CN111088174B

CN111088174B - Saccharomycetes Fungiensis with oxidation resistance and whitening effect and application thereof

Info

Publication number: CN111088174B
Application number: CN201911394237.1A
Authority: CN
Inventors: 陈臣; 刘洋; 田怀香; 于海燕; 刘政; 陈彬; 景艳; 郑丹蔚
Original assignee: Shanghai Institute of Technology
Current assignee: Shanghai Institute of Technology
Priority date: 2019-12-30
Filing date: 2019-12-30
Publication date: 2022-03-04
Anticipated expiration: 2039-12-30
Also published as: CN111088174A

Abstract

The invention provides a strain of saccharomycete Fungiella (Saccharomyces fibuligera) with a preservation number of CCTCC NO: m2019324. Tests prove that the saccharomycete of Saccharopolyspora fibuligera CCTCC NO: m2019324, the DPPP free radical clearance rate of the extracellular supernatant is 81.9%, and the tyrosinase inhibition rate is 68.1%. The saccharomycete of Saccharopolyspora fibuligera CCTCC NO: the extracellular supernatant of M2019324 is fermented by using medicinal plants as a substrate, and the fermentation liquid has a better effect of inhibiting propionibacterium acnes. Meanwhile, the medicinal plant fermentation liquor can also be applied to the preparation of cosmetics, and the prepared saccharomycete with saccharomycete covered with CCTCC NO: the product of the plant fermentation liquid of M2019324 can effectively remove free radicals, promote skin renewal and reduce melanin synthesis, and has a very good application prospect.

Description

Saccharomycetes Fungiensis with oxidation resistance and whitening effect and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to saccharomyces bayanus (saccharomyces fibuligera) with oxidation resistance and whitening effect and application thereof.

Background

Skin care products are always popular for consumption, and the desire of consumers to care skin and seek essence promotes the vigorous development of the market. From the market trend in recent years, the natural plant cosmetics are increased more than the synthetic cosmetics in the global scope, China is the country where the natural plant cosmetics are increased most rapidly, international brands begin to intervene in the biological field besides foreign popular plant components, and the current SK-II magical water has good whitening effect due to the abundant yeast fermentation liquor. Microbial fermentation technology is a process of producing our desired product by using the metabolism of microorganisms under specific circumstances. Modern fermentation technology has wide prospect in skin care, can enrich effective components after fermentation, improve the efficacy of products, reduce toxic and side effects and the like. Which is impossible to do by the traditional solvent extraction method at present. Compared with other extraction technologies, the fermentation technology has the advantages of no pollution, low energy consumption, simple and convenient operation and the like. In addition, partial enzyme generated in the fermentation process of the microorganism plays roles of cleaning the skin, preventing whelk and resisting aging to a certain extent.

Recently, due to the rapid development of probiotic science, the efficacy of probiotics is from the original digestion promoting function to the prevention of allergy, cancer and infection, the improvement of cholesterol metabolism and the like in the medical field. Not only the health care function is achieved by improving the balance of intestinal flora, but also the direct effect of the probiotics on human or animals and plants is very obvious. The probiotics can be used in food, and the fermentation product thereof is widely applied in cosmetics. Yeast is an early and most widely used microorganism in humans. The original flavor is a good natural flavor and has wide application in the food industry. Later on, the traditional Chinese medicine composition is used for treating acne in medicine, is gradually applied to the skin care product industry at present, and relates to the fields of whitening, resisting aging, removing dark eye circles, removing acne products, washing and caring hair and the like. In recent years, biochemical products such as yeast and its metabolites have become hot as major ingredients of cosmetics instead of chemically synthesized preparations. The skin care mechanism of yeast is mainly that yeast itself is a fungal cell, which contains, in addition to amino acids and nucleotides, monosaccharides, disaccharides, minerals, vitamins and other beneficial components. In fact, people in the middle ages are aware of brewing wine by active substances of yeast as early as 8000 years ago, the ancient Barbien uses beer and yeast to help wound healing, and Greek women also use foams generated by brewing fermentation to scrub faces and bodies so as to keep the health and beauty of the skin.

Because the development of probiotic fermentation and skin care in the domestic market is not strong at present, natural skin care products still have the trend of being plant extracts, and the natural skin care products taking the plant extracts as the main components can not meet the consumption requirements of people gradually along with the higher and higher requirements of people on the skin care products. Nowadays, the biotechnology of pure natural cosmetics gradually becomes a new direction of the development of the cosmetic industry, the cosmetic industry formally enters the 4.0 era, and the microorganism, a technology which is not new, begins to enter the visual field of consumers by using 'new face' of the cosmetic industry.

Disclosure of Invention

The invention aims to provide yeast with high oxidation resistance and whitening effect and application thereof.

In order to achieve the above effects, the present invention provides a saccharomycete, and saccharomycete, wherein the saccharomycete has a high oxidation resistance and a whitening effect, and has a biological name of: saccharomyces fibuligera, which is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2019324.

The invention also provides a preparation method of the plant saccharomycete fermentation liquor, which is characterized in that the saccharomycete of fibula of saccharomycete of fibula of the above is inoculated to a fermentation raw liquor containing plants of saccharomycete of the saccharomycete of the above, and of saccharomycete of the above.

Preferably, the fermentation raw material liquid comprises plants, water and glucose, wherein the mass ratio of the plants to the water is (1-3): 100, and the addition amount of the glucose is 4% -6% of the sum of the masses of the plants and the water.

Preferably, the plant is a plant powder.

More preferably, the plant is a medicinal plant, preferably, platycodon grandiflorum, dandelion, mint, ginseng, angelica sinensis, ginkgo biloba, hemerocallis fulva, lavender, and the like, preferably hemerocallis and lavender, and more preferably hemerocallis and lavender flower.

Preferably, the preparation method of the plant yeast fermentation broth specifically comprises the following steps: inoculating 10% of strain culture solution of Saccharomycopsis fibuligera⁶～10⁸And (3) inoculating CFU/mL into the fermentation raw material liquid, culturing in a constant-temperature incubator at 37 ℃ for 24-48h, sterilizing, centrifuging and taking supernatant, wherein the obtained fermentation supernatant is the plant yeast fermentation liquid containing saccharomycete fibuligera.

More preferably, the preparation of the seed culture broth comprises: taking a strain of Saccharomycopsis fibuligera (Saccharomycopsis fibuligera) preserved by a freeze-drying tube dissolved in sterile water by using an inoculating loop, drawing a line on a PDA agar culture medium plate, and culturing in an incubator at 30 ℃ for 24-48h until a single colony grows out to obtain a plate-activated Saccharomycopsis fibuligera (Saccharomycopsis fibuligera) strain; inoculating strain of Saccharomycopsis fibuligera (Saccharomycopsis fibuligera) activated by inoculating plate into 250mL triangular flask containing 50m L MEB culture medium, and culturing at constant temperature of 30 deg.C for 24-48h to obtain strain culture solution.

Preferably, the sterilization and centrifugation conditions are sterilization at 115 ℃ for 20min and centrifugation at 4500-5500r/min for 15 min.

The invention also provides the plant yeast fermentation liquor prepared by the method.

The invention also provides application of the saccharomycete of ascomycete tectoria with high oxidation resistance and whitening effect in preparation of cosmetics.

The invention also provides the application of the plant yeast fermentation liquor in preparing cosmetics.

Preferably, the application refers to adding the plant yeast fermentation broth into a cosmetic formulation.

More preferably, the addition amount of the plant yeast fermentation liquid is 0.2-0.4% (w/w).

Preferably, the cosmetic is an antioxidant cosmetic, a whitening cosmetic, and an anti-acne, anti-acne cosmetic.

Compared with the prior art, the invention has the beneficial effects that:

1) tests prove that the saccharomycete of Saccharopolyspora fibuligera has high DPPH free radical eliminating rate and tyrosinase inhibiting rate compared with other saccharomycete. Wherein, DPPH free radical clearance rate of the substance in the saccharomycete of the envelope saccharomycete is 38.8 percent, and tyrosinase inhibition rate is 26.0 percent; the DPPH free radical clearance rate of the saccharomycete metabolite of the saccharomycete is 81.9 percent, and the tyrosinase inhibition rate is 68.1 percent.

2) The saccharomycete of Fujianfecti incarnata of the invention can take plants as fermentation substrates, can promote DPPH clearance rate and tyrosinase inhibition rate of plant fermentation liquor, and has better activity compared with DPPH free radical clearance rate of ascorbic acid and tyrosinase inhibition rate of arbutin respectively.

3) The saccharomycete of Saccharopolyspora fibuligera and the plant saccharomycete fermenting liquid prepared with the saccharomycete have obvious effect of inhibiting acne pathogenic bacteria Propionibacterium acnes.

4) The plant saccharomycete fermentation liquor prepared by the saccharomycete of the invention has excellent whitening and wrinkle-removing effects, and the whitening and skin-lubricating effects are obviously superior to those of the similar products sold in the market.

The invention provides a strain 1-13 of saccharomyces cerevisiae fibuligera, the biological name of which is: saccharomyces fibuligera, deposited in the China center for type culture Collection 5.5.2019, with the deposition address: wuhan university Collection, Lodoku mountain, Wuchang, Wuhan, Hubei province. 430072, its preservation number is CCTCC NO: m2019324.

Drawings

FIG. 1 is a bar graph showing the measurement of oxidation resistance in Effect example 1 of the present invention;

FIG. 2 bar graph of tyrosinase inhibition assay in effect example 2 of the present invention;

FIG. 3 is a graph showing the measurement of the inhibition ratio of Propionibacterium acnes in Effect example 3 of the present invention; wherein, the A part is the bacteriostasis zone of the Saccharopolyspora fibuligera yeast 1-13, and the B, C part is the bacteriostasis zone of 1 percent of methyl paraben.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.

EXAMPLE 1 Oxidation resistance assay of Yeast extracellular actives

(1) Taking a wine medicine sample to be tested, adding sterile water, diluting in a gradient manner by 10 times, oscillating, taking supernatant fluid to be coated on a solid culture medium, culturing for 12-48 hours, and taking an obtained single colony as a strain to be screened;

(2) under the aseptic condition, taking a strain to be screened, inoculating the strain to a porous cell culture plate containing a liquid culture medium, and activating for 3 generations for later use;

(3) centrifuging the activated bacterial liquid at 4000r/min for 2min, and taking supernatant for later use;

(4) carrying out a preliminary experiment, taking 2mL of DPPH solution, adding a small amount of sample solution into the DPPH solution, gradually adding the sample solution at a small amount and a large amount of sample solution at the same time of adding the sample solution, mixing the sample solution and the DPPH solution at the same time, observing the fading condition of the solution, recording the sample adding amount of the sample when the color of the solution is basically faded, namely the maximum sample adding amount, and taking half of the maximum sample adding amount to measure the antioxidant activity of the sample adding amount;

(5) taking the supernatant of the volume in the A1 and B1 wells of a porous plate, adding absolute ethanol solution into B1 to make the volume reach 200 mu L, then adding 100 mu L of 0.2mmol/L DPPH absolute ethanol solution into A1, supplementing less than 200 mu L of absolute ethanol, simultaneously adding 200 mu L of mixed solution of the absolute ethanol solution and the DPPH absolute ethanol solution into C1, and in C1, the volume ratio of the absolute ethanol solution to the DPPH absolute ethanol solution is 1:1, mixing uniformly, and reacting for 30min in a dark environment;

(6) the antioxidant activity of the samples is measured by an enzyme-labeling instrument at the wavelength of 517nm, each sample is paralleled at least 3 times, and the average value is taken.

(7) The results of the experiment are shown in Table 1. From these, 30 strains with the highest DPPH free radical scavenging rate were selected for the next experiment.

TABLE 1 DPPH clearance of extract from extracellular supernatant of Yeast

EXAMPLE 2 determination of tyrosinase inhibitory Activity of Yeast extracellular active substances

(1) Taking 30 strains to be tested, centrifuging the activated bacterial liquid at 4000r/min for 2min, and taking supernatant for later use.

(2) The desired solutions were prepared as follows:

TABLE 2 determination of tyrosinase inhibition

Unit (mL)	C1	C2	T1	T2
					PBS buffer	1.5	2.0	1.0	1.5
Sample (I)	0	0	0.5	0.5
					Tyrosinase enzyme	0.5	0	0.5	0
Total volume	2.0	2.0	2.0	2.0

C1, C2, T1 and T2 are added according to the table above, water bath is carried out in a water bath kettle at 37 ℃ for 10min, 1mL of dopa solution is added in the water bath kettle at 37 ℃ for 4min, the solution is immediately placed into a spectrophotometer to measure the light absorption value at 475nm at the time of 5min, and the activity inhibition rate T (%) of the sample on tyrosinase is calculated to be 1- (T1-T2)/(C1-C2). times.100%.

(3) The results of the experiment are shown in Table 3. As can be seen from the table, strains 1 to 13 had the highest tyrosinase inhibition efficiency.

TABLE 3 tyrosinase inhibition of extract of extracellular supernatant of yeast

Bacterial strains	Tyrosinase inhibition (%)	Bacterial strains	Tyrosinase inhibition (%)
				1-11	20.0％	6-7	19.7％
1-13	68.1％	6-8	44.0％
				1-18	12.8％	6-10	17.5％
2-21	19.4％	6-11	18.2％
				2-27	35.0％	6-12	37.6％
2-30	20.8％	6-15	35.2％
				2-31	44.9％	6-16	13.3％
5-26	6.2％	6-21	21.9％
				5-28	12.9％	6-25	24.2％
6-2	40.0％	6-27	9.3％
				6-4	20.7％	6-28	10.8％
6-5	24.8％	6-29	53.7％
				6-6	24.8％

EXAMPLE 3 determination of antioxidative Activity and tyrosinase inhibition efficiency of intracellular active substance of Yeast

(1) Taking 1-13 strains to be detected, centrifuging the activated bacterial liquid at 4000r/min for 2min, and completely emptying the centrifuged supernatant (namely the mixed liquid of the MEB culture medium and extracellular secretion) in a sterile operating platform;

(2) adding 0.9ml of sterile water, completely mixing the sterile water with a micro vortex mixer, covering an EP tube, centrifuging at low temperature and low speed for a short time again, wherein the centrifugation aims to clear the residual mixed solution of the MEB culture medium and extracellular secretion in the EP tube, and repeating the experimental steps for 2-3 times until the culture medium in the EP tube is completely cleaned;

(3) a small glass beaker is found, a proper amount of ice-water mixture and a small foam pore plate are added into the small glass beaker, an EP tube is opened and inserted into the small foam pore plate, after an ultrasonic rotor of an ultrasonic crusher is cleaned, the EP tube is placed into the ultrasonic crusher, the corresponding position between the ultrasonic rotor and the EP tube is adjusted (the ultrasonic rotor can not be inserted too deep into the liquid surface and can not be positioned outside the liquid surface), and the ultrasonic crusher is utilized to carry out cell wall breaking work;

(4) the wall breaking power is 30% power, each treatment is 2S, the process is stopped for 2S, and the total wall breaking time is 30 min. After the wall breaking is completed, taking out the EP pipe, and washing the ultrasonic rotor by using clear water;

(5) dripping the crushed liquid drops on a glass slide by using a liquid transfer gun, dripping a drop of crystal violet solution, baking on an alcohol lamp until no liquid drops exist, observing the crushing state of the liquid drops by using an optical microscope, checking whether the liquid drops are completely crushed, repeating the work of the second step again if the liquid drops are not completely crushed, performing wall breaking work again on the liquid drops, and centrifuging the liquid drops through a centrifuge if the liquid drops are completely broken to obtain supernatant;

(6) the DPPH radical clearance was again determined by the same method as described in example 1, and the DPPH radical clearance of intracellular active substances of strains 1-13 was 38.8%;

(7) the tyrosinase inhibition was again measured in the same manner as described in example 2, and the tyrosinase inhibition of the intracellular active substance of strain 5-4 was measured to be 26.0%;

example 4 identification of strains 1-13

(1) Colony characteristics: the strains 1-13 are streaked and separated on a PDA plate, and are cultured for 48h at 30 ℃, so that the strains 1-13 grow well, the bacterial colonies are circular and white, concentric circles are obvious, the strains are dry and opaque, and the surfaces and the edges of the strains are in a hypha shape.

(2) The characteristics of the culture: the lowest growth temperature of the strains 1-13 is 10 ℃, the highest growth temperature is 40 ℃, and the growth temperature is optimal at 28-35 ℃.

(3) ITS sequence analysis of Strain 1-13

The extraction method of the genome DNA of the strain 1-13 comprises the steps of selecting a single colony of the purified strain 1-13, inoculating the single colony into 10mL of MEB liquid culture medium, culturing at 30 ℃ for 8h, centrifuging the bacterial liquid (4000r/min, 15min) and collecting the thallus. The DNA is extracted by a genome DNA extraction kit (biological engineering (Shanghai) Co., Ltd.). Two synthetic universal primers (NL1: GCATATCAATAAGCGGAGGAAAAG, see SEQ ID NO: 2; NL4: GGTCCGTGTTTCAAGACGG, see SEQ ID NO:3) were used for PCR amplification, and the PCR products were recovered using a column PCR product purification kit (Biotechnology, Shanghai, Inc.), and purified and then sent to Biotechnology, Shanghai, Inc. for sequencing. The ITS nucleotide sequence of the obtained strain 1-13 is shown as SEQ ID NO. 1 in the sequence table and is 582 bp. Sent to GenBank (GenBank accession number: GQ359860) for Blast analysis. Strain 1-13 the most homologous strain was Saccharomyces fibuligera FBKL2.8026(Sequence ID: MK722478.1) with a homology of 97%. Species having a G + C (mol%) of the DNA of 10 to 12% or less and a sequence homology of ITS of 95% or more as described by Goodfellow and O' Donnell are classified as one genus, and Embley and Stackelbraggdt consider that species having a sequence homology of ITS of 97% or more are classified as one species. It can be concluded that strains 1-13 belong to the same species as Saccharomyces fibuligera FBKL 2.8026. Strains 1-13 were identified as Saccharopolyspora fibuligera. According to the morphological characteristics, physiological and biochemical characteristics and other microbiological characteristics and the genetic characteristics ITS, the CCTCC NO of the yeast is as follows: m2019324 is identified as Saccharomycopsis fibuligera (Saccharomyces fibuligera), which has been deposited in China Center for Type Culture Collection (CCTCC) in 5 months and 20 days in 2019, with the deposit number of CCTCC NO: m2019324.

Example 5 preparation of Hemerocallis fulva fermentation supernatant I

Adding glucose 4% of the mixed solution mass into the mixed solution of the daylily flower powder and the deionized water with the material taking liquid ratio (mass) of 1:100, and adding edible Na₂CO₃Adjusting the initial pH to 4.5 and adding the solution to a concentration of 10⁶-10⁸CFU/mL of Saccharopolyspora fibuligera 1-13, wherein the volume percentage concentration of the zymocyte liquid is 4%, and culturing for 24h in a constant temperature incubator at 37 ℃. Sterilizing in a high-pressure steam sterilizing pot at 121 deg.C for 15min after fermentation. Centrifuging at 5000r/min for 15min, and collecting supernatant, namely day lily saccharomycete fermentation supernatant I.

Example 6 preparation of Hemerocallis fulva fermentation supernatant II

The difference between the embodiment and the embodiment 5 is only that the mass ratio of the feed liquid is 2:100, and the other parts are the same as the embodiment 5.

Example 7 preparation of Hemerocallis fulva fermentation supernatant III

The difference between the embodiment and the embodiment 5 is only that the mass ratio of the material liquid is 3:100, and the other parts are the same as the embodiment 5.

Example 8 preparation of Lavender Yeast fermentation broth I

This example differs from example 5 in that the plant selected was lavender pollen, and the rest was the same as example 5.

Example 9 preparation of Lavender Yeast fermentation broth II

The difference between the embodiment and the embodiment 8 is only that the mass ratio of the feed liquid is 2:100, and the other parts are the same as the embodiment 8.

Example 10 preparation of Lavender Yeast fermentation broth III

The difference between the embodiment and the embodiment 8 is only that the mass ratio of the material liquid is 3:100, and the other parts are the same as the embodiment 8.

Example 11 preparation of Hemerocallis fulva Yeast fermentation broth cosmetic

The day lily flower yeast fermentation broth was formulated into an emulsion according to the formula shown in table 4.

TABLE 4 Hemerocallis fulva yeast fermentation liquor cosmetic formula

The preparation method of the emulsion comprises the following steps:

(1) accurately weighing each component in the phase A into a beaker A;

(2) accurately weighing deionized water in a beaker B, and dispersing the rest components in the phase B in a water phase one by one;

(3) placing the beaker A phase beaker in a water bath at 90 ℃, and simultaneously heating the aqueous solution in the beaker B to 90 ℃ while stirring;

(4) when the temperature of the two phases reaches about 90 ℃, slowly pouring the sample in the beaker A into the beaker B under the condition of stirring the aqueous solution of the phase B, and continuously stirring for 5 min;

(5) then homogenizing for 2min under the condition that the homogenizing speed is 10000 rpm;

(6) then slowing down the stirring speed, and adding the C phase component when the temperature is reduced to 55 ℃;

(7) and (5) continuously stirring for 20-30 min, and obtaining the uniform system.

Example 12 preparation of Hemerocallis fulva Yeast fermentation broth cosmetic

The difference between this example and example 11 is that the amount of the fermentation broth of Hemerocallis fulva was 0.3% (w/w), and the rest was the same as in example 11.

Example 13 preparation of Hemerocallis fulva Yeast fermentation broth cosmetic

The difference between this example and example 11 is that the amount of the fermentation broth of Hemerocallis fulva was 0.4% (w/w), and the rest was the same as in example 11.

Comparative example 1

This comparative example differs from example 5 only in that the preparation process was carried out without fermentation by the yeasts 1 to 13 of the species Saccharopolyspora sinensis, and the other parts are the same as in example 5.

Comparative example 2

This comparative example differs from example 8 only in that the preparation process is carried out without fermentation by the yeasts 1 to 13 of the species Saccharopolyspora fibuligera, the rest being the same as example 8.

Comparative example 3

The difference between the comparative example and the example 11 is that the day lily flower yeast fermentation liquid is not added in the formula of the emulsion, and the other parts are the same as the example 11.

Effect example 1 measurement of Oxidation resistance

The enzyme assay was used to measure the antioxidant activity of 0.01% ascorbic acid (VC) samples, 10% Hemerocallis broth from examples 5-7 and the plant stock solution from comparative example 1, 10% plant stock solutions from examples 8-10 and comparative example 2, as described in example 1. The results are shown in table 5:

TABLE 5 DPPH clearance assay results for various samples

As shown in fig. 1, the anti-oxidation effects of the day lily flower yeast fermentation liquid of 10% in examples 5 to 7 provided by the present invention are respectively equivalent to the effects of Vc of 0.0049%, 0.0055% and 0.0061%, and the anti-oxidation effects of the lavender flower yeast fermentation liquid of 10% in examples 8 to 10 are respectively equivalent to the effects of Vc of 0.0047%, 0.0052% and 0.0059%, and the prepared plant fermentation liquid has a certain wrinkle removing effect. More importantly, in comparative examples 1 and 2, which do not add 10% of the hemerocallis fulva fermentation broth prepared in examples 5-7 of the present invention, the DPPH clearance is only about 20%, while the DPPH clearance of the plant fermentation broth added with different proportions of Saccharopolyspora fibuligera increases with the increase of the addition proportion, wherein the highest DPPH clearance can reach 49.65%, the DPPH clearance of 10% of examples 5-7 is significantly higher than that of comparative example 1, and the DPPH clearance of examples 8-10 is also significantly higher than that of comparative example 2. Therefore, the saccharomycete fibuligera provided by the invention has high oxidation resistance and can also obviously improve the oxidation resistance of the medicinal plant fermentation liquor.

Effect example 2 measurement of tyrosinase inhibition Rate

The tyrosinase inhibition was measured by the enzyme assay on 0.01% ascorbic acid (VC), 10% day lily fermentation broth of examples 5-7 and the plant stock of comparative example 1, 10% plant stock of examples 8-10 and comparative example 2, as described in example 2. The results are shown in Table 6:

TABLE 6 determination of tyrosinase inhibition efficiency for various samples

As shown in fig. 2, the whitening effects of the day lily flower yeast fermentation liquids of 10% in examples 5 to 7 provided by the present invention are respectively equivalent to the effects of 0.473%, 0.535% and 0.585% arbutin, and the whitening effects of the lavender flower yeast fermentation liquids of 10% in examples 8 to 10 are respectively equivalent to the effects of 0.406%, 0.469% and 0.535% arbutin, and have certain whitening effects. More importantly, in comparative example 1 and comparative example 2 in which 10% of the day lily fermentation broth prepared in examples 5-7 of the present invention was not added, the tyrosinase inhibition rate was only about 20%, while the plant fermentation broth added with different proportions of Ascophyllum nodosum increased the tyrosinase inhibition rate with increasing addition rate, which was up to 49.64%, and the inhibition rates of examples 5-7 were significantly higher than those of comparative example 1 and examples 8-10 were also significantly higher than those of comparative example 2. Therefore, the saccharomycete tectorial membrane yeast provided by the invention has high tyrosinase inhibition rate and can also obviously improve the tyrosinase inhibition capability of the medicinal plant fermentation liquor.

Effect example 3 measurement of inhibition ratio of Propionibacterium acnes

Comparison of the effect of 1% methylparaben on Propionibacterium acnes with the Hemerocallis fulva fermentation broth of example 8 was performed using the Oxford cup bacteriostasis test.

The specific method comprises the following steps: the sterilized culture medium of the acne propionibacterium acnes is heated to be completely melted, poured into a culture dish and solidified. After complete cooling and solidification, 100. mu.L of Propionibacterium acnes suspension was pipetted with a pipette tip sterilized and placed on a petri dish and spread evenly with a spreading bar until almost completely dry. Directly and vertically placing 3-4 Oxford cups (circular small tubes with the inner diameter of 6mm, the outer diameter of 8mm and the height of 10mm, wherein two ends of the tubes are smooth, and glass tubes and porcelain tubes can also be used) on the surface of the culture medium in a sterile operation, slightly pressurizing to ensure that the tubes are in contact with the culture medium without gaps, and adding 200 mu L of a sample to be detected (1% of methylparaben) into the cups. After the mixture is filled, the mixture is cultured for 16 to 18 hours at 37 ℃, and the observation result shows that the diameter of the zone of inhibition is measured by a ruler, and the outer diameter of the Oxford cup is subtracted from the diameter of the zone of inhibition.

The results are shown in fig. 3, where the part a is the zone of inhibition by the yeast, saccharomyces pombe, 1-13, and the part B, C is the zone of inhibition by 1% methylparaben, it can be clearly seen that the fermentation broth of the day lily flower yeast has indeed the effect of inhibiting propionibacterium acnes, and the inhibition ability is obvious, and the diameter of the zone of inhibition is about 20.0 mm.

Effect example 4

To further verify the efficacy of the fermentation broth of Hemerocallis fulva in cosmetics, the emulsions prepared in examples 11-13 were subjected to the corresponding human experiments. The specific process is as follows:

1. sample (I)

Emulsions from examples 11 to 13

2. Experimental methods

Selecting 100 volunteers (50 male and 50 female, age 18-25 years), with dark yellow and dry skin on face, and no cosmetic allergy history. Volunteers were divided into 2 groups of 50 persons each, with half the ratio between men and women.

A first group, trial implementation 11 product; second, trial example 12; third, trial example 13; and fourthly, trying a certain commercially available whitening emulsion.

The using method comprises the following steps: after cleaning the face in the morning and evening, a proper amount of suitable product is uniformly smeared on the face, and the face is gently tapped and massaged for 8 weeks for continuous trial. The subjective evaluation of the product used by the test subjects was investigated in the form of a questionnaire. The results are shown in Table 7.

Table 7 evaluation of test subjects on products

Table 7 shows the results of the evaluation of the trial products by the test subjects, and the results in the table show that, after the daylily yeast fermentation liquid is added, the examples 11 to 13 of the present invention have good whitening and wrinkle removing effects, and the whitening and skin-lubricating effects are significantly better than those of the similar products on the market.

Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the invention. In all examples shown and described herein, unless otherwise specified, any particular value should be construed as merely illustrative, and not restrictive, and thus other examples of example embodiments may have different values.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention; such modifications and substitutions do not depart from the spirit and scope of the present invention, and they should be construed as being included in the following claims and description.

SEQUENCE LISTING

<110> Shanghai applied technology university

<120> saccharomycete ascomycete fascicularis with oxidation resistance and whitening effect and application thereof

<130> BCN1192747

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 582

<212> DNA

<213> Saccharomycopsis fibuligera

<400> 1

cccaagggca atgcttagta cggcgagtga agcggcaaaa gctcaaattt gaaagctagc 60

accttcggtg ttcgcgttgt aatttgaaga tagtttcctt gagtagtcct ttatctatgt 120

tccttggaac aggacgtcat agagggtgag aaccccgtat gattttggat actactcttt 180

gtgggattct atcgaagagt cgagttgttt gggaatgcag ctctaagtgg gtggtaaatt 240

ccatctaaag ctaaatattg gcgagagacc gatagcgaac aagtacagtg atggaaagat 300

gaaaagaact ctgaagagag agtgaaaaag tacgtgaaat tgctgaaagg gaagggcttg 360

aggtcagact tggtgtttaa tgattatcag ttcttcttgg actgtgcact cgtttttcac 420

cgggccaata tcagttttag cggtagagta ccccttgaaa tgtggcttcc ttcggggagt 480

gttatagtct tggggagatc tacttgctgg gactgaggac tgcgcttcgg caaggatatt 540

ggcgtaatga ccttaagccg cccgtcttga aaccacggga cc 582

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> NL1

<400> 2

gcatatcaat aagcggagga aaag 24

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> NL4

<400> 3

ggtccgtgtt tcaagacgg 19

Claims

1. The saccharomycete of saccharomycete covering saccharum dunculosum with high oxidation resistance and whitening effect is characterized in that the biological name is as follows:Saccharomycopsis fibuligerathe strain is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2019324.

2. A method for preparing day lily flower yeast fermentation liquor, which is characterized in that the Hemerocallis Fulvis strain of claim 1 is inoculated into fermentation raw material liquor containing day lily flower for fermentation, and the fermentation raw material liquor is sterilized and centrifuged to obtain supernatant fluid.

3. The method for preparing a Hemerocallis fulva yeast fermentation broth according to claim 2, wherein the fermentation raw material liquid comprises Hemerocallis fulva, water and glucose, wherein the mass ratio of the Hemerocallis fulva to the water is (1-3): 100, and the addition amount of the glucose is 4% -6% of the sum of the Hemerocallis fulva and the water.

4. The method of claim 3, wherein the method of making the fermentation broth comprises: inoculating 10% of strain culture solution of Saccharomycopsis fibuligera⁶～10⁸The CFU/mL is inoculated into a fermentation raw material liquid containing the day lily, the fermentation raw material liquid is cultured in a constant-temperature incubator at 37 ℃ for 24h-48h, then the sterilization and the centrifugation are carried out, the supernatant fluid is taken, and the obtained fermentation supernatant fluid is the day lily yeast fermentation liquid containing the saccharomycete of the Saccharopolyspora sinensis; the sterilization and centrifugation conditions are that the sterilization is carried out for 20min at the temperature of 115 ℃ and the centrifugation is carried out for 15min at the speed of 4500-5500 r/min.

5. The method of claim 4, wherein the preparing the culture solution comprises: taking a loop of the saccharomycete strain preserved by a freeze drying tube dissolved in sterile water by using an inoculating loop, scribing on a PDA agar culture medium plate, and culturing in an incubator at 30 ℃ for 24-48h until a single colony grows out to obtain the saccharomycete activated by the plate; inoculating the strain of Saccharomycopsis fibuligera activated by inoculating loop taking plate into MEB culture medium, and culturing in 30 deg.C incubator for 24-48h to obtain strain culture solution.

6. The fermentation broth of Hemerocallis fulva yeast prepared by the method of any one of claims 2-5.

7. The use of the Saccharopolyspora fibuligera yeast with high antioxidant and whitening effects of claim 1 in the preparation of day lily cosmetics.

8. The use of the fermentation broth of Hemerocallis fulva yeast of claim 6 in the preparation of cosmetics.