MXPA99009159A - Method for inactivating pathogens, especially viruses, in a biological material - Google Patents

Abstract

The invention relates to a method for inactivating pathogens, especially viruses, in a biological material, by means of incubation with a chemical agent. The invention is characterized in that the incubation takes place in the presence of an eluotropic salt corresponding to an NaCl concentration of at least 200 mmole/l, preferably at least 300 mmole/l. The invention also relates to a preparation containing a prothrombin complex and purified by chromatography.

Description

PROCEDURE FOR INACTIVATING PATHOGENS, ESPECIALLY VIRUSES, IN A BIOLOGICAL MATERIAL DESCRIPTION OF THE INVENTION The present invention relates to a process for the inactivation of pathogens in a biological material by means of incubation with a chemical agent. A biological material is derived from organisms or from bodily fluids or microorganisms. Since biological material with pathogens, such as infectious molecules or microorganisms and viruses, or pwógpnaß, which can be csitapinacb, has been developed for the inactivation or reduction of pathogens or pyrogens. Such procedures include physical and / or chemical treatments, such as different filtering methods (eg nano-, dia- or uitrafiltrate), heat treatment, treatment with acids or bleach, treatment with detergents and / or organic solvents, as well as as a treatment with UV light or laser light. Different combinations of these procedures for the inactivation or reduction of pathogens have also been proposed in the prior art. For example, P 0 197 554 describes a process for depyrogenation and inactivation of viruses in a biological or pharmaceutical product, comprising a treatment with a virus-inactivating or depyrogenation agent, such as, for example, an amphiphile and depyrogenation substance, in one phase REF: 31315 solid in which the product is adsorbed. After this treatment, the virus-inactivating and depyrogenation agent is separated from the solid phase, the adsorbed agent is washed and finally eluted from the solid phase. It is known from EP 0 131 740 to treat a protein-containing composition in a solution with organic solvents such as di- or triacyl phosphates, optionally in the presence of a detergent (solvent / detergent treatment), it being possible to obtain the protein compositions free of viruses that contain lipids. By AT-PS 402 151 a thermal treatment is known, in which the present preparation in aqueous solution, before heating it, is added with a surfactant with a concentration of at least 1% by weight. Another method for the reduction or suppression of undesirable activities in biological or pharmaceutical products is known from EP 0 083 999. This is based on prolonged contact with a solution or suspension of an amphiphile with a non-denaturing effect. The depyrogenated product is treated with an ion exchanger to separate the amphiphile. A disadvantage of many of these processes known in the state of the art is the frequency of loss of activity of the labile proteins found in the compositions to be treated, for example of blood proteins. In particular, by carrying out a chromatographic purification step, a protein inactivation is preferentially required. The destruction of protein can also lead to activation. Thus, it is known, for example, that factor VII in the case of chromatological purification due to autocatalytic processes very easily becomes a Vlla factor. Another disadvantage is the high expenditure in time and equipment, which greatly reduces its practicality and therefore makes its use on a large technical scale very inappropriate. The present invention proposes the task of presenting a procedure for JLa inactivation of pathogens in biological materials for proteins, especially proteins sanguneae iabilee, which can be transferred to a large technical scale and can be performed economically. Especially in the procedure for the inactivation of pathogens, the destruction or possible activation of sensitive proteins should be avoided. The present task is solved because a procedure is presented for inactivating pathogens, especially viruses, in a biological material by means of incubation with a chemical agent, in which the incubation is carried out in the presence of an eieutropic salt corresponding to a NaCl concentration of whenXnenos 200 mmo / 1, preferably 300 mmol / 1. The inactivation of pathogens in solution offers some advantages over the treatment of an adsorbent. For example, the practicality of such a procedure in a homogeneous system of a larger phase and the validation of the inactivation stage is more possible. It also seems that better access to pathogens in a relatively homogeneous phase increases the efficiency of that stage of the procedure. The biological material preferably contains a human protein and is in particular plasma or a plasma fraction or ee derived from a cell culture. Preferably the biological material contains a blood factor such as factor XII, XI, VIII, V, von Willebrand factor or fibrinogen, especially a vitamin K dependent protein such as factor II, factor VII, factor IX, factor X, protein C, protein S or protein 2. The proteins can be presented as individual factors preferably in purified form or in a complex mixture. In a very special embodiment the biological material contains at least one factor of the prothrombin complex and is in particular a fraction containing a prothrombin complex or a material containing factor VII, for example it is obtained after a plasma cryoprecipitation from of the superficial or superior residue (superficial crioresidu ©). The preparation according to the invention is preferably one with FEIB activity (Eight Inhibitor Bypaseing Activity factor), also a preparation that is suitable for the treatment of patient with inhibition VIII. The material originating from a cell culture is preferably a material containing blood factors prepared by recombinant methods, including intrinsic or extrinsic factors of coagulation, fibrinoiyisis, thrombosis or its inhibitors, especially blood factors dependent on vitamin K. cells are considered cells obtained for the expregation of recombinant proteins, especially mammalian cells, such as Vero, CHO or BHK cells. The corresponding proteins can directly from the crude cell extract, be subjected to the procedure to inactivate the pathogens eventually present but can also be a previously purified cell fraction. The chemical agent is especially a detergent (amphiphile, surfactant) which is preferably contained in an amount of at least 1%, preferably more than 5%, most preferably in more than 10%; however, other chemical agents can be used according to the invention, especially those which are already known for their virucidal, bactericidal or depyrogenation effect, or mixtures of different chemical agents. The selection is limited, however, because the birth of the biological material must not be modified in an essential way. For an economical procedure, a chemical subetancy is selected that maintains the biological activity of the material by more than 50%, in relation to the antee activity of the incubation, preferably at least 70%, especially more than 85%. Maintenance of biological activity means that the proteins contained in the biological material can perform their function or sleep different functions that are naturally characteristic of them. This biological activity can be determined and expressed depending on the type of protein, for example by means of a standardized chromogen test or a determination of the antigen. Eventually the chemical agent is separated after incubation. Detergent in general should be understood as a synthetic, organic, surfactant substance. Preferably in the process according to the invention a non-ionic detergent is used. Nonionic detergents such as polyether, especially alkylphenol polyglycol ether, are among other products of the ethoxylation of fatty acids, fatty acid amides, amine fats, fatty alcohols, amino oxides, fatty acid esters of poiiaicohoies and eacaroea esters. A surfactant of that type acts on the proteins in a non-denaturing manner and is preferably selected from the group of polysorbate and Triton. As a polyethoxide, for example, Tween "1 can be used. When detergents are used as chemical agents, they are used according to a preferred embodiment without the addition of other agents, especially without the addition of toxic or toxic organic substances. for example, TNBP This minimizes the risk of contamination The biological material according to the method according to the invention is incubated with a chemical agent The incubation means contacting the biological material with a solution, euepeneion or emulsion of a chemical agent to inactivate a pathogen or pyrogen eventulently present for a sufficiently long period of time at a given temperature.Contacting can be done simply by allowing the mixture to stand for a defined period of time. the present invention in the presence of an eleutropic salt. The "eleutropic salt" is to be understood as a mixture of the chemical agent or the salt of a complex composition, with the property of releasing and / or expelling the superabundance of solid or liquid impregnated adsorbents or also in the form of a gel. Preferably the eleutropic salt is treated here as a deaeration agent, such as those used in chromatographic processes. The adsorbed substance is, inter alia, sufficiently soluble in the presence of the eleutropic salt, that is, conditions which do not precipitate the biological material are preferably selected. The type and concentration of the salt or composition is generally selected depending on. adsorbent selected. The eluant effect of a salt depends, for example, on the polarity of the solvent, it also increases, for example, in the ethanol-acetone-methane sequence! Water. The adsorbent can be a solid fae, especially a suitable matrix for ion exchange chromatography. The composition contained in the etheotropic eal may contain other additives, for example, other salts. Preferably the composition here is an aqueous composition with a pH value in the range between 6.0 to 8.0, preferably 7.0. In a preferred embodiment as eieuotropic, sodium chloride is used, but also other alkaline or alkaline earth salts, including CaCl 2. As the eleutropic salts, so-called chaotropic salts, such as for example urea, rhodanide or guanidine, can also be used. The concentration of the eal is at least _ >; 200 mmol / 1, preferably > . 300 mmoi / 'l. The upper limit of the concentration used depends in particular on the solubility of the salt in question and is found in the case of NaCl for example in 2 mol / l. The caotropic substances, for example ureas, can optionally be used in a concentration of up to 8 mol / L. The incubation of the biological material with the chemical agent is carried out for the activation of pathogens possibly present for a sufficiently long period of time, preferably between 10 minutes and 10 hours, is preferred between 1 y- 5 horae. The period of time required for the method according to the invention can, according to the invention, be determined by means of model viruses such as HIV, Sindbis, FSME or hepatitis in a previous test. Also the selection of the temperature influences the period of time to use. E the process according to the invention is preferably incubated at room temperature, for example in a temperature range between 15 and 45 ° C, especially between 20 and 30 ° C. In the process according to the invention the biological material is preferably made in a solid carrier, it is purified and the incubation is carried out directly after the elution of the purified material. Elueion and incubation can be performed consecutively, they can also perform simultaneously. According to another preferred embodiment, the incubation is carried out after a chromatographic purification of a biological material, wherein the eluate is subsequently processed, for example by means of centrifugation, filtering or other physical methods. The solid carrier is preferably a material suitable for chromatography, especially for ion exchange chromatography, hydrophobic chromatography or affinity chromatography. For example, materials such as Sepharose ^, Superdez, Sephadex "", Spherodex "X Toyoperarl ™" or inorganic materials such as hydroxylapatite are used, as anion exchangers, such as DEAE-Sephacel "'1', D? AE, can be used. -SephadexmX DEAE-Sepharosem? CL6B, DEAE-Sepharose-'Fast Flow, QAE-Sephadex? RX Q-SepharosemFast Flow, Q-Sepharosem? 'High Performance, DEAE-Tris-Acryl, DEAE-SpherodexraX Q-yper-D (obtainable by Sepracor), DEAE-Toyopearlm? QAE-Toyopéarl "r, Fractogei" EMD-TMAE or other Fractogel material. Examples of hydrophobic chromatography materials are, for example, Sepharose ™ 1 'butyl, Sepharose "11" octyl, Sepharose1"1" phenyl, FractogelrarTSK-butyl, HIC support t-butyl or TSK-gel Butyl Toyopearlr. Biological material can be adsorbed on the carrier and purified directly from a complex mixture, at the inactivation stage other steps can precede it or happen to purify the material, in the framework of the present invention the chromatographic purification steps are preferred. Pathogens are inactivated according to the invention Pathogens are also understood to be fragments of, for example, viruses, especially the genome or fragment thereof. Pathogens can be lipid-coated pathogens, such as, for example, hepatitis B virus. or pathogens not coated in lipids, such as, for example, the hepatitis A virus. Procedures for the inactivation of virus are classified as nowadays as effective when after using the procedure in a sample of biological material that was mixed with a high dose of a test virue for example HIV, or the virue Sinbie as virue model for virue de hepatitie, can not be determined no virus in the sample and the viral concentration was thus reduced below the limit determined. The determination and quantification of the nucleic acids can be performed, for example, by means of a PCR method, such as that described in AT-PS 401 062, or by means of direct titration. As a measure of inactivation, the so-called reduction factor is known, which is calculated after the single addition of test viruses from the logarithmic decimal ratios of the initial and final concentration of the virus. From the European guidelines EC III / 8115/89-EN of the commission of European communities the so-called total reduction factor is known. It is calculated from the sum of the reduction factors of subsequent individual inactivation measures. Also another independent step for the inactivation or elimination of pathogens is preferably carried out. All the methods known in the state of the art to minimize the risk of infection are considered here.

In particular, filtering and / or thermal treatment is carried out as an additional step for inactivation or elimination. As filtering, preferably a nanofiitration is carried out, a preferred heat treatment is carried out in the solid biological material, for example in a lyophilisate with controlled water content, for example a water content between 5 and 8% and a temperature between 50 and 80 °. C, as described in EP-0 159 311. In a preferred embodiment, two-stage treatment with a detergent as a chemical agent is envisaged. For this, a detergent is used in a first step in an amount of at least 1%, preferably at least 5%, most preferably 10%. In a second stage, another detergent is used in an amount of at least 10%, preferably at least 12%, preferably by 14%. The detergent used can be the same for ambae stages, but different detergents can be used. In general, by means of the combination of steps for the inactivation of virue the risk of a viral infection can be strongly reduced or eliminated after administering the corresponding preparation. According to the present invention, there is also a chromatographically purified preparation containing a blood factor that can be activated autodynamically with an activated blood factor fraction of less than 50%, based on the content of the activated and non-activated blood factor, preferably less than 40. %, more preferably less than 30%, still more preferably less than 20%, still more preferably less than 10%, and preferably less than 1%, and a detergent content. contains prothrombin complex with a Vlla factor activity of less than 50% relative to the content of activated and non-activated factor VII, preferably less than 10%, more preferably less than% The detergent content of the preparation according to the invention it is in a pharmaceutically acceptable amount, preferably between 1% and the detergent limit of the detergent., Under the t An autodynamically reactive blood factor, according to the present invention, should be understood as a blood factor that is activatable autocatalytically, by means of surface contact, or by means of processes such as, for example, chromatographic processes. In particular, this type of blood factor is that selected from the group of factor VII, factor XII, factor XI and precalicrein. In another preferred embodiment, the preparation is free of serine protease inhibitors, such as thrombin inhibitors, or cofactors, such as heparin. In a special embodiment, the absence of these substances is already present during the chromatographic process. Therefore, the present invention also covers the corresponding preparations that are obtained with the process according to the invention. Other additives, for example substances with a stabilizing effect, such as amino acids, can also be present in the preparation according to the invention. By means of the following examples, the present invention should be detailed, without limiting it to them. Ejepplo 1 Treatment with FEIBA prothrombin complex detergent activated in the presence of T EENmr-80 15 mg of DEAE-Sephadexar A-50, Pharmacia signature, were incubated at room temperature with 1 ml of a solution of 30 g / l NaCl in water until they swelled. After the gel is separated by means of centrifugation of the swelling surface residue. Then, five washes of the gel followed with 1 ml of buffer (9 g / l Na2HP04.2H20, 7 g / 1 NaCl, pH 7.0) and another two washes with buffer (7 g / 1 citrate Na3.2H20, 7 g / 1 NaCl) also by means of resuspension and centrifugation. 30 ~ ml of freshly frozen human citrate plasma was thawed at 0 to + 4 ° C and the cryoprecipitate was separated by centrifugation at + 2 ° C. The resulting "surface crinoid" was incubated with DEAE-Sephadexrar washing, where FEIBA was generated and together with the factors of the prothrombin complex and the inert protein was adsorbed on the gel. Then the inert protein coadsorbed from the DEAE gel was washed by means of a buffer (9g / l Na2HP04.2H20, 7 g / i NaCl). "- The gel-protein complex moistened with the buffer was now suspended with 1.5 ml of a 150 mg / ml TWEEN ™ r-80 and 30 mg / ml NaCl solution for 1 hour at 26 ° C. a solution of greater ionic strength was used to deodorize the protein together with the factors of the prothrombin complex and the pathogens eventually present, then the suspeneion was diluted by adding 6.5 ml of water and readsorbing at room temperature for 1 hour, The protein factor was again readsorbed, while the conetitutivae parts of the inactivated pathogen remained in the solution together with the detergent.The gel / protein complex was then washed five times with each 1 ml of a solution of 7 g / l NaCl in water free of For the elution the gel was treated with 0.7 ml of a solution of 30 g / 1 NaCl in water "under agitation. The eluate was dialyzed against distilled water, freeze and freeze. "After the lyophilized reconstruction, the activity of FEIBA was determined according to AT-B 350 726. Preparations prepared from FEIBA were also used as controls, however without the treatment with detergent.

The analysis of the obtained preparation showed a specific activity of 3.2 U FEIBA / mg protein with a protein content of 16.6 g / l after reconstitution of the lyophilisate and was comparable with "the procedure variant without detergent treatment, where it was obtained a specific activity of 2.8U / mg protein with a protein concentration of 16.5 mg / ml EXAMPLE 2: Treatment with detergent at a desorption of FEIBA with a prolonged incubation time: Analogously to example 1, the complex fraction was adsorbed The protein fraction was kept in a state of desorption for more than 2 or 3 hours under the conditions of proton bina in DEAE-Sephadex, which was released by washing inert proteins and then desorbed with a TWEElsr'r-NaCl solution. The final product was then elaborated as described in example I. The analysis of these products showed a specific activity of 2.5 U FEIBA / mg protein co n a protein content of 16.6 mg / ml during 2 hour incubation in the presence of TWEENKE-80 and a specific activity of 2.3 U FEIBA / mg protein with a protein content of 17.4 mg / ml during 3 hour incubation with the Detergent . Thus, it could be shown that also at prolonged contact times with the detergent there is no associated 1 / essential inactivation of the active subenergy or a reduction in performance. EXAMPLE 3: Treatment with FEIBA detergent with readsorption in another gel. FEIBA was prepared as described in example i.

After the treatment and desorption with the detergent, the obtained solution was transferred to a vessel in which there was 15 mg of DEAE-SephadexpA50, Pharmacia Firm, which had been previously incubated in a solution of 30 g / 1 NaCl for its swelling and Subsequently, five washes with 1 ml of a buffer (9 g / l Na2HP04.2H20, 7 g / 1 NaCl, pH 7.0) and two other washes with a buffer (7 g / 1 citrate Na3.2H20, 7 g / 1 NaCl) also by means of resuspension and centrifugation. After adsorption for 1 hour of the diluted protein complex to remove the detergent, the procedure described in example 1 was carried out. The final product thus obtained had in comparison with FEIBA prepared according to a standard variant that is without the treatment with detergent, a yield of 95% and was comparable in? specific activity. EXAMPLE 4: Treatment with activated prothrombin complex detergent FEIBA in the presence of TWEENmr-80 at high temperature 15 mg of DEAE-SephadexmrA-50 Pharmacia Signature, were incubated for 15 minutes at room temperature with 1 ml of a solution of 30 g / 1 NaCl in water until it swelled.

The gel is then separated by centrifugation of the surface swelling residue. Then, five washes of the gel followed with (9g / l Na2HP04.2H20, 7 g / 1 NaCl, pH 7.0) and two other washes with a buffer (7 g / 1 citrate Na3.2H20, 7 g / 1 NaCl) also by means of re-centrifugation and centrifugation. 30 ml of freshly frozen human citrate plaster was thawed at 0 to + 4 ° C and the cryoprecipitate was separated by means of t. .3 * centrifugation at + 2 ° C. The "euperficial cryosidue" was incubated with washed DEAE-Sephadex, where FEIBA was generated and together with the factors of the prothrombin complex and the inert protein was adsorbed on the gel, then the inert coadsorbed gel protein was separated. DEAE by means of washing with a buffer (9 g / l Na2HP04.2H20, 7 g / 1 NaCl) The wet-buffered protein-gel complex was now euepended with 1.5 ml of a 1 mg / ml solution of TWEEN "11 -80 and 30 mg / ml NaCl for 1 hour at room temperature, whereby the protein fraction and impurities adsorbed were desorbed in a non-specific manner, and the gel was then filtered off. medium of the addition of more TWEE] Sr-80 was brought to a detergent concentration of 150 mg / ml and then it is incubated either for one hour at 26 ° C or for 1 hour at 40 ° C with stirring to inactivate the eventually present pathogens. It was then diluted by the addition of 6.5 ml of water and a freshly washed DEAE-Sephadex1 gel "A-50 prepared was re-oiled, then by means of five washes with sendoe 1 ml of a 7 g / 1 NaCl solution in The detergent was removed and work continued exclusively with the preparation as described in example 1. The analysis of both treatment variants at 26 ° C and 40 ° C showed a specific activity of the FEIBA preparation comparable with a standard version without inactivation The yields were in both cases 75% of the standard variant EXAMPLE 5: Treatment with prothrombin complex detergent in the presence of TWEENmr-80 (At the moment according to the applicant the best way to carry out the invention) 30 ml of freshly frozen human citrate plasma was thawed at 0 to + 4 ° C and the cryoprecipitate was separated by centrifugation at + 2 ° C. The resulting "surface crioresidus" was mixed with 2 IU heparin / ml Then the proteins of the prothrombin complex were adsorbed with DEAE-Sephadex ~ 'r A-50, Pharmacia firm, ~~ at a concentration of 0.5 mg / Ml. The protein gel complex was separated from the solution and washed with a buffer 1 (4 g / 1 citrate Na3.2H20, 7 g / 1 NaCl, 9 g / 1 Na2HP04.2H20, 500 IU heparin / 1, pH 7.5) and then with buffer 2 (4 g / 1 citrate Na3.2H20, 7 g / 1 NaCl, 500 IU Lheparin / 1, pH 7.5).

The washed gei was now suspended for inactivation of the pathogens with 1.5 ml of a solution containing 150 mg TWEEN ^ '- SO / ml and 30 mg of NaCl / ml, 1 hour at 26 °. By means of this treatment, the protein fraction was desorbed together with the pathogens or pathogenic fraction possibly presente and during the incubation with detergent the pathogens were inactivated. It was then diluted with 6 ml of water as described in example 1 and the protein fraction together with the active substance was reabsorbed in the ion exchange matrix for 1 hour at room temperature. It was then washed five times with a buffer (4 g / 1 citrate Na3, 7 g / 1 NaCl, 500 IU heparin / 1, pH 7.5) until the detergent was removed and eluted with a solution of lg / 1 of citrate Na3 -2H20, 20 g / 1 NaCl, 1000 IU heparin, pH 7.0. To the eluate I added '1 IU heparin / ml. The solution containing the prothrombin complex was desamortiguous with a buffer containing 4g / l citrate Na3.2H20, 0.8g / l NaCl, pH 7.0 and lyophilized. "In the reconstituted lyophilized prothrombin complex the protein content was tested and the prothrombin complex factor content, the results are given in Table 1. As a control, a product was prepared without treatment with TWEENmr -Resuited for analysis are also given in Table 1.

Table i Comparison of the activities of the prothrombin complex factors after carrying out the procedure according to the invention and without this procedure It was found that by means of 1 treatment with detergent there were no essential modifications of the composition of the prothrombin complex. EXAMPLE 6: Detergent treatment of factor VII with TWEENrar-80 in comparison with viral inactivation of factor VII according to a conventional procedure. From human citrate plamema, 'as described in example 5,' the fraction of prothrombin complex that contained the prothrombin coagulation factors small parts of factor VII, factor IX and factor X. The largest fraction of the coagulation factor VII that remained in the surface residue after adsorption on DEAE-Sephadexmr A50, was obtained in aluminum hydroxide by means of adsorption.

To this, 10 ml of a suspension of 2% aluminum hydrogel was added to the surface residue after the preparation of the prothrombin complex and stirred for 30 minutes at 4 ° C. Then the protein of aluminumium hydroxide-protein was separated by means of centrifugation at 5000 rpm for 10 minutes at approx. 4 ° C in a Sorvall RC3B rotor H6000A, the surface residue was discarded and the precipitate with 3.5% of the volume of the prothrombin complex surface residue used for the adsorption was suspended in a solution of 4g citrate Na3.2H20 / l, 7g NaCl / l pH 7.5 and stirred for 20 minutes. Thus, the inert protein of aluminum hydroxide was desorbed. The factor VII that remained in the aluminum hydroxide was returned pellets by means of re-centrifugation as described above. The top residue was discarded and the precipitate continued to be used. For the absorption of the protein fraction the aluminum hydroxide-factor VII complex was stirred for 30 minutes with 1% vol prothrombin complex using 0.3 mol / l phosphate buffer, pH 8.6 ^ (53.4 g Na2HP04.2H20 / 1 ee were adjusted with a solution of 41.1 g NaH2P04H20 / la at a pH of 8.6) containing 1% TWEEN ™ 1'-80. Then, for the inactivation of the pathogens, detergent was added to a final concentration of 15% TWEENp, r-80 and then stirred for 1 hour at 40 ° C. The solution was then cooled to approximately 22 ° C. and diluted with 9 parts of distilled water. The fraction of factor VII is readeorbed then in i g / 1 of DEAE-Sephadext'1 A 50, stirring for 1 hour at approx. 22 ° c. The gel-protein complex was then washed until the detergent was removed on an ion exchange funnel by means of triple washing with each 100 ml per liter of TWEEN ^ -dO solution used, diluted with a buffer containing 4 g of citrate Na3.2H20. / i, 7g NaCl / 1, pH 7.5 and containing 500 IU heparin / i. The elution of the factor VII fraction was performed by means of agitation of the ion exchange protein complex and 100 ml / l of TWEEN7"" - 80 solution of a solution containing 85 g NaCl / 1 for 30 minutes at 22 ° C. . In the eluate, the factor VII content was determined quantitatively with a factor VII chromogen test (Immunochrom FGaktoir VII; Cm IMMUNO AG, Vienna, measured against the international prothrombin complex standard), protein content according to the Bradford method [Anal. Biochem. 72: 248-254 (1976)] and the factor Vlla, according to the method of US 683,682 (measured against the international standard the Vlla factor). The results are shown in table 2. For comparison, factor VII was separated by means of adsorption on aluminum hydroxide and treated as described before other proteins of the prothrombin complex and in the adsorbed state according to EP No. 197. 554 with the virus inactivating agents of EP 0 131 740 with TWEEl \ Tr-80 and tri- (N-butyl) phosphate (TNBP). For this the alhydrogel-protein complex was shaken in an aqueous solution of 1% TWEE] XPr-80 and 0.3% trifoephate (N-butyl), for 18 hours at 4 ° C with a volume of 50 ml / 1 of the euperior redox of the prothrombin complex. Then centrifuged as described above for the separation of the aluminum hydroxide-protein complex and by means of washing with 3x 100 ml of a solution of 4g citrate Na3.2H20 / l, 7g NaCl / 1, pH 7.5, free from TWEEN? r'- -80 and excessive (N-butyl) triphosphate by resuspension.A pelletization of the aluminumium hydroxide-protein complex was performed by centrifugation between each wash. performed under the same conditions as in the parallel product according to the process according to the invention, analogously the analyzes of the final product were carried out, The results are given in table 2.

Table 2 Activities of the factor Vlla after carrying out the procedure according to the "invention and after carrying out the procedure according to EP 0 197 554.

It was shown that using this method the content of factor Vlla compared to the process according to the invention clearly increased, where in spite of the complex treatment of factor VÍI activation could not be determined. Furthermore, in the process according to the invention, the obtained product had a higher specific activity than in the comparative preparation.

EXAMPLE 7: Semi-quantitative determination of hepatitis G virus In the pathogen inactivation products of Examples 1 to 6, tests were carried out of the starting materials, of the superior reagent after cryoprecipitation or of the adsorption after separation of the samples. coagulation factors II, IX and X, ae as a purified coagulation preparation and corresponding concentrates. 0.5 ml of eeae samples were diluted 1 + 1 with fieiological buffer of common foefate-eai and eventually virue were present received pellets form by means of ultracentrifugation. The RNA was extracted from the viral pellets by means of the RNAzoi reagent method (Biotecx, Houston Texas), and dissolved in distilled water. The RT-PCR was performed on the nucleic acids of the hepatitis G virus (HGV) with the pair of primers NS5a 1 and NS5á 2 (Linnen, J. et al., Science 271; 505-508 (1996)). The sequence of the primer used (obtainable from Boehringer Mannheim, Germany) was for NS5a 1: 5 'CTCTTTGTGGTAGTAGCCGAGAGAT 3' and for BS5a 2; 5 'CGAATGAGTCAGAGGACGGGGTAT 3'. The primers were labeled with a fluorescent dye and the resulting fluorescent amplifications according to the PCR protocol according to a routine procedure were analyzed in an ABI 377.-Sequencer from Applied Biosyetems. In order to exclude the presence of RT-PCR inhibitors in the samples, the samples were inoculated with a 7NN imitator of hepatitis C virus and in a hepatitis C PCR carried out in accordance with EPO 714 988. Valioeoe were used for PCR HGV exclusively loe extracts that showed no inhibition in the HCV PCR. The intensity of the fluorescence was taken as a measure for the content of hepatitis B virus. It was shown that the starting materials used for the fractionation had, prior to the inactivation of pathogens according to the method of the invention, strong poeitivae signals, This is a high concentration of HGV nucleic acid amplifications, whereas in the eluates after the readsorption and separation of the previously inactivating viruses, no more HGV RNA was found. In parallel tests without performing a treatment with detergents, the eluates as the starting materials were positive in the HGV PCR. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (18)

1. CLAIMS Having described the invention as above, it is claimed as property contained in the following claims: l.- Procedure for the inactivation of pathogens, especially viruses, in a biological material, by incubation with a chemical agent, characterized in that the incubation is carried out in the presence of an eleutropic salt corresponding to a NaCl concentration of at least 200 mmol / 1, preferably at least 300 mmol / l.
2. 2. Method according to claim 1, characterized in that a detergent is used as a chemical agent, which is preferably contained in an amount of at least 1%, more preferably more than 5%, and most preferably more than 10%. %.
3. 3. Method according to claim 1 or 2, characterized in that sodium chloride is used as the eleutropic salt.
4. 4. - - Method according to one of claims 1 to 3, characterized in that the incubation is carried out for a period of time between 10 minutes and 10 hours, preferably between 1 and 5 hours.
5. 5. - Method according to one of claims 1 to 4, characterized in that plasma or a plasma fraction or the material of a cell culture is used as the biological material.
6. 6. - Method according to one of claims 5, characterized in that a biological material is used that contains a blood factor in eepeciai a protein dependent on vitamin K.
7. 7. - - Procedure according to one of claims ia 6, characterized because a biological material is used that is a fraction that contains a prothrombin complex.
8. 8. Method according to one of claims 1 to 7, characterized in that the biological material is adsorbed on a solid, purified carrier and the incubation is carried out after the elution of the purified material.
9. 9. Process according to claim 8, characterized in that the elusion and the incubation are carried out simultaneously.
10. 10. Process according to claim 8 or 9, characterized in that a chromatographic material is used as the solid carrier, especially a material suitable for ion exchange chromatography or for affinity chromatography.
11. 11. - Method according to one of claims 1 to 10, characterized in that other steps are carried out to purify the material, especially a chromatographic purification.
12. 12. - Process according to one of claims 1 to 11, characterized in that another step is carried out for the inactivation or elimination of pathogens, especially a filtration or a thermal treatment.
13. 13. Method according to one of claims 1 to 12, characterized in that a non-ionic detergent selected from the group of Tween and Triton is used as the chemical agent.
14. 14.- Chromatographically purified preparation, which contains a blood factor activatable autodynamically with a fraction of activated blood factor less than 50%, in relation to the content of the activated and unactivated blood factor, preferably less than 40%, more preferably less than 30% , still more preferably less than 20% and still more preferably less than 10%, and most preferably less than 1%, and a detergent content.
15. 15. Preparation according to claim 14, characterized in that the blood factor is selected from the group formed by factor VII, factor XII, factor XI and pre-kallikrein.
16. 16. "Preparation according to one of claims 14 or 15, characterized in that it contains a prothrombin complex with a factor Vlla activity of less than 50%, in relation to the content of activated and non-activated factor VII, preferably less than 10%, more preferably less than 1%.
17. 17. - Preparation according to one of claims 14 to 15, characterized in that the preparation is free of serine protease inhibitors or their cofactors.
18. 18. Preparation according to one of claims 14 to 17, characterized in that it is obtainable by means of a process according to claims i to 13.