IL164674A IL164674A (en) 2002-04-23 2004-10-18 Catalytic deoxyribonucleic acid that cleaves pai-1 and uses thereof
AU2009201027A AU2009201027B2 (en) 2002-04-23 2009-03-04 A DNA enzyme to inhibit plasminogen activator inhibitor-1

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US10/128,706 US20030199463A1 (en) 2002-04-23 2002-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10512496 Continuation-In-Part 2003-04-23

Publications (1)

Publication Number Publication Date
US20030199463A1 true US20030199463A1 (en) 2003-10-23

Family

ID=29215497

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/128,706 Abandoned US20030199463A1 (en) 2002-04-23 2002-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1
US10/512,496 Expired - Lifetime US7662794B2 (en) 2002-04-23 2003-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/512,496 Expired - Lifetime US7662794B2 (en) 2002-04-23 2003-04-23 DNA enzyme to inhibit plasminogen activator inhibitor-1

Country Status (11)

Country Link
US (2) US20030199463A1 (zh)
EP (1) EP1501948B1 (zh)
JP (1) JP4574992B2 (zh)
CN (1) CN1662663B (zh)
AT (1) ATE477324T1 (zh)
AU (2) AU2003231089B2 (zh)
CA (1) CA2483007C (zh)
DE (1) DE60333747D1 (zh)
IL (1) IL164674A (zh)
WO (1) WO2003091456A1 (zh)
ZA (1) ZA200408776B (zh)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050148527A1 (en) * 2002-04-23 2005-07-07 Silviu Itescu Dna enzyme to inhibit plasminogen activator inhibitor-1

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2008016221A (es) 2006-07-05 2009-02-23 Catalyst Biosciences Inc Métodos de selección de proteasa y proteasas identificadas por este medio.
CN107630011A (zh) * 2006-07-05 2018-01-26 催化剂生物科学公司 蛋白酶筛选方法及由此鉴别的蛋白酶
KR101712208B1 (ko) 2008-01-09 2017-03-03 인트렉손 코포레이션 Ｐａｉ―１ 작용의 치료학적 억제제 및 이의 사용 방법
CN105148261A (zh) * 2008-03-31 2015-12-16 苏州兰鼎生物制药有限公司 尿激酶原及尿激酶原变体在急性心肌梗塞易化经皮冠状动脉介入中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5985558A (en) * 1997-04-14 1999-11-16 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998028317A2 (en) 1996-12-24 1998-07-02 Ribozyme Pharmaceuticals, Inc. Synthesis of nucleosides and polynucleotides
AU2001229441A1 (en) * 2000-01-14 2001-07-24 Tanox, Inc. Use of antagonists of plasminogen activator inhibitor-1 (pai-1) for the treatment of asthma and chronic obstructive pulmonary disease
AU3173301A (en) * 2000-02-11 2001-08-20 European Molecular Biology Laboratory Methods and compositions for treatment of alzheimer's disease by enhancing plasmin or plasmin-like activity
US20030199463A1 (en) 2002-04-23 2003-10-23 Silviu Itescu DNA enzyme to inhibit plasminogen activator inhibitor-1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5985558A (en) * 1997-04-14 1999-11-16 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050148527A1 (en) * 2002-04-23 2005-07-07 Silviu Itescu Dna enzyme to inhibit plasminogen activator inhibitor-1
US7662794B2 (en) 2002-04-23 2010-02-16 The Trustees Of Columbia University In The City Of New York DNA enzyme to inhibit plasminogen activator inhibitor-1

Also Published As

Publication number Publication date
CA2483007C (en) 2018-05-22
ATE477324T1 (de) 2010-08-15
CA2483007A1 (en) 2003-11-06
AU2003231089B2 (en) 2008-12-04
AU2009201027A1 (en) 2009-04-02
ZA200408776B (en) 2007-12-27
AU2009201027B2 (en) 2012-02-23
EP1501948A1 (en) 2005-02-02
DE60333747D1 (de) 2010-09-23
US7662794B2 (en) 2010-02-16
JP2005523708A (ja) 2005-08-11
WO2003091456A1 (en) 2003-11-06
IL164674A0 (en) 2005-12-18
EP1501948A4 (en) 2007-05-23
AU2003231089A1 (en) 2003-11-10
JP4574992B2 (ja) 2010-11-04
EP1501948B1 (en) 2010-08-11
IL164674A (en) 2012-01-31
CN1662663B (zh) 2012-09-26
CN1662663A (zh) 2005-08-31
US20050148527A1 (en) 2005-07-07

Similar Documents

Publication Publication Date Title
US6566127B1 (en) Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor
US6127173A (en) Nucleic acid catalysts with endonuclease activity
US6831171B2 (en) Nucleic acid catalysts with endonuclease activity
US7235534B2 (en) Antisense strategy to modulate estrogen receptor response (ER α and/or ER β )
US7034009B2 (en) Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
JPH10500309A (ja) リボザイムを用いて再狭窄および癌を治療するための方法および組成物
AU2021204399A1 (en) Compositions and methods for inhibiting gene expression of alpha-1 antitrypsin
US20190169618A1 (en) Nucleic acids and methods for the treatment of pompe disease
US6037463A (en) Enzymatic RNA molecules that cleave mutant N-RAS
AU2009201027B2 (en) A DNA enzyme to inhibit plasminogen activator inhibitor-1
JP2003525037A (ja) Ｃｄ２０およびｎｏｇｏ遺伝子発現の調節および診断のための方法および試薬
AU749561B2 (en) Nucleic acid molecules having endonuclease and/or catalytic activity
US20040072783A1 (en) Nucleozymes with endonuclease activity
JP2003521943A (ja) エンドヌクレアーゼ活性を有するヌクレオザイム
US6656731B1 (en) Nucleic acid catalysts with endonuclease activity
Prins et al. Antisense of oligonucleotides and the inhibition of oncogene expression
US20030087847A1 (en) Method and reagent for the inhibition of checkpoint kinase-1 (Chk1) enzyme
US7078390B1 (en) Ribozymes to growth factor originating in human platelet
AU3986201A (en) Method and reagent for the inhibition of grid
EP1321521A1 (en) Ribozymes directed against flt-1

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION