TWI754351B - A preparation method of a guarana fermentation liquid and an use for guarana fermentation liquid - Google Patents

Abstract

A preparation method of guarana fermentation liquid includes providing a culture medium, fermenting multiple strains with the culture medium for 7 days to obtain a basic fermentation, and adjusting the basic fermentation to obtain a guarana fermentation liquid. The culture medium includes a guarana extract made by 1 weight guarana (Paullinia Cupana ) and 10 weight water, and a glucose which weight is 10% of the total weight of the guarana fermentation liquid. The multiple strains includes 0.1% yeast relative to the culture medium, 0.05% Lactobacillus relative to the culture medium and 0.5% Acetobacter relative to the culture medium.

Description

Preparation method of guarana fermented liquid and use of guarana fermented liquid

The present invention relates to a kind of fermentation liquid, in particular to a preparation method of guarana fermentation liquid and its application.

Since the rise of the concept of organic and natural diets, biotechnology companies and food companies have been actively investing in the research and development of natural plant-related products. In order to make plant-related products have a scientifically proven basis for their health benefits, active ingredient analysis and efficacy evaluation of plants have become key items in product development. And Guarana (Guarana, scientific name Paullinia cupana) native to the Brazilian Amazon Basin has also become one of the objects of research and development.

Guarana (scientific name Paullinia cupana), also known as Brazilian cocoa, is a climbing vine of the Sapinaceae family. Guarana is distributed in the Amazon Basin regions such as Brazil, Peru, Colombia, and Venezuela. It is currently mainly grown in the Brazilian Amazon and the Brazilian state of Bahia.

Guarana is three-leafed, its flowers are small and white, and its fruit has a red husk that reveals white pulp and seeds when the fruit ripens. The fruit of guarana contains a lot of caffeine and is often used to make syrups, foods, and reprocessed into beverages.

Guarana has been a traditional medicinal herb used by the Amazons since the 15th century, mainly as a physical booster. In Portugal, Guarana has been used as a beverage since the late 1990s.

In some embodiments, a method for preparing a guarana fermentation broth includes providing a culture broth, fermenting the culture broth and a plurality of bacterial species for 7 days to obtain a fermentation stock solution, and adjusting the fermentation stock solution to form a guarana fermentation broth. The above-mentioned culture solution includes a guarana extract formed by 1 part by weight of guarana ( Paullinia cupana ) and 10 parts by weight of water and 10% glucose of the total weight of the guarana extract. The above-mentioned plural strains include yeast bacteria at 0.1% relative to the culture solution, lactic acid bacteria at 0.05% relative to the culture solution, and acetic acid bacteria at 5% relative to the culture solution.

In some embodiments, the use of a guarana fermentation broth prepared by a method for preparing a guarana fermentation broth is used to prepare a composition for reducing adipogenesis of receptors, wherein the guarana fermentation broth is used to enhance lipolytic enzymes (ATGL) expression amount to reduce adipogenesis.

In some embodiments, the use of a guarana fermentation broth prepared by a method for preparing a guarana fermentation broth for preparing a composition for reducing adipogenesis of receptors, wherein the guarana fermentation broth is used to reduce lipid oil droplets production to reduce fat formation.

In some embodiments, a use of guarana fermentation broth prepared by the above-mentioned preparation method of guarana fermentation broth for preparing a composition for reducing adipogenesis of receptors, wherein guarana fermentation broth is used to reduce The activity of amylolytic enzymes and alpha-glucosidase and the reduction of caloric absorption after the breakdown of starch into sugars to reduce fat formation.

To sum up, according to the preparation method of guarana fermentation broth of any embodiment, it can prepare a guarana fermentation broth. In some embodiments, a guarana fermentation broth can be used to prepare a composition that reduces adipogenesis. In some embodiments, the preparation method of guarana fermentation broth can increase the total polyphenol content of the prepared guarana fermentation broth. In some embodiments, the guarana fermentation broth is used to increase the expression of lipolytic enzymes, thereby reducing receptor lipogenesis. In some embodiments, the guarana fermentation broth is used to reduce the production of lipid oil droplets, thereby reducing adipogenesis. In some embodiments, the guarana fermentation broth is used to reduce the activity of amylolytic enzymes and reduce the caloric absorption after the decomposition of starch into sugars, thereby reducing fat formation.

As used herein, the symbol "%" generally refers to weight percent concentration, and the symbol "vol%" generally refers to volume percent concentration. As used herein, "Guarana" generally refers to the fruit (including seeds) of Guarana ( Paullinia cupana ), which is 1 to 1.5 cm in size and which is fully ripe.

See Figure 1. In some embodiments, the preparation method of guarana extract has the following steps: providing a culture solution (step S100 ), fermenting the culture solution and multiple strains for 7 days to obtain a fermentation stock solution (step S300 ), and adjusting the fermentation stock solution to A guarana fermentation broth is formed (step S500). Wherein, the culture solution includes guarana extract formed by 1 weight part of guarana ( Paullinia cupana ) and 10 weight parts of water, and 10% glucose of the total weight of the guarana extract. The plural strains include yeast at 0.1% relative to the culture solution, lactic acid bacteria at 0.05% relative to the culture solution, and acetic acid bacteria at 5% relative to the culture solution.

In some embodiments, the yeast may be Saccharomyces cerevisiae . In some embodiments, the lactic acid bacteria may be Lactobacillus plantarum or Lactobacillus plantarum. In some embodiments, the acetic acid bacteria may be Acetobacter aceti .

See Figure 2. In some embodiments, step S100 includes the following steps: mixing guarana and water to form a guarana base liquid (step S110 ), extracting the guarana base liquid at 95° C. for 1 hour to obtain a guarana extract liquid (step S120 ), and mixing the guarana extract with glucose to obtain a culture solution (step S130 ). Here, in the guarana-based liquid, the ratio of guarana to water is 1:10.

In some embodiments of step S110, the guarana mixed with water is granular. In other words, before mixing the guarana and water, the guarana needs to be broken up to form guarana particles so that it can be thoroughly mixed with the water.

In some embodiments, the guarana used herein may be a whole fruit comprising a red husk, white pulp and seeds, the whole fruit being 1 to 1.5 cm in size, and being a fully ripe fruit. In other words, the whole guarana fruit is crushed together with the husk and seeds into guarana particles.

In some embodiments of step S120, the extraction method of the guarana extract is by soaking the guarana in water with a constant temperature of 95°C for 1 hour. In other embodiments of step S120, the guarana extract is extracted by soaking the guarana in water and then placing the guarana and the water in an environment of 95° C. for 1 hour.

In some embodiments, the guarana extract is adjusted to a Brix of 10°Bx to 10.4°Bx with its total weight of 10% glucose to form a broth. Here, the culture medium with a sugar content of 10°Bx to 10.4°Bx can ensure the smooth progress of the subsequent fermentation and ensure that the bacteria have sufficient nutrient consumption.

In some embodiments, the obtained culture solution can be cooled to room temperature by natural cooling, so as to facilitate subsequent fermentation of the culture solution and various bacterial species.

In some embodiments, the pH of the culture medium is 6.3±2.

See Figure 3. In some embodiments, step S300 includes the following steps: first, fermenting the yeast in the culture solution for 1 day to form a first primary fermentation solution (step S310 ). In other words, the first mixed liquid obtained by mixing 0.1% of the yeast with the culture liquid was fermented for 1 day to form the first initial fermentation liquid. Among them, the amount of yeast added is 1% relative to the total weight of the culture solution. In some embodiments, the first mixed liquor is fermented at 28°C to 37°C. In addition, in an embodiment of step S310, the yeast is Saccharomyces cerevisiae ( Saccharomyces cerevisiae ).

After the first preliminary fermentation liquid is formed, lactic acid bacteria are added to ferment in the first preliminary fermentation liquid for 1 day to form a second preliminary fermentation liquid (step S330 ). In other words, the second mixed liquid obtained by mixing 0.05% of lactic acid bacteria and the first initial fermentation liquid was fermented for 1 day to form the second initial fermentation liquid. Among them, the addition amount of lactic acid bacteria is 0.05% of the total weight of the culture solution. In some embodiments, the second mixed liquor is fermented at 28°C to 37°C. Furthermore, in an embodiment of step S330, the lactic acid bacteria are Lactobacillus plantarum .

After the second primary fermentation broth is formed, acetic acid bacteria are added to ferment in the second primary fermentation broth for 5 days to form a third primary fermentation broth (step S350 ). In other words, the third mixed solution obtained by mixing 5% acetic bacteria and the second primary fermentation broth was fermented for 5 days to form the third primary fermentation broth. Among them, the addition amount of acetic acid bacteria is 5% relative to the total weight of the culture solution. In some embodiments, the third mixed liquor is fermented at 28°C to 37°C. In addition, in one embodiment of step S350, the acetic acid bacteria are acetic acid bacteria ( Acetobacter aceti ). And, the pH value of the third primary fermentation broth is 3 to 4. In some embodiments, the pH of the third primary fermentation broth is 3.4.

After the third primary fermentation broth is formed, the third primary fermentation broth is filtered to obtain a fermentation stock solution (step S370 ). In an implementation aspect of step S370, the filtering step of the third primary fermentation broth includes concentrating under reduced pressure at 60°C, and filtering the third primary fermentation broth with a 200 mesh mesh filter to obtain fermentation stock solution. Here, the pH of the fermentation stock solution is 3 to 4. In some embodiments, the pH of the fermentation stock is 3.4.

See Figure 1 again. After the fermentation stock solution is obtained, the fermentation stock solution is adjusted to form a guarana fermentation solution (step S500 ). For example, a guarana fermentation broth can be formed by adjusting the sugar content or/and concentration of the fermentation stock. In an implementation aspect of step S500, the sugar content of the fermentation stock solution is adjusted to form a guarana fermentation solution. In some embodiments, the guarana fermentation broth is formed by adding 60% of the oligosaccharide relative to the total weight of the fermentation broth to the fermentation broth. Here, the sugar content of the guarana fermentation broth is 40°Bx.

In some embodiments, the total polyphenol content of the guarana fermentation broth is above 1600 micrograms per milliliter (µg/ml). In other words, there are more than 1600 micrograms of total polyphenols per 1 ml of guarana fermentation broth.

In some embodiments, the guarana fermentation broth has the effect of increasing the expression of lipolytic enzyme genes. The lipolytic enzyme may be adipose triglyceride lipase (ATGL). In some embodiments, the guarana fermentation broth has the effect of reducing the production of lipid oil droplets. In some embodiments, the guarana fermentation broth has the effect of reducing the activity of amylase. In some embodiments, the guarana fermentation broth has the effect of reducing the activity of α-glucosidase. In some embodiments, the guarana fermentation broth has the effect of reducing caloric absorption after the breakdown of starch into sugars in the recipient. In some embodiments, guarana fermentation broth can achieve fat loss and/or calorie absorption through one or more of the following cellular-level effects: increased expression of lipolytic enzymes (ATGL) genes, decreased lipid oil droplets Generates, reduces the activity of amylolytic enzymes and reduces the activity of alpha-glucosidase.

In some embodiments, the guarana fermentation broth can be used to prepare a composition that increases the expression of a lipolytic enzyme (ATGL) gene.

In some embodiments, a guarana fermentation broth can be used to prepare a composition that reduces the production of lipid oil droplets.

In some embodiments, the guarana fermentation broth can be used to prepare a composition that reduces the activity of amylase and/or alpha-glucosidase.

In some embodiments, the guarana fermentation broth can be used to prepare a composition that reduces the caloric absorption of starch broken down into sugars in a recipient.

In some embodiments, a guarana fermentation broth can be used to prepare a composition that reduces adipogenesis in a receptor.

In some embodiments, any of the foregoing compositions can be a pharmaceutical. In other words, this medicinal product contains an effective amount of guarana fermentation broth.

In some embodiments, the aforementioned medicinal products may be manufactured for parenterally, parenterally, orally, or topically using techniques well known to those skilled in the art Dosage form.

In some embodiments, the dosage form for parenteral or oral administration can be, but is not limited to, a tablet, troche, lozenge, pill, capsule , dispersible powder or granule, solution, suspension, emulsion, syrup, elixir, slurry or the like. In some embodiments, the dosage form for parenteral or topical administration may be, but is not limited to, an injection, sterile powder, external preparation, or the like. In some embodiments, the injection can be administered by subcutaneous injection, intraepidermal injection, intradermal injection or intralesional injection.

In some embodiments, the aforementioned pharmaceutical product may comprise a pharmaceutically acceptable carrier that is widely used in pharmaceutical manufacturing techniques. In some embodiments, the pharmaceutically acceptable carrier can be one or more of the following carriers: solvent, buffer, emulsifier, suspending agent, disintegrant ( decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent ), gelling agents, preservatives, wetting agents, lubricants, absorption delaying agents, liposomes, and the like. Regarding the type and quantity of the carrier selected, it falls within the scope of the professional quality and routine skills of those who are familiar with the technology. In some embodiments, the solvent used as a pharmaceutically acceptable carrier may be water, normal saline, phosphate buffered saline (PBS), or an aqueous solution containing alcohol (aqueous solution containing alcohol). alcohol).

In some embodiments, any of the foregoing compositions may be edible compositions. In other words, the edible composition contains a specific amount of guarana fermentation broth. In some embodiments, the aforementioned edible composition may be a food product or a food additive. In some embodiments, food products may be, but are not limited to, beverages, fermented foods, bakery products, health foods, and dietary supplements.

In some embodiments, any of the foregoing compositions can be a cosmetic or skin care product. In other words, cosmetics or skin care products contain a specific amount of guarana fermentation broth.

In some embodiments, the aforementioned cosmetics or skin care products can be in any of the following forms: lotion, gel, jelly film, mud film, lotion, cream, lipstick, foundation, pressed powder, powder, makeup remover, makeup remover Milk, facial cleanser, body wash, shampoo, conditioner, sunscreen, hand cream, nail polish, perfume, serum and mask. In some embodiments, the aforementioned cosmetics or skin care products may further include externally acceptable ingredients as needed. In some embodiments, topical acceptable ingredients may be, for example, emulsifiers, penetration enhancers, emollients, solvents, excipients, antioxidants, or combinations thereof.

Example 1: Preparation of Guarana Fermentation Broth

After crushing the whole guarana fruit (including the husk, pulp and fruit core) into guarana granules, mix 1 part by weight of guarana granules and 10 parts by weight of water to form a guarana base liquid. Next, the guarana base solution was extracted at 95°C for 1 hour to obtain a guarana extract. The guarana extract was mixed with 10% of its total weight of glucose to form a broth for fermentation. In addition, the Brix of the culture solution was 10.4°Bx and the pH was 6.3.

The culture solution was cooled to room temperature (25°C) and the cooled culture solution was placed in a fermenter, followed by adding 0.1% brewer's yeast ( Saccharomyces cerevisiae , purchased from the Institute of Food Industry Development) relative to the total weight of the culture solution. Resource Conservation and Research Center (BCRC) and deposit number BCRC20271) into the broth in the fermenter to form the first mixture. The first mixed liquor was fermented at 30°C for 1 day to form the first primary fermentation liquor.

Lactobacillus plantarum TCI378, which is 0.05% relative to the total weight of the culture medium, was added to the first initial fermentation liquid in the fermentation tank, purchased from the Biological Resource Conservation and Research Center (BCRC) of the Food Industry Development Research Institute and the deposit number BCRC910760 ) to form the second mixture. The second mixed liquor was fermented at 30°C for 1 day to form a second primary fermentation liquor.

Add 5% acetic acid bacteria ( Acetobacter aceti , purchased from the Biological Resource Conservation and Research Center (BCRC) of the Institute of Food Industry Development and the deposit number 11688) to the second initial fermentation broth in the fermentation tank relative to the total weight of the culture broth. to form a third mixed solution. The third mixed liquor was fermented at 30°C for 5 days to form a third primary fermentation liquor. Next, it was confirmed whether the pH value of the 3rd primary fermentation liquid was pH 3.4, and the fermentation end time point was confirmed.

The fermented third primary fermentation broth was concentrated under reduced pressure with a vacuum concentrator at 60°C, and the third primary fermentation broth was filtered through a 200 mesh mesh filter to obtain a fermentation stock solution. In addition, 60% of isomalt oligosaccharide relative to the total weight of the fermentation stock solution was added to the fermentation stock solution to adjust the sugar content of the fermentation stock solution to 40°Bx to form a guarana fermentation broth.

Example 2: Preparation of Guarana Water Extract

After crushing the whole guarana fruit (including the husk, pulp and fruit core) into guarana granules, mix 1 part by weight of guarana granules and 10 parts by weight of water to form a guarana base liquid. Next, the guarana base solution was extracted at 95° C. for 1 hour to obtain a guarana water extract stock solution. The guarana water extract was mixed with 10% of its total weight of dextrose to form the guarana water extract. In addition, the sugar content of the guarana water extract was 10.4°Bx and the pH value was 6.3.

Experiment 1: Total polyphenol content test

1-1. Standard curve

Weigh 10.0 milligrams (mg) of gallic acid into a 10 mL volumetric flask, and then quantify to 10 mL with water (H2O) to obtain a stock solution of gallic acid. Dilute the stock solution of gallic acid by a factor of 10, i.e., 100 μL of the stock solution of gallic acid plus 900 μL of water, to obtain an initial solution of 100 μg/mL gallic acid (i.e., containing 1000 ppm of gallic acid). Then, prepare standard solutions of 0 μg/mL, 20 μg/mL, 40 μg/mL, 60 μg/mL, 80 μg/mL, and 100 μg/mL of gallic acid according to Table 1 below, and take 100 μL of the standard solutions of each concentration. into a glass test tube. Add 500 μL of Folin-Ciocalteu's phenol reagent (purchased from Merck) to each glass test tube and mix with the standard solution and let stand for 3 minutes, then add 400 μL of 7.5% sodium carbonate and mix evenly The reaction was carried out for 30 minutes to obtain a standard reaction solution. Take 200 μL of the standard reaction solution into a 96-well plate, and measure its absorbance at 750 nm to obtain a standard curve.

Table 1 Standard solution (μg/mL) 0 20 40 60 80 100 Initial solution (μL) 0 20 40 60 80 100 water (μL) 100 80 60 40 20 0

1-2. Experimental results

Dilute the test sample of the experimental group (that is, the guarana fermentation broth of Example 1) and the test sample of the control group (that is, the water extract of guarana of Example 2) with water respectively 10 times, and take 100 microliters (μL) into a centrifuge tube. Add 500 μL of Folin phenol reagent to the centrifuge tube containing the test sample diluted 10 times, mix it with the test sample and let it stand for 3 minutes, then add 400 μL of 7.5% sodium carbonate, mix it evenly, and react for 30 minutes to obtain the test sample. reaction solution. After shaking the centrifuge tube containing the reaction solution to be tested to ensure no air bubbles, take 200 μL of the reaction solution to be tested into a 96-well plate, and measure the absorbance of the reaction solution to be tested at 750 nm.

Next, use the standard curve and interpolation method to convert the absorbance value of the reaction solution to be tested into the total polyphenol content. Here, the total polyphenol content of the experimental group (that is, the guarana fermentation broth) is 1617.45 μg/mL, and the total polyphenol content of the control group (that is, the guarana water extract) is 728.09 μg/mL, such as shown in Figure 4.

It can be seen that guarana can increase the total polyphenol content by 2.2 times after microbial fermentation. That is, guarana fermentation broth can enhance antioxidant activity relative to guarana water extract.

Experiment 2: Enzyme activity test of amylolytic enzymes

2-1. Solvent configuration

0.02 molar concentration (M) sodium phosphate buffer solution containing 6 mM sodium chloride (hereinafter referred to as NaCl-Pi buffer solution): 0.7356 g of sodium monohydrogen phosphate (purchased from JT Baker, No. 3828-01) , 0.5492 g of sodium dihydrogen phosphate (purchased from Sigma, No. 04270) and 1.7532 g of sodium chloride (purchased from No. 1 Chemical Industry, No. C4B07) were mixed and dissolved in 500 ml of water (H ₂ O) to prepare NaCl-Pi buffer solution containing 6 mM NaCl and pH 6.3.

2N (N) Sodium Hydroxide (NaOH) Solution: Dissolve 8 grams of sodium hydroxide (available from Macron, no. 7708-10) in 100 ml of water to prepare a 2N sodium hydroxide solution.

Dinitrosalicylic acid color reagent (hereinafter referred to as terminator): Dissolve 1 g of 3,5-dinitrosalicylic acid (purchased from Sigma, No. D0550) in 50 ml of deionized water, and then 30 grams of sodium potassium tartrate tetrahydrate (purchased from Sigma, no. 32312) and 20 ml of 2N sodium hydroxide solution were slowly added and made up to 100 ml with deionized water. Here, a terminator can be obtained. Among them, the shelf life of the terminator is within two weeks.

1% starch solution: weigh 1 gram of starch to 100 ml of NaCl-Pi buffer solution and slowly heat it to completely dissolve the starch in the NaCl-Pi buffer solution. After the heated NaCl-Pi buffer solution containing starch is lowered to room temperature , to 100 ml with water. Here, a 1% starch solution can be obtained and stored at 4°C. In addition, the 1% starch solution should be left at room temperature for at least 4 to 5 minutes before enzymatic activity testing.

Alpha-amylase solution (5 units/ml): Dissolve 0.0096 g of alpha-amylase in 25 ml of NaCl-Pi buffer solution. Here, a solution of 5 units per milliliter of alpha-amylolytic enzyme can be obtained. In general, alpha-amylase solutions are stored at 4°C and can be stored for 2 to 3 days.

2-2. Test process

The enzymatic activity test of the amylolytic enzymes of each test group was carried out according to Table 2 below. Among the test groups, the experimental group (0 minutes), the control group (0 minutes) and the control group (0 minutes) represent the test groups in which α-amylase does not react with starch (hereinafter referred to as the reaction starting point (0 minutes). minutes)), while the experimental group (10 minutes), the control group (10 minutes) and the control group (10 minutes) represent the test groups in which α-amylase reacts with starch for 10 minutes (hereinafter referred to as the reaction termination point (10 minutes). )).

Table 2 test group testing sample reactive enzyme reactive matrix Experimental group (0 minutes) 5 times diluted guarana fermentation broth alpha-amylase starch Experimental group (10 minutes) 5 times diluted guarana fermentation broth alpha-amylase starch Control group (0 minutes) 5x diluted guarana water extract alpha-amylase starch Control group (10 minutes) 5x diluted guarana water extract alpha-amylase starch Control group (0 minutes) NaCl-Pi buffer solution alpha-amylase starch Control group (10 minutes) NaCl-Pi buffer solution alpha-amylase starch

In Table 2, both the guarana fermentation broth and the guarana water extract were diluted with water, and each test group was subjected to three replicate experiments. The reaction enzyme was 5 units/ml of alpha-amylase solution. The reaction matrix of the reaction enzyme is 1% starch solution. In other words, the substrate on which the enzymes (ie, alpha-amylases) act is starch.

According to Table 2, first, 200 μL of test samples (ie, 5-fold diluted guarana fermentation broth, 5-fold diluted guarana water extract and NaCl-Pi buffer solution) were taken into centrifuge tubes, respectively, and then placed in a centrifuge tube. Add 200 μL of α-amylase solution (5 units/ml) to each centrifuge tube, and shake the centrifuge tube containing the test sample and α-amylase solution to mix the test sample and α-amylase solution evenly To form the solution to be reacted, the centrifuge tube containing the solution to be reacted was placed at 25° C. for 10 minutes to react.

Next, add 400 μL of terminator to the centrifuge tube for the three test groups at the starting point of the reaction (0 minutes) and mix them evenly with the solution to be reacted, then add 200 μL of 1% starch solution and let stand at 25°C 10 minutes to form an unreacted solution. In other words, in the test group at the reaction initiation point (0 minutes), alpha-amylase did not react with starch.

For the three test groups at the reaction termination point (10 minutes), 200 μL of 1% starch solution was added to the centrifuge tube, and the 1% starch solution was mixed with the solution to be reacted to form a mixed solution. The centrifuge tube containing the mixed solution was placed at 25°C for 10 minutes to form a reaction solution, and then 400 μL of a terminator was added and mixed with the reaction solution to stop the reaction between starch and α-amylase.

Then, the three groups of test groups at the starting point of the reaction (0 minutes) (that is, the centrifuge tubes containing the unreacted solution) and the three groups of test groups at the end point of the reaction (10 minutes) (that is, the centrifuge tubes containing the reaction solution) were divided into three groups. Tubes) were placed in boiling water (100°C) for 5 minutes, and the centrifuge tubes of the 6 groups of test groups were cooled to room temperature (25°C) to form the test solutions of the 6 groups of test groups.

Take 150 μL of the solution to be tested from the centrifuge tube and mix with 850 μL of water to dilute the solution to be tested. Then take 200 μL of the diluted solution to be tested into a 96-well plate, and measure its absorbance at 540 nm.

2-3. Experimental Results

The enzyme activity percentage (%) of the amylolytic enzymes of each test group relative to the control group was calculated according to the following formula (1), as shown in Figure 5. In other words, the enzyme activity percentage of amylolytic enzymes in the control group was regarded as 100% to calculate the enzyme activity percentage (%) of the amylolytic enzymes in the experimental group and the control group.

×100%  （1）Formula (1) % α-Amylase activity =

×100% (1)

Among them, %α-Amylase activity represents the percentage of amylolytic enzyme activity (%); A _540nm (Sample _10min -Sample _0min ) represents the absorbance value and reaction starting point of the test group at the reaction termination point (10 minutes) at 540nm (0 min) is the difference between the absorbance values at 540 nm of the test group, and the test group is the experimental group or the control group. A _540nm (Control _10min -Control _0min ) represents the difference between the absorbance value at 540nm of the control group at the end point of the reaction (10 minutes) and the absorbance value of the control group at the start point of the reaction (0 min) at 540nm.

Please refer to Figure 5. Compared with the control group (enzyme activity was regarded as 100%), the percentage of amylolytic enzyme enzyme activity in the experimental group was 20.9%. In other words, the enzyme activity percentage of amylolytic enzymes in the experimental group was significantly decreased by 79.1% (about 80%) compared to the control group. And, compared with the control group, the enzymatic activity percentage of amylolytic enzymes in the control group was 77.7%. In other words, the enzymatic activity percentage of amylolytic enzymes in the control group decreased by 22.3% relative to the control group. It can be seen that the inhibitory ability of the guarana fermentation broth on the enzymatic activity of amylolytic enzymes is significantly higher than that of the guarana water extract on the enzymatic activity of amylolytic enzymes.

Experiment 3: Enzyme activity inhibition test of α-glucosidase

3-1. Solvent configuration

0.1 molar concentration (M) sodium phosphate buffer solution (Sodium phosphate buffer, hereinafter referred to as Pi buffer solution): 4.7283 g of sodium monohydrogen phosphate (purchased from JT Baker, No. 3828-01) and 2.0028 g of sodium dihydrogen phosphate (purchased from Sigma, No. 04270) mixed and dissolved in 400 ml of reverse osmosis water (RO water), and quantified to 500 ml in a quantitative bottle to obtain a Pi buffer solution with a pH value of 7.0.

2.5mM p-Nitrophenyl β-D-glucopyranoside (PNPG): Weigh 0.0377 g of PNPG to 100 ml with reverse osmosis water (RO water).

0.2M sodium carbonate (Na ₂ CO ₃ ): 2.1198 g of sodium carbonate was weighed and quantified to 100 ml with RO water, as a terminator for α-glucosidase.

0.2 units/ml (units/ml) α-glucosidase (α-glucosidase, purchased from sigma Chemical Co. (St. Louis, MO, G5003-100UN)) solution: Take 3.85 mg of solid α-glucosidase to 2.0 ml of 0.1M Pi buffer solution was dissolved to obtain 50 U/ml stock solution of α-glucosidase. Next, take 0.1 ml of 50 U/ml α-glucosidase stock solution and quantify to 25 ml with RO water to obtain 0.2 U/ml α-glucosidase solution. The activity of α-glucosidase per milligram of solid state is 26 units (units).

3-2. Test process

The enzymatic activity test of the amylolytic enzymes of each test group was carried out according to Table 3 below. Among the test groups, the experimental group (0 minutes), the control group (0 minutes) and the control group (0 minutes) represent the test groups in which α-glucosidase does not react with PNPG (hereinafter referred to as the reaction starting point (0). minutes)), while the experimental group (5 minutes), the control group (5 minutes) and the control group (5 minutes) represent the test groups in which α-glucosidase reacts with PNPG for 5 minutes (hereinafter referred to as the reaction termination point (5 minutes). )).

table 3 test group testing sample buffer reactive enzyme reactive matrix terminator Experiment (0 minutes) 5 times diluted guarana fermentation broth Pi buffer solution Pi buffer solution PNPG 0.2M sodium carbonate Experimental group (5 minutes) 5 times diluted guarana fermentation broth Pi buffer solution alpha-glucosidase PNPG 0.2M sodium carbonate Control group (0 minutes) 5x diluted guarana water extract Pi buffer solution Pi buffer solution PNPG 0.2M sodium carbonate Control group (5 minutes) 5x diluted guarana water extract Pi buffer solution alpha-glucosidase PNPG 0.2M sodium carbonate Control group (0 minutes) Pi buffer solution Pi buffer solution Pi buffer solution PNPG 0.2M sodium carbonate Control group (5 minutes) Pi buffer solution Pi buffer solution alpha-glucosidase PNPG 0.2M sodium carbonate

In Table 3, the guarana fermentation broth of Example 1 and the guarana water extract of Example 2 were both diluted with water, and each test group was subjected to three replicate experiments. The reaction enzyme was 0.2 units/ml α-glucosidase solution. The reaction matrix for the reaction enzyme was 2.5mM PNPG.

According to Table 3, first, 160 μL of test samples (i.e., 5-fold diluted guarana fermentation broth, 5-fold diluted guarana water extract and Pi buffer solution) were taken into 96-well plates, and then placed in each 20 μL of Pi buffer solution was added to the well to form the solution to be reacted.

Next, 20 μL of Pi buffer solution was added to the corresponding wells of the three test groups at the starting point of the reaction (0 minutes), mixed with the solution to be reacted, and reacted at 25°C for 10 minutes. After 10 minutes of reaction, 20 μL of 2.5 mM PNPG was added to each well, and the to-be-reacted solution, Pi buffer solution and PNPG were mixed uniformly and then placed at 37°C for 5 minutes to form a 0-minute group reaction solution. 80 μL of stopper was added to the 0-minute group reaction solution to stop the activity of α-glucosidase. Next, after the reaction solution in the 0-minute group was mixed evenly with the terminator, the absorbance at 405 nm was measured.

For the three test groups at the reaction termination point (5 minutes), 20 μL of 0.2 unit/ml α-glucosidase solution was added to the corresponding wells and mixed with the solution to be reacted. Then, the reaction termination point (5 minutes) was added. ) of the three test groups were placed at 25°C for 10 minutes to activate α-glucosidase. After 10 minutes of reaction, 20 μL of 2.5 mM PNPG was added to each well to make the activated α-glucosidase react with PNPG. The to-be-reacted solution, the α-glucosidase solution and the PNPG were mixed uniformly and then placed at 37° C. to react for 5 minutes to form a 5-minute group reaction solution. 80 μL of stopper was added to the 5-minute group reaction solution to stop the activity of α-glucosidase. Next, after the 5-minute group reaction solution and the terminator were mixed uniformly, the absorbance at 405 nm was measured.

3-3. Experimental Results

The enzyme activity percentage (%) of α-glucosidase in the experimental group and the control group was calculated according to the following formula (2), as shown in Figure 6. In other words, the enzyme activity percentage of α-glucosidase in the control group was regarded as 100% to calculate the enzyme activity percentage (%) of α-glucosidase in the experimental group and the control group.

×100%  （2）Formula (2) % α-Glucosidase activity =

×100% (2)

Among them, %α-Glucosidase activity represents the enzyme activity percentage (%) of α-glucosidase; A _405nm (Sample _5min -Sample _0min ) represents the absorbance value and reaction at 405nm of the test group at the reaction termination point (5 minutes). The difference between the absorbance values at 405 nm of the test group at the starting point (0 min), and the test group is the experimental group or the control group. A _405nm (Sample _5min -Sample _0min ) represents the difference between the absorbance at 405nm of the control group at the end point of the reaction (5min) and the absorbance at 405nm of the control group at the start of the reaction (0min).

Please refer to Figure 6. Compared with the control group (the enzyme activity was regarded as 100%), the enzyme activity percentage of α-glucosidase in the experimental group was 0%. In other words, the enzyme activity percentage of α-glucosidase in the experimental group was significantly decreased by 100% compared to the control group, which represented that the guarana fermentation broth completely inhibited the enzyme activity of α-glucosidase. And, compared with the control group, the enzyme activity percentage of α-glucosidase in the control group was 10.2%. In other words, the alpha-glucosidase enzyme activity percentage of the control group decreased by 89.8% relative to the control group. It can be seen that the inhibitory ability of guarana fermentation broth on the enzymatic activity of α-glucosidase is significantly higher than that of guarana water extract on the enzymatic activity of α-glucosidase. Here, the guarana fermentation broth has the ability to inhibit the activity of α-glucosidase.

Experiment 4: Detection of lipolytic enzyme gene expression

4-1. Test target and solution configuration

The adipose triglyceride lipase (ATGL) gene was used as the target of lipolytic enzyme gene detection.

Here, the used conditioned medium (Condition Medium) is the minimum essential medium α (Minimum Essential Medium Alpha, MEMα, brand: Gibco) supplemented with 20 vol% FBS (brand: Gibco) and 1 vol% penicillin-streptomycin.

4-2. Detection process

First, the mouse bone marrow stromal cell line OP9 (purchased from ATCC ^® , No. CRL-2749 ^™ ) was inoculated into each well of a 6-well culture dish containing 2 mL of conditioned medium at a cell number of 1×10 ⁵ cells per well. , and incubated at 37°C for 48 hours. Then, after culturing for 48 hours, the 6-well culture dish containing OP9 cells was placed at 37°C for 7 days. And during the 7-10 day culture period, fresh 2 mL of conditioned medium was replaced every 2 days. And after 7-10 days of culture, the formation of lipid droplets in the cells in each well was observed using a microscope (brand: ZEISS) to confirm that OP9 cells were completely differentiated into adipocytes.

The adipocytes were divided into 3 groups: experimental group, control group and control group. The conditioned medium of each group was removed and replaced with 2 mL of experimental medium per well, and then placed at 37°C for 48 hours of continuous culture. The experimental medium of the experimental group was a conditioned medium containing 0.031 vol% of the guarana fermentation broth obtained in Example 1. The experimental medium of the control group was a conditioned medium containing 0.031 vol% of the guarana water extract obtained in Example 2. The experimental medium of the control group was simply conditioned medium (ie, without guarana fermentation broth or guarana water extract).

After 48 hours of incubation, the experimental medium was removed from each well and washed once with PBS. After removing the PBS, RNA was extracted from the adipocytes of each group using an RNA purification kit (Brand: GeneMark). Next, the RNA extracted from each group was reverse-transcribed into cDNA by the reverse transcriptase kit (SuperScript™ Reverse Transcriptase kit, brand: Invitrogen), and the ABI system (ABI StepOne Plus™ System, brand: Applied Biosystems) was used with two Primers (shown in Table 4, SEQ ID NO: 1 and SEQ ID NO: 2) quantified the expression of the ATGL gene in adipocytes, and quantified the gene using the 2 ^-ΔΔCt method, as shown in Figure 7. It should be noted that the gene expression in Figure 7 is presented in relative expression fold numbers, in which the standard deviation was calculated using the STDEV formula of Excel software, and the statistically significant differences between groups were calculated by Student's t-test. analyze. In Fig. 7, "*" represents that the p-value is less than 0.05 in comparison with the control group.

Table 4 Introductory name serial number sequence ATGL-F SEQ ID NO: 1 GGATGGCGGCATTTCAGACA ATGL-R SEQ ID NO: 2 CAAAGGGTTGGGTTGGTTCAG

4-3. Experimental Results

See Figure 7. The expression level of the ATGL gene in the control group was regarded as 1.00 (ie, the expression level of the ATGL gene in the control group was 100%). Compared with the control group, the expression level of the ATGL gene in the experimental group was 3.30, while the expression level of the ATGL gene in the control group was 1.57. Here, the expression level of the ATGL gene in the experimental group was significantly increased compared to the control group, and the expression level of the ATGL gene in the experimental group was also significantly increased compared with the control group. From this, it can be seen that the guarana fermentation broth can effectively improve the expression of lipolytic enzyme genes, thereby increasing the lipolytic enzyme. In other words, guarana fermented liquid has the function of decomposing fat, thereby avoiding the accumulation of fat, and achieving the effect of reducing adipogenesis of receptors and reducing fat. In addition, guarana may produce more fat-degrading active ingredients than guarana water extract after microbial fermentation.

Experiment 5: Fat accumulation detection

5-1. Solvent configuration

Here, the pre-adipocyte expansion medium (pre-adipocyte expansion medium) used is the minimum essential medium alpha (Minimum Essential Medium Alpha, MEMα, 20vol% FBS (brand name: Gibco) and 1vol% penicillin-streptomycin) supplemented with Brand: Gibco). The differentiation medium used was MEMα (brand: Gibco) supplemented with 20 vol% FBS (brand: Gibco) and 1 vol% penicillin-streptomycin. And, oil-red O staining reagent (brand: Sigma) was completely dissolved in 100% isopropanol (isopropanol, supplier: ECHO) to prepare a 3 mg/mL stock solution of oil-red O staining reagent. To obtain a ready-to-use oil-red O working solution, dilute the stock solution of oil-red O staining reagent with secondary water (ddH ₂ O) to a concentration of 1.8 mg/day immediately before use. mL, which is the stock solution of 60% oil-red O staining reagent.

5-2. Detection process

First, the mouse bone marrow stromal cell line OP9 (purchased from ATCC ^® , No. CRL-2749 ^™ ) was seeded in a 24-well culture dish containing 500 μL of preadipocyte proliferation medium at a cell number of 8×10 ⁴ cells per well. in each well and incubated at 37°C for 7 days. During the 7-day culture period, fresh 500 μL differentiation medium was replaced every 3 days. After 7 days of culture, the formation of lipid droplets in the cells in each well was observed using a microscope (brand: ZEISS) to confirm that the cells were fully differentiated into adipocytes for subsequent experiments.

After 24 hours of culture, the adipocytes were divided into 3 groups: experimental group, control group and control group. The differentiation medium of each group was removed and replaced with 500 μL of experimental medium per well, and then cultured at 37°C for 7 days. During the 7-day culture period, fresh 500 μL experimental medium was replaced every 3 days. Among them, the experimental medium of the experimental group was a differentiation medium containing 0.062 vol% of the guarana fermentation broth obtained in Example 1. The experimental medium of the control group was a differentiation medium containing 0.062 vol% of the guarana water extract obtained in Example 2. The experimental medium of the control group was pure differentiation medium (ie, without guarana fermentation broth or guarana water extract).

Next, the experimental medium in each well was removed and rinsed twice with IxPBS. Next, 1 mL of 10% formaldehyde (supplier: ECHO) was added to each well and incubated at room temperature for 30 minutes to fix the cells. Afterwards, the formaldehyde in each well was removed and each well was rinsed twice with 1 mL of PBS. After re-rinsing, 1 mL of 60% isopropanol was added to each well and allowed to act for 1 minute. Next, the isopropanol was removed and an additional 1 mL of Oil-Red O working solution was added and allowed to act at room temperature for 1 hour.

After 1 hour of exposure, the Oil-Red O working solution was removed and rapidly destained with 1 mL of 60% isopropanol for 5 seconds. After destaining, the stained cells were photographed with a microscope to obtain a photomicrograph of the stained cells, as shown in FIG. 8 .

Next, 100% isopropanol was added to each well and placed on a shaker for 10 minutes to dissolve the dye. Then, 100 μL of the aforementioned dye-isopropanol solution was taken from each well to a 96-well culture plate and the absorbance (OD ₅₁₀ ) of each well was read with an ELISA reader (brand: BioTek) at a wavelength of 510 nm. .

After the measurement, the relative content (%) of lipid oil droplets was calculated by substituting the measured absorbance values into the following formula (3). In other words, here, the relative content (%) of lipid oil droplets in each group is calculated by taking the lipid oil droplet content of the control group as 1 (that is, the relative lipid oil content of the control group is 100%). Also, statistically significant differences between groups were statistically analyzed by Student's t-test, as shown in FIG. 9 . In Fig. 9, "*" represents that the p-value is less than 0.05 in comparison with the control group.

Formula (3) Relative content of lipid oil droplets (%) = (OD ₅₁₀ sample/OD ₅₁₀ control) × 100% (3)

Among them, OD ₅₁₀ sample represents the absorbance value of the group to be converted, and OD ₅₁₀ control represents the absorbance value of the control group.

5-3. Experimental Results

Referring to Figure 8, compared with the control group and the control group, the oil droplets of the adipocytes in the experimental group were significantly reduced. Please refer to Figure 9, compared to the control group, the relative content of lipid oil droplets in the experimental group was 77.96%, and it could reduce the amount of oil droplets by 22.04%. Here, the relative content of lipid oil droplets in the experimental group was significantly lower than that in the control group. Compared with the control group, the relative content of lipid oil droplets in the control group was 95.05%, and it could reduce the amount of oil droplets by 4.95%. Here, the relative content of lipid oil droplets in the experimental group was also significantly lower than that in the control group. It can be seen that the guarana fermentation broth can effectively inhibit the accumulation of fat, and has the function of reducing the fat formation of receptors, thereby achieving the effect of reducing fat. In addition, guarana may produce more fat-reducing active ingredients than guarana water extract after microbial fermentation.

Experiment 6: Human Body Detection

6-1. Detection process

Eight subjects were asked to drink 5 mL of guarana fermented beverage (containing 12 vol% of the guarana fermented liquid of Example 1 and 88 vol% of water) daily for 4 weeks. And, before drinking (ie the 0th week) and after drinking for 4 weeks (ie the 4th week), the body weight of these subjects was measured with a body weight scale (brand: TANITA BC545N Ten-in-One Composition Scale) and with a cloth ruler The waist circumference of these subjects. Also, 8 subjects (aged 20-55 years old) had a BMI greater than or equal to 24 and less than 27, and the body fat percentage of male subjects was greater than 25% and the body fat percentage of female subjects was greater than 30% .

It should be noted that the statistically significant difference between the measurement results of week 0 and the measurement results of week 4 was statistically analyzed by Student's t-test, as shown in Figure 10 and Figure 11 . In Figures 10 and 11, "*" represents that the p-value is less than 0.05 in comparison with Week 0, and "**" represents that its p-value is less than 0.01 in comparison with Week 0.

6-2. Test results

See Figure 10 and Figure 11. The average body weight of the 8 subjects decreased from 68 kg to 67.3 kg (as shown in Figure 10), and the average waist circumference of these subjects decreased from 85.8 cm to 82.9 cm (as shown in Figure 10). 11). In other words, consumption of guarana fermented beverages containing guarana fermented liquid for 4 weeks significantly reduced the average body weight of these subjects by 0.7 kg compared to before consumption (week 0), and the The average waist circumference of the subjects decreased significantly by 2.9 cm. It can be seen that long-term use of guarana fermented liquid can improve the body weight and waist circumference of the recipient, that is, guarana fermented liquid has the effect of slimming and reducing fat.

To sum up, according to the preparation method of guarana fermentation broth according to any embodiment of the present invention, a guarana fermentation broth can be prepared. In some embodiments, the prepared guarana fermentation broth can be used to prepare a composition that reduces adipogenesis in a recipient. In other words, the aforementioned composition has one or more of the following functions: enhancing antioxidant activity, inhibiting amylolytic enzyme activity, inhibiting α-glucosidase activity, enhancing expression of lipolytic enzyme genes, inhibiting fat accumulation, reducing receptor fat Form and lose fat.

Although the technical content of the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person who is familiar with the art, makes some changes and modifications without departing from the spirit of the present invention, should be included in the present invention. Therefore, the protection scope of the present invention should be determined by the scope of the appended patent application.

S100~S500: Steps

Fig. 1 is the preparation flow chart of guarana fermentation liquid; Fig. 2 is the flow chart of the detail of step S100 of Fig. 1; Fig. 3 is the flow chart of the detail of step S300 of Fig. 1; Fig. 4 is the polyphenol content measurement result figure of guarana fermentation liquor; Figure 5 is a graph of the relative measurement results of the enzymatic activity of amylolytic enzymes; Figure 6 is a graph of the relative measurement results of the enzyme activity of α-glucosidase; Figure 7 is a graph showing the results of the expression fold of the ATGL gene; Figure 8 is a photo of Oil Red O staining; Fig. 9 is the relative measurement result graph of lipid oil content; Figure 10 is a graph of the results of weight data for weeks 0 and 4; and Fig. 11 is a graph showing the results of waist circumference data in the 0th and 4th weeks.

S100~S500: Steps

Claims (8)

A preparation method of guarana fermentation liquid, comprising: providing a culture liquid, the culture liquid comprising a guarana extract formed by 1 weight part of guarana ( Paullinia cupana ) and 10 weight parts of water and the 10% glucose of the total weight of the guarana extract; 0.1% yeast is added to the culture solution and fermented for 1 day to form a first initial fermentation solution, wherein the yeast is Saccharomyces cerevisiae ; add 0.05 % lactic acid bacteria form a second initial fermentation liquid after 1 day of fermentation in the first initial fermentation liquid, wherein this lactic acid bacteria is Lactobacillus plantarum ; Add 5% acetic acid bacteria to fermentation in the second initial fermentation liquid for 5%. In the future, a third primary fermentation broth is formed, wherein the acetic acid bacteria are Acetobacter aceti ; the third primary fermentation broth is filtered to obtain a fermentation stock solution; and the fermentation stock solution is adjusted to form the guarana fermentation broth. The preparation method of guarana fermentation broth according to claim 1, wherein the step of filtering the third primary fermentation broth comprises: concentrating under reduced pressure at 60° C. and filtering the third primary fermentation broth with 200 mesh. The preparation method of guarana fermentation broth as claimed in claim 1, wherein the step of providing the broth comprises: mixing the guarana and the water to form a guarana base liquid; the guarana base liquid Extracting at 95°C for 1 hour to obtain the guarana extract; and mixing the guarana extract with the glucose to obtain the culture broth. The method for preparing a guarana fermentation broth according to claim 1, wherein the step of adjusting the fermentation stock solution to form the guarana fermentation broth is to adjust the sugar content of the fermentation stock solution to form the guarana fermentation broth. The preparation method of guarana fermentation broth according to claim 1, wherein the total polyphenol content of the guarana fermentation broth is 1600 μg/ml or more. Use of a guarana fermentation broth for preparing a composition for reducing adipogenesis of a receptor, wherein the guarana fermentation broth is prepared by the preparation method of claim 1, the guarana fermentation broth To increase the expression of a lipolytic enzyme (ATGL) gene to reduce adipogenesis. Use of a guarana fermentation broth for preparing a composition for reducing adipogenesis of a receptor, wherein the guarana fermentation broth is prepared by the preparation method of claim 1, the guarana fermentation broth To reduce the formation of lipid oil droplets to reduce adipogenesis. Use of a guarana fermentation broth for preparing a composition for reducing adipogenesis of a receptor, wherein the guarana fermentation broth is prepared by the preparation method of claim 1, the guarana fermentation broth It is used to reduce the activity of amylolytic enzymes and α-glucosidase and reduce the calorie absorption after the decomposition of starch into sugars to reduce fat formation.

Images