SK138999A3 - Method for inactivating pathogens, especially viruses, in a biological material - Google Patents

Abstract

The invention relates to a method for inactivating pathogens, especially viruses, in a biological material, by means of incubation with a chemical agent. The invention is characterized in that the incubation takes place in the presence of an eluotropic salt corresponding to an NaCl concentration of at least 200 mmole/l, preferably at least 300 mmole/l. The invention also relates to a preparation containing a prothrombin complex and purified by chromatography.

Description

The present invention relates to a method for inactivating pathogens in a biological material by incubation with a chemical composition and to compositions obtained therewith.

BACKGROUND OF THE INVENTION

Biologically, the material originates from organisms or body fluids or microorganisms.

Since the biological material may be contaminated with pathogens such as infectious molecules or microorganisms and viruses or pyrogens, various methods for inactivating or reducing the contamination of pathogens or pyrogens have already been developed.

Such methods include physical and / or chemical treatments such as various filtration methods (e.g., nano, dia- or ultrafiltration), heat treatment, acid or lye treatment, detergent and / or organic solvent treatment, as well as UV light or laser treatment. Various combinations of these methods have also been proposed in the art to inactivate or reduce contamination of pathogens.

For example, EP 0 197 554 discloses a method for depyrogenation and inactivation of viruses in a biological or pharmaceutical product which comprises treatment with a virus inactivation and depyrogenation agent such as an amphiphilic substance and / or a solid phase solvent on which the product is adsorbed. After this treatment, the virus inactivation and depyrogenation agent is separated from the solid phase, the adsorbed product is washed and then eluted from the solid phase.

EP 0 131 740 discloses the treatment of a protein-containing composition in solution with organic solvents such as di- and / or trilal-alkyl phosphates, optionally in the presence of a detergent (solvent / detergent treatment), where

31310 / H to obtain a protein preparation free of lipid viruses.

A heat treatment is known from AT-PS 402 151, in which at least 1% by weight of a surfactant is added to the preparation in aqueous solution before heating.

Another method for reducing or suppressing undesired activities in biological or pharmaceutical products is known from EP 0 083 999. This method is based on prolonged contact with a solution or suspension of amphiphil which does not act denaturing. The depyrogenated product is treated with an ion exchanger to remove amphiphil.

A disadvantage of many of these methods known in the art is the frequent occurrence of loss of activity of the labile proteins contained in the treated compositions, for example blood proteins. In particular, in carrying out the chromatographic purification process, proteins are inactivated to a relatively high degree. Protein degradation can also lead to activation. Thus, it is known, for example, that factor VII in chromatographic purification based on autocatalytic processes can very easily be activated to the undesirable factor VIIa because it is very labile.

A further disadvantage lies in the high time and apparatus demands of many methods, which greatly limits their feasibility and their use on a scale is often inappropriate.

SUMMARY OF THE INVENTION It is an object of the present invention to provide a protein-friendly method, in particular labile blood proteins, for the effective inactivation of pathogens in a biological material which can be easily scaled up and can be carried out economically. In particular, the degradation and possible activation of sensitive proteins is to be largely prevented by this method of inactivating pathogens.

SUMMARY OF THE INVENTION

The above task has been solved by providing a method for inactivating pathogens, especially viruses, in biological material by incubation with a chemical agent in which the incubation is carried out in the presence of an eluotropic salt corresponding to sodium chloride concentration

31310 / H at least 200 mmol / l, preferably at least 300 mmol / l.

Inactivation of pathogens in solution offers some advantages over treatment of the adsorbent. Thus, for example, the operability of such a method in a homogeneous, single-phase system is easier and the validation of inactivation is better feasible. It also appears that the improved accessibility of pathogens in a relatively homogeneous phase increases the efficiency of the process step.

The biological material preferably comprises a human protein and is in particular a plasma or plasma fraction or is derived from a cell culture. Preferably, the biological material comprises a blood factor such as factor XII, XI, VIII, V, a Wollebrand factor or fibrinogen dependent protein, in particular vitamin K, such as factor II, factor VII, factor IX, factor X, protein C, protein S or protein Z.

Proteins can be present as individual factors, preferably in purified form, or as complex mixtures. In one particularly preferred embodiment, the biological material comprises at least one prothrombin complex factor, and is in particular a material containing a prothrombin complex or factor VII fraction, for example starting from the corresponding residue (cryos residue) after plasma cryoprecipitation.

The composition of the invention is preferably a composition with FE1B (Factor Eight Inhibitor Bypassing-Activity), a composition that is suitable for treating patients with a Factor VIII inhibitor.

The cell culture material is preferably a material comprising recombinantly produced blood factors, including internal or external clotting factors, fibrinolysis, thrombolysis, or inhibitors thereof, particularly vitamin K-dependent blood factors. Suitable cells are conventional cells for the expression of recombinant proteins, preferably mammalian cells such as Vera-, CHO- or BHK cells. The corresponding proteins can be subjected directly from the crude cell extract to a method according to the invention for inactivation of potentially occurring pathogens, but it can also be a pre-purified cell fraction.

The chemical composition is, for example, a detergent (amphiphil, surfactant), which is preferably present in an amount of at least 1%, more preferably more than 5%,

31310 / H most preferably greater than 10%; however, other chemical agents can also be used according to the invention, in particular those in which, for example, a virulidal, bactericidal or depyrogenic effect or mixtures of various chemical agents are already known.

However, the selection is limited by the team so that the nativity of the biological material is not substantially affected. For the economical process, chemicals are selected which retain the biological activity of the material more than 50%, based on the activity before incubation, preferably at least 70%, in particular more than 85%. Preservation of biological activity means that the proteins contained in the biological material can perform their naturally attributed functions or various functions. This biological activity can then be detected and reported according to the type of protein, for example by means of a standardized chromogenic assay or the determination of antigens.

Optionally, the chemical composition is separated after incubation,

A detergent is generally understood to be a synthetic, organic substance active on boundary surfaces.

Preferably, a nonionic detergent is used for the process of the invention. Nonionic surfactants such as the polyether, especially the alkylphenol polyglycol ether, are, inter alia, products of ethoxylation of fatty acids, fatty acid amides, fatty amines, fatty alcohols, amine oxides, fatty acid esters of polyalcohols and sugar esters.

Such a surfactant does not denaturate the proteins and is preferably selected from the group of polysorbates and triton. For example, Tween® is used as the polysorbate.

When detergents are used as chemical agents, these detergents according to a preferred embodiment of the invention are used without the addition of other agents, in particular without the addition of toxic organic substances or solvents such as TNBP. This minimizes the risk of contamination.

The biological material is incubated with a chemical agent according to the method of the invention. Incubation means contacting the biological material with a solution, suspension or emulsion of the chemical composition for a sufficient period of time to inactivate any pathogens or pyrogens present at a certain temperature. The contacting can be, for example

31310 / H can be carried out by simply leaving the mixture for a defined time.

Incubation according to the present invention is carried out in the presence of an eluotropic salt. By "elotrophic salt" is further meant a salt mixed with a chemical agent or a salt in a complex formulation, having the property of leaching absorbed substances from solid or liquid-bonded adsorbents or gel-like adsorbents and / or extruding. Preferably, the eluotropic salts are desorption agents as used for chromatographic processes. Accordingly, the adsorbed substance is sufficiently soluble in the presence of an eluotropic salt, that is to say, preference is given to conditions under which the biological material does not precipitate.

The type and concentration of the salt or preparation is generally chosen according to the adsorbent used. The elution effect of the salt depends, for example, on the polarity of the solvent and thus increases, for example, in the order of ethanol-acetone-methanol-water. The adsorbent may be a solid phase, particularly a matrix suitable for ion exchange chromatography. Other additives, for example other salts, may be included in the formulation comprising the elotrophic salt. Preferably, the formulations are aqueous formulations having a pH in the range between 6.0 to 8.0, more preferably around 7.0.

In a preferred embodiment, sodium chloride, but also other alkali metal or alkaline earth metal salts, among them calcium chloride, are used as the eluotropic salt. The so-called chaotropes, such as urea, rhodanides or guanidine, can also be used as the eluotropic salts. The salt concentration is at least> 200 mmol / l, preferably> 300 mmol / l. The upper limit of the concentration used depends in particular on the solubility of the salt and is for sodium chloride

I, for example, about 2 mol / l. Chaotropic substances, such as urea, can even be used, for example, in a concentration of up to 8 mol / l.

Incubation of the biological material with chemical agents is carried out for a period of time sufficient to inactivate any pathogens present, preferably for between 10 minutes and 10 hours, most preferably between 1 hour and 5 hours. The time required for the method of the invention can be determined by model viruses such as HIV, Sindbis-, FSME- or hepatitis viruses by preliminary experiment.

31310 / H

Also, the choice of temperature affects the time used. In the method according to the invention, it is advantageously incubated at room temperature, for example in a temperature range between 15 and 45 ° C, in particular between 20 and 30 ° C.

In the method of the invention, the biological material is preferably adsorbed onto a solid support, purified and incubated immediately after elution of the purified material, the eluate being further processed, for example by centrifugation, filtration or other physical methods.

The solid support is preferably a material suitable for chromatography, in particular a support suitable for ion exchange chromatography, hydrophobic chromatography or affinity chromatography. For example, materials such as Sepharose®, Superdex®, Sephadex®, Spherodex®, Toyopearl®, or inorganic materials such as hydroxylapatite are used.

Inonomeners can be used inonomer materials such as DEAE-Sephacel®, DEAE-Sepharose® CL6B, DEAE-Sepharose® Fast Flow, QAE-Sephadex®, Q-Sepharose® Fast Flow, Q-Sepharose® High Performance, DEAE-Tris -Acryl, DEAE-Spherodex®, Q-Hyper-D (supplied by Sepracor), DEAE-Toyopearl®, QAE-Toyopearl®, Fractogel® EMD-TMAE or other Fractogel materials.

Examples of hydrophobic chromatography materials include, but are not limited to, Butyl-Sepharose®, Octyl-Sepharose®, Phenyl-Sepharose®, Fractogel® TSK-butyl, t-Butyl-HlC Support or TSK-Gel Butyl Toyopearl®.

The biological material may be adsorbed directly to the carrier and cleaned directly from the complex mixture, but the inactivation step may be preceded or followed by other material purification steps, within the scope of the present invention.

Further chromatographic purification is preferred according to the invention.

The pathogens are inactivated by the method of the invention. Degradation products of, for example, viruses, in particular also isolated by a gene or fragment thereof, are also to be understood as pathogens.

The pathogens may be surrounded by lipids such as Hepatitis B-Virus, or non-lipidic pathogens such as Hepatitis-A-Virus.

Methods of virus inactivation are now considered effective if, after applying the method to a sample of biological material that has been mixed with a high

The 31310 / H dose of the test virus, for example H1-virus or Sindbis-virus as a model virus for Hepatitis viruses, could not be detected in the sample and the virus titer was thus reduced below the detection limit. For example, the detection and quantification of nucleic acids can be performed by the PCR method as described in AT-PS 401 062 or by direct titration.

As a measure of inactivation, a so-called reduction factor is known which, after a single addition of the test virus, is calculated from the decimal logarithm of the quotients of the initial and final virus titers. Furthermore, according to European Directive EC 111/8115/89-EN, the Commission of the European Community is known as the so-called total reduction factor. It is calculated from the sum of the reduction factors of the individual sequential inactivation measures.

Preferably, another independent step for inactivation or reduction of pathogen contamination is also performed. Here, all known methods for minimizing infectious risk are contemplated.

In particular, filtration and / or heat treatment are performed as a further step for inactivation or reduction of contamination.

Nanofiltration is preferably performed as filtration. The preferred heat treatment is carried out on a solid biological material, for example a freeze-dried with a controlled water content, for example a water content between 5 and 8% and a temperature between 50 and 80 ° C, as described in EP 0 159 311.

In one preferred embodiment, a two-step treatment with a detergent as a chemical is performed. The detergent is used in the first step in an amount of at least 1%, preferably at least 5%, most preferably at least 10%. In the second step, an additional detergent is used in an amount of at least 10%, preferably at least 12%, most preferably at least 14%. The detergent used may be the same for both stages, but different detergents may also be used. Generally, by combining steps for inactivating viruses, the risk of viral infection after administration of the preparation can be greatly reduced or eliminated.

According to the present invention, a chromatographically purified preparation comprising an autodynamically activated blood factor with an activated blood factor content of less than 50%, based on the content of

31310 / H activated and unactivated blood factor, preferably less than 40%, more preferably less than 30%, even more preferably less than 20%, even more preferably less than 10%, most preferably less than 1%, and with a detergent content.

In particular, it is a preparation comprising a prothrombin complex with a Factor VIIa activity of less than 50%, based on an activated and non-activated Factor VII content, preferably of less than 10% and most preferably of less than 1%. The detergent content of the composition according to the invention here corresponds to a pharmaceutically acceptable amount, preferably between 1% and a limit of detectability of the detergent.

By autodynamically activatable blood factor according to the present invention is meant a blood factor that is activatable autocatalytically, by surface contact or by a process such as a chromatographic process. In particular, such a blood factor is selected from the group of factor VII, factor XI and precallikrein.

In another preferred embodiment, the formulation does not contain serine protease inhibitors such as thrombin inhibitors or cofactors such as heparin. In a special embodiment, the absence of substances of this kind is already present during the chromatographic process.

Therefore, the present invention also relates to the corresponding compositions which can be obtained by the process according to the invention.

Other additives, for example stabilizing substances such as amino acids, may also be included in the compositions of the invention.

The following examples the invention to be in more detail explained _f I, but are not, however, limited to these examples.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Detergent treatment of activated FEIBA prothrombin complex in the presence of TWEEN®-80 mg DEAE-Sephadex® A-50 from Pharmacia is incubated for 15 minutes at room temperature for swelling with 1 ml of 30 g / l chloride solution

31310 / H sodium in water. Then the gel is separated by centrifugation from the swollen residue. The gel is then washed five times with 1 ml of buffer (9 g / l Na ₂ HPO ₄ · 2H ₂ O, 7 g / l NaCl, pH 7.0) and two more washes with buffer (7 g / l trisodium citrate. 2 H ₂ O, 7 g / l NaCl) as well as resuspension and centrifugation.

ml of freshly frozen human citrate plasma is melted at 0 to +4 ° C and the cryoprecipitate formed is separated by centrifugation at +2 ° C. The resulting "cryo residue" is incubated with washed DEAE-Sephadex ® to generate FEIBA and adsorb to the gel along with prothrombin complex factors and inert protein. Thereafter, the coadsorbed inert protein is removed from the DEAE gel by washing with a buffer (9 g / L Na ₂ HPO ₄ · 2H ₂ O, 7 g / L NaCl).

The gel protein complex moist with the buffer is now suspended with 1.5 ml of a 150 mg / ml solution of TWEEN®-80 and 30 mg / ml sodium chloride for 1 hour at 26 ° C. The treated solution of higher ionic starch desorbs the protein together with prothrombin complex factors and any pathogens present. Subsequently, the suspension is diluted by the addition of 6.5 ml of water and readsorbed at room temperature for one hour while the protein fraction is re-absorbed while the inactivated pathogen components remain in solution together with the detergent. The gel / protein complex is then washed five times with 1 ml of a 7 g / l solution of sodium chloride in water until the detergent is removed.

For elution, the gel is treated with stirring with 0.7 ml of a 30 g / l solution of sodium chloride in water. The eluate is then dialyzed against distilled water, frozen and lyophilized. After reconstitution of the lyophilisate, the FEIB activity is determined according to AT-B 350,726.

The FEIBA preparation, but without detergent treatment, serves as a control.

Analysis of the obtained preparation showed a specific activity of 3.2 E FE1BA / mg protein at a protein content of 16.6 mg / ml after reconstitution of the lyophilisate and is comparable to a variant of the detergent-free method when a specific activity of 2.8 E / mg protein was achieved at a concentration protein 16.5 mg / ml.

31310 / H

Example 2

FEIBA desorption detergent treatment with extended incubation time

Analogously to Example 1, the fraction of the prothrombin complex is adsorbed onto DEAE-Sephadex®, washed until the inert protein is removed, and then desorbed with TWEEN®-80 / sodium chloride solution. However, the protein fraction is maintained in a desorbed state for more than 2-3 hours under otherwise maintained conditions. Subsequently, the product is processed to the final product in the same manner as described in Example 1.

Analysis of this batch gives a specific activity of 2.5 E FE1BA / mg protein at a protein content of 16.6 mg / ml at 2 hours incubation in the presence of TWEEN®-80 and a specific activity of 2.3 E FE1BA / mg protein at a protein content

17.4 mg / ml at 3 hours incubation with detergent.

Thus, it can be shown that even prolonged contact time with the detergent is not associated with any substantial inactivation of the active ingredient or reduction of yield.

Example 3

Treatment of FEIBA with a different gel reabsorption detergent

Feiba is prepared as described in Example 1. After treatment and desorption with the detergent, the solution obtained is transferred to a container into which 15 mg DEAE-Sephadex® A50 from Pharmacia has been pre-incubated in a solution of 30 g / l chloride the swelling solution and then washed five times with 1 ml of buffer (9 g / l Na 2 HPO _4, 2 H2 O, 7 g / l NaCl, pH 7.0) and further washed twice with a buffer (7 g / l of trisodium citrate. 2 H2 O, 7 g / l NaCl) and always resuspended and centrifuged. After one hour of absorption of the diluted protein complex to separate the detergent, the treatment is carried out as described in Example 1. The final product thus obtained has a yield of 95% compared to FEIBA, i.e. without detergent treatment, and is comparable in specific activity.

31310 / H

Example 4

Detergent treatment of the activated prothrombin complex FEIBA in the presence of TWEEN®-90 at elevated temperature.

mg DEAE-Sephadex® A-50 from Pharmacia is incubated for 15 minutes at room temperature for swelling with 1 ml of a 30 g / l solution of sodium chloride in water. Then the gel is separated by centrifugation from the swollen residue. Subsequently, the gel is washed five times with 1 ml of buffer (9 g / l Na ₂ HPO _4l 2 H ₂ O, 7 g / l NaCl, pH 7.0) and two more washes with buffer (7 g / l trisodium citrate. 2 H). ₂ 0.7 g / l NaCl) as well as resuspension and centrifugation.

ml of fresh frozen human citrate plasma is melted at 0 to + 4 ° C and the cryoprecipitate formed is separated by centrifugation at + 2 ° C. The resulting "cryo residue" is incubated with washed DEAE-Sephadex ® to generate FEIBA and adsorb to the gel along with prothrombin complex factors and inert protein. Thereafter, the coadsorbed inert protein is removed from the DEAE gel by washing with a buffer (9 g / l Na ₂ HPO ₄ · 2H ₂ 0.7 g / l NaCl).

The gel protein complex moist with the buffer is now suspended with 1.5 ml of a 1 mg / ml solution of TWEEN®-80 and 30 mg / ml sodium chloride for 1 hour at room temperature, whereby the protein fraction and the non-specific adsorbed impurities are desorbed. Subsequently, the gel is separated by filtration. The protein solution is now made up to 150 mg / ml with a detergent concentration of 150 mg / ml and then incubated with stirring to inactivate any pathogens present for one hour at 26 ° C or 1 hour at 40 ° C. Subsequently, it is diluted with 6.5 ml of water and the gel is readsorbed onto the freshly washed DEAE-Sephadex® A-50. Subsequently, it is washed five times with 1 ml of a 7 g / l solution of sodium chloride in water each time until the detergent is removed, and finally the formulation is further processed as described in Example 1.

Analysis of both treatment variants at 26 ° C and 40 ° C showed comparable specific activity of FEIBA with the standard variant without virus inactivation. The yields are always 75% of the standard variant.

Example 5

Treatment of the prothrombin complex FEIBA with a detergent in the presence

31310 / H

TWEEN®-80 (at the time the Applicant believes the best way to practice the invention) ml of freshly frozen human citrate plasma is melted at 0 to +4 ° C and the cryoprecipitate formed is separated by centrifugation at + 2 ° C. The resulting cryos residue is mixed with 2 IU heparin / ml. The proteins of the prothrombin complex are then adsorbed with DEAE-Sephadex® A-50 from Pharmacia at a concentration of 0.5 mg / ml. The gel-protein complex is separated from the solution and washed with buffer 1 (4 g / l trisodium citrate. 2H ₂ O, 7 g / l NaCl, 9 g / l Na ₂ HPO _4. 2H ₂ 0, 500 IU heparin / l, pH 7.5) followed by buffer 2 (4 g / l trisodium citrate, 2H ₂ O, 7 g / l NaCl, 500 IU heparin / l, pH 7.5).

The washed gel is now suspended for pathogen inactivation with 1.5 ml of a solution containing 150 mg TWEEN® -80 / ml and 30 mg / ml sodium chloride for 1 hour at 26 ° C. By this treatment, the protein fraction together with any pathogens or fragmentary pathogens present are desorbed and the pathogens are inactivated during incubation with the detergent. Subsequently, as in Example 1, the suspension is diluted by the addition of 6 ml of water and the protein fraction, together with the active substances, is adsorbed at room temperature on the ion exchange matrix for one hour. Subsequently, it is washed five times with 1 ml of buffer (4 g / l trisodium citrate. 2 H ₂ O, 7 g / l NaCl, 500 IU heparin / l, pH 7.5) until the detergent is removed and eluted with 1 g / l citrate solution. trojsodného. 2 H ₂ O, 30 g / L NaCl, 1000 IU heparin, pH 7.0. 1E heparin / ml is added to the eluate. The solution containing the prothrombin complex is buffered against a buffer containing 4 g / l trisodium citrate. 2 H ₂ O, 8 g / l NaCl, pH 7.0 and lyophilized. The reconstituted lyophilized prothrombin complex is assayed for protein and prothrombin complex factors; the results are shown in Table 1.

As a control, a batch without TWEEN® treatment is produced. The results of the analysis are also shown in Table 1.

Table 1

Comparison of prothrombin complex factor activities after and without the method of the invention

31310 / H

composition inspection The composition of the invention Protein (mg / l) 14.7 14.4 Prothrombin (E / ml) 22.1 19.7 Factor VII (E / ml) 0.9 1.0 Factor IX (E / ml) 21.0 22.2 Factor X (E / ml) 23.2 22.1 Protein C (E / ml) 26.5 27.9

It appears that the detergent treatment did not significantly alter the composition of the prothrombin complex.

Example 6

TWEEN®-80 Factor VII Detergent Treatment Compared to Conventional VI Inactivation of Factor VI Virus

Fractions of prothrombin complex containing prothrombin clotting factors, tiny proportions of Factor Vil, Factor IX and Factor X as described in Example 5 were separated from human citrate plasma. is obtained by adsorption to aluminum hydroxide. To this, 10 ml of a 2% aluminum hydrogel suspension is added to 1 l of the prothrombin complex residue and stirred for 30 minutes at 4 ° C. Subsequently, aluminum hydroxide-protein complex is separated by centrifugation at 5000 rpm at about 4 ° C with a Sorvall RC3B Rotor H6000A, the residue is collected and the precipitate is suspended and stirred for 30 minutes with 3.5% by volume of the remainder of the prothrombin complex used for adsorption. in a solution of 4 g / l trisodium citrate. 2 H ₂ O, 7 g / l NaCl, pH 7.5. An inert aluminum hydroxide protein is thereby desorbed. The aluminum hydroxide remaining Factor VII is pelleted by re-centrifugation as described above. The residue was collected and the precipitate was reused for further processing. For desorption of the protein fraction, the aluminum hydroxide-Factor VII complex is stirred for 30 minutes with 1 volume% of the prothrombin complex residue used for adsorption 0.3

31310 / H mol / L phosphate buffer, pH 8.6 (53.4 g Na 2 HPO ₄ .2 H 2 O / I, a solution of 41.1 g NaH ₂ PO _fourth H2 O / I, adjusted to pH 8.6) containing 1% TWEEN ®-80th Subsequently, for the inactivation of pathogens, TWEEN®-80 detergent is added to a final concentration of 15% and further stirred at 40 ° C for 1 hour. The solution is then cooled to about 22 ° C and diluted with 9 parts of distilled water. The Factor VIII fraction is then readsorbed to 1 g / L DEAE-Sephadexd® A50 with stirring for 1 hour at a temperature of about 11 ° C. Subsequently, the gel-protein complex is washed three times with 100 ml per liter of dilute TWEEN®-80 solution on a sinter suction with a buffer containing 4 g / l trisodium citrate. 2H ₂ O, 7 g / l NaCl, pH 7.5, containing 500 IU heparin / L until the absence of detergent. The elution of the Factor VII fraction is accomplished by mixing the ion exchange protein complex and 100 ml / L of a dilute TWEEN®-80 solution containing 85 g NaCl / L for 30 minutes at 22 ° C. The eluate is then quantitated for factor VII content by a factor VII chromogenic assay (Immunochrom-Factor VII: C, Immuno AG, Wien, measured against an international standard of prothrombin complex), protein content according to the method of Bradford [Anal.Biochem. 72: 248254 (1976)] and factor VIIa according to the method of US 683 682 (measured against the international standard factor VIIa). The results are shown in Table 2.

For comparison, Factor VII is separated by adsorbing on aluminum hydroxide as described above, from the other proteins of the prothrombin complex and, in the adsorbed state, treated according to EP 0 197 554 with the virus-inactivating agents of EP 0 131 740 with TWEEN®-80 and tri- (N-butyl) I-phosphate (TNBP). To this end, the alhydrogel-protein complex is mixed in an aqueous solution of 1% TWEEN®-80 and 0.3 tri- (N-butyl) phosphate for 18 hours at 4 ° C with a volume of 50 ml / l of the prothrombin complex residue. Subsequently, it is centrifuged to separate the aluminum hydroxide-protein complex as described above and washed with 3 x 100 ml of a 4 g / l trisodium citrate solution. 2 H 2 O, 7 g / l NaCl, pH 7.5 was re-suspended to remove excess TWEEN ® -80 and tri- (N-butyl) phosphate. Between each wash, the aluminum hydroxide-protein complex is pelletized by centrifugation. The elution is carried out under the same conditions as in the case of a parallel feed according to the method of the invention. Analogously, analyzes of the final product are also carried out. The results are shown in Table 2.

31310 / H

Table 2

Factor VIIa activities after carrying out the process according to the invention and after carrying out the process according to EP 0 197 554

composition Preparation according to invention Preparation according to EP 0 197 554 / EP 0 131 740 Activity F VII (E / ml) 3.2 3.8 Protein concentration (mg / ml) 0.2 0.5 Specific activity (E / mg) 15.2 7.6 Factor Vila activity (U / ml) 2.7 11.9 (VIIa / II) 0.84 3.13

Using this method, it appears that the factor VIIa content was significantly higher compared to the process of the invention, and no activation was detected despite the complex treatment of factor VII. In addition, in the method of the invention, the specific activity of the product obtained was higher than that of the comparative formulation.

Example 7

Semi-quantitative determination of G-virus Hepatitis

Samples of starting materials, cryoprecipitate residue or absorption residue after separation of clotting factors I, IX and X as well as the corresponding purified and concentrated clotting factor preparations were always taken from the pathogens for inactivating the pathogens of Examples 1 to 6. 0.5 ml of these samples were diluted with 1 + 1 physiological phosphate-sodium salt buffer and any viruses present were pelleted by ultracentrifugation. RNA was extracted from the viral pellets by RNAzol-Reagens (BIOTECX, Houston, Texas) and dissolved in sterile distilled water.

RT-PCR for G-virus Hepatitis (HGV) nucleic acids is performed with the primary pairs NS5a 1 and NS5a 2 (Linnen, J. et al., Science 271: 505-508 (1996). Sequence of primers used (obtained from Boehringer Mannheim,

31310 / H

Germany is for NS5a 1: 5 CTCTTTGTGGTAGTAGCCGAGAGAT 3 and for NS5a 2 5 CGAATGAGTCAGAGGACGGGGTAT 3. The primer is labeled with a fluorescent dye and routine procedures from which the usual fluorescence amplicon PCR protocols are analyzed on an Applieded Biosystems Biosystems sequencer. In order to exclude the presence of RT-PCR-inhibitors in the samples, samples were doped with C-virus-RNA-Mimics Hepatitis and in one performed Hepatitis C-PCR analyzed according to EP 0 714 988. Only suitable extracts were taken as suitable extracts evaluable for HGV-PCR. which show no inhibition in HCV-PCR. Fluorescence intensity was taken as a measure of Hepatitis G-virus. The starting materials used for fractionation prior to the inactivation of pathogens according to the invention appear to show strongly positive signals, i.e. a high concentration of HGV-nucleic acid amplifiers, whereas the velats after readsorption and separation of virus-inactivating agents were not detectable by HGV-RNA.

In parallel experiments without performing detergent treatment, the eluates used as starting materials HGV-PCR were positive.

Claims (18)

Method for the inactivation of pathogens, in particular viruses, in biological material by incubation with a chemical composition, characterized in that the incubation is carried out in the presence of an eluotropic salt corresponding to a sodium chloride concentration of at least 200 mmol / l, preferably at least 300 mmol / l. Method according to claim 1, characterized in that a detergent is used as the chemical composition, preferably in an amount of at least 1%, more preferably more than 5% and most preferably more than 10%. The process according to claim 1 or 2, characterized in that sodium chloride is used as the eluotropic salt. Method according to one of claims 1 to 3, characterized in that the incubation is carried out for a period of between 10 minutes and 10 hours, most preferably between 1 hour and 5 hours. Method according to any one of claims 1 to 4, characterized in that plasma or a plasma fraction or cell culture material is used as the biological material. Method according to one of Claims 1 to 5, characterized in that a biological material comprising a blood factor, in particular a vitamin K dependent protein, is used. Method according to any one of claims 1 to 6, characterized in that a biological material is used which is a fraction containing the prothrombin complex. Method according to any one of claims 1 to 7, characterized in that the biological material is adsorbed on a solid support, purified and incubated after elution of the purified material. Method according to claim 8, characterized in that the elution and the incubation are carried out simultaneously. Method according to claim 8 or 9, characterized in that a chromatographic material, in particular a material suitable for use as a solid support, is used as the solid support 31310 / H ion exchange chromatography or affinity chromatography. Method according to one of Claims 1 to 10, characterized in that further steps are carried out for the purification of the material, in particular purification by chromatography. Method according to one of Claims 1 to 11, characterized in that a further step is carried out to inactivate or reduce the contamination of the pathogens, in particular filtration or heat treatment. Method according to any one of claims 1 to 12, characterized in that the chemical composition is a nonionic detergent selected from the group of Tween and Triton. A chromatographically purified preparation comprising an autodynamically activated blood factor of less than 50%, based on the content of activated and non-activated blood factor, preferably less than 40%, more preferably less than 30%, even more preferably less than 20%, even more preferably less than 10%, most preferably less than 1%, and with a detergent content. 15. The composition of claim 14, wherein the blood factor is selected from the group of Factor VII, Factor VII, Factor XI and Pre-kallikrein. Composition according to either of claims 14 or 15, characterized in that it contains a prothrombin complex with a Factor VIIa activity of less than 50%, based on the content of activated and non-activated Factor VII, preferably less than 10% and most preferably less than 1%. Composition according to any one of claims 14 to 15, characterized in that the composition does not contain serine protease inhibitors or cofactors thereof. A composition according to any one of claims 14 to 17 which is prepared by a process according to any one of claims 1 to 13.