SK130598A3 - Nucleic acid and amino acid sequences relating to helicobacter pylori and vaccine compositions thereof - Google Patents

Abstract

Recombinant or substantially pure preparations of H. pylori polypeptides are described. The nucleic acids encoding the polypeptides also are described. The H. pylori polypeptides are useful in diagnostic and vaccine compositions.

Description

Nucleic acid and amino acid sequences related to Helicobacter pylori and vaccine compositions thereof.

BACKGROUND OF THE INVENTION

Helicobacter pylori is a gram-negative, microaerophilic, S-shaped bacterium that has been isolated and cultured from a human stomach biopsy (Warren, JR and B. Marshall, (1983) Lancet 1: 1273-1275; and Marshall et al., (1984) , Microbios Lett. 25: 83-88). The pylori bacterium is closely associated with chronic gastric inflammation and duodenal ulcer disease (Rathbone et al., (1986) Gut 27: 635-641). However, there is evidence that H. pylori has an important role in the etiology of non-ulcer digestive disorders, gastric ulcer disease and gastric adenocarcinoma (Blaser M. J., (1993) Trends Microbiol. 1: 255-260). Bacterial transmission occurs via the oral route and the risk of infection increases with age (Taylor, D. N. and M. J. Blaser, (1991) Epidemiol. Rev 13: 42-50). The bacterium //, pylori, colonizes the mucosa of the human stomach, producing a disease that usually lasts for decades. H. pylori infection is found worldwide. While in developed countries the prevalence of infection in the adult population is over 50%, in developing countries the prevalence of infection in adults over 20 years is 90% (Hopkins RJ and JG Morris (1994) Am. J. Med. 97: 265 - 277).

The factors necessary for colonization of the stomach environment and for virulence are not fully known. Examples of putative virulence factors include: urease, an enzyme that may be involved in neutralizing the pH of gastric acids (Eaton et al., (1991) Infect. Immunol. 59: 2470-2475; Ferrero, RL and A. Lee (1991)) (Microb.Ecol., Hlth. Dis. 4: 121 134; Labigne et al., (1991) J. Bacteriol. 173: 1920-1931); bacterial flager proteins that are responsible for mucosal layer mobility (Hazell et al., (1986) J. Inf. Dis. 153: 658-63; Leying et al., (1992) Mol. Microbiol. 6: 2863-2874; and Haas et al., (1993) Mol. Microbiol. 8: 753-760); Vac A, a bacterial toxin that induces intracellular vacuole formation in epithelial cells (Schmitt, W. and R. Haas, (1994) Molecular Microbiol. 12 (2): 307-319); and several gastric tissue-specific adhesins (Boren et al., (1993) Science 262: 1892 1895; Evans et al., (1993) J. Bacteriol. 175: 674-683; and Falk et al., (1993) Proc. Natl Acad Sci USA 90: 2035-203).

There are a number of therapeutic agents for the in vitro infections caused by H. pylori (Huesca et al., (1993) Zbi. Bakt. 280: 244-252; Hopkins, RJ and JG Morris, (1994) Am. J. Med., 97: 265-277). Some of these agents are not suboptimally effective in vivo because of the resistance of bacteria, the distribution of drugs, the drug inadequate or unavailable to patients (Hopkins, RJ and JG Morris, (1994) Am. J. Med. 97: 265 - 277). Part of the standard procedure used to treat H. pylori infection is antibiotic treatment that is combined with bismuth (Malfertheiner, P. and J. E. Dominguez-Munoz (1993) Clinical Therapeutics 15 Supp. B 37-48). A combination of proton pump inhibitors and a simple antibiotic has been shown to be effective in suppressing diseases of duodenal ulcers (Malfertheiner, P. and J.E. Dominguez-Munoz, (1993) Clinical Therapeutics 15 Supp. B 37-48). For methods that use antibiotics, efficacy problems may arise in strains that are resistant to these agents (Hopkins, R.J. and J.G. Morris, (1994) Am. J. Med. 97: 265-277). These limitations indicate the need to develop new, more effective methods for controlling in vivo infections caused by H. pylori. In particular, it is necessary to prepare new vaccines which can prevent the development of an infection caused by these bacteria.

SUMMARY OF THE INVENTION

The present invention describes novel genes, e.g. genes encoding polypeptides, such as bacterial surface proteins derived from Helicobacter pyroli (H. pyroli), and other related genes, their products and uses thereof. The nucleic acids and peptides of the invention are used in the diagnosis and therapy of H. pyroli and other Helicobacter species. They can also be used in detecting the presence of H. pyroli and other Helicobacter species in a sample, as well as testing the ability of compounds to interfere with the H. pyroli life cycle or to inhibit infection caused by H. pyroli. The present invention describes nucleic acid compositions that correspond to all of the coding sequences of H. pyroli proteins that include surface and secreted proteins, or portions thereof, and to nucleic acids capable of binding to mRNA from H. pyroli proteins to block protein translation and methods. production of H. pyrrole proteins or portions thereof using peptide synthesis and recombinant DNA methods. The invention also discloses antibodies and nucleic acids that are used as probes to detect H. pyroli infection. In addition, the invention discloses vaccine compositions and methods of protecting against H. pyroli infection.

The invention provides a recombinant or substantially pure preparation of an H. pylori polypeptide having the sequence of SEQ ID NO: 496. The invention further comprises a substantially pure nucleic acid that encodes an H. pylori polypeptide having SEQ ID NO: 496, such nucleic acid being comprised in SEQ ID NO: 5. The H. pylori polypeptide sequences described herein are included in the sequence listing and nucleic acids that encode H. pylori polypeptides.

The invention further provides a recombinant and substantially pure preparation of an H. pylori polypeptide selected from the group consisting of SEQ ID NO: 496, SEQ ID NO: 501, SEQ ID NO: 514, SEQ ID NO: 547, SEQ ID NO: 550, SEQ. ID NO: 553, SEQ ID NO: 564, SEQ ID NO

NO: 568, SEQ ID NO: 586, SEQ ID NO: 588, SEQ ID NO. 598, SEQ ID NO. 602, SEQ ID NO

NO: 606, SEQ ID NO: 614, SEQ ID NO: 621, SEQ ID NO: 632, SEQ ID NO: 636, SEQ ID NO.

NO: 652, SEQ ID NO: 654, SEQ ID NO: 655, SEQ ID NO: 660, SEQ ID NO: 664, SEQ ID NO.

NO: 670, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 679, SEQ ID NO.

NO: 683, SEQ ID NO: 690, SEQ ID NO: 701, SEQ ID NO: 704, SEQ ID NO: 706, SEQ ID NO

NO: 707, SEQ ID NO: 708, SEQ ID NO: 709, SEQ ID NO: 711, SEQ ID NO: 712, SEQ ID NO.

NO: 713, SEQ ID NO: 714, SEQ ID NO: 715, SEQ ID NO: 716, SEQ ID NO: 729, SEQ ID NO.

NO: 742, SEQ ID NO. 745, SEQ ID NO: 746, SEQ ID NO. 754, SEQ ID NO: 758, SEQ ID NO

NO: 773, SEQ ID NO: 776, SEQ ID NO: 777, SEQ ID NO: 802, SEQ ID NO: 809, SEQ ID NO.

NO: 810, SEQ ID NO: 816, SEQ ID NO: 817, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO

NO: 821, SEQ ID NO: 822, SEQ ID NO: 842, SEQ ID NO: 843, SEQ ID NO: 844, SEQ ID NO

NO: 855, SEQ ID NO: 865, SEQ ID NO: 880, SEQ ID NO: 890, SEQ ID NO: 903, SEQ ID NO.

NO: 913, SEQ ID NO: 916, SEQ ID NO: 924, SEQ ID NO: 928, SEQ ID NO: 929, SEQ ED

NO: 938, SEQ ID NO: 939, SEQ ID NO: 940, SEQ ID NO: 942, SEQ ID NO: 943, SEQ ED

NO: 945, SEQ ID NO: 946, SEQ ID NO: 956, SEQ ID NO: 958, SEQ ID NO: 960, SEQ ID NO.

NO: 1038, SEQ ID NO: 1043, SEQ ID NO: 1049, SEQ ID NO: 1050, SEQ ID NO: 1052, SEQ ID NO: 1053, SEQ ID NO. 1063, SEQ ID NO. 1077, SEQ ID NO. 1081, SEQ ID NO. 1083, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 1297 and SEQ ID NO: 1298. The invention also provides a substantially pure nucleic acid that encodes a H. pylori polypeptide selected from the group consisting of H. polypeptide polypeptides. pylori having the sequences of SEQ ID NO: 496, SEQ

SEQ ID NO: 501, SEQ ID NO: 514, SEQ ID NO: 547, SEQ ID NO: 550, SEQ ID NO: 553, SEQ ID NO.

NO: 564, SEQ ID NO: 568, SEQ ID NO: 586, SEQ ID NO: 588, SEQ ID NO: 598, SEQ ID NO

NO: 602, SEQ ID NO: 606, SEQ ID NO: 614, SEQ ID NO: 621, SEQ ID NO: 632, SEQ ID NO

NO: 636, SEQ ID NO: 652, SEQ ID NO: 654, SEQ ID NO: 655, SEQ ID NO: 660, SEQ ID NO.

NO: 664, SEQ ID NO: 670, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO.

NO: 679, SEQ ID NO: 683, SEQ ID NO: 690, SEQ ID NO: 701, SEQ ID NO: 704, SEQ ID NO.

NO: 706, SEQ ID NO: 707, SEQ ID NO: 708, SEQ ID NO: 709, SEQ ID NO: 711, SEQ ID NO.

NO: 712, SEQ ID NO: 713, SEQ ID NO: 714, SEQ ID NO: 715, SEQ ID NO: 716, SEQ ID NO.

NO. 729, SEQ ID NO: 742, SEQ ID NO: 745, SEQ ID NO: 746, SEQ ID NO: 754, SEQ ID NO.

NO: 758, SEQ ID NO: 773, SEQ ID NO: 776, SEQ ID NO: 777, SEQ ID NO: 802, SEQ ID NO.

NO: 809, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 817, SEQ ID NO: 818, SEQ ID NO.

NO: 820, SEQ ID NO: 821, SEQ ID NO: 822, SEQ ID NO: 842, SEQ ID NO: 843, SEQ ID NO.

NO: 844, SEQ ID NO: 855, SEQ ID NO: 865, SEQ ID NO: 880, SEQ ID NO. 890, SEQ ID NO

NO: 903, SEQ ID NO: 913, SEQ ID NO: 916, SEQ ID NO: 924, SEQ ID NO: 928, SEQ ID NO.

NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 940, SEQ ID NO: 942, SEQ DD

NO: 943, SEQ ID NO: 945, SEQ ID NO: 946, SEQ ID NO: 956, SEQ ID NO: 958, SEQ ID NO.

NO: 960, SEQ ID NO: 1038, SEQ ID NO: 1043, SEQ ID NO: 1049, SEQ ID NO: 1050, SEQ ID NO: 1052, SEQ ID NO: 1053, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1081, SEQ ID NO: 1083, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 1297 and SEQ ID NO:

1298, such nucleic acid is comprised in SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 23, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 73 SEQ ID NO:

77, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 123, SEQ ID NO: 130, SEQ ID NO:

SEQ ID NO. 163, SEQ ID NO: 164;

SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO:

SEQ ID NO: 199, SEQ ID NO: 210, SEQ ID NO:

SEQ ID NO: 217, SEQ ID NO: 218, SEQ ID NO:

SEQ ID NO: 223, SEQ ID NO: 224, SEQ ID NO.

SEQ ID NO: 254, SEQ ID NO: 255, SEQ ID NO:

SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO:

SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO:

SEQ ID NO: 331, SEQ ID NO: 351, and SEQ ID NO:

107, SEQ ID NO: 111, SEQ ID NO: 115,

141, SEQ ID NO: 145, SEQ ID NO: 161, 169, SEQ ID NO: 173, SEQ ID NO: 179, 187, SEQ ID NO: 188, SEQ ID NO: 192, 213, SEQ ID NO: 215, SEQ ID NO: 216, 220, SEQ ID NO: 221, SEQ ID NO: 222, 225, SEQ ID NO: 238, SEQ ID NO. 251, 263, SEQ ID NO: 267, SEQ ID NO: 282, 311, SEQ ID NO: 318, SEQ ID NO. 319, 327, SEQ ID NO: 329, SEQ ID NO: 330, 352, SEQ ID NO: 353, SEQ ID NO: 364,

SEQ ID NO: 374, SEQ ID NO: 389, SEQ ID NO: 399, SEQ ID NO: 412, SEQ ID NO: 422,

SEQ ID NO: 425, SEQ ID NO: 433, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447,

SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 451, SEQ ID NO: 452, SEQ ID NO: 454,

SEQ ID NO: 455, SEQ ID NO: 465, SEQ ID NO: 467, SEQ ID NO: 469, SEQ ID NO: 984,

SEQ ID NO: 989, SEQ ID NO: 995, SEQ ID NO: 996, SEQ ID NO: 998, SEQ ID NO: 999,

SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO. 1027, SEQ ID NO: 1029, SEQ ID NO: 1031, SEQ ID NO: 1032, SEQ ID NO: 1294, and SEQ ID NO: 1295.

Further, the invention provides a recombinant and substantially pure preparation of an H. pylori polypeptide selected from the group consisting of H. pylori polypeptides set forth in the Sequence Listing. The invention includes a substantially pure nucleic acid encoding an H. pylori polypeptide selected from the group consisting of H. pylori polypeptides set forth in the Sequence Listing. It is to be understood that the invention emphasizes any H. pylori polypeptide and nucleic acids encoding such a polypeptide that is listed in the Sequence Listing under a given sequence identification number. For example, a representative H. pylori polypeptide is contained in SEQ ID NO: 496. Therefore, the present invention emphasizes a recombinant or substantially pure preparation of H. pylori polypeptide having the sequence of SEQ ID NO: 496. Such invention also encompasses substantially pure nucleic acid an acid that encodes a H. pylori polypeptide of SEQ ID NO: 496.

The invention also relates to any single member of the polypeptides or nucleic acid that encodes such a member from the group of the above H. pylori polypeptides or nucleic acids, as well as any subgroups from the various groups mentioned above. The subgroups may further preferably comprise 1, 3, 5, 10, 15, 20, 30, or 40 members of any of the above groups, as well as any combination thereof.

Particularly preferred is an isolated nucleic acid comprising a nucleotide sequence that encodes a H. pylori cell coat polypeptide or fragment thereof. Such nucleic acid was selected from the group consisting of SEQ ID NO: 255, SEQ ID NO: 263, SEQ ID NO: 285, SEQ ID NO: 311, SEQ ID NO: 327, SEQ ID NO: 329, SEQ ID NO: 331, SEQ ID NO:

353, SEQ ID NO: 255, SEQ ID NO: 255, SEQ ID NO: 255, SEQ ID NO: 255, SEQ ID NO:

364, SEQ ID NO: 412, SEQ ID NO: 433, SEQ ID NO: 449, SEQ ID NO: 452, SEQ ID NO:

469, SEQ ID NO. 989, SEQ ID NO: 1029, SEQ ID NO: 1032, SEQ ID NO: 286, SEQ ID NO:

326, SEQ ID NO: 374, SEQ ID NO: 399, SEQ ID NO. 422, SEQ ID NO. 454, SEQ ID NO.

465, SEQ ID NO: 998, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO: 1294, SEQ ID NO.

NO: 1295, SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 425, SEQ ID NO: 437, SEQ.

SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 467, SEQ ID NO: 996, SEQ ID NO.

NO: 1027, SEQ ID NO: 1031, SEQ ID NO: 254, SEQ ID NO: 352 and SEQ ID NO: 389.

In another embodiment, the H. pylori cell coat protein or fragment thereof is an H. pylori outer membrane polypeptide or fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 255, SEQ ID NO: 263, SEQ ID NO: 285, SEQ ID NO: 311, SEQ ID NO: 327, SEQ ID NO: 329, SEQ ID NO: 331, SEQ ID NO. 353, SEQ ID NO: 364, SEQ ID NO: 412, SEQ ID NO. 433, SEQ ID NO. 449, SEQ ID NO: 452, SEQ ID NO: 469, SEQ ID NO: 989, SEQ ID NO: 1029, SEQ ID NO: 1032, SEQ ID NO: 286, SEQ ID NO: 326, SEQ ID NO: 374, SEQ ID NO: 399, SEQ ID NO: 422, SEQ ID NO: 454, SEQ ID NO: 465, SEQ ID NO: 998, SEQ ID NO: 1009, SEQ ID NO. 1023, SEQ ID NO: 1294, SEQ ID NO: 1295, SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 425, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 467, SEQ ID NO: 996, SEQ ID NO: 1027, SEQ ID NO: 1031, SEQ ID NO: 254, SEQ ID NO: 352 and SEQ ID NO: 389.

In another embodiment, the H. pylori cell envelope polypeptide or fragment thereof is an H. pylori outer membrane polypeptide or fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 255, SEQ ID NO: 263, SEQ ID NO: 285, SEQ ID NO: 311, SEQ ID NO: 327, SEQ ID NO: 329, SEQ ID NO: 331, SEQ ID NO: 353, SEQ ID NO: 364, SEQ ID NO: 412, SEQ ID NO: 433, SEQ ID NO. NO: 449, SEQ ID NO: 452, SEQ ID NO: 469, SEQ ID NO: 989, SEQ ID NO: 1029, SEQ ID NO: 1032, SEQ ID NO: 286, SEQ ID NO: 326, SEQ ID NO: 374, SEQ ID NO: 399, SEQ ID NO: 422, SEQ ID NO: 454, SEQ ID NO: 465, SEQ ID NO: 998, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO: 1294, SEQ ID NO: 1295, SEQ ID NO: 319, SEQ ID NO. 325, SEQ ID NO: 425, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 467, SEQ ID NO. 996, SEQ ID NO: 1027, SEQ ID NO: 1031, SEQ ID NO: 254, SEQ ID NO: 352 and SEQ ID NO: 389.

In another embodiment, the outer membrane polypeptide of H. pylori or a fragment thereof is H. pylori polypeptide or fragment thereof having a terminal phenylalanine residue encoded by a nucleic acid selected from the group consisting of SEQ ID NO:

255, SEQ ID NO: 263, SEQ ID NO: 285, SEQ ID NO: 311, SEQ ID NO: 327, SEQ ID NO:

329, SEQ ID NO: 331, SEQ ID NO: 353, SEQ ID NO: 364, SEQ ID NO: 412, SEQ ID NO:

433, SEQ ID NO: 449, SEQ ID NO: 452, SEQ ID NO: 469, SEQ ID NO: 989, SEQ ID NO:

1029 and SEQ ID NO: 1032.

In another embodiment, the outer membrane polypeptide of H. pylori or a fragment thereof is H. pylori polypeptide having a C-terminal tyrosine cluster or fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 286, SEQ ID NO: 326, SEQ ID NO: 374, SEQ ID NO: 399, SEQ ID NO: 422, SEQ ID NO. 454, SEQ ID NO: 465, SEQ ID NO. 998, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO: 1294, and SEQ ID NO: 1295.

In another embodiment, the outer membrane polypeptide of H. pylori or a fragment thereof is H. pylori polypeptide or fragment thereof having a terminal phenylalanine residue and having a C-terminus having a tyrosine cluster encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 319 SEQ ID NO: 325, SEQ ID NO: 425, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 467, SEQ ID NO: 996, SEQ. SEQ ID NO: 1027 and SEQ ID NO: 1031.

Particularly preferred is an isolated nucleic acid comprising a nucleotide sequence encoding a H. pylori cytoplasm polypeptide or fragment thereof. Such nucleic acid was selected from the group consisting of SEQ ID NO: 455, SEQ ID NO: 351, SEQ ID NO: 318, SEQ ID NO. 330 and SEQ ID NO: 995.

In another embodiment, the H. pylori cytoplasm polypeptide or fragment thereof is an H. pylori polypeptide or fragment thereof that is involved in cofactor metabolism and is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 455.

In another embodiment, the H. pylori cytoplasm polypeptide or fragment thereof is an H. pylori polypeptide or fragment thereof that is involved in lipid metabolism and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 351.

Particularly preferred is an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide or fragment thereof that secretes H. pylori. Said nucleic acid comprises the nucleotide sequence of SEQ ID NO: 451.

Particularly preferred is an isolated nucleic acid comprising a nucleotide sequence encoding a H. pylori cell polypeptide or fragment thereof. Said nucleic acid is selected from the group consisting of SEQ ID NO: 267, SEQ ID NO: 282 and SEQ ID NO: 984.

Particularly preferred is a purified or isolated H. pylori cell envelope polypeptide or fragment thereof, wherein the polypeptide is selected from the group consisting of SEQ ID NO. 746, SEQ ID NO. 754, SEQ ID NO. 776, SEQ ID NO. 802, SEQ ID NO. 818, SEQ ID NO

NO: 820, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 903, SEQ ID NO: 924, SEQ ID NO.

NO: 940, SEQ ID NO: 943, SEQ ID NO: 960, SEQ ID NO: 1043, SEQ ID NO: 1083, SEQ ID NO.

NO: 777, SEQ ID NO: 817, SEQ ID NO: 865, SEQ ID NO: 890, SEQ ID NO: 913, SEQ ID NO.

NO: 945, SEQ ID NO: 956, SEQ ID NO: 1052, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO. 1297, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 916, SEQ ID NO: 928, SEQ ID NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 958, SEQ ID NO: 1050, SEQ ID NO: 1081, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 745, SEQ ID NO: 843, SEQ ED NO: 880 and SEQ ED NO: 909.

In another embodiment, the H. pylori cell envelope polypeptide or fragment thereof is an H. pylori outer membrane polypeptide or fragment thereof selected from the group consisting of SEQ ID NO. 746, SEQ ID NO: 754, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 903, SEQ ID NO: 924, SEQ ID NO: 940, SEQ ID NO: 943, SEQ ID NO: 960, SEQ ID NO. 1043, SEQ ID NO. 1083, SEQ ID NO. 777, SEQ ID NO. 817, SEQ ID NO. 865, SEQ ID NO: 890, SEQ ID NO: 913, SEQ ID NO: 945, SEQ ID NO: 956, SEQ ID NO: 1052, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1297, SEQ ID NO: 1298, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 916, SEQ ID NO: 928, SEQ ID NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO. NO: 958, SEQ ID NO: 1050, SEQ ID NO: 1081, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 745, SEQ ID NO: 843 and SEQ ID NO: 880.

In another embodiment, the H. pylori outer membrane polypeptide or fragment thereof is an H. pylori polypeptide or fragment thereof having a terminal phenylalanine residue encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 746, SEQ ID NO: 754, SEQ ID NO. NO: 776, SEQ ID NO: 802, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 903, SEQ ID NO: 924, SEQ ID NO:

940, SEQ ID NO: 943, SEQ ID NO: 960, SEQ ID NO: 1043, SEQ ID NO: 1083, and SEQ ID NO: 1086.

In another embodiment, the H. pylori outer membrane polypeptide or fragment thereof is H. pylori polypeptide or fragment thereof having a C-terminal tyrosine cluster selected from the group consisting of SEQ ID NO: 777, SEQ ID NO: 817, SEQ DD NO: 865, SEQ ID NO: 890, SEQ ID NO: 913, SEQ ID NO: 945, SEQ ID NO: 956, SEQ ID NO: 1052, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1297 and SEQ ID NO: 1298.

In another embodiment, the outer membrane polypeptide of H. pylori or a fragment thereof is an H. pylori polypeptide or fragment thereof having a terminal phenylalanine residue and having a C-terminus having a tyrosine cluster selected from the group consisting of SEQ ID NO: 810, SEQ DD NO SEQ ID NO: 916, SEQ ID NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 958, SEQ ID NO: 1050, SEQ ID NO: 1081 and SEQ DDNO: 1085.

Particularly preferred is a purified or isolated H. pylori cytoplasm polypeptide or fragment thereof. Said polypeptide is selected from the group consisting of SEQ ID NO: 946, SEQ ID NO: 842, SEQ ID NO: 809, SEQ ID NO: 821 and SEQ ID NO: 1049.

In another embodiment, the H. pylori cytoplasm polypeptide or fragment thereof is an H. pylori polypeptide or fragment thereof that is involved in cofactor metabolism and comprises the amino acid sequence of SEQ ID NO: 946.

In another embodiment of the invention, the H. pylori cytoplasm polypeptide or fragment thereof is an H. pylori polypeptide or fragment thereof that is involved in lipid metabolism and comprises the amino acid sequence of SEQ ID NO: 842.

Particularly preferred is a purified or isolated polypeptide secreted by H. pylori or a fragment thereof, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 942.

Particularly preferred is a purified or isolated H. pylori cell polypeptide or fragment thereof, wherein the polypeptide is selected from the group consisting of SEQ ID NO: 758, SEQ ID NO: 773, SEQ ID NO: 808, and SEQ ID NO: 1038.

The invention relates to any single H. pylori polypeptide representative or to a nucleic acid encoding such a representative of the above H. pylori polypeptide groups.

The invention provides nucleic acids capable of binding to H. pylori mRNA. Such a nucleic acid is capable of acting as an antisense nucleic acid and controls the translation of H. pylori mRNA. Further, the invention provides a nucleic acid that is capable of specifically binding to a H. pylori nucleic acid. These nucleic acids are referred to herein as complements and are used as probes and as capture agents.

The invention describes an expression system comprising an open reading frame corresponding to a H. pylori nucleic acid. The nucleic acid further comprises a control sequence compatible with a particular host. The expression system can be used to prepare polypeptides that correspond to H. pylori nucleic acid.

The invention describes a cell transformed with an expression system to produce H. pylori polypeptides.

The invention provides a method for preparing antibodies against H. pylori polypeptides that are capable of specifically binding H. pylori polypeptides. Such an antibody can be used as an agent in immunoassays to evaluate the relative representation and distribution of antigens that are specific for H. pylori.

The invention further provides a method of preparing vaccines for immunizing individuals against H. pylori. The method comprises immunizing a subject with a H. pylori polypeptide, e.g. a surface or secreted polypeptide, or an active portion thereof, and a pharmaceutically acceptable carrier. Such vaccines have therapeutic and prophylactic uses.

The invention provides a method of preparing a vaccine comprising a modified immunogenic H. pylori polypeptide, e.g. a surface and secreted polypeptide, or an active portion thereof, and a pharmaceutically acceptable carrier.

The invention further includes a method for assessing the ability of compounds, e.g. a polypeptide, e.g. a fragment of a host cell polypeptide, binding to a H. pylori polypeptide. In this method, the candidate compound contacts the H. pylori polypeptide and determines whether the compound binds or otherwise interacts with the H. pylori polypeptide. [0006] Compounds of value that bind to H. pylori can be used as activators or inhibitors of the life cycle of bacteria. This test is performed in vitro or in vivo.

The invention further provides a method for assessing the ability of a compound, e.g. a polypeptide, e.g. a fragment of a host cell polypeptide, binding to a H. pylori nucleic acid, e.g. DNA or RNA. In this method, the compound is contacted with the H. pylori nucleic acid and determined whether the compound binds or otherwise interacts with the H. pylori polypeptide. Compounds that bind to H. pylori can be used as activators or inhibitors of the life cycle of bacteria. This test is performed in vitro or in vivo.

The invention preferably discloses H. pylori polypeptides, preferably describes a substantially pure preparation of H. pylori polypeptide or recombinant H. pylori polypeptide. In preferred embodiments, the polypeptide has biological activity; the polypeptide has an amino acid sequence at least 60%, 70%, 80%, 90%, 95%, or 99% homologous to the amino acid sequence that is included in the sequence protocol; The polypeptide has an amino acid sequence that is substantially the same as the amino acid sequence set forth in the Sequence Listing; the polypeptide has at least 5, 10, 20, 50, 100, or 150 amino acid residues; the polypeptide comprises at least 5, preferably at least 10, preferably 20, more preferably at least 50, 100 or 150 contiguous amino acid residues of the polypeptide that is included in the sequence protocol.

In preferred embodiments, the H. pylori polypeptide is encoded by a nucleic acid that is indicated in the sequence protocol or by a nucleic acid that exhibits at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology to the nucleic acid. listed in the Sequence Protocol.

In a preferred embodiment of the invention, the amino acid sequence of the H. pylori polypeptide differs in 1, 2, 3, 5, 10 or more residues from the sequence shown in the Sequence Listing. However, the differences are that the H. pylori polypeptide exhibits biological activity, e.g. the H. pylori polypeptide retains the biological activity of the naturally occurring H. pylori enzyme.

In preferred embodiments, the polypeptide comprises all or a fragment of an amino acid sequence as set forth in the Sequence Listing; this sequence is fused to a reading frame with additional amino acid residues, preferably residues encoded by genomic DNA 5 'to genomic DNA that encodes the sequence set forth in the sequence protocol.

In further preferred embodiments of the invention, the H. pylori polypeptide is a recombinant fusion protein consisting of a first portion of an H. pylori polypeptide and a second portion of a polypeptide, e.g. the second portion of the polypeptide has an amino acid sequence that does not relate to H. pylori. The second portion of the polypeptide may be e.g. any glutathione S-transferase, DNA binding region, or polymerase activating region. In a preferred embodiment, the fusion protein can be used in a two-hybrid assay.

Polypeptides of the invention include those polypeptides that arise as a result of alternative transcription, alternative RNA splicing, and alternative translation and post-translational modifications.

The invention provides an immunogenic component comprising a H. pylori polypeptide that is used in an immunogenic composition; the immunogenic component is capable of eliciting an immune response that is specific for an H. pylori polypeptide, e.g. a humoral response, an antibody response, or a cellular response. In preferred embodiments of the invention, the immunogenic components comprise at least one antigenic determinant found in a polypeptide of the Sequence Listing.

The invention further provides a substantially pure nucleic acid having a nucleotide sequence that encodes a H. pylori polypeptide. In preferred embodiments, the encoded polypeptide has biological activity; the encoded polypeptide has an amino acid sequence of at least 60%, 70%, 80%, 90%, 95% 98, or 99% homologous to the amino acid sequence set forth in the sequence protocol; the encoded polypeptide has an amino acid sequence substantially the same as the amino acid sequence in the sequence protocol; the encoded polypeptide is at least 5, 10, 20, 50, 100, or 150 amino acids in length; the encoded polypeptide comprises at least 5, preferably 10, preferably 20, most preferably 50, 100 or 150 contiguous amino acids, which are listed in the sequence protocol.

In preferred embodiments of the invention, the preferred nucleic acid is that set forth in the Sequence Listing. In a preferred embodiment, the encoded H. pylori polypeptide differs (e.g., by amino acid substitution, addition or deletion of at least one amino acid residue) from the sequence indicated in the sequence protocol in the amino acid sequence of 1, 2, 3, 5, 10, or more residues. However, the differences are that the encoded H. pylori polypeptide exhibits the biological activity of H. pylori, e.g. encoded by the enzyme H. pylori retains the biological activity of the naturally occurring H. pylori.

In preferred embodiments, the encoded polypeptide comprises the entire amino acid sequence or fragment thereof that is indicated in the sequence protocol; this sequence is fused to a reading frame with additional amino acid residues, preferably residues encoded by genomic DNA 5 'to genomic DNA that encodes the sequence set forth in the sequence protocol.

In preferred embodiments, the H. pylori nucleic acid will comprise a transcriptional regulatory sequence, e.g. at least one transcriptional promoter or transcriptional enhancement frequency operably linked to a H. pylori gene sequence, e.g. to produce a H. pylori gene sequence that is suitable for expression in a recombinant host cell.

In another preferred embodiment, the nucleic acid that encodes the H. pylori polypeptide of the invention hybridizes under high stringency conditions to a nucleic acid probe that corresponds to at least 8 consecutive nucleic acid nucleotides as listed in the Sequence Listing; preferably, it corresponds to at least 12 consecutive nucleotides of the nucleic acid contained in the sequence protocol; preferably corresponds to 20 consecutive nucleic acid nucleotides contained in the sequence protocol; more preferably it corresponds to at least 40 consecutive nucleotides of the nucleic acid contained in the sequence protocol.

In a preferred embodiment, the nucleic acid encodes a peptide that differs from the sequences set forth in the sequence protocol by at least one amino acid residue.

In a preferred embodiment, the nucleic acid differs from the nucleotide sequence set forth in the Sequence Listing that encodes the amino acid sequences set forth in the Sequence Listing by at least one nucleotide.

In another embodiment, the invention highlights a vector comprising a nucleic acid that encodes a H. pylori polypeptide described herein or a variant thereof; vector-transfected host cell; and a method for producing a recombinant H. pylori polypeptide or a variant thereof. The method comprises culturing a cell, e.g. in a culture cell medium and isolating H. pylori or a variant of H. pylori polypeptide e.g. from a cell or cell culture medium.

The invention further provides a purified recombinant nucleic acid that exhibits at least 50%, 60%, 70%, 80% 90%, 95%, 98% or 99% homology to the sequence set forth in the Sequence Listing.

The invention further provides a probe or primer that comprises a substantially pure oligonucleotide. The oligonucleotide comprises a region of a nucleotide sequence that hybridizes under stringent conditions to at least 10 consecutive nucleotides of the sense or antisense molecule listed in the Sequence Listing, or naturally occurring mutants thereof. In preferred embodiments of the invention, the probe or primer further comprises a labeling moiety attached thereto. The labeled group may be e.g. a radioisotope, a fluorescent compound, an enzyme, and / or an enzyme cofactor. Preferably, the oligonucleotide comprises at least 10 and less than 20, 30, 50, 100, or 150 nucleotides.

The invention further provides nucleotide acids, e.g. RNA or DNA encoding a polypeptide of the invention. Said acids include double strands as well as coding and antisense single chains.

The H. pylori strain whose genomic sequences were sequenced was deposited with the American Type Culture Collection (ATCC) as an HP-J99 strain.

The invention includes allelic variants; natural mutants; induced mutants; DNA-encoded proteins that hybridize under high or low stringency conditions to a nucleic acid that encodes a polypeptide that is listed in the sequence protocol (for definition of high or low stringency conditions, see Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989, 6.3.1-6.3.6); polypeptides that specifically bind to antisera generated to H. pylori polypeptides, particularly to sera formed against the active site or binding domain of an H. pylori polypeptide. The invention further includes fragments, preferably active fragments. These and other polypeptides are also referred to herein as polypeptide analogs or variants of H. pylori.

The putative functions that were determined for several H. pylori polypeptides are shown in Table 2. First

The invention also substantially encompasses the use of the claimed H. pylori polypeptides in these identified functions.

The invention includes H. pylori polypeptides characterized in accordance with Table 1. 1, which include H. pylori cell envelope proteins, secreted H. pylori proteins, H. pylori cytoplasmic proteins, and H. pylori cell proteins. Members of this group were identified by following BLAST homology and searching for a secretory signal or transmembrane protein motifs. Polypeptides which, by their substantial homology, relate to the polypeptides set forth in Table 2. 1 (reflecting on FASTA amino acid sequence comparisons and reported in many cases in Tables 3-6 below) are classified according to the homologue method shown in Table 1. First

Table no. 1

NÁZOVORF nt Seq 1D # and to SEQ XD tt A. CELL PACKAGING A. 1 outer membrane A. 1.2 terminal fe. Rest 01ael20012421878 l f2 18 255 746 02gel 1622 875260 β 36 263 754 02gp20706 23,632,775 f3 32 ~ 266 757 07apI 1015 23938312 f3 2 '’ 271 762 05ee 10816 4103408 f2 l 1 277 768 06ap20306 23437632J3 9 280 771 07ap20216 7227202 f3 10 285 776 14apI0815 20585777 cI 13 292 783 hplpl4013 l1726503 c2 20 294 785 hp5pl564I 21698387 c2 20 299 790 02gp20706 16803513 fl l 311 802 02gp20706 20365905 f2 8 312 803 02gp208143984818 fl l 313 804 05ae30220 9882767 f2 34 321 812 07ep 11916 5913 592 f3 l 8 327 818 09zel0333 22460750 f2 6 329 820 14apl02211368938l c3 4 331 882 06ce206l0 1367157 fl 8.aa 353 844 02gel0116 168O35I3 12 34 364 855 02gel0116 36367936 cl 92 366 857 05ce 10910 25598277 f3 3 368 859 Oócpl12174881263 f2 9 375 866 06ep30223 34409437 f3 94 384 875 06gp71906 970325 c3 190 391 882 07ael0923 24426508 n l 392 883 09cp10224J062966 c3 61 397 888 09cpI0224 1412715 c3 56 398 889 09cp61003 14562637 c2 93 402 893 09cp61003 240635 87 c1 74 404 895 1Iae80818 7952 cl 49 409 900 1lap20714 4960432 c3 96 410 901 1 lap20714 7227202 f3 43.aa 412 903 hp5p 156411219528l cl 24 427 918 hp6pl0903 4398263 f3 6.aa 433 924 hp6pl0903 4398263 J3 6.aa 434 925 02ae31010 30208317 fl 14 441 932 02cpl0615 26573462 cl 45 444 935 03ael0804 12609533 cl 26 445 936 04ep41903 4101593 12 J O.aa 449 940 05epl0815 26570332 c2 99 450 941 05ep108154719175 cl 83 452 943 06cp30603 679218 (2 34 453 944 llae80818 l963278l c3 57 466 957 1 lap20714 34023312 13 46 468 959 11ee11408 497719 3 c1 .aa 469 960 1lael1922 12586675 f2 1 983 1037 07ccl 1402 2458267 c3J08 985 1039 11 and _P 40 20714_7227202_f3 989 1043

hp7e! 0192 25598277 c2 I5 1008 1062 06ep30223 34409437 f2 64 1011 1065 09cp10224J 062966c1 44 1014 1068 01ce610I6 12931513 c2 106 1015 1069 05epl0815 4719175 cl l15 1029 1083 05ae30220 4977193 c3 l98 1032 1086 A. 1.3 without terminal fe. the rest 02ael1612 22477267 f2 27 259 750 A. 1.4 C-terminal tyrosine cluster motif 07epl 1916 5273452 c3 31 286 777 07ce i 1019 2205129 l fl l 326 817 Oocc1217 19720300 f3 11 374 865 09cp 10224 429510 c2 46.aa 399 890 hp4e53394 22864682 c2 86.aa 422 913 06epl0615 961562 f2 41 454 945 09cp61003 492187 c2 80.aa 465 956 14gpl1423 26803801 f3 7 998 1052 hp4e53394 19720300 c3 97 1009 1063 hp4e53394 19720300 c3 97 1023 1077 01ce61016 492187 c3 120 1294 1297 06ep 10615_961562_fl_l 5 1295 1298 A. 1.5 terminal fe. and a C-terminal tyrosine cluster 04gel0816 33726080 c2 319 810 06eel0709 21675012 fl 2 325 816 hp5p 15575 33445317J2 20.aa 425 916 01 cp20708 36134808 f2 l 1 437 928 02ae31010 J 2504512J3 28aa 438 929 04ep41903 26757937J3 16 447 938 04ep41903 26757937 f3 16 448 939 1lae8O818 7290627 c2 51 467 958 13ael0610 35912 f2 3 996 1050 01cp20708 13086002 f3 27 1027 1081 14cplI908242I8954 cl 68 1031 1085 A. 1.6 Via homolgy Olael1010 40688 c2 39 254 745 02gp2081424415958 f3 9 269 760 09cpl1003 5945252 f2 4 328 819 06cp30603 23476568 c2 133.aa 352 843 09cp61003 5945252 fl 5 406 897 14ee41924 23527267 c3 107 415 906 07eel1402 10759567 c2 86 1019 1073 Other outer membrane protons 06epl0615 9842 f3 46 381 872 06gp 10409 3 3 98426 f2 12 389 880 06epI06I5 9842 fl 5 1010 1064 06gp 10409 3398428 f2 12 1012 1066 A.2 inner membrane A.2.1 proteins involved in outer membrane and cell wall synthesis 06ep30223 4698838 f2 55 354 845 A.2.2 P a ^cts involved in energy conversion

0 6ce20610 43313 3 8 f3 18 372 863 09cpl0224 4484718 c1 3S 400 891 hp4el3394 5964452 c2 97 421 912 hp4el3394_15828963_c2_90 1022 1076 A.2.3 proteins involved in cofactor metabolism 06gp71906 25478I92 c1 131 463 954 A.2.4 proteins involved in secretion and adhesion 06cp30603 23452 c3 80 281 772 09cpl0713 23452 c3 195 988 1042 A.2.5 Via homolgy 1 lap20714 J> 271967_cI_60 411 902 A.2.6 proteins involved in transport 1lae80818 l1188791 c3 60 407 898 14cplI908_25593768_c3_97 1017 1071 A.2.7 Other inner membrane proteins 13ael0712 14100018 f2 12 290 781 hp1 p 13939 25397327 ø3 22 417 908 hp5pl5870 14350428 fl l 430 921 06ge205 01J 4100018 c1 34 992 1046 05ae30220 14350428 f3 91 1025 1079 A.3 flagellate proteins hp4el3394_3368767_cl_80 477 968 A.4 transport proteins 14ce31519 15635927 f3 14 414 905 And .5 other cellular envelope proteins 04cpl1202 24256567 c3 117 253 744 29ge3032134157812J3 J 0 293 784 29ge30321 12913562 fl l 334 825 hp6pl0233 12273302 fl l 343 834 hp2el091124855312 cl 69 418 909 hp5pl5575 2930031l cl 29 424 915 02ae31010 5085162 g 1 4 7 443 934 B. CYTOPLASMATIC PROTEINS B. 1 proteins involved in energy conversion 1Igel0308 5256 f2 l 470 961 lIgel0308_24609417_f2 1 1033 1087 B.2 proteins involved in amino acid metabolism and transport 06ep11917 24803153 c3 24 357 848 Oóepl1202_4884677_cl_l 7 457 948 B.3 proteins involved in nucleotide metabolism and transport 06ep30223 23476067 c 1,119 461 952 06ep30223 23476067 cl 15 1030 1084 B.4 proteins involved in cofactor metabolism 07apl1213 35156577 cl 24 345 836 06ep30223 23557202 c2 130 383 874 06ep30223 5109443 CI 109 387 878 Ooepl1202 133293 cl 19 455 946 07ee50709 35156577 f3 80 1003 1057 B.5 The ^{role of} China involved in lipid metabolism hp6el2267 14650278 f3 29 351 842 14 ee41924 23,834,800 f2 32 416 907 B.6 proteins involved in mRNA translation and ribosonic biogenesis

14ee41924 16282067 cl 72 473 964 07ee11402 19565702 c2 88 1034 1088  B7 proteins involved in replication, transcription, recombination, and genome repair 05eel0816_468765I cl 22 278 769 29ge30321 135253 f2 5 335 826 07ap80602 976413 D 9 346 837 14ce21516 85786 fl 1 350 841 hp2el0911 3349 cl 63 419 910 06ep30223 16512 c3 160 460 951 14ce61516 13073577 f2 12 472 963 07ee50709 4818967 à 43 1000 1054 05ae30220 976413 c3 204 1004 1058 07ee50709 4818967 f2 43 1020 1074 hp7el0590_13073577_c3_107 1293 1296 B.8 other cytoplasmic proteins 04gel0816 22086531 f2 10 318 809 05cp21223 4725443 f3 14 322 813 06apl1119 24426508J3 26 324 815 12ge 10321 4821082 f3 14 330 821 hp3p10807 l89075 f2 4 347 838 02ae31010 2117087 f3 34 440 931 03ael0804 21698400 c2 31 446 937 06gp71906 25504187 13 112 464 955 hp7p10290 35156558 f3 l 5 490 981 hp7p10290 4351718 fl 6 491 982 13ael0610 859692 c2 32 995 1049 06apl1119 24426508 f3 27 997 1051 hp3el1188 47327 f2 9 1005 1059 07ee50709_26438968_f2_36 1028 1082 C. secreted proteins C. 1 proteins involved in secretion and adhesion 12apl0324 4805318 f2 3 355 846 12apl0324 4805318 f2 6 1006 1060 Q 2 other secreted proteins Olgpl1016 4103403 c2 13 257 748 02ael1612 1074212 fl 1 258 749 02ael 1612 23598175 fl 2 260 751 02ael161233203250c1 5I 261 752 02gp20706 1203402 c3 58 264 755 02gp20706 l5781452 c2 51 265 756 02gp20706 4892558 f3 19 268 759 04cpl 1202 24261588J223 270 761 05ae3 0220 21619067 f3 56 272 763 07apl12133540i528 cl 21 273 764 O5ae3 0220 24882812 c3 103 274 765 05ae30220 25953163 c3 98 275 766 05eel0816 14649077 f3 18 276 767 06apl111916594193 Π 9 279 770 06cp30603 4689068 c3 79 283 774 07ap1111l 234692 c3 14 284 775 09cpl1003 19532625 c3 17 287 778

09cp20502 24001388 cl 31 288 779 12gp31I06 3024I26 12 25 289 780 13ae10712 29569208 c2 27 291 782 hp2p10272 23697200 D 22 295 786 hp2pl0272 26829I36 fl l 296 787 .hp5el521l 8I9455 c2 24 297 788 hp5pI5212 34064750 f2 9 298 789 hp6el0967 23476502 f2 6 300 791 hpóe10967 24882750 f2 7 301 792 hpóe 12267 ^ 4876718 f2 23 302 793 hp6e20339 l190660 c2 45 303 794 hp6e20339 21492187 cl 40 304 795 hp6e20339 34024187 cI 37 305 796 04cp11202 16603425 c2 72 314 805 04cplI202 19797128 fl 5 315 806 05eeI0816 259703 f2 7 323 814 hp2p 10272 22692325 β 21 338 829 hp6e20339 24317062 c3 58 342 833 02geI1622 21695936c154 348 839 12ge10321243085I3 f3 20 349 840 14ee41924 2458267 c2 93 356 847 OlcelI104 36125337 cl 8 358 849 01 ce21I04 33203250 c3 87 359 850 02ae31010 34616666J2 27 360 851 02ae31010 35270000 f3 33 361 852 02ae31010 36132785 f2 29 362 853 02gel01I6 1578l452 cl 87 363 854 03ael0804 23485968 c3 47 367 858 06ce20610 29298537 c2 31 370 861 06ce2061O 3913967 c3 36 371 862 06cpl1118 212827 c1 17 373 864 06cp30603 21492187 f2 41 377 868 06cp30603 34024187 fl 20 378 869 06cp30603 34024187 fl 20 379 870 06ep10615 14649077 f3 52 380 871 06ep30223 5271902 cl 106 388 879 06gp71906 242615 88 c2 174 390 881 09ce10413 41401l fl 3 394 885 09cel0413 5865665 n4 395 886 09ce52017 29324062 c.l 2l 396 887 09cp2I6O7 7224187 c2 l2 ' 401 892 09cp61003 I9532625 c1 78 403 894 09cp61003 24335762 c3 l11 405 896 1 lae80818 783127 c3 64 408 899 hp4el3394 35957200 fl 21 420 911 hp5pI5575 6140713 f2 18 426 917 hp5pl5641 24304527 c3 36 428 919 hp5pl5641 25635452 c3 34 429 920 hp6pl0606 19546933 c3 31 432 923 02ae3101016833312 f2 l 9 439 930 02ae3101036132785 f2 29 442 933 05ep108154195292c1 84 451 942

I2ap10324J 3178562J3 6 471 962 hp2el091l 4882027 c2 87 474 965 hp5p152126928132 c3 34 478 969 hp7p10290 25548812 f3 l4 488 979 07ee50709 10213 593J3 77 986 1040 06ep10615 14649077 f2 30 987 1041 0Ice6I016 23609580 c3 139 990 1044 06gp71906 3024126 cl 128 991 1045 09cp 10713 34024187 fl 31 993 1047 02apl1117 23495187 c3 81 1001 1055 09cp ί 0713 34024187 f 1 31 1002 1056 hp1e80523 23485968 c2 49 1007 1061 09cel0413 5865665 fl 4 1013 1067 01ce61016 23609580 c3 13 9 1016 1070 14cpl190 783127 cl 72 1018 1072 hp4el3394 5088562 f3 54 1021 1075 hp8e1008019546933 c2 88 1026 1080 07ee50709 960952 f2 47 1035 1089 D. OTHER CELL PROTEINS Olgel 1619 23711062 c3J5 256 747 02gp20706 23866562 c2 53 267 758 06cp30603 23476568 cl 44 282 773 01gel0203 35281542 c3 16 306 797 01gel0203 860166 f3 9 307 798 Olgel1619 13788141 c2 l1 308 799 Olgel1619 24415880 c2J2 309 800 Olgel1619 24417813 cl 8 310 801 04cpll202 23553177 cl 75 316 807 04cpl1202 23553I77 c3 109 317 808 29ep10720 24220926 f2 8 332 823 29epl0720 24432762 c3 39 333 824 29ge30321 21673965 ø2 7 336 827 29ge30321 24336712 fl 5 337 828 hp2p10272 24406280 c1 26 339 830 hp3plO8O7 29343768 fl l 340 831 hp3p! 0807 29352212 f2 5 341 832 02ep20506 24611325 f2 6 344 835 06ae11016 30579712 f2 21 369 860 06cpl12I7 4897077 fl 6 376 867 06epl1202 26353438 cl 22 382 873 06ep30223 4876077 c3 149 386 877 hp5el5044 4554652 f3 3 423 914 hpóp1059023440913 c2 31 431 922 hpóp10904 2214676j: 1 15 435 926 hpóp1090423704412 f2 5 436 927 06epl 1202 792962 c2 26.aa 458 949 06gp71906 l 5115637 59 59 462 953 hp3el1188 47327 f2 5 475 966 hp3el1188 5082842 f3 12 476 967 hp5p15641 30273312 c2 28 479 970 hp5p15641 5211687 c2 29 480 971 hpóp10590 30521093 f2 14 481 972

hpóp10904 7089062 c 16 482 973 hpóp 1212 9 16603417 f3 14 483 974 hpóp12244 3948467 c1 52 484 975 hp6p22217 23470967 fl 4 485 976 hp7el0192 4412568J2J 486 977 hp7pl0287 24611325 c2 24 487 978 hp7pl0290 25585941 f3 12 489 980 02gel0116 23866562 c3 146 984 1038 hp4p62853 5914693 c3 52 994 1,048 07cel0312 4554652 f3 2 1024 1078 hpóp12244 3948467 c3 88 1036 1090

Explanation: “nt” SEQ ID No. of nucleotide and “if” is SEQ ID No. of amino acid.

definitions

A purified preparation or substantially pure preparation of a polypeptide means a polypeptide that is separated from other proteins, lipids, and nucleic acids with which it naturally occurs. Preferably, the polypeptide is also separated from substances such as e.g. an antibody or gel matrix, e.g. polyacrylamide used in its purification. Preferably, the polypeptide constitutes at least 10, 20, 50, 70, 80, or 95% of the dry weight of the purified preparation. Preferably, the composition comprises sufficient polypeptide to allow protein sequencing; at least 1, 10 or 100 µg of polypeptide; at least 1, 10 or 100 mg of polypeptide.

A purified cell preparation in the case of plant or animal cells means in vitro cells and not the whole intact plant or animal. In the case of cultured cells or microbial cells, it comprises at least 10% and preferably 50% of the cells of interest.

A substantially pure nucleic acid, e.g. substantially pure DNA is a nucleic acid that includes one or both of the following: it does not immediately link to the two coding sequences immediately adjacent (i.e., one at the 5 'end and one at the 3' end) in the naturally occurring genome of the organism; the nucleic acid obtained; or which is substantially free of the nucleic acid with which it appears in the organism from which the nucleic acid is derived. The term includes, for example, recombinant DNA that is incorporated into a vector, e.g. into a self-replicating plasmid or virus, or a prokaryotic or eukaryotic genomic DNA, or which exists as a separate molecule (e.g., a cDNA or genomic DNA fragment generated by PCR or by the application of restriction endonucleases) independently of other DNA sequences. Substantially pure DNA also includes recombinant DNA that is part of a hybrid gene that encodes another H. pylori DNA sequence.

Here, "Contig" refers to a nucleic acid that forms a contiguous extension of the genomic sequence of an organism.

An "open reading frame" also referred to herein as an ORF is a region of a nucleic acid that encodes a polypeptide. This region may represent part or all of the coding sequence.

A "coding sequence" is a nucleic acid that is transcribed into a messenger RNA and / or translated into a polypeptide when it is directed by appropriate regulatory sequences. The boundaries of the coding sequence are determined by the translation start codon at the 5 'end and the translation stop codon at the 3' end. The coding sequence may include, but is not limited to, messenger RNA, synthetic DNA, and recombinant nucleic acid sequences.

A "complement" of a nucleic acid means an antiparallel or antisense sequence that participates in Watson-Crick's base pairing with the original sequence.

A "gene product" is a protein or structural RNA that is specifically encoded by a gene.

The term "probe" means a nucleic acid, peptide, or other chemical entity that specifically binds to a molecule of interest. Probes are often labeled or capable of binding to labeling agents. Said "label" is a chemical part capable of being detected. Typical labeling agents include dyes, radioisotopes, luminescent and chemoluminescent substances, fluorophores, enzymes, precipitating agents, amplification sequences, and the like. Similarly, a nucleic acid, peptide, or other chemical that specifically binds to and immobilizes a molecule of interest is termed a "capture ligand". The capture ligands are typically associated with a carrier such as nitrocellulose, glass, nylon membrane, beads, particles, and the like. The specificity of the hybridization depends on conditions such as nucleotide base pair composition and temperature and salt concentration in the reaction. These conditions can be readily recognized by one skilled in the art using routine experimentation.

Homology refers to sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When the position in both of the two comparable sequences is occupied by the same base or amino acid monomeric subunit, e.g. when the position in each of the two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent homology between two sequences is a function of the number of homologous positions or positions that fit together that share two sequences divided by the number of positions to be compared multiplied by stomi. For example, if 6 of the 10 positions in the two sequences fit together or are homologous, then the two sequences are 60% homologous. For example, the ATTGCG and TATGGC DNA sequences have 50% homology. Generally, the comparison is performed when the two sequences are oriented to maximize homology.

Nucleic acids may hybridize to each other when at least one nucleic acid strand can bind to another nucleic acid strand under defined conditions.

The stringency of the hybridization conditions is defined: (a) as the temperature at which hybridization and / or washing takes place; and (b) the ionic strength and polarity of the hybridization and wash solution. Hybridization requires that two nucleic acids contain complementary sequences; mismatches may be tolerated depending on the stringency of the hybridization. Typically, hybridization of two sequences under very strict conditions (e.g., in 0.5x SSC solution, at 65 ° C) requires the sequences to be completely homologous. Medium stringency conditions (e.g., 2X SSC at 65 ° C) and low stringency (e.g., 2X SSC at 55 ° C) require lower overall complementarity between hybridization sequences. (1XSSC is 0.15M NaCl, 0.015M sodium citrate).

The terms peptides, proteins and polypeptides are used interchangeably herein.

The term "surface protein" means all surface-accessible proteins, such as inner or outer membrane proteins, cell wall adhering proteins, and secreted proteins.

A polypeptide has the biological activity of H. pylori when it exhibits one, two, and preferably more of the following properties: (1) when expressed when H. pylori is infected, it may promote or mediate the capture of H. pylori on a cell ; (2) has an enzymatic activity that characterizes the H. pylori protein, (3) or the gene encoding it can save a lethal mutation in the H. pylori gene. A polypeptide has biological activity when it is an antagonist, agonist or superagonist of a polypeptide having one of the above properties.

A biologically active fragment or analog is one having in vivo or in vitro activity that is characteristic of H. pylori polypeptides that are listed in the Sequence Listing, or other naturally occurring H. pylori polypeptides. One or more biological activities are described herein. Particularly preferred are fragments that exist in vivo, e.g. fragments that arise from post-transcriptional modifications or that occur during translation of alternatively spliced RNAs. Fragments include those expressed in natural or endogenous cells, as well as those produced in an expression system, e.g. in CHO cells. Because peptides, such as H. pylori polypeptides, often exhibit a range of physiological properties and because such properties can be attributed to different parts of the molecule, a useful fragment or analog is one that exhibits biological activity in any biological assay where H. activity is investigated. pylori. It is preferred that the fragment or analog in any in vivo or in vitro assay exhibits 10%, preferably 40%, preferably 90%, and higher H. pylori activity.

Analogs may differ from naturally occurring H. pylori polypeptides by an amino acid sequence or feature that does not include the sequence, or both. No modifications include changes in acetylation, methylation, phosphorylation, carboxylation or glycosylation. Preferred analogs include H. pylori polypeptides (or a biologically active fragment thereof) whose sequences differ from the wild-type sequence by substitution of one or more conservative amino acids or by substitution, deletion or insertion of one or more non-conservative amino acids that do not substantially damage the biological activity of the bacterium H. pylori. A conservative substitution typically involves the substitution of one amino acid by another amino acid that exhibits similar characteristics, e.g. substitutions in the following groups: valine, glycine; glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. Other conservative substitutions are shown in Table 2. 2 below.

Table no. 2 Conservative amino acid replacements

amino acid code replaced by any of the alanine A D-Ala, Gly, beta-Ala, L-Cys, and D-Cys arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, Met, Ile, D-Met, D-Ile, Orn, D-Orn asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln acid. aspartic D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr glutamine Q D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp acid. glutamic E D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln glycine G Ala, D-Ala, Pre, D-Pro, [beta] -Ala, Acp isoleucine I D-Ile, D-Val, D-Val, Leu, D-Leu, Met, D-Met leucine L D-Leu, Val, D-Val, Leu, D-Leu, Met, D-Met lysine The D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-Ile, Orn, D-Orn methionine M D-Met, S-Me-Cys, D-Ile, Leu, D-Leu, Val, DVal phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, DTrp, Trans-3,4 or 5-phenylproline, cis-3,4, or 5-phenylproline proline P D-Pro, L-1-thioazolidine-4-carboxylic acid, or L-1-oxazolidine-4-carboxylic acid serine WITH D-Ser, Thr, D-Thr, D-Met, D-Met, O-D, Met-O, D-Met (O) threonine T D-Thr, Ser, D-Ser, Allo-Thr, Met-D, Met-O, D-Met (O), Val, D-Val tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His valine in D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met

Other analogs of the invention are those with a modification that increases the stability of the peptide; such analogs may contain, for example, one or more non-peptide bonds (which replace peptide bonds) in the peptide sequence. They also include analogs that include residues other than native 27 L-amino acids, e.g. D-amino acids or unnatural or synthetic amino acids, e.g. β or γ amino acids; and cyclic analogs.

The term "fragment" means an analogue that typically has at least about 20 residues, preferably at least about 40 residues, preferably about 60 residues. Fragments of polypeptides may be generated by methods known to those skilled in the art. The ability of a fragment to exhibit biological activity of an H. pylori polypeptide can be determined by the methods described herein. Also included are H. pylori polypeptides that contain residues that do not participate in the biological activity of the peptide or that result in alternative mRNA splicing or alternative protein modification.

The term "immunological component" refers to a portion, such as a H. pylori polypeptide, analog, or fragment thereof, capable of eliciting a humoral and / or cellular immune response in a host animal.

The term "antigenic component" refers to a moiety, such as an H. pylori polypeptide, analog, or fragment thereof, that is capable of binding to specific antibodies with sufficient affinity to form a detectable antigen-antibody complex.

The term "transgene" means a nucleic acid (encoding, for example, one or more polypeptides) that is partially or totally heterogeneous, that is, it is foreign to, or is homogeneous to, the transgenic animal or cell into which it is introduced, or a cell into which it has been introduced but which is prepared to be or is incorporated into the cellular genome in such a way as to alter the gene of the cell into which it is introduced (e.g., to be integrated into a region different from that in the cell) a natural gene, or insertion of a nucleic acid leads to cell death). The transgene may comprise one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, which may be necessary for optimal expression of the selected nucleic acid and which are operably linked to the selected nucleic acid, and may further comprise an enhancer sequence.

The term "transgenic cell" means a cell containing a transgene.

The term "transgenic animal" means any animal in which one or more, preferably all, cells contain a transgene. The transgene can be introduced into the cell directly or indirectly, which means that it is introduced into the cell precursor by a method of deliberate gene manipulation, such as microinjection or recombinant virus infection. This molecule can be incorporated into the chromosome or can replicate outside the chromosome.

The term "antibody" is intended to include a fragment that specifically reacts with H. pylori polypeptides.

The term "cell-specific promoter" means a DNA sequence that serves as a promoter, that is, it regulates the expression of a selected DNA sequence that is operably linked to a promoter and that affects the expression of the selected DNA sequence in specific tissue cells. The term also includes so-called "leaky" promoters that regulate expression of the selected DNA primarily in one tissue, but also cause expression in other tissues.

The term "misexpression" means a wild type gene expression pattern. This includes expression that is not at the wild-type expression level, that is, it exceeds or does not reach the wild-type expression level; the expression pattern differs from the wild-type expression pattern at the time or stage at which the gene is expressed, for example, increased or decreased expression (when compared to wild-type expression) at a predetermined time or stage of development; an expression pattern that differs from a wild type pattern in reduced expression (when compared to wild type pattern) in predetermined cell types or tissue type; an expression pattern that differs from the wild type pattern by the splice site, amino acid sequence, post-translational processing, or biological activity of the expressed polypeptide; an expression pattern that differs from the wild type pattern by the effect of an environmental stimulus or an extracellular stimulus on gene expression, e.g. pattern of enhanced or attenuated expression (compared to wild type) when the attenuated or enhanced stimulus is.

The term "host cell" and other such terms that describe microorganisms or higher eukaryotic cell lines cultured as unicellular entities mean cells that can become or are used as recipients of a recombinant vector or other transfer DNA and include the progeny of the parent cell being transfected . One of skill in the art will recognize that in the case of single parent cell progeny, it is not necessary that their genomic or total DNA be completely identical to the parent, which is due to a random or deliberate mutation.

The term "control sequence" means a nucleic acid having a sequence that is recognized by the host organism to effect expression of the encoded sequences to which it is attached. The nature of such control sequences vary depending on the host organism, in prokaryotes such control sequences generally include a promoter, a ribosomal binding site, and terminators; in eukaryotes generally, such control sequences include promoters, terminators and, in some cases, enhancers. The term control sequence includes at least all components whose presence is necessary for expression, and may also include other components whose presence is preferred, for example, leader sequences.

The term "operably linked" refers to the linkage or ligation of sequences that function as intended. For example, a control sequence is operably linked to a coding sequence by ligation in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequence and the host cell.

Metabolism of a substance means any aspect of the expression, function, action or regulation of a substance. The metabolism of the agent includes modifications, e.g. covalent or non-covalent modifications of the substance. The metabolism of the agent includes modifications, e.g. covalent or non-covalent modifications that the substance induces in other substances. The metabolism of a substance also involves changes in the distribution of the substance. The metabolism of a substance also includes changes that the substance induces in the distribution of other substances.

The term "sample" means a biological sample, such as body tissue or fluid (including without limitation plasma, serum, cerebrospinal fluid, lymph, tears, saliva and tissue sections) or from in vitro cell culture constituents as well as environmental samples.

Practical examples of the invention employ, unless otherwise indicated, conventional chemical methods, molecular biology methods, microbiology, DNA recombination, and immunology, which are well known in the art. Such methods are described in publications e.g. Sambrook, Fritsch and Maniatis, Molecular Cloning; Laboratory Manual ^2nd ed. (1989); DNA Cloning, Volumes I and II (DN Glover ed. 1985); Oligonucleotide Synthesis (MJ Gait ed 1984); Nucleic Acid Hybridization (BD Hames & SJ Higgins eds. 1984); Methods in Enzymology (Academic Press, Inc.), in particular Vol. 154 and 155 (Wu and Grossman, eds.) And PCR-A Practical Approach (McPherson, Quirk, and Taylor, eds.)

I. Isolation of H. pylori nucleic acids and use of the genomic sequence of H. pylori.

The invention describes nucleotide sequences of the H. pylori genome, which thus include H. pylori genomic DNA library sequences. The detailed description that follows provides the nucleotide sequences of H. pylori and also provides a method for obtaining sequences and a method for identifying ORFs and sequences that encode proteins. It also discloses methods of using H. pylori sequences for diagnosis and therapeutic purposes. Further, the library can be used as a database to identify and compare medically important sequences in this or other H. pylori strains.

To determine the genomic sequence of H. pylori, DNA was isolated from an H. pylori strain and mechanically cut by nebulization to an average size of 2 kb. Following size distribution by gel electrophoresis, the fragments had blunt ends, ligated into adapter oligonucleotides, and cloned into each of 20 different pMX vectors (Rice et al., Meeting of Genome Mapping and Sequencing Abstract, Cold Spring Harbor, NY, 5 / 115/15, 1994, p. 225) to construct a series of subclone libraries.

DNA sequencing was performed using sequence procedures as essentially described in Church et al., 1988, Science 240: 185; U. Patens No. 4,942,124 and 5,149,625). DNA was extracted from the collected cultures and chemical or enzymatic sequencing was performed. The sequencing reaction was resolved by electrophoresis and the products were transferred to nylon membranes to which they were covalently bound. Finally, the membranes were sequentially hybridized to a series of labeled oligonucleotides that are complementary to the "tag" sequences present in the various cloning vectors. In this way, a large number of sequences can be obtained from simple sequence sequencing reactions. Cloning and sequencing procedures are described in more detail in the following examples.

The FALCON ™ program (Church et al., 1994, Automated DNA Sequencing and Analysis, JC Venter, eds., Academic Press) and PHRAP (P. Green, Abstracts DOE Human Genome Program Contractor-Grantee Workshop V, Jan. 1996, p157). The resulting assembly of "contigs" was obtained, each representing a downstream DNA strand or DNA sequence. The average “contig” length is approximately 3 kb.

A number of approaches have been used to "contig" to obtain a contiguous sequence that represents the entire genome of H. pylori. Synthetic oligonucleotides were designed to be complementary to the sequences at the end of each contig. These oligonucleotides can hybridize to H. pylori genomic DNA libraries in, for example, lambda phage vectors to identify clones that contain sequences corresponding to the junction regions between each contig. Such clones are then used to isolate the template DNA and some oligonucleotides are used as primers in the polymerase chain reaction (PCR) to amplify the pooled fragments and then determine their nucleotide sequence.

The presence of an open reading frame (ORF) comprising at least 180 nucleotides in the H. pylori sequence was tested. The existence of a 180 nucleotide ORF was predicted (when the ORF is read from the stop codon to the stop codon). When ORF analysis is used based on a stop codon to stop codon reading, these ORFs cannot correspond to the ORF of a naturally occurring H. pylori polypeptide. Said ORFs may contain initiation codons that indicate initiation of protein synthesis of a naturally occurring H. pylori polypeptide. Such initial codons in the ORFs described herein can be identified by the skilled artisan, and the resulting ORF and the encoded H. pylori polypeptide are within the scope of the invention. For example, an ORF may identify a codon such as AUG or GUG (encoding methionine or valine) that is part of the protein synthesis initiation signal, and the ORF may be modified to correspond to a naturally occurring H. pylori polypeptide. The predicted coding region was defined by evaluating the coding potential of such sequences using the GENEMARK ™ program (Borodovsky and McLinnch, 1993, Comp. Chem. 17: 123).

Other H. pylori nucleic acids

Nucleic acids of the invention can be obtained directly from the DNA of the above H. pylori strain using a polymerase chain reaction (PCR). For a detailed description of PCR, see “PCR, A Practical Approach” (McPherson, Quirke, and Taylor, eds., IRL Press, Oxford, UK, 1991). High fidelity PCR can be used to ensure a true copy of the DNA prior to expression. The amplified product can be checked by conventional sequencing methods. Clones carrying the desired sequences of the invention can be obtained by screening libraries by PCR or by hybridization to a colony membrane or plaque library with synthetic oligo32 nucleotide probes (Sambrook et al., Molecular Cloning, A Laboratory Manual 2 ^nd edition, 1989, Cold Spring Harbor Press, NY). ).

It is also possible, in accordance with the protocols described herein, to obtain nucleic acids encoding H. pylori polypeptides from a cDNA library. The cDNA encoding the H. pylori polypeptide can be obtained by isolating total mRNA from a suitable cell line. The double stranded cDNA can then be prepared from total mRNA. The cDNA can then be inserted into a suitable plasmid or viral vector (e.g., a bacteriophage) using one of a number of known methods. Genes encoding H. pylori polypeptides can also be cloned using the polymerase chain reaction method in accordance with the nucleotide sequence information of the invention. The nucleic acids of the invention may be DNA or RNA. Preferred nucleic acids are listed in the Sequence Listing.

The nucleic acids of the invention may also be chemically synthesized using standard methods. Various methods of chemical synthesis of polydeoxynucleotides are known which include solid phase synthesis which, like peptide synthesis, is fully automated and is carried out on commercially available DNA synthesizers (Itakura et al., US Patent No. 4,598,049; Caruthers et al., US Patent No. And Itakura US Patent Nos. 4,401,796 and 4,373,071).

Nucleic acids isolated or synthesized in accordance with the invention are useful without limitation as probes, primers, capture ligands, antisense genes, and for developing expression systems suitable for the synthesis of proteins and peptides corresponding to such sequences. Nucleic acids that are used as primers, probes, capture ligands, and antisense reagents normally comprise all or part (for specificity and ability to form a stable hybridization product, contain about 20 or more nucleotides) of the nucleic acid set forth in the Sequence Listing. These uses are described in further detail below.

probes

Nucleic acids isolated or synthesized in accordance with the nucleotide sequences set forth in the Sequence Listing can be used as a probe for the specific detection of H. pylori. According to the sequence information provided herein, sequences of 20 or more nucleotides have been identified that provide the desired inclusivity and exclusivity with respect to the house of H. pylori, and compete with inappropriate nucleic acids under given hybridization conditions. It is preferred that the sequences comprise at least twenty to thirty nucleotides in order to ensure the stability of the hybridization product formed between the probe and the intended target molecules.

It is difficult to synthesize sequences larger than 1000 nucleotides, but can be prepared by recombinant DNA. Those skilled in the art will recognize that nucleic acids that are used as probes are labeled for detection of the hybridization product.

Nucleic acids that have been isolated and synthesized in accordance with the sequences set forth in the Sequence Listing can be used as probes in the detection of homologous regions (particularly homologous genes) of other H. pylori species using stringent hybridization conditions described herein.

Catching ligands

For use as a capture ligand, a nucleic acid that has been selected with respect to the probes as described above may be associated with a support. The manner in which a nucleic acid is coupled to a support is well known. The nucleic acid has a sequence of 20 or more nucleotides, which is listed in the Sequence Listing, used to separate H. pylori nucleic acid from the nucleic acid of any other organism. The nucleic acid has twenty or more nucleotides in the sequence shown in the Sequence Listing and can also be used to separate other Helicobacter species and other organisms. It is preferred that the sequence comprises at least twenty nucleotides to ensure the stability of the hybridization product that is formed between the probe and the intended target molecules. Sequences that are larger than 1000 nucleotides are difficult to synthesize, but may be produced by recombinant DNA techniques.

primers

The nucleic acid isolated or synthesized in accordance with the sequences described herein can be used as primers in amplifying H. pylori nucleic acid. These nucleic acids can also be used as primers in amplifying nucleic acids in other Helicobacter species. Due to the polymerase chain reaction (PCR) method, nucleic acids that contain 10 to 15 nucleotides or more nucleotides and that are included in a sequencing protocol can be used in conjunction with suitable enzymes and reagents to make copies of H. pylori nucleic acid. Preferably, the sequence comprises twenty or more nucleotides, thereby ensuring the stability of the hybridization product that forms between the primer and the intended target molecules. Binding conditions for primers larger than 100 nucleotides are more difficult to control to achieve specificity. High fidelity PCR can be used to ensure the plausibility of a copy of PCR prior to expression. In addition, the amplified products can be checked by conventional sequencing methods.

The copies may be used in diagnostic assays to detect specific sequences including H, pylori and / or other Helicobacter species. These copies may also be incorporated into cloning and expression vectors to produce polypeptides that correspond to the nucleic acid synthesized by PCR, which is described in more detail herein.

antisense

Nucleic acid or nucleic acid hybridizing derivatives isolated or synthesized according to the sequences described herein are used as antisense agents in preventing expression of H. pylori genes. These sequences can also be used as antisense agents to prevent the expression of genes of other Helicobacter species.

In one embodiment of the invention, the nucleic acid or derivatives corresponding to the nucleic acids of H. pylori are combined with a suitable carrier, such as a liposome or bacteriophage, for introduction into bacterial cells. For example, a nucleic acid having 20 or more nucleotides is capable of binding to a bacterial nucleic acid or a bacterial mediator RNA. It is preferred that the antisense nucleic acid comprises 20 or more nucleotides in order to achieve the necessary stability of the non-naturally occurring hybridization product and the bacterial nucleic acid and / or bacterial mediator RNA. A nucleic acid having a sequence greater than 1,000 nucleotides is difficult to synthesize, but may be produced by a recombinant DNA method. Methods for depositing nucl35ic acid on liposomes are well known in the art and are described in U.S. Pat. No. 4,241,046, filed Dec. 23, 1980, by Papahadjopoulos et al.

II. Expression of H. pylori Nucleic Acids.

A nucleic acid isolated or synthesized in accordance with the sequences described herein can be used to prepare polypeptides. Nucleic acids listed in the Sequence Protocol or fragments of said nucleic acids that encode active portions of H. pylori polypeptides may be cloned into suitable vectors or used in nucleic acid isolation. The isolated nucleic acid was combined with appropriate DNA linkers and cloned into a suitable vector.

The function of a specific gene or operon can be ascertained by expression in a bacterial strain under conditions where the activity of the gene product (s) specified by the gene or operon can be specifically measured. Alternatively, the gene product can be produced in large quantities in expression strains for use as an antigen, an industrial agent, or in structural studies. This expression can be performed in a mutant strain that lacks the activity of the gene being tested or in a strain that does not produce the same gene product (s). These strains include, but are not limited to, other Helicobacter strains and other bacterial strains such as E. coli, Norcardia, Corynebacterium, and Streptomyces species. In some cases, the expression of the host will utilize the natural promoter of H. pylori, while in other cases it is necessary to direct the gene with a promoter sequence that is derived from an expression organism (e.g., the E. coli beta-galactosidase promoter useful for expression in E. coli.)

The following methods are used to express a gene product using the natural promoter of H. pylori. The restriction fragment containing the gene of interest, together with its associated natural promoter element and regulatory sequences (determined using DNA sequence data) is cloned into a suitable recombinant plasmid that includes an origin of replication that is functional in the host oragnism and a suitable selectable marker. This can be accomplished by a variety of procedures well known in the art. The most preferred method for cloning purposes is to cut the plasmid and fragment with the same restriction enzyme to form compatible ends that can be ligated to form a two-piece junction. The recombinant plasmid is introduced into a host organism e.g. electroporation and cells containing the re36 combination plasmid are determined based on a selection marker that is carried by the plasmid. Expression of the desired gene product is detected using an assay specific for said gene product.

In the case of a gene that requires a different promoter, the base of the gene (coding sequence) is specifically excised and cloned into a suitable expression plasmid. A variety of methods can be used for this subcloning, but the simplest is done by PCR amplification of a specific fragment and ligation into an expression plasmid after the PCR product is digested with restriction enzymes or exonucleases to provide suitable ends for cloning.

The host suitable for expression of the gene may be any prokaryotic or eukaryotic cell. For example, a H. pylori polypeptide can be expressed in bacterial cells such as E. coli, insect cells (baculoviruses), yeast, or mammalian cells such as Chinese hamster ovary (CHO) cells. Other suitable host cells are well known in the art.

Expression in eukaryotic cells, such as mammalian, yeast or insect cells, may result in partial or total glycosylation and / or formation of relevant inter- or intra-chain disulfide bonds of the recombinant peptide product. Examples of vectors for expression in yeast S. cerivisiae include pYepSecI (Baldari, et al., (1987) Embo J. 6: 229-234), pMFα (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 ( Schultz et al., (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA). Baculovirus vectors that are suitable for expression of proteins in cultured insect cells (SF 9 cells) include the pAc series (Smith et al., (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow, VA and Summers) , MD, (1989) Virology 170: 31-39 In general, COS cells (Gluzman, Y. (1981) Cell 23: 175-182) are used to associate with vectors such as pCDM 8 (Aruífo, A. and Seed, B., (1987) Proc. Natl. Acad. Sci. USA 84: 8573-8577) for short-term amplification / expression in mammalian cells, while CHO (dhfr Chinese hamster ovary) cells are used with vectors such as pMT2PC (Kaufman et al., (1987), EMBO J. 6: 187-195), which provides for stable amplification / expression in mammalian cells The DNA vector can be introduced into mammalian cells by conventional techniques such as calcium phosphate co-precipitation. or calcium chloride, transfection mediated by DEAE-dextran or electroporation. host cell conformations can be found in Sambrook et al., Molecular

Cloning: A Laboratory Manual, ^2nd Edition, Cold Spring Harbor Laboratory Press (1989) and other laboratory manuals.

Expression in prokaryotes most commonly occurs in E. coli with either fusion or non-fusion inducible expression vectors. Fusion vectors usually add a series of amino acids to the NH ₂ terminus to the expressed target gene. These amino acids of the NH ₂ terminus are often referred to as the reporter group. The reporter groups have two functions: 1) increase the solubility of the target recombinant protein; and 2) facilitate purification of the target recombinant protein by acting as a ligand in affinity purification. In fusion expression vectors, a proteolytic cleavage site is often introduced into the junction of the reporter group and the target recombinant protein to allow separation of the target recombinant protein from the reporter group following purification of the fusion protein. Such enzymes and their related recognition sequences include factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA, USA) and pRIT5 (Pharmacia, Piscataway, NJ) that fuse glutathione-S-transferase, maltose binding to protein E, or protein A, with the target recombinant protein. A preferred reporter group is poly (His), which is fused to the N or C terminus of the protein and which retains the recombinant fusion protein readily isolated by metal chelate chromatography.

Inducible non-fusion expression vectors include pTrc (Ammann et al., (1988) Gene 69: 301-315) and pET11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990)). 60-89). While expression of the target gene relies on polymerase transcription of the host RNA under the control of a hybrid trp-lac fusion promoter in pTrc, expression of the target genes incorporated into pET11d relies on transcription under the control of the T7 gn10-lacO fusion promoter mediated by co-expressed RNA (T7 gnl). The viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3), which originate from a resident prophet λ carrying T7 gnl, the transcription being directed by the UV 5 promoter.

For example, host cells transfected with the nucleic acid of a vector that directs expression of a nucleotide sequence encoding an H. pylori polypeptide can be cultured under suitable conditions to allow expression of the polypeptide. The polypeptide may be secreted and isolated from the cell mixture and from the medium containing the polypeptide. Alternatively, the polypeptide is maintained in the cytoplasm, and the cells are collected, lysed, and the polypeptide isolated. Cell culture includes host cells, medium and other products. Suitable cell culture media are well known in the art. Polypeptides of the invention may be isolated from cell culture medium, host cells, or both using protein purification procedures such as ion exchange chromatography, electrophoresis, and immunoaffinity purification with antibodies specific for said polypeptides. Such procedures are well known in the art. In addition, in many cases, the polypeptides can be produced by chemical cleavage of the native protein (e.g., tryptic cleavage), and the cleaved product can be isolated by standard procedures.

When proteins bound to the membrane, they can be isolated from the host cell by contacting a fraction containing said protein with a detergent that forms a soluble complex, wherein the membrane-bound protein does not remain fully embedded in the membrane fraction, but dissolves at least in an amount that allows chromatographic isolation from the membrane fraction. Several different criteria are suitable for dissolving these complexes. One of these criteria is the ability of the detergent to dissolve the H. pylori protein contained in the membrane fraction, with minimal denaturation of the membrane-associated protein, allowing the activity and function of the membrane-associated protein to be maintained after reconstitution of the protein. Another feature to consider when selecting a detergent is the critical micelle concentration (CMC) of the detergent. It is preferred that the detergent of choice be high in CMC, allowing easy removal after reconstitution. Another property to consider when selecting a detergent is its hydrophobicity. Typically, membrane-associated proteins are very hydrophobic and therefore detergents that are also hydrophobic, e.g. it is a series of tritons that can be used to dissolve hydrophobic proteins. Another property important for a detergent is the ability of the detergent to remove H. pylori protein with minimal protein-protein interaction, allowing further purification. Another important property of the detergent is the detergent charge. For example, when considering ion-exchange resin purification procedures, a non-charged detergent is preferred. Chromatographic methods used in the final purification step are well known in the art and include hydrophobic interaction, lectin affinity, ion exchange, affinity staining, and immunoaffinity.

One strategy to maximize expression of recombinant H. pylori peptide in E. coli is to express the protein in a host bacterium that has a disrupted capacity for proteolytic cleavage of the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128. Another strategy is to alter the nucleotide acid encoding the H. pylori peptide so that it can be incorporated into an expression vector such that the individual codons for each amino acid will be those that are preferentially used in strongly expressed proteins in E. coli (Wada et al., (1992) Nuc Acids Res 20: 2111-2118). Such a change of nucleic acids of the invention can be accomplished by standard DNA synthesis methods.

The nucleic acids of the invention may also be chemically synthesized using standard methods. Various methods of chemically synthesizing polydeoxynucleotides are known which include solid phase synthesis which, like peptide synthesis, is fully automated and is carried out on commercially available DNA synthesizers (e.g., Itakura et al., US Patent No. 4,598,049; Caruthers et al. US. Itakura et al., US Patent Nos. 4,401,769 and 4,373,071).

III. H. pylori polypeptides.

The invention provides isolated H. pylori polypeptides encoded by the exemplified H. pylori gene sequences. Said polypeptides include those listed in the Sequence Listing. The polypeptides of the invention preferably contain at least 5 amino acid residues. Using the DNA sequence information provided herein, the amino acid sequence of a polypeptide of the invention can be deduced using well known methods. It is understood that the entire nucleic acid sequence encoding the H. pylori polypeptide can be isolated and identified based on an ORF that constitutes only a fragment of the related protein coding sequence. This can be achieved, for example, by using an isolated nucleic acid that encodes the ORF or a fragment thereof, serving as a primer for the polymerase chain reaction, wherein the template is H. pylori genomic DNA, followed by sequencing of the amplified product.

The polypeptides of the invention may be isolated from wild-type H. pylori or mutant cells, or from heterogeneous organisms, or from cells (including, but not limited to, bacteria, yeast, insects, plants and mammals) into which they are introduced. the bacterium //, pylori and where it is also expressed. In addition, the polypeptides may be part of recombinant fusion proteins.

The H. pylori polypeptides of the invention can be synthesized chemically using the commercially available automated procedures disclosed herein.

Many polypeptides of the invention are related. Some of these relationships are described in the tables below. 3 to 6. 3 are from the stop codon to the stop codon of the nucleotide sequence of H. pylori. One of ordinary skill in the art knows that the actual lengths of the polypeptides are usually shorter than the length between the two termination codons, since the initial codon of the charged tRNA initiator usually appears several nucleotides downstream of the previous termination codon and several nucleotides following the ribosome binding site. Dalgarno sequence ”). Since most ribosome binding sites in H. pylori have a number of the same general features with the binding site that occurs in E. coli, one of skill in the art can predict the true start codon from the terminating-terminating nucleotide sequence of the open reading frame with good reliability. The polypeptide sequences of SEQ ID NOs: 492 to 743 of the invention represent the distance between the stop to stop codons of the open reading frames of SEQ ID NO. All other polypeptide sequences of the invention represent predicted protein lengths from the start to the stop codon of the nucleotide sequences. One of skill in the art can recognize the start site in the stop-stop open reading frames of the nucleotide sequences set forth herein. In addition, one skilled in the art can determine alternative starting sites, some of which may be used in vivo in cellular mechanisms. A number of these alternative starting sites are small enough that one skilled in the art can readily test in known recombinant expression systems which of them provide authentic functional protein products. The relationship between the polypeptides set forth in Table 2. 3, can be described as follows. First, all of the polypeptides listed in Table 2 are: 3 are at least 90% identical in length and most are more than 95% identical. Second, the stop-to-stop codon lengths vary for some of the homologous pairs of polypeptides. In some instances, the shorter polypeptide comprises a relevant portion of a protein that may be used in the invention; in some cases, the longer polypeptide exhibits improved use. Third, some polypeptides in the second column are homologous to the shorter polypeptides that are listed in the fifth column.

In all cases, the homologous relationships described in Table 2 are incorporated herein by reference. 3 are highly essential. For example, a typical H. pylori gene product exhibits an amino acid sequence that is 92% to 100% identical between different H. pylori strains obtained from patients. The nucleotide sequences encoding the related polypeptides of the invention are also very similar. For example, nucleotide probes derived from the coding sequence of a polypeptide of the invention may be used in PCR or hybridization to identify clones that carry a nucleotide sequence encoding a homologous related polypeptide.

ORF name if length ORF name if length difference in length-% ID overlap cr = * £ O Q oo K cr * = # = (U Q CZ) ti

261 ch xT ro xT 138 69 ro -O CM 105 | ³¹⁹ 1 ro r- xr CM ro ro CM ro ABOUT OO xr CM ro ro within ABOUT CM 1_256 I ro r- ro ro ro CM within CM vO r- Ov ro within _ VO xr about ro 1 96 1 ABOUT ro CM ch within ch v ° © s © s 5 o ^x at © ch © s ch ch 'x o ^x from? © s ch from? x © ch ch with? ch ch ch from? with? with? ä? oV s? ABOUT about ABOUT ABOUT ch 5 ^ o ^x O Ch about about ABOUT about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT xr ch ABOUT about Ov ch ABOUT about ABOUT ABOUT oo ch ABOUT about ABOUT about ABOUT about 00 OV Ov Ov Ov Ov within Ov ABOUT ABOUT about about CM Γ about 1. J CM ro xr CM OO within ro about CM CM xr > about ch about about about ABOUT ABOUT ABOUT within about ABOUT ro about about about about about about CM xr xr CM xr ro about ABOUT within xr ro within ch ro xr ro ro CM CM within within ΓΟ ro ro CM r-. r- VO about about Ό r- about within T ΓΟ about - r- CM CM ABOUT within ro ABOUT within Γ ~ CM vO ch VO χΤ xr ro oo ro CM ro CM ro ro ro CM CM ro within CM CM oo about r- OO r- ch oo xr oo Ov ch ABOUT ch ABOUT ro within xr ro CM within xr within ro within within MO within VO within oo r- oo oo about ABOUT CM - xr about CM xr oo r- within VO VO within within within vO VO within VO MO MO within within within MO within within va within within within V-> within r- within VO VO VO VO VO within VO IN) ch r- xr CM xr ro within within Γ- within r * · L'- VO OO G D G G with CZ G G CZ CZ G CZ G CZ G G G G CZ C " VO G G ΰΞ G them U u. U 1- l_ l_ l_ 1-. in- L_ about about about ABOUT about ABOUT about ABOUT ABOUT and ABOUT ABOUT ABOUT ABOUT ABOUT about ABOUT ABOUT ABOUT about ABOUT about ABOUT ABOUT what about about within r- ro ro ro ch ch ch ch VO CM within CM - ro VO VO within m · within about about about ABOUT about within r- about about ABOUT ABOUT ABOUT about ABOUT about about · - - - « -> CM -. about ch oo CM CM CM ro ro ro ro ABOUT ABOUT CM VO ch within - CM CM 00 r- r- r- r- · - · " ~~ ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT - - « ABOUT ABOUT ABOUT about about - about CM C- <u CL Q. OJ ABOUT <L> D <υ ABOUT «D CL ABOUT 4J <D CL <D <U 4) 4> 4.> 4> Cl. CL CL CL CL about what OL OL CL CL CL CD Oju CL OL OL WHAT X 03 ABOUT ABOUT OL ABOUT ABOUT CL CL about ABOUT ABOUT about ABOUT OL CL VO C ~~ - · - - - - - · 1- ΓΜ ro CM within CM WHAT WHAT ch VO - VO -C about about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT about ABOUT ABOUT · " • ~ · about ABOUT ABOUT about about about about about 00 oo ro VO ch ro xr VO ro xr CM Ov VO ro WHAT ro CM OO oo oo WHAT OO about VO xr xr SO MO ro about «-> r- CM xr ABOUT about ro ABOUT within r * CM VO ch oo oo 00 Ov Ov ro CM CM CM CM ro WHAT ro WHAT within CM WHAT within xr xr xr CM within M0 MO r * r- 00 about r- ABOUT 00 ch ABOUT CM VO ro ch xr within VO CM CM CM ro ro r- • xT xT xT about ch ch ch xr about about xT xr VO within within ro within ro within within within ABOUT about about ABOUT ABOUT within r- r * r- r- ' r ** C * c * r * 00 00 r- r * · t * - r * C- 00 00 r ** c- r- oo what oo oo oo r- oo oo MO MO xt CM r ** » OV Ό- CM - - 00 ro CM 1 CM J within within - IN) 00 within - · - - 00 oo ro l I ( 1 1 1 l 1 «- · I 1 1 T within l 1 1 I | 38 and G WHAT about -O ABOUT ch I CM ABOUT ro about CM ABOUT about 1 CM 1 G CZ ABOUT and about about ro j ! * Γ Ί CM c_> CZ CZ ΰΣ G G G 1 CM 1 1 CM 1 CM C 1 CM 1 ABOUT 1 ro about 1 in- I 1 r- 1 within 1 about 1 in-the 1 VO 1 VO G about 1 1 CM 1 ro ro 1 ro 1 VO 1 within 1 within D oo oo xr xr 1 xr MO oo - ro CM within C- within CM ro ro 1 CM within - - - about about 1 Γ * within within Μ0 · - « ABOUT oo 00 ABOUT CM CM ro ch ch ABOUT ABOUT xr within within within Ov Ov r- © o oo oo - - MO oo · - · within r- xr CM r- OO ro - r- VO within xr - ro ro ro within within CM 00 oo oo - oo - · - ro xr r- Ov ABOUT · - ¹ < within ch CM ro WHAT ABOUT ABOUT ABOUT VO VO ro MO CM CM CM CM WHAT r- Γ XT xr ABOUT r * xr within CM VO ro within within about r- oo oo oo ro ro VO ABOUT xT xr VI within MO ro ro xr xr · - · about CM WHAT ro xr vO - r- CM within within within vO ABOUT ABOUT ro xr CM CM ro ro OO CM 1 CM CM xr | CM CM ro CM ro '' L oo | and s j CM CM CM 1 about 1 1 ro ro ro Ov 1 Ov ch ch vO 1 CM CM CM CM VO within CM CM VO Ό vO ABOUT VO within 1 VO within ABOUT about ABOUT ABOUT ABOUT -. r- «- · - · ABOUT - CM CM ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT  ABOUT about about CM CM CM MO MO MO within ABOUT VO within within within within VO VO C ~ C " r- r * - C- r- r- r- CM CM ABOUT ABOUT ABOUT - - · - · ' about ABOUT - - about about about about ABOUT about about about - - - - r " - __ ___ cm CM CM CM CM CM CM CM CM 4> <υ <L> 4J 4) 4) 40 ABOUT 4J <υ CL <L> about OJ <L> cl 4> (L) <u cx ABOUT_ about. LL n Q. CL CL what ca 03 CL CL CL CL CL CL 0L CL CA 03 03 OJ 4> OL OL OL CL 0L CL 0L OL OL 0L 00 - - - - - - - - · - · CM CM CM CM CM CM CM CM OJ CM CM CM CM CM CM CM ABOUT ABOUT ABOUT about ABOUT about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT about <_> ABOUT ABOUT about ABOUT ABOUT ABOUT

Table no. 3 continued

OO VO ro oo r- Ov Γ- Ov OV vr oo about m VO Ov vO m vr ΓΝ within VO oo it VO OO oo CN r- VO vr within CN Γ- c- c- Ov what CN Ov about CN CN Ov CN oo vr OO vr vr C- VO ro CN (- oo) CN CN CN ä? WITH? 2? from? X® © S from? o ^x from? 2? 2? 2? 2? 2? 2? The '' K ABOUT' 2? © ^ '' K ABOUT' oV to © ^ AS 2s with? 2? χο within Ov about about Ov ABOUT with Ov <_> about <O Ov ABOUT ABOUT UK s oO Ov within Ov oO Ov Ov Ov Ov C- Ov ABOUT ABOUT ABOUT ABOUT oO Ov about about about about ABOUT about ABOUT ABOUT ABOUT ABOUT c- Ov m Ov about about ABOUT ABOUT ABOUT about about about ABOUT about ABOUT ABOUT Ov Ov VO WHAT about ABOUT 1 147 about within t * 1 1 67 vr OO CN 981 | 1 284 981 | | 336 1 414 VO OO CN ABOUT about | 236 about about about ABOUT ABOUT - within about 1 277 | ^1,715 1 ABOUT 1 vr WHAT 48 j 00 VO OO VO m CN OO OO within VO ABOUT CN ABOUT 96 I oo en m VO Ov VO * Γ Ί CN CN v> within 00 | 98 WHAT OO CN Γ- within NO what OO OO 00 about CN CN within CN about CN m Ov CN oo vr oo νη vr within m CN oo WHAT vr CN vr CN Vt what vr CN within vr what vr what VO c- CN vr ABOUT vr CN Ό VO vr Ov CN about L0 Ov about ABOUT axis axis axis Ov within c- r- c- c * ABOUT within within Ov within Ov vr vr vT C * Ov m within m - WHAT oo oo θ ' vr within vd ΙΖΊ within vO VO within within within vO VO VO within VO vr within VO in n Ln V> VO VO vr> vO VO Ό VO about VO VO about Ov about about within oo VO OO - V-> C- ABOUT vO r- VO 00 WHAT G C WITH G C G G 2 G G C G C L ~ F G G G G G C £ with G L_ G G G G G G them them I_ IN. u. U. in- u. at L-. l_ them l- them about ABOUT about about about about about ABOUT about ABOUT ABOUT ABOUT ABOUT about ABOUT about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT about ABOUT ABOUT ABOUT ABOUT and ABOUT and about in n ABOUT oo oo OO Ov ro axis o> Ov Ov ro ro what · F- about ABOUT ABOUT ABOUT about ABOUT ABOUT about- r- C- c ~ C- and in Ov WHAT WHAT ABOUT about about · * - ABOUT about ABOUT ABOUT - F- - CN - .-. CN CN CN CN ABOUT FM. - F- F- F- about ABOUT within ABOUT · r- ro what ro - C- CN CN CN CN c- C- r- ABOUT CN within CN CN CN CN in n within vO VO within within m ro <_> oo ABOUT - ABOUT ABOUT ABOUT ABOUT F- ABOUT ABOUT ABOUT ABOUT · - · - - " CN - ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT - - - - F- ABOUT ABOUT CN - CN CN CN CN C) CL <υ about <L> CL ABOUT CL CL CL CL about (D <u ABOUT ABOUT <υ ABOUT <υ <1) <U about C) ABOUT ABOUT (D ABOUT <u and <υ CL CJQ about <υ QJ ABOUT ABOUT WHAT Λ σι C3 CD FROM FROM WHAT (OJ FROM C3 CA C0 CD WHAT - <J about about ABOUT (J 00 OU vr WHAT VO vr vr vr vr vr VO within within within vr vr vr - vr m VT) »Vol IZV Q_ vr vr vr ^ r vr - - « CL vr ABOUT about about ABOUT ABOUT ABOUT ABOUT about about about about about ABOUT about ABOUT ABOUT lc about about about <u about -C about ABOUT oo within within within VO Ov CN CN fN CN VO within within VO Ov 00 s m VO Ov within cn ΓΊ 00 m m n ABOUT about CN f- < r- f- · r- OO Ov C * C- r · * r ^ · ro ΓΟ WHAT about VO Ov oo OO · F- VO - · in n VO oo CN CN Ov CN CN CN what what WHAT what within VO CN WHAT CN vr CN Ov Ov CN OO Ov about VT vr VO Ό r- r- 00 00 vr vr vr Ov ABOUT m ΜΊ within CN m r ^ · vr oo s Ov ABOUT it LO V i in n within ABOUT ABOUT ABOUT ABOUT about about WHAT about vr vr vr VO about - within VO ABOUT VO - within VO within c- - M- r- Γ- r- r- OO oo oo OO oo oo oo oo r- c- oo oo c- C- C * 00 00 00 r · r- r * 00 00 r * s Ov r- r- m what CN VO VO about ABOUT - - «- m about Ov within about OO oo vO VO VD ABOUT Ov C * VO r- c * F "* - · - · * CN r- CN VD - Ov vr vr CN CN Ov CN CN Ov 1 M- 1 l 1 1 T CN ABOUT l l C * V J CN CN 1 1 1 T CN about ) C G 1 1 1 in- CN l ° G 1 about about 1 what about what about ro about what about 1 m about G G 1 £ m about cn Q I G ¹ C G, C G ¹ G ¹ F- ¹ o ABOUT · L- G G C CN 1 oo 1 within OO c- C- r- r * C * r- 00 - ABOUT C CN ΡΊ 1 1 C- 1 1 1 WHAT OO 00 CN VO oo VO oo oo CN CN c- r- r- c- VO within vO oo m OO within VO r- cn r- 1 oo Ov about about what within within s - «- · vr - F-F -M F- within within υη vr> VD about ABOUT oo VO vr about m about Ό VO - it it within VO in n within oo oo what c- WHAT what what what within within within VO within Ov CN m vr Ov about vr VO VO vr VO within r- VO CN Tt vr about Ov within within within within within VO in n vO OO CN F-F OO ό CN vr c- m C ^ Γ Ov CN CN what OO Ov TT 00 oo within C- VO within VO VO CN CN CN CN about C- Ό 00 Ov 00 CN VO Ov ABOUT oo OO within vr vr vr cn oo TJ- s Ov within Ov what what what ro vr vr vr vT CN m vr in n 00 (** · vr within VO vO within vT vr what CN vT CN what what CN CN CN CN CN ° * | CN | CN r * V CN CN Ov ^ 1 CN vr vr vr - CN CN I CN ABOUT at © vr vT vr ΓΝ CN CN CN CN and CN CN CN CN CN VO VO ABOUT about about ABOUT m within VO vO within within Ov Ov Ov within ABOUT ABOUT · - · - «- · about ABOUT about ABOUT ABOUT ABOUT about ABOUT ABOUT ABOUT F- - CN ΓΝ CN CN CN about r- r- oo oo oo CN CN CN CN CN CN CN CN CN CN OO oo ΓΝ CN ΓΝ CN CN oo oo 00 00 00 - * - · F-F what about ABOUT ABOUT ABOUT ABOUT «-» MM -M - - F- • - · about about ABOUT ABOUT ABOUT ABOUT · - about about about about about - F- - about CN CN CN CN CN - MM m- » - · - · - - m m m m CN - · F- F- - F-F -F CN f) clay CL CL CL Cl Cl. CL CL CL CL CL CL CL. CL about about <L> t> 4> <υ CL <J> a.> about 4> <L> CL CL CL CL FROM 00 00 OO OO about about ABOUT about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT FROM 00 c3 WHAT <ΰ 03 ABOUT about about <D <u <u C3 03 C3 what CN CN CN CN CN vr vr vr vr vr vr vr vr vr vr vr vr i / D Ό ir> νη v-V »ΖΊ within vO VO VO within VO within VO ABOUT ABOUT ABOUT ABOUT ABOUT about about about about about about about about about about about about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT about ABOUT about ABOUT ABOUT ABOUT ABOUT ABOUT

Table no. 3 continued

*ABOUT CM ABOUT Tt r- about axis WHAT Tt axis SO about TJ- Ό C ' axis CM CM SO r- • ςτ- about with -O with Tt ABOUT oo WITH c ~ about axis with tt CM with Ο » - SO Ό - SO TT M Tt about SO SO r- Ό t ~ W * Tt CM CM ro TT ro ABOUT CM TT CM WHAT CM WHAT CM with CM CM what SO with WHAT CM 1 97% % ooi | % οοι | 1 100% \ ° cp ABOUT ABOUT | 99% 'x © S ABOUT ABOUT 'x cP axis axis cP ABOUT ABOUT X® oS ABOUT ABOUT x o ^x O O | 100% environment axis axis oS ABOUT ABOUT o ^x O O '' K ABOUT' m axis o ^x Os Os · cr ABOUT ABOUT oS ABOUT about er · r- axis 1% 66 1 '' K CJ ABOUT ABOUT ! 92% 'x o ^x O O cp · axis axis 100% 1 96% | 100% 1 100% 98% 95% | SO axis SO axis C- CM with sO Tt about axis SO ! about ABOUT about SO ABOUT Tt SO ro SO about OO ABOUT CM ABOUT ABOUT about ABOUT ABOUT SO ABOUT ABOUT ABOUT about Tt about about WHAT 1 -O TJ- TJ- TJ- WHAT WHAT Tt axis CM about Tt 56 axis about 00 TJ- axis OO what OO «Ο SO R * axis WHAT CM SO OO SO Tt ABOUT L 99 c * Tt with Tt about OO - ABOUT CM SO TJ- CM SO axis SO ΤΓ with - SO CM Tt F- » Tt ABOUT with c ~ c- SO oo tf CM CM CM Tt Tt rs with CM TT CM WHAT CM what CM CM CM WHAT with WHAT CM about ABOUT about with CM Tt SO oo CM ABOUT c- ro OO axis TJ- axis with ABOUT ABOUT WHAT Ό CM Tt WHAT SO oo WHAT ABOUT about SO SO Γ * CM CM with Γ- CM Tt what r- C- » ABOUT Ό axis ABOUT' ABOUT SO TJ- oo ABOUT OO axis OO with C * CM WHAT Tt Ό Ό Ό with with Ό about r * SO with with SO with SO SO SO SO with SJ Ό C- with C- Ό with SO SO SO SO SO C- with axis with what within with Tt TJ- £ SO Ό axis C- CZ C CZ f? ¹ G £ T CZ C G G with G CZ C G G CZ C CZ G From £ G u_ G CZ Cl CZ G TZZ C l_ IN- u. L_ u. u- 1-. k k_ · L - u_ L- t U. ABOUT ABOUT ABOUT about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT about ABOUT about ABOUT ABOUT ABOUT about ABOUT about ABOUT about ABOUT ABOUT ABOUT ABOUT about about about ABOUT about about m OO ro about ό νΊ - - - · · F- with - TT TJ- TT about SO Ό about with about CM CM r- SO CM - with axis with TT ABOUT - about about - · - - F- F-- · - «- ABOUT -F- > - ^ · · - - « about ABOUT CM ABOUT CM Ό SO - ABOUT about ABOUT Tt about with Ό with c- ABOUT ABOUT - axis about axis CM with p- C- TJ- c- C · r- OO SO axis ΓΟ WHAT SO c- C- axis what what Ό axis about about ABOUT about - - - · ABOUT about ABOUT - about - ' - - - about ABOUT - · ABOUT - · r- ABOUT about ABOUT ABOUT ABOUT m CM ro - - - - F- · F- CM OO CM CM - r- - - - - - - F ~> »- · CM CM Q- CL CL about CL cl CL <L> about <u CL CL CL CL CL CL about <L> CL <L> CL CL CL CL CL about Q. Q- <υ ABOUT CL about ABOUT ABOUT fl> «5 CD 03 ΓΜ CM CM CD CD ABOUT ABOUT ABOUT ABOUT what WHAT WHAT ου WHAT TT Tt CD ABOUT CD ου ABOUT what ABOUT CD Ό about SO with C- C- C CL CL CL about P- C ' C- - « TJ- TJ- TJ- WHAT with CL CL what Tt what SO with CL Tt Tt ABOUT ABOUT ABOUT about ABOUT ABOUT ABOUT JZ JC -L ' ABOUT about about about ABOUT about about about JC _C ABOUT ABOUT J = ABOUT Ό CM about Tt OS ro rs CM TJ * about about Ό CM axis axis CM CM CM C- Tt SO SO C- ABOUT ABOUT c * Tt about 00 r- r ^ · ABOUT ABOUT ABOUT ABOUT ro C- about about SO C- Ό > -> with CM TT C- C * Tt ABOUT with with with ABOUT about Tt CM CM CM CM Tt 00 oo Ό CM SO SO CM CM WHAT CM CM CM CM WHAT WHAT with C- c- CM what -ABOUT* Ό CM CM SO SO Tt TJ- with C * C C r * 0O 00 ABOUT\ axis ABOUT ABOUT ABOUT CM CM CM what c- r- r- SO SO r- m with with · r- what c- CM TT CM ΓΜ oo OO OO CM CM oo Tt Tt c- r * r- OO c- c- c- OO C- c- oo 00 OO c- oo c- OO C- OO OO oo OO c < r- c- WHAT oo r- OO OO tf TJ- c- about CM c- Tt WHAT ^ t axis CM | CM CM | CM CM CM about - 00 WHAT SO I CM Tt with CM • 'T. ** 1 C * · and Tt 1 1 1 | | m 1 TJ- 1 I CM I 1 1 1 1 08 about 1 l cn about C 1 Q 1 C 1 1 ro about J about 1 about 1 1 G ABOUT\ 1 G CZ 1 CZ 1 1 m about 1 G WHAT ABOUT 1 1 G about 1 G 1 C 1 1 G 1 C l D G 1 CM ABOUT 1 WHAT ABOUT 1 WHAT about 1 ABOUT 1 | j what oo 1 CM CM CM about r * oo oo 1 1 1 SO 1 00 about WHAT 1 l 1 with 00 00 Γ about Ό 00 - · f- 1 r * CM CM CM 1 axis axis CM CM CM CM oo with F-. CM CM F- about oo OO c * S + -. CZ 1 with Ό ABOUT ro ro WHAT with "about «Ο ABOUT ro CM CM SO axis SO with WHAT r * Ό OO 00 CM about CM WHAT WHAT c- 1 1 CM with ABOUT <O 00 oo axis sO - CM * -> TJ- Ό CM CM · - · about 00 about about · ~ · about axis axis axis SO Ό with * / t c- axis c- ro ro SO with ABOUT about r- ie with SO m WHAT WHAT SO about with about »- · - · 't about SO oo OO 00 00 00 Tt Tt oo with axis axis Tt - * tf Tt CM SO ABOUT ABOUT c * Ό TJ- about tT WHAT CM CM CM - « with with with with C * C- what what SO ro ro ro Ό with SO CM p- CM CM CM axis axis axis TJ- CM tr OO OO ABOUT Tt axis WHAT WHAT ABOUT SO with CM j CM Tt CM CM CM CM what -O what C- axis CM with SO Ό l CM Tt · T, WHAT I CM I | CM j oo oo what what what 1 OS with with ro what WHAT SO -J axis axis SO SO WHAT WHAT CM WHAT sO CM CM SO with SO ABOUT about about about - - -> - »-« ABOUT »- -> ABOUT ABOUT ABOUT WHAT CM CM CM ABOUT F-. - CM CM F- F-_ with with with r- about about - CM CM CM CM SO ABOUT ABOUT axis axis ABOUT ABOUT *about WHAT WHAT ΓΟ WHAT - C- C- CM CM 00 SO SO ABOUT ABOUT ABOUT <-> - F- - - · - ABOUT ABOUT · - ABOUT about ABOUT ABOUT ABOUT about about ABOUT ABOUT about what what ro - · - CM OO - - CM ro CM CM CL Cl. CL about CL cl CL CL CL CL CL Cl <S> about CL CL. n n ABOUT, 4> <υ <L> ABOUT CL <u <υ CL CL CL ABOUT ABOUT ABOUT about ABOUT <U CD CD CD CD 03 CD CD CD c_> about 4> D about <_> ABOUT fM ου ου ου ου CD CD CD CD CD about ABOUT with Ό SO SO c- c- C- C- r- r ^ · P P- C- r- C- C- axis axis axis axis ΓΜ CM CM CM WHAT ro Tt Tt Tt Tt Tt ABOUT ABOUT ABOUT ABOUT about about ABOUT ABOUT about about ABOUT ABOUT ABOUT about ABOUT ABOUT about about about ABOUT

Table no. 3 continued

within OO OO 1 227 I 1_Z9 1 ABOUT 1,409 1 OO The £ 3 98 L '49 | L ‘49 1 276 | xr axis rs rs L ³¹² 1 Γ- ΟΟ about rs CM axis VO CM OO they ¹⁸⁵ «WS vO r- ~ «WS 277 146 axis VO 1 901 382 CM Π «ZS ABOUT 1 100% 'x o ^x O O 'to © v ABOUT ABOUT | 100% [97% x? θ ' ABOUT ABOUT | 93% VO θ ' WITH? Γ- axis 1 99% o ^ - axis axis V® about- ABOUT ABOUT % ooi | -e θ ' ABOUT ABOUT | 99% | 100% \ ° axis ABOUT ABOUT S® about' ABOUT ABOUT OO OS 'x about' OO axis with? o ^x Os Os '' K o ^x O O '' X about' 00 axis 1% 86 100% 1 '' X o ^ - axis axis 99% 100% I 95% | about I / S ABOUT about ABOUT axis C- I 234 1 187 within «WS CM ABOUT : 9Z_I «WS ABOUT ABOUT rs about ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT rs about -30 I ABOUT about «WS 1 98 r- Γ- axis axis OO «ZS | 86 axis rs OO they rs «WS r- ABOUT axis OO «WS «ZS Γ- r- within 1 69 I VO CM CM 00 C * S CM about ABOUT 00 rs they vO r- axis they CM 00 rs VO they 00 within "/WITH they rs OO CM rs CM they CM CM rs rs CM CM CM rs axis «R> Ό OO about r- axis OO r- ABOUT about «WS OO r- OO «ZS they within r- CM CM ABOUT axis axis OO r- about OO 00 CHILDREN «WS «ZS they they axis - WHAT r- 00 CM CM axis axis they - they CM CM they OO they rs VO rs C- ABOUT VO VO VO VO within within within XT within within «ZS within within r * VO within •"about «ZS VO VO VO Γ-- «WS «ZS «WS «Ο «WS VO OO axis CM c- tt r- rs tt £ rs axis rs WITH ABOUT CM they G G G G G C G G D u- CZ G , 'Τ and C G L-. G and G and G «LL and CZ «ZS 1_ ABOUT ABOUT ABOUT about about about ABOUT about ABOUT ABOUT ABOUT ABOUT about ABOUT ABOUT ABOUT about about ABOUT ABOUT ABOUT about about about ABOUT ABOUT ABOUT about ABOUT rs axis axis OO OO OO OO OO OO rs CM CM CM CM r- r- r- - rs «WS «ZS «WS «WS m rs rs rs CM VO ABOUT about - ABOUT ABOUT ABOUT Γ- about about about »-« they CM CM ABOUT ABOUT r- • - - * about rs rs within within within within VO with about OO OO OO CM OO OO OO CM CM VO within Ό rs rs CM CM CM CM rs CM ABOUT ABOUT * ί ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT * WS ABOUT • WS ABOUT <P ABOUT ABOUT - " · - ABOUT CM CM CM CM <u about <D <L> 0> <X> ABOUT <υ CL CL CL CL CL CL CL CL ABOUT <u CL CL CL L> <D CL CL CL CL CL they what OU ABOUT about ABOUT about about about «3 WHAT WHAT CM rs rs rs «ZS D «WS CM CM 00 OO OO 00 OO OU (j CL «-« - CL axis axis axis LL LL LL CL CL CM CL LL CL CM CM they they they they Γ- J = - - ABOUT about about about ABOUT about _C ABOUT ABOUT ABOUT x: JC x: JZ x: ABOUT JZ JZ JZ ABOUT ABOUT ABOUT ABOUT ABOUT within within Γ- axis OO CM CM CM axis OO axis they rs CM c- ABOUT axis OO WRS • WS r- Γ- rs 69 1 Ό CM CM rs CM about OO CM CM they they 00 CM axis they OO rs VO they 00 within «WS r- they ABOUT 00 CM TR CM they CHILDREN TT rs rs rs rs CM CM CM rs rs rs CHILDREN «rs VO r- 00 00 they vs cb within ABOUT r- 00 CM OO axis about CM CM rs you «WS rs VO they CM CM CM CM CM CM CM CM 00 OO CM OO rs OO rs rs rs OO OO axis axis axis they axis axis axis rs axis rs OO 00 OO OO OO OO OO OO r- r- OO r- OO r- OO OO OO r- Γ- r- OO r- r- Γ- OO Γ- OO axis about about CM VO ABOUT axis ABOUT r- r- 00 and 00 1 m r * «WS * WS | CM CM CM CM · r- - · «WS θ ' CM VO r- CM rs VO they «WS rs - 1 J 1 1 ! 1 j 1 1 1 T they 1 1 CM ABOUT 1 I CM they 1 1 C! G rs about C VO I G already IZ C CM ABOUT C C about C they <4 G CM G, G C C 1 G 1 CM about rs about about L- within o ¹ CM 1 CM G 1 «ZS CM 1 CM 1 CM 1 rs 1 • WS 1 about 1 ABOUT within G 1 OO 1 CM CM Q ABOUT 1 r- 1 CM 1 about 00 ABOUT 1 J CM r- I CM CM CM VO VO J within ABOUT CM about 00 rs 1 within 1 «WS OO ABOUT «ZS 00 ABOUT OO VO 00 ABOUT axis axis r- «ZS f * S axis C- r- OO «WS rs CM CM «- · «ZS CM "/WITH r- rs «WS C- CM - vO ABOUT rs ABOUT ABOUT CM rs «WS C * S VO SO r- VO CM C- VO axis rs CM «WS they OO vO CM about vO CM r- you rs CM CM rs CM rs rs sr> CM axis OS ABOUT CM about they «WS they V0 axis Γ- OO «ZS Ό ABOUT axis CM Γ- CM CM Tt axis «WS within rs rs VO VO they OO Ov rs rs OS ABOUT within they OO VO Ov they rs ABOUT CM they TJ- CM rs they they they - CM rs they within OO axis axis CHILDREN - rs they they OO · - · they they CM CM CM G G CM G rs CM CM CM . j CM CM | 00 rs and CM ( CM ^ 1 they CM | CM | rs | ABOUT 1 about 1 about 1 1 1 rs CM CM CM CM r- r- Γ- CM r- r- Γ- r- Or axis axis axis rs CM CM CM CM CM CM CM CM - Γ- r- Γ- Γ about about ABOUT «- · they within with VO with rs rs rs rs rs Γ- Γ » r ~ - m rs rs rs ABOUT CM CM CM CM OO OO OO CM CM vO LA axis CM CM rs rs rs rs CM ABOUT ABOUT fs ABOUT about ABOUT ABOUT ABOUT ABOUT xr ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT ABOUT «WS «ZS «ZS ABOUT about CM CM ABOUT ABOUT ABOUT ABOUT ABOUT f * S rs rs rs CM CM CM CM CL Q. Cl Q> β> <3> <u e) CL CL CL CL CL CL CL CL (D CL CL about <L> <u (D OJ <L> OJ L> CL <υ o> OO 00 FSO he O0 00 CM CM CM CM rs rs rs «WS • WS «ZS Ό VO VO within "ABOUT within within VO "ABOUT axis axis axis axis OS axis axis axis axis CL CL CL CL LL LL CL CL CL CL CL LL LL CL CL CL CL CL CL LL CM CM CM CM CM CM CM CM CM _C -C _C x: JG x: x: x: x: x; XZ X. x: X. _c x: JZ JZ JZ JZ

The relationship between the polypeptides of the invention is described below in Table 2. 4. All lengths of polypeptides in Table 4. 4 are measured from the stop codon to the stop codon in the nucleotide sequence of H. pylori.

The relationship between the polypeptides, which is shown in Table 1, is shown in FIG. 4 is described as follows. First, the length of the polypeptides listed in Table 2 is shown below. 4 is at least 90% identical, most of which are more than 95% identical. Second, the stop-to-stop codon lengths vary for some of the homologous pairs of polypeptides. In some instances, the shorter polypeptide comprises a relevant portion of a protein that may be used in the invention; in some cases, the longer polypeptide exhibits improved use. Third, some polypeptides in the second column are homologous to the shorter polypeptides that are listed in the fifth column.

In all cases, the homologous relationships described in Table 2 are incorporated herein by reference. 4 are highly essential. For example, a typical Äpylori gene product has an amino acid sequence that is 92% to 100% identical between different H. pylori strains obtained from patients. The nucleotide sequences encoding the related polypeptides of the invention are also very similar. For example, nucleotide probes derived from the coding sequence of a polypeptide of the invention may be used in PCR or hybridization to identify clones that carry a nucleotide sequence encoding a homologous related polypeptide.

Table no. 4

ORF name if length ORF name if length-% i- for- Changes SSeq (if) Seq ^{ka de} - ^range length I1D # ID # (if) ^{tlty (aki} Olcel1104 36125337 cl 8 849 74 iplel0523orf3 612 63 100 63 11 01ce21104 33203250 c3 87 850 509 05cpl191lorf35 549 206 100 204 303 01cp20708 36134808 f2 l 1 928 230 14eel0419orf5 704 229 100 229 1 02ae31010 12504512J3 28.aa 929 490 01 ge 10801 orf1 514 60 95 56 430 02ae31010 16833312 f2 19 930 181 02cell022orf2 530 184 98 181 -3 02ae31010 2117087 f3 34 931 137 07cel0203orfl7 635 76 97 77 61 02ae31010 30208317 fl 14 932 343 iplpl3947orfl0 717 343 100 343 0 02ae31010 34616666 f2 27 851 184 Olcel 1618orfl 503 124 99 125 60 ^ ae31010_34616666_f2_27 851 184 hplpl3947orfl 1 616 81 94 77 103 flke31010 35270000 f3 33 852 231 Olepl 1504orf5 505 156 99 156 75 02ae31010 36132785 f2 29 853 438 Olcel 1618orf3 499 67 98 64 371 02ae31010 36132785 f2 29 853 438 Olcel 1618orfl3 504 378 97 387 60 02ae31010 5085162 cl 47 934 416 07cel0203orfll 634 416 100 416 0 02cp10615 26573462 c1 45 935 168 hp3pl0304orf2 727 126 91 129 42 02gel0116 15781452 cl 87 854 97 OógelOl I5orfl7 563 97 100 97 0 02gel0116 J 6803513 f2 34 855 488 Olepl 171 Oorfl 5 652 64 100 62 424 02geI0116 16803513 12 34 855 488 Olepl 1710orf5 654 146 99 145 342 02gel0116 36367936 cl 92 857 173 02ge20116orí25 521 173 100 173 0 03ael0804 12609533 cl 26 936 257 06epl0306orľl0 610 257 100 257 0 hp6p 10903 4398263 f3 5.aa 924 370 05gp 11901 orfl9 553 370 100 370 0 hp6 _P 10903 4398262 D 6.aa 924 370 05gpl 1901orfl9 553 370 100 370 0 03 ae10804 21698400 c2 31 937 386 06epl0306orfl 1 611 386 100 386 0 03ael0804 23485968 c3 47 858 88 06epl0306orf5 561 88 100 88 0 04ep41903 26757937 f3 16 938 703 29apl0306orf3 711 325 97 319 378 04ep41903 26757937J3 16 938 703 29apll902orfl 712 280 92 280 423 04ep41903 4101593 f2 l O.aa 940 1240 14ee211 lSorfl 706 3.65 96 358 875 Ael09I0_25598277 f3_3 859 258 07eel 1519orfl 567 170 96 166 88 Wpl0815 26570332 c2 99 941 183 12gel0610orf2 702 97 98 97 86 05epl0815 4195292 c1 84 942 441 hplel0554orfl 715 103 99 94 338 05ep10815 47I9175 c1 83 943 663 06eel0207orfl 606 99 99 99 564 06ael1016 30579712 f2 21 860 239 Q3ce21717orfl 526 193 99 193 46 06ce20610 l 367157 f 1 8.aa 844 248 29gel0111orfi 714 124 90 121 124 06cc20610 29298537 c2 31 861 234 05gp2011 lorf4 555 234 100 234 0 06ce20610 3913967 c3 36 862 283 05gp20111 orfó 556 283 100 283 0 06ce20610 4331338 f3 18 863 353 05gp2011 lorfl2 554 ' 243 99 245 110 06cpl1118 212827 cl17 864 73 06cp 11118orf7 558 73 100 73 0 06cpl1217 19720300 f3 l 1 865 308 hplpl3852orf6 614 646 96 278 -338 Oócpl1217_4881263_f2_9 866 93 hplpl3852orf7 615 93 100 93 0

Table no. 4 continued

Ooepl1217 4897077fl 6 867 100 hplpl3852orf4 613 100 100 100 0 06cp30603 21492187 f2 41 868 106 04gpl 1213orfl4 539 136 98 '106 -30 06cp30603 34024187 fl 20 869 483 04gpl 1213orfl 1 538 122 100 122 361 06cp30603 34024187 f7 20 869 483 04gpl 1213orf5 669 382 95 377 101 06cp30603 679218 f2 34 944 380 hp3el0302orfl7 721 231 98 236 149 Oóep10615 14649077 f3 51 871 300 04cel 1617orf4 534 152 96 145 148 Oop 10615 961562J2 41 945 636 29ep20112orf2 713 135 98 87 501 Ooepl 0615 9842 D 46 872 159 05epll717orf2 552 192 99 159 -33 Ooepl1202 133293 cl 19 946 167 06cp20302orf3 602 167 100 167 0 Ooepl 1202 26353438 cl 22 873 286 bp2e 1 1858orf6 623 155 100 154 131 Ooepl1202 26353438 cl 22 873 286 02ae2l214orfl 522 109 92 110 177 Ooepl 1202 792962 c2 26.aa 949 151 P6C _P 20302orf6 604 66 92 66 85 Oóepl1202 4884677 cl 17 948 171 06cp20302orf5 603 171 99 171 0 Oóep1191724803153 c3 24 848 409 hp4el4535orf3 536 253 98 239 156 Oóepl1917 24803153 c3 24 848 409 hp4el4535orf7 730 60 97 60 349 06ep30223 16512 c3 160 951 231 hp3el0128orfl 720 231 100 231 0 06ep30223 23476067 cl l19 952 151 01ep30520orí8 511 94 93 95 57 06ep30223 23557202 c2 130 874 329 ip3el 1024orf49 630 329 100 329 0 06ep30223 34409437 f3 94 875 148 ip3el 1024orf5 631 148 100 148 0 06ep30223 4698838 f2 55 845 663 14gpl2015orfl3 662 344 100 334 319 06ep30223 4698838 £ 2,55 845 663 14gp 12015orf 16 663 117 99 112 546 06ep30223 4876077 c3 149 877 113 hp3el 1024orf34 629 113 100 113 0 06ep30223 5109443 cl 109 878 342 05eel 0411 orf5 551 293 95 287 49 06ep30223 5271902 cl 106 879 207 hp2el0229orf4 619 80 95 38 127 06gpl0409 3398427 f2J 2 880 115 13ael0511orO 583 115 92 115 0 06gp71906 15115637 f2 59 953 158 np4pl 1393orf2 733 158 100 158 0 06gp71906 24261588 c2 174 881 96 01 and e 12021 orf5 492 96 100 96 0 06gp71906 25478192 c1J 31 954 236 ip3el 1122orf3 723 236 100 236 0 06gp71906 2550418 7 f3 112 955 443 hp4p 11393orfl 732 169 91 155 274 06gp71906 970325 c3 190 882 158 02ap21113orí2 512 113 92 98 45 07ael0923 24426508 fl l 883 137 1 Igel0309orf28 685 137 100 137 0 07ae10923 24426508 fl J 883 137 1 Igel0309orf28 685 137 100 137 0 09cel0413_41401l_fl_3 885 169 02cel0216orf6 516 172 100 169 -3 09cel0413 5865665 fl 4 886 353 02ce 10216orf7 517 74 100 74 279 09ce52017 29324062 c1 21 887 141 01ep30520orf24 506 141 100 141 0 09cp10224 1062966 c3 61 888 367 05cel0420orfl 548 194 100 194 173 09cp10224J 412715 c3 56 889 185 01 ce 10516orf20 495 185 100 185 0 09cp10224 429510 c2 46.aa 890 316 01cel0516orf21 496 108 98 108 208 09cp10224 4484718 c138 891 581 OlcelOS 16orfl5 493 301 99 297 280 09cp21607 7224187 c2 12 892 72 07gp31516orf9 569 72 100 72 0 09cp61003 1456263 7 c2 93 893 106 03gp20123orf3 527 80 98 83 26 09cp61003 19532625 CI 78 894 357 14gel0705orfl4 599 357 99 357 0 09cp61003 24063587 cl 74 895 201 1 leel0423orfl 577 116 100 116 85 09cp61003 24335762 c3 l11 896 204 1 Ieel0423orf4 578 105 100 104 99 09cp61003492187 c2 80.aa 956 667 06gpl0108orf2 621 266 98 266 401 09cp61003 5945252 fl 5 897 219 14gel0705orf3 695 219 100 219 0 1lae80818 l1188791 c3 60 898 221 1 catches 1902orf3 575 185 99 185 36 11 ae80818 19632781 c3 58 957 100 Ooepl 1722orfll 595 100 100 100 0 11 ae80818 7290627 c2 51 958 152 Oóepl 1722orf5 598 98 100 93 54 1 lae80818 783127 c3 64 899 182 03ap21820orf4 523 182 100 182 0 1 lae80818 7952 cl 49 900 148 03ap21820orf8 524 148 100 148 0 ) 1ap20714_34O23312_f3_46 959 285 hp3el0057orf3 719 285 100 285 0

Table no. 4 continued

1lap20714 4960432 c3 96 901 151 14eel 1217orf2 596 100 100 88 51 1lap20714 5271967 cl 60 902 260 14eell217orfi 597 231 100 227 29 1 lap20714 7227202 f3 43.aa 903 798 05ap21216orf4 547 529 100 529 269 1 lap20714 7227202 f3 43.aa 903 798 05ap21216orf4 547 529 100 529 269 11 ee 11408 4977193 c 1 .aa 960 497 14ep 11115orí3 708 91 100 91 406 11 gel0308 5256 ll 961 71 1 lgel0308orfl 693 71 100 71 0 12apl0324 13178562 f3 7 962 269 12apl0324orf8 700 164 99 164 105 12apl0324 4805318 f2 3 846 326 12apl0324orf6 581 95 100 77 231 12apI0324 4805318 f2J 846 326 12apl0324orf5 645 215 99 213 111 14ce31519 15635927 f3 14 905 293 Ó2cel0809orf6 518 293 100 293 0 14ce61516 13073577 f2 12 963 784 14epl 1905orfl3 709 721 100 526 63 14ee41924 I6282067 c1 72 964 64 02ep30607orf32 546 104 97 63 -40 I4ee41924 23527267 c3 107 906 233 02ep30607orf27 520 138 98 97 95 14ee41924 23 834800 f2 32 907 298 1 Icel0917orfl0 639 298 100 298 0 14ee41924 2458267 c2 93 847 1304 02ep30607orfl9 590 407 99 397 897 hp p 13939 25397327 β 22 908 228 06cel0808orf2 557 151 100 145 n hp2el091l 24855312 cl 69 909 161 1 Icpl2006orfl3 576 105 95 112 56 hp2eI091l 3349 cl 63 910 113 Olcel 1618orf22 648 79 100 65 34 hp2el091l 4882027 c2 87 965 583 Olcpl 1108orf6 507 101 99 99 482 hp3eli 188 47327 f2 4 966 368 hp3pl0807orf6 728 325 96 323 43 hp3el 1188 5082842J3 l2 967 89 06eel 161 lorfl 608 89 100 89 0 hp4e133943368767cI 80 968 804 09apl 1406orf2 668 804 100 804 0 hp4el3394 35957200 fl 21 911 233 lepep 1 1108orfl 7 562 165 100 147 68 hp4eI3394 5964452 c2 97 912 79 02ap71220orf2 513 79 100 79 0 hp4e53394 22864682 c2 86.aa 913 427 hp 1 p 13 852orph6 614 646 100 422 -219 hp5e 15044 4554652 f3 3 914 146 07cpl0312orf5 677 138 100 138 8 hp5p! 5212 6928132 c3 34 969 270 1 lce! 682 165 93 169 105 hp5pl5575 2930031l cl 29 915 152 14cel0720orf3 591 163 95 152 -11 hp5p 15 57 5 3,344 5,317 f2 20.aa 916 294 hp3pl 1086orfl 636 217 92 202 77 hp5p155756140713 f2 18 917 288 14cel0720orfl2 589 288 100 288 0 hp5pl56411219528l cl 24 918 92 hp5p 15612orf2 643 92 100 92 0 hp5p15641 24304527 c3 36 919 139 29gel0307orf4 609 103 98 102 36 hp5pl5641 25635452 c3 34 920 92 29gel0307orf3 607 92 100 92 0 hp5p15641 30273312 c228 970 301 05cel0613orfl 572 79 91 70 222 hp5p1564I 30273312 c2 28 970 301 05cel0613orf2 573 61 100 54 240 hp5p15641 5211687 c2 29 971 297 05apl0914orf3 571 60 98 60 237 hp5pI5870 14350428 fl l 921 84 05ae20220orf56 543 101 99 79 -17 hpóp1059023440913 c2 31 922 371 04ee70114orfI0 535 243 98 235 128 hpóp10590 30521093 f2 14 972 138 07ceI I206orfl 637 107 97 107 31 hp6pl0606 19546933 c3 31 923 283 13epl2003orf21 587 222 92 228 61 hpóp109042214676 c1 14 926 179 hp4pl3446orf3 640 179 99 179 0 hpóp10904 23 704412 f2 5 927 384 hp4pl3446orfl3 638 384 99 384 0 hpóp10904 7089062 c1J 6 973 364 hp4pl3446orf5 736 364 100 364 0 hpóp12129 16603417 f3 14 974 358 hp3el0302orf26 722 268 98 266 90 hpóp12244 394 8467 c1 52 975 476 hp4pl2005orf2 735 108 96 84 368 hpóp22217 234 70967 fl 4 976 272 13eel2016orf7 703 272 100 272 0 hp7el0192 4412568 f2 5 977 291 02cel0114orf3 525 291 100 291 0 hp7pl0287 24611325 c2 24 978 256 Olcel 1513orfl 6 500 256 100 256 0 hp7pl0290 255488l2 f3 14 979 489 hp3p 10156orf2 724 333 100 333 156 hp7pI0290 25585941 f3 12 980 374 hp3pl0156orf3 725 91 91 87 283 hp7pl0290 3515Ó558J3J5 981 411 1 Icpl2002orf3 689 109 96 107 302 hp7pl0290 4351718 fl 6 982 324 hp3plO1 56orf7 726 302 95 299 22

The relationship between the polypeptides of the invention is described below in Table 2. 5. All polypeptide lengths in Table 3. 5 are measured from the stop codon to the stop codon in the nucleotide sequence of H. pylori.

The relationship between the polypeptides, which is shown in Table 1, is shown in FIG. 5 is described as follows. First, the length of the polypeptides listed in Table 2 is shown below. 5 is at least 90% identical, most of them more than 95% identical. Second, the stop-to-stop codon lengths vary for some of the homologous pairs of polypeptides. In some cases, the shorter polypeptide comprises the relevant polypeptide. a portion of a protein that can be used according to the invention; in some cases, the longer polypeptide exhibits improved use. Third, some polypeptides in the second column are homologous to the shorter polypeptides that are listed in the fifth column.

In all cases, the homologous relationships described in Table 2 are incorporated herein by reference. 5 are highly essential. For example, a typical H. pylori gene product exhibits an amino acid sequence that is 92% to 100% identical between different H. pylori strains obtained from patients. The nucleotide sequences encoding the related polypeptides of the invention are also very similar. For example, nucleotide probes derived from the coding sequence of a polypeptide of the invention may be used in PCR or hybridization to identify clones that carry a nucleotide sequence encoding a homologous related polypeptide.

Table no. 5

x: σ3 CZ3 z — x ABOUT CM ABOUT VK about OO 479 ^{128 169} OK OO at © ck they r * · VK Ck 00 VK they CN OO OO r * about 00 ³³³ 1 861 | r · CN VK r * VK CM VK kO 1 1 ck ABOUT OO OK oo ck ck 242 L-T D- honors _z + - * C 00 about ABOUT the © the © about VK r- ABOUT ABOUT about they C * about about about about ABOUT ABOUT about about about OO VK VK c- they at © VK ABOUT Q Q \ about about about about ABOUT about the © about about about about about ABOUT about about about oo ' the © about Ό ABOUT\ r-> t * • -I VK KO o ^x OK OK OK OK OK OK OK > oo kO kO <υ • 3 N ABOUT > N about r- r * < 210 CM about - 122 361 > · ck - kO 53 OK Ck 259 ck about 40 kO VK -29 247 28 they ABOUT at T3 pole Λί FROM-\ > N Λί CN the © QK CA OK OO Ό r- OO ck 88 ABOUT ck OO Ck r- CM ck 00 OK oo CN honor ABOUT OO OO kO kO Ck VK - kO OO Ck OK ck VK - they they Ck they ' ^z VK Ti CN they ck - CN - Ck VK CN ^r ck r- ck CN cr = tt = CM kO ΓΜ 00 ck VK Ck Ck the © r- m ck 00 CA Ό CN VK 00 they CN VK VK VK about - VK OK r *> Ck CA kO kO - CN r- - Γ- kO CN Ck ck - they CM ck Are u ω Q r- r- OO OO Γ r> 00 r * r- t'- 00 00 r * OO C- r- OO OO 00 OO r- 00 oo honor ix> H - OK about they r- C ~ OO ck Ό r- oo in-, VK - 00 - they they VK Ck CN CN 00 about CN - OK they the © 1 1 CM ABOUT 1 1 -. 1 1 1 1 1 | 1 1 T 1 they - and l 1 1 about | <- 1 1 C about 1 about l about 1 Ck about about l G I G 1 G 1 G 1 Ck about 1 1 G 1 G C 1 Ο- Ι they I G G 1 L- I G Ck ABOUT 1 G 1 ABOUT CM Ck 1 the © r * 00 CN r- r- 00 OO kO i / k 1 1 CM CN CM 00 VK VK VK - CN Ck OO kO the © OO r-- OO about CM CN CN CN - kO 1 ABOUT CM oo OO CM CM they VK CA CA - VK about - about in n KCK OK kO * Tk ABOUT ck VK VK ck they r * Ck ck ck - " m VK C- CN the © C-- they OK - kO about CM CM CN 00 ck Γ- ck ABOUT oo CA - U-i ABOUT OO about Cl the © OK r- - CN they kO CM CN Ck * Tk r * · Ck - ABOUT r- VK oo 2 CN C- OO - ck they they ck ABOUT kO CN they CN KCK they CN OK OK OK CM Ck CM Ό the © ABOUT ck VK the © CA the © - Ck they they they they they they θ ' OK CN ck CN OO CM they they Ck they ck I 1 VK ck CN j CM CM ck CN CM CN <Tk r- j J CM CN > CN the © kO the © the © OK Ck ABOUT\ OK kO CN OK ABOUT Ck Ck ABOUT VK r- Ck ABOUT 1 kO about ABOUT about - ck about ck Ck ABOUT CN about about · - CN about Ck CM about CM ABOUT N about C- r- CA - ck Ό ck Ck 00 CN T Γ about about CN ABOUT Ck 00 CM CM ABOUT CM VK about about - ABOUT ABOUT about ABOUT ABOUT about - ABOUT, - - ABOUT ABOUT about ABOUT ABOUT CM ABOUT ABOUT _ CN CN · - «· - CN Ck CN CN - -. CN - Ck Ck - CN i- < about CX CX ABOUT. about <υ CX <υ ABOUT <u n. cx cx TX n. CX £ X ABOUT cx CX about ABOUT Q. CL 93 CD CD ABOUT CD kO ABOUT the © the © 4J about <υ about about C3 C0 FROM Ck kf) what 93 93 CJ CM CM CM r- CM CX kO CX CX i / k they kO OK OK OK r- r- OK cx CL VK m they CN honor about ABOUT ABOUT about ABOUT OZ about -C J = ABOUT about about CM about ABOUT about about CN JX until about ABOUT ABOUT Z-N > N Are u honor CM ABOUT CA CA OO c- OK OK ABOUT OK OO ck ck CM CN | 1288 ABOUT OO they kO the © kO ''-WITH ABOUT OK Γ- r- r- Ck r- c- about Ck Ck VK - OK kO - oo Ό the © VK VK • they they they they they Ck ck CN r- ck ck Ck CM cr 3t O Q honor CZ) R about they VK VK r- OO ck OK OK Ck Ck they C- ck r- ABOUT kO they - they they OO VK VK VK VK VK kO they the © kO r * 00 00 00 OK OK ABOUT they - kO CM CN CM OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OK OO OK OK OK OK θ ' OK OK «3 93 Ck they CA 93 93 r- r- they they CN Ck about ABOUT CN r- OO WHAT 93 93 they OO OO Ck Ck ABOUT they CN CN V » - r- Ck Ck - CM 1 1 l 1 1 CN ABOUT 1 1 VK OK Ck 1 the © kO 1 CM ABOUT 1 m υ at 1 G 1 G 1 ABOUT l G CN ABOUT 1 G G 1 C 1 G G and about l G 1 G 1 CM about ck kO I VK C u- 1 1 G C ABOUT n ck ck the © C- OO r- r- r- OO OO OO VK 1 G ¹ oo 1 VK ν '. VK - ck OO kO OO OO r- OO about about CM CN CM r- CM CM ck ck CN CN • they VK VK CA - VK - about vzk •ABOUT neck kO VK ABOUT Ό about VK they the © the © Ck Ck - ck m C- CN kO they they OK - kO kO CN CN CN CM r- kO about CM CN - about OO about ABOUT kO CA r- CN CN they kO CN CN ck neck C * OO OK CM they VK oo oo Ά CN r * OO OO ck they they ABOUT ABOUT Ό CN they they irk they CM VK they ck VK Ck OK OK kO ABOUT Ck VK ό Ό kO - ck they they they they they they OK OK CN they Ck r- VK they Ck Ck they Ck - · " Ck CN CN ck ck CN | CM CN · -! VK r- CN Ck they they they they CN j > they ABOUT about kO kO Ck Ck Ck ck KCK kO ck l Ck ck Ck they 1 _ OO they about m Ck C- about ABOUT - - - ABOUT about ABOUT ABOUT ABOUT CN CN ck Ck CN OO they r- ABOUT ABOUT OO N - - · - kO N_) kO the © kO CA OK OK ABOUT ABOUT C- OK OK about oo CA CA CM -Read ABOUT about about about ABOUT ABOUT ABOUT ABOUT ABOUT - » about about - - about ABOUT VK VK ABOUT ABOUT ABOUT C CN - - - - m Ck Ck ck - r- kn kn CN - - - - · - - ABOUT <U cn <u oO here CD <L> oD cx ABOUT- U. Cl Q. CL FROM about (D tx LX LL about (U OJ <υ cx CL CL CX U about about ABOUT about OJ «3 what at ABOUT what <L> CM m 1 / k VK the © the © r * - - CN CN <N CN kO NJ the © Ό ABOUT Ό r- r- CA CA - they tx cx cx Cl CX CX cx about ABOUT C 1 ° ABOUT about ABOUT about about ABOUT ABOUT about about ABOUT <3> - until to until until until - =

The relationship between the polypeptides of the invention is described below in Table 2. 6. 6 are measured from the stop codon to the stop codon in the nucleotide sequence of H. pylori.

The relationship between the polypeptides, which is shown in Table 1, is shown in FIG. 6 is described as follows. First, the length of the polypeptides listed in Table 2 is shown below. 6 is at least 90% identical, most of them more than 95% identical. Second, the stop-to-stop codon lengths vary for some of the homologous pairs of polypeptides. In some instances, the shorter polypeptide comprises a relevant portion of a protein that may be used in the invention; in some cases, the longer polypeptide exhibits improved use.

In all cases, the homologous relationships described in Table 2 are incorporated herein by reference. 6 are highly essential. For example, a typical H. pylori gene product exhibits an amino acid sequence that is 92% to 100% identical between different H. pylori strains obtained from patients. The nucleotide sequences encoding the related polypeptides of the invention are also very similar. For example, nucleotide probes derived from the coding sequence of a polypeptide of the invention may be used in PCR or hybridization to identify clones that carry a nucleotide sequence encoding a homologous related polypeptide.

Table no. 6

% ID | ooooi | | 00 001 i | 100.00 ÍOO'.OO 96.74 94.35 | 00 001 | OO'OOl 100.00 1 00 001 1 1 OO’OOl 1 99.62 98.56 100.00 OO'OOI | 99.82 69'96 | 98.84 99.47 96.55 | Γ 100.00 [OO’OOl | OO’OOl | 100.00 OO’OOl | [OO’OOl | 96.76 99.37 97.28 λ CA b CM within he r- cn CM m «- CM OO - r- OO cn VO oo 00 r- about T CM he oo T 00 cb T ABOUT r- CM 'T r- cn 'T 'T about CM VO about VO CM VO Ό oo Γ · about r- · - · CM he Γ in n T - - CM C · CM - he cn <M - CM CM cn - he m - · cn T CM cn cn CM CM - «- Q. : JD <u -3 n? n 00 CM m cn <-> oo r * m 49 he within 'T oo he CM he VO - cn cb 06 VO CM cb within oo he within ABOUT within within about within he cn cb he cn 64 00 r * 98 C- T he VO cn CM 1 CM cn cn cn · - * · - * - cn -. O Ό > σ3 > N <b T T oo ABOUT within oo cn he cn cn CM cb r * CM he r- m «m r- 'T oo about cn CM Ό he he T T cn ABOUT CM cb T ABOUT wn 00 ABOUT he cn r * 00 he 00 within 00 VO CM CM CM 00 T <b CM VO cn he r- cn 'T he T CM 'T T cn 'T CM 'T he cn cn 'T CM 'T within m CM Ό cr 4FC r- 00 (b ABOUT CM cn T he within r · oo about about CM cn 'T he VO r » 00 (b ABOUT CM cn T he v * O hon CO Q cn cn cn 'T 'T T T 'T T T T 'T 'T he he he he he he he he he he within within within within within within ABOUT ABOUT ABOUT about ABOUT about about about about about about about about ABOUT about ABOUT about ABOUT about ABOUT about ABOUT ABOUT about ABOUT ABOUT ABOUT ABOUT about VO cb 00 τ oo r-- about cn T CM r- cb about <b he OO T _ · - about r- m about - CM cn cn CM r- cn oo cn oo T T - cb VO | 1 - · 1 1 he T 1 1 1 he CM 1 1 1 'T 1 1 about within ! 1 CM D 1 1 WITH D 1 m about T 1 m about C G cb ~ l 1 G cn about 1 about about T u- 1 cn about cn 1 CM cn and G 1 C G 1 1 G cn about q. G CM 1 cn cb I and G CM U 1 m about 1 he j G about he CM 1 cn r- cn 1 ABOUT 1 within oo r- 1 ABOUT G oo - he T r- Γ · r- ABOUT and 1 oo r- cn r- r- within c- cb c- about CM OO - oo m ABOUT about r ~~ r- oo Oô r- 1 oo within r- T cn within he VO he about 1 ABOUT he CM about - cb CM 1 he oo within within - - · he cn 1 - cb CM oo CZ T about VO CM cn cb CM CM cb • - · ABOUT T within cb ΓΜ within cn within cb he T VO cn he oo cb 1 cb about oo Ό OO - 'T he r- cn T ABOUT CM T vO CM about oo OO cb CM he T CM in n oo cb about CM about N he too OO he CM VO T CM ABOUT CM - ABOUT - ABOUT\ cb T oo he M T CD within cn ABOUT 'T he CM T T ~ σ3 CM cn τ ABOUT 'T cn CM cn ABOUT 'T T cb he he T within CM OO cn xr he r- oo m he VO oo 'T C CM J CM J CM J r- CM cn | m he | 00 cn CM CM J | T CM j cn cn <b 'T T CM | CM CM cb cn CM within 1 CM 1 cb he cn T 1 within within cn cn ABOUT ABOUT about\ cn <b and cb r- cn cb about oo 'T cn CM T he cn CM - ABOUT about · - · · - · »-1 ABOUT about - un r- CM about about - about CM oo CM CM cb cb - CM <B - T r- within r- ABOUT cb he r- oo within within - T VO c- - C- r- CM cn he cn VO CM about about ABOUT about about - ' about about CM ABOUT ABOUT ABOUT about - · about ABOUT about -1 ABOUT ABOUT ABOUT cn ABOUT ABOUT . - · he «- · CM ' within r- ~ ΓΜ - VO - - · he he cn oo he - cn • in about about about cx cx CX q> cx 4J n. ix (D ABOUT cx Q. CX q> cx a. q> Q> <υ CX about <υ q> Q. cx ÍÚ oo about <u ABOUT CJ <0 about he he about T here <0 03 he 03 q> WHAT about a> «3 cn WHAT · - « 'T about about - CM c- the D- VO cb «- · within Ό cb cx m cn VO 'T VO r- CM cb r- he cx CM CX LX LX ABOUT within about about ABOUT ABOUT ABOUT · " ' about about about about J = about ABOUT about ABOUT about about ABOUT -C JZ x = x = ABOUT ABOUT <b about cn cn r- cn r- c- CM oo cb about VO OO CM T CM r> oo oo 00 00 <b oo T CM r- about within c- » cn he 'T about CM VO about VO CM about within about OO OO about r * - CM he about he T - CM oo CM - he cn - CM - CM CM cn - VO cn - - · cn 'T CM cn cn CM cn > N vO OO CM 'T r- CM within oo about VO Γ ** cb ABOUT he r- CM VO cb m vO r- oo within oo cb he CM he CU Λ CO T he VO within VO r- c- oo 00 cb axis about CM CM CM cn cn m cn 'T he he within r- Θ Γ- C- r- r- r- r- r- r- C *> C- Γ oo oo oo oo oo oo OO OO oo oo oo oo oo oo oo oo oo OO cn oo c- CM * Γ- vO about cb within C ' 'T r- 'T he CM CM ABOUT »- he cn CM CM l 'T CM he T m f- cb 1 1 CM ABOUT CM 1 1 CM l 1 | 1 1 cn 1 1 1 G 1 G 1 CM 8_cl 7_f3. about oo l cn 1 C 1 5_c3 1 G 1 G 1 00 7_cl 2_c3 G 1 0_c2 ^C i oo <* - 1 cn ABOUT VO G ¹ C 1 VI 2_c3 7_cl cb 1 C 'Ί G g ' 1 cn about 1 oo C 1 Γ ' C 1 about 46 c! 1 r ~ OO VO - CM about CM CM vO OO T cn OO about cb oo CM VO ABOUT 1 1 he OO within r- ABOUT cn r- he m he about 1 ABOUT VO (M about he he ABOUT he CM cn cn cn ABOUT he cn - cb CM cn G 'T OO Ό oo »- cb CM CM CM - about T - vO VO within cb he CM Γ-- vO - · C- m he OO about 1 cb within cn about 'T he r- cn T about CM oo oo CM CM in n oo CM cb «-« ΟΪ 'T about he oo cb CM CM ABOUT CM oo cb T within 'T CM he CM ABOUT CM ABOUT Γ * T about VO he within cn VO cb ABOUT 'T he r- T T r m cn he 'T cn CM cb ABOUT T 'T he CM cn T CM m m CM 'T he C * oo oo cn he cb oo T b CM CM | CM cn CM the D- » cn 1 m cn CM cn CM CM CM CM cn 1 axis J T CM CM cb cn « Ό he cn 1 within cn VO cn vO CM cb cn Ό within cb cb CM cb m T 'T about r- he cn about about ABOUT - - cn cn ABOUT cn about - - CM CM r- m about about CM ABOUT - - CM about (** - ABOUT CM oo within CM ABOUT - Γ- cn CM OO oo - about CM cn CM m CM within oo m oo cb CM VO CM > CM ABOUT - - ABOUT about ABOUT - - about about <_> ABOUT about - ABOUT ABOUT about ABOUT about about ABOUT about about ABOUT about CM - - m CM cn CM - m CM · oo cn ABOUT LX Q. CX 0> cx CX cx CX (U <u about (L> OJ cx about CX about cx q> CX cx cx cx <D a> CX CX Q-; ä WHAT he KJ CTJ <u about <u about he σ3 within he □ n he 03 about 03 he CM within 03 what cn π3 σ3 about about l> <U CM Γ- r- he within C cb CM cn CX - T 'T VO c- 'T cb LL LX r- C · cx CM cn o> VO VO within C ABOUT ABOUT ABOUT about about about ABOUT about • XZ about about about ABOUT about CM _C x: about about ABOUT ° ABOUT about

Table no. 6 continued

ABOUT about about about f OO'OOl 94.09 93.62 100.00. 99.5! and 98.20 I 100.00 1 vr »n axis | OO'OOl 100.00 1 οοόοΠ about about about about 1 98.81 I 99.29 100.00 98.44 | ooooi | r * · with oo axis <n with oo oo tn about axis ch : 98.55 i OO'OOl J 97.78 1 OO'OOl | OO'OOl i i OO'OOl OO'OOl VO ΓΝ CN vr P CN axis tn CN VO ABOUT about oo m about oo ch within tn tn tn P- VO RF P · axis vr ABOUT VO m about p CN vr WITH oo m CN tn tn vr CN VO oo vr 00 with en P * · en en CN CN CN vr CN CN within tn tn vr p- within with VO ch 00 ABOUT vr p · tn OV tn vr OO VO tn about oo tn oo CN axis in n vr oo ABOUT CN CN p- r- - P ~ - tn p CN CN VO vr 'U * CN VO about VO ABOUT cn - · CN CN 1 en en CN VO CN CN vr within CN en m VO m OO p CN p tn m r * Vt CN oo tn tn in n ABOUT within Ov n n 00 P- oo P * axis tn OO VT en m ch OO CN en vr r * tn CN within CN r- < »n m m VO CN about ch within m CN m vr m en <n en CN vr CN within R - vr CN CN axis CN m tn CN vr tn 00 with VO VO p ~ 00 about about CN m vr tn within r- oo ch about CN m vr tn with oo axis about VO P> oo VO within within within p * r- r * p r- r- r * r « oo 00 OO 00 00 00 00 00 00 00 axis ch axis Ov ABOUT about about about about about about about about about about about about about about about about about about about about about about ABOUT about CN CN CN within axis tn P- about m r- within about OO - oo oo SO tn - oo OO oo oo about CN in - axis 00 en vr ch Ov axis oo m 1 m - within OV 00 -a ABOUT - κΤ 1 1 1 CN 1 tn 1 1 CN I 1 CN about T 1 - 1 1 1 1 r- CN tn 1 G G 1 about CN ABOUT ! m about l en about and Ĺ I CN ABOUT l g ' 1 C CN L> l m about l 1 G C s G l G I 1 ABOUT about about l m about <+ -. 1 CN L) l vr 1 G 1 m ABOUT m 4> l - | m ~ Ί F J 1 en ABOUT WHAT about I- I 1 en ABOUT oo m r- oo 1 t- » vr r- CN 1 P- about u_; r- tn within SO VO 1 vO p ΓΝ within about CN CN m WHAT with tn within with m oo ABOUT 1 r- P- * 1 CN within VO tn tn p r- tn VO within ch m tn vr ch n ch r- ~ CJ> tn o> m r- CN VO * n P- CN ' vr within ch ch en CN ch axis tn oo about within about SO m oo - « with CN - oo tn tn vr m oo SO OO tn CN m ABOUT axis - · tn OO oo CN CN vr tn vr r- * m axis l ~ r- ch within ch oo P- -1 m. about within VO about tO tn m c- - oo OO r-- tn m tn CN vr - vr - r- within tn about vr about CN - m WHAT ABOUT CN m tn oo ABOUT OO about tn Ot tn vr axis ABOUT within c- m SO axis ch in n axis en Ov Ό en I and - CN CN I p I vr * n j m CN vr j CN J CN | CN ABOUT\ m | j vr ch ch 1 en VT ABOUT it OO oo CN axis vr vt vr CN about ABOUT l about axis »n m ABOUT about r- CN ABOUT\ vr about within tn ABOUT CN ABOUT about ABOUT about Ov Ov Ov CN oo CN ABOUT CN axis CN tn about ABOUT vr ch - · vr rr CN ABOUT about axis LH vr r- en en m m CN ABOUT m r- oo CN tn CN tn vr r- CN tn about SO ABOUT about ABOUT - about m m m ABOUT ABOUT ABOUT ABOUT about ABOUT about about ABOUT ABOUT about CN ABOUT ABOUT ^ ~ · - Ό \ T) -a -, n «-« - · n m «- · tn · - « m · - · m tn in n - · CL 4) CL «> 4) CL Ω. <u 4) 4> about 4) 4) 4) 4> 4) 4> CL Cl. 4> 4) 41 41 Q> CL 4) 4> CL OU ABOUT about about ABOUT ABOUT <u 4) vr vr vr ABOUT CA OO ABOUT 4> <υ 4> r- C3 r- 4> 41 vO C- about 41 within axis axis vr vr r- r- Cl CL CL r- tn LL «- < r- in n with CL »n CL r * r * · CL CL -a SO ABOUT about about about ABOUT about about jc X -C about about -C ABOUT about about about JC about JX about about JZ J = about ABOUT ABOUT p ~ within CN m m m axis r * within m about r- m CN ABOUT m within tn P * VO - · VO about tn CN OO m en CN vr 00 oo m m within »n tn m within 00 r- oo SO en en en CN CN CN vr CN CN SO tn tn vr p> SO within ABOUT vO OO m vr 00 Ov ABOUT about CN m vr m oo m CN oo ABOUT vt tn tn en ABOUT tn OO 00 OO about axis axis axis ABOUT - - - - CN CN CN m vr tn tn with SO within VO r- with tn Vt OO OO 00 00 OO 00 OO ch axis axis Ov ch axis axis ch axis ch axis axis axis Ov Ov ch axis s Ov Ov ch r- (Q c3 ch WHAT m OO ABOUT about __ vO - · - < CN CN CN CN · - axis r- VO CN r- OO - m - cn - · C ** r- - * 3 · within 1 CN ABOUT 1 en ch m 1 C m Q | m 1 C oo 1 tn vr oo tn | about 1 G en about en about within 1 m about en G CN CN ABOUT already G s about 1 CN 1 ABOUT 1 CN s G oo 1 '• Ί · L- about 1 T I m | within 1 about 1 1 1 T about 1 L> about . 1 ABOUT about l CN G 1 1 1 P * tn about r- about 1 CN oo m oo 1 r- l I | c- 1 1 p- ABOUT r- tn within en CN axis ABOUT about CN 00 CN CN rn ABOUT Γ tn within r * m G within P- P> CN sO VO ABOUT VO p p CN about CN «n VO tn vr ch oo oo r- about CN ch about CN within tn P ~ CN vr vO ch CN CN OO ΓΝ p p vr vr within about VO vr ABOUT within VO 1 CN about vr m oo vO OO υη CN VO m OO CN axis tn vr Ό vr tn vr m r- axis C ABOUT C- with OO CN oo p- tn ch tO VO tn tn - m tn vr axis tO OO »n m tn - <-> vr ch r- tn CN oo vr about CN - m 00 ABOUT vr θ ' - oo cn en tn Ov CN <n vr Ov VO - m CN Ov CN ABOUT 00 ch m ch vO cn tn | - · r- CN m en tn CN vr - m CN vr CN Γ- vr tn vr m - vr ch Ov rn vr en en 1 OO oo vr __ vr vr vr vr about vO oo ABOUT »n m oo oo oo vr - vr J VO m tn about - CN ABOUT about CN - axis ch axis vr r- ABOUT ABOUT - CN ^ -1 about ABOUT CN - vr about VT <T CN ABOUT ABOUT oo oo axis axis m en m about oo within r ~~ ABOUT oo CN oo vr m axis ch CN tn about in n ABOUT ABOUT - - about ABOUT ABOUT en en m tn tn ABOUT about ABOUT about about ABOUT about CN - about - • - · VO vO oo oo vr - n - CN m - · m oo - - within Ό &> CL ABOUT. LL 4> 4> about 41 4i 41 4> 4> CL CL CL 4> CL LL 4> 41 4> 4> 4> about. 4> Cl CL Ou 41 about about ABOUT ro 41 CN vr vr vr tn * n VO ABOUT (0 4> 4) <0 4) ου 41 CN SO about (1 d) vO axis about axis axis - - vr CL CL CL CL CL CL CL - CN tn VO - vr CL CL vr axis within about ABOUT about ABOUT ABOUT -C _c J = JZ _c _c J = ABOUT ABOUT about ABOUT - J = _C ABOUT ABOUT

IV. Identification of nucleic acids encoding vaccine components and targets for agents effective against H. pylori.

The disclosed H. pylori genomic sequence includes segments that direct ribonucleic acid synthesis as well as origin of replication, promoters, other types of regulatory sequences, and intracellular nucleic acids. The invention describes the identification of nucleic acids encoding immunogenic components of vaccines and targets of agents effective against H. pylori. An important aspect of identification is the determination of the functions of the described sequences, which can be achieved by different approaches. Examples of these methods are described below.

Homology with known sequences:

A computer-assisted comparison of said H. pylori sequences with the previously mentioned sequences previously published in publicly available databases is a useful tool in identifying a functional H. pylori nucleic acid and polypeptide sequences. It is understood that the protein coding sequences can, for example, be compared as a whole and that they achieve a high degree of homology at the amino acid level (e.g., greater than 80 to 90%). This finding suggests that the two proteins also have some degree of functional homology, such as between enzymes involved in metabolism, DNA synthesis or cell wall synthesis, and proteins involved in transport, cell division, etc. a number of structural features of certain classes of proteins, and this correlates with specific sequences, such as nucleotide, DNA, metal ion, and other small molecule binding regions; covalent modification sites such as phosphorylation, acylation and the like; protein-protein interaction sites, etc. These sequences can be quite short and thus can only represent fractions of the entire protein coding sequence. Determining such a feature in the H. pylori sequence is therefore useful in determining the function of the encoded protein and identifying potentially useful targets for antibacterial drugs.

Particular relevance to the invention are the structural features common to secretory, transmembrane and surface proteins, including secretory signal peptides and hydrophobic transmembrane regions. H. pylori proteins that have been identified as putative signal sequences and / or transmembrane regions can be used as immunogenic components of vaccines.

Determination of essential genes:

Preferred drug targets are nucleic acids that encode proteins essential for the growth or viability of H. pylori. H. pylori genes are tested for biological relevance to the organism by examining the effect of deletion and / or gene disruption, i.e. gene knockout, using procedures that are well known in the art. In this way, essential genes can be determined.

Tribe-specific sequences:

Due to the developmental relationship between different strains of H. pylori, it is believed that the presently demonstrated H. pylori sequences are useful in identifying and / or discriminating between previously known and novel strains of H. pylori. Other H. pylori strains are believed to exhibit at least 70% sequence homology to the sequence exemplified herein, whether or not this is not relevant to the invention. Systematic and routine analysis of DNA sequences derived from samples containing H. pylori strains and comparison to the present sequence allows determination of sequences that can be used to discriminate between strains, as well as those common to H. pylori strains. In one embodiment, the invention provides nucleotide sequences that include probes and a peptide, and polypeptide sequences that discriminate against different strains of H. pylori. Stem-specific components can also be determined functionally based on their ability to elicit antibody production or to react with antibodies that selectively recognize one or more strains of the bacterium //, pylori.

In another embodiment of the invention, nucleic acids are disclosed that include probes and peptide and polypeptide sequences that are commonly found in all strains of H. pylori, but not found in other bacterial species.

Determination of candidate protein antigens for antibody and vaccine development.

Selection of candidate protein antigens in vaccine development may be derived from nucleic acids encoding H. pylori polypeptides. At first; ORF is analyzed for homology with other known exported or membrane proteins and further analyzed using the discriminant analysis described by Klein et al. (Klein, P., Kanehsia, M., and DeLisi, C. (1985)

Biochimica et Biophysica Acta 815, 468-476) to predict exported and membrane proteins.

Homology testing can be performed using the BLAST algorithm contained in the Wisconsin Sequence Analysis Package (Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) to compare each predicted ORF amino acid sequence with all sequences found in current GenBank, SWISS-PROT and PIR databases. BLAST examines the local alignment between ORF and database sequences and gives a probability score that indicates the likelihood of finding this sequence by changing the database. ORFs exhibiting significant homology (e.g., probabilities greater than 1x10 6 (ee-6)) with membrane or exported proteins are likely to represent protein antigens suitable for vaccine development. Based on sequence homology with genes cloned into other organisms, H. pylori genes provide certain functions.

Discriminant analysis (Klein, P., Kanehsia, M., and DeLisi, C. (1985) Biochimica et Biophysica Acta 815, 468-476) can be used to test the ORF amino acid sequences. This algorithm uses the actual information contained in the amino acid sequence of the ORF and compares it with information derived from the properties of known membrane and exported proteins. This comparison predicts which proteins will be exported, which are membrane-bound or which are contained in the cytoplasm. The ORF amino acid sequences designated by this algorithm as exported or membrane-associated are likely protein antigens suitable for vaccine development.

The outer membrane proteins are likely to represent the best antigens that elicit a protective immune response against H. pylori. Algorithms that can be used to predict outer membrane proteins include the presence of an amphipathic beta-sheet region at their C-terminus. This region, which was detected in a large number of outer membrane proteins in gram-negative bacteria, is often characterized by hydrophobic residues (Phe or Tyr) at approximately positions 1, 3, 5, 7, and 9 from the C-terminus (e.g. in Fig. 8, block F). Importantly, these sequences were not detected at the C-terminus of the periplasmic proteins and thus allow for a pre-primary differentiation of the protein classes depending on the primary sequence data. This phenomenon has been previously described by Struyne et al., (J. Mol. Biol. 218: 141-148, 1991).

As shown in FIG. no. 8 additional amino acid sequence motifs are found in a variety of H. pylori outer membrane proteins. Amino acid sequence alignment in FIG. 8 depicts portions of the sequence of H. pylori bacterial proteins (represented by a single letter amino acid code), which are indicated by amino acid sequence ID numbers, and show sequences from the N-terminus to the C-terminus from left to right. There are six different blocks (labeled A to F) of similar amino acid residues to include different hydrophobic residues (Phe or Tyr; F or Y relative to the one-letter code for amino acid residues), often located at positions near the C-terminus of the outer proteins membrane. The presence of several shared motifs clearly indicates similarity between members of this family of proteins.

In addition, outer membrane proteins isolated from H. pylori often share, as shown by the amino acid residues enclosed by the box in FIG. no. 9, a motif near the completed N-terminus (i.e., after the secretion signal removal process). Fig. no. 9 depicts a portion of the N-terminus of nine H. pylori proteins (designated by amino acid sequence ID numbers and showing the sequence from N-terminal to C-terminal from left to right).

It is known to those skilled in the art that these shared sequence motifs are highly significant and establish similarity between this family of proteins.

Not too often one can distinguish between more possible nucleotides at a given position in the nucleic acid sequence. In these cases, the ambiguity is indicated by the extended alphabet as follows:

These are the official single letter base codes according to IUPAC-IUB

code description of the base G guanine A adenine T thymine C cytosine R purine (A or G) Y pyrimidine (C or T or U) M amino (A or C) The ketone (G or T)

WITH strong interaction (C or G) w weak interaction (A or T) H without G (A or C or T) B without A (C or G or T) IN without T (without U) (A or C or G) D without C (A or G or T) N any (A or C or G or T)

Amino acid translation according to the invention, where the ambiguity in the nucleotide sequence is evaluated by translation of the ambiguous codon, is indicated by the letter "X".

V. Production of H. pylori nucleic acid fragments and analogs and polypeptides.

Based on the discovery of the H. pylori gene product that is listed in the Sequence Listing, one of skill in the art can alter the described structure (H. pylori genes), e.g. production of fragments or analogs and can test the activity of newly formed structures. Examples of procedures that are well known in the art and which allow the production and testing of fragments and analogs are described below. These or analog methods can be used to prepare and test the ability of polypeptide libraries, e.g. random peptide libraries or cell protein fragment or analog protein libraries to bind to H. pylori polypeptides. Such assays are useful for developing inhibitors of H. pylori.

Preparation of fragments

Protein fragments can be produced in several ways, e.g. by recombination, proteolytic cleavage, or chemical synthesis. Internal or terminal fragments of a polypeptide can be generated by removing one or more nucleotides from one end (in the case of a terminal fragment) or from both ends (in the case of an internal fragment) of the nucleic acid that encodes the polypeptide. Expression of the mutated DNA produces fragments of the polypeptide. Endonuclease digestions that "end-nibbling" can generate DNAs that encode a group of fragments. DNAs encoding protein fragments may be generated by random sharing, restriction digestion, or a combination of the above methods.

Fragments can also be chemically synthesized using methods known in the art, such as f-Moc or t-Boc solid phase Merrifield chemistry. For example, the peptides of the invention may be divided into fragments of desired length without overlapping the fragments, or may be divided into overlapping fragments of desired length.

Change of nucleic acids and polypeptides: random methods.

Amino acid sequence variants of a protein can be prepared by random mutagenesis of a DNA that encodes a protein or a particular domain or region of a protein. Useful methods include PCR mutagenesis and saturation mutagenesis. A library of random amino acid sequence variants can also be prepared by synthesizing a set of degenerate oligonucleotide sequences. (Methods for testing proteins in a variant library are also provided herein).

(A) PCR mutagenesis

In PCR mutagenesis, the limited fidelity of Taq polymerase is used to introduce mutagenesis into a cloned DNA fragment (Leung et al., 1989, Technique 1: 11-15). The DNA region that is mutated is amplified using polymerase chain reaction (PCR) under conditions that reduce the fidelity of DNA synthesis by Taq DNA polymerase, e.g. a dGTP / dATP ratio of five and the addition of Mn ²⁺ to the PCR reaction can be used. The amplified DNA fragments are inserted into suitable cloning vectors to form a random mutant library.

(B) Saturation mutagenesis

Saturation mutagenesis allows the rapid introduction of a large number of single base substitutions into cloned DNA fragments (Mayers et al., 1985, Science 229: 242). This method involves generating mutations, e.g. by chemical route or by irradiation of single-stranded DNA in vitro and synthesis of complementary DNA strand. The mutation frequency can be adjusted by modulating the intensity of application and essentially all possible base substitutions can be obtained. Since this method does not involve gene selection of mutant fragments, both neutral substitutions were obtained, equal to 61 as those that changed function. The point mutation distribution is inclined towards the conserved sequence elements.

(C) degenerate oligonucleotides

A library of homologs can also be prepared from degenerate oligonucleotide sequences. Chemical synthesis of degenerate sequences can be performed on automated synthesizers, and the synthetic genes are then ligated into a suitable expression vector. The synthesis of degenerate oligonucleotides is known in the art (Narang, SA (1983) Tetrahedron 39: 3; Itakura et al., (1981) Recombinant DNA, Proc 3 ^rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp 273-289 Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al. (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acid Res. 11: 477. Such methods are used. in the directed development of proteins (Scott et al., (1990) Science 249: 386-390; Roberts et al. (1992) PNAS 89, 2429-2433; Devlin et al., (1990) Science 249: 404-406; Cwirla et al (1990) PNAS 87: 6378-6382; U.S. Patent Nos. 5,223,409; 5,198,346 and 5,096,815).

Change of nucleic acids and polypeptides: Methods suitable for directed mutagenesis.

No random or directed mutagenesis method can provide specific sequences or mutations of specific regions. These methods can be used to prepare variants that include e.g. deletions, insertions, or substitutions of residues of a known amino acid sequence of a protein. The mutation sites may be modified individually or in series, for example (1) first substituted with conservative amino acids and then with a more radical choice depending on the result we want to achieve, (2) deletion of the targeted residue, or (3) next to the localized site. introduce residues of the same or different class, or use a combination of points 1 to 3.

(A) Alanine scanning mutagenesis.

Alanine scanning mutagenesis is a useful method in identifying certain residues or regions of a desired protein that are preferred regions or domains of mutagenesis (Cunnigham and Wells, Science 244. 1081-1085, 1989). In alanine scanning, a residue or group of target residues (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) are identified and replaced with a neutral or negatively charged amino acid (most preferably alanine or prolylanine). Replacement of an amino acid may affect the interaction of the amino acids with the surrounding aqueous environment inside or outside the cell. These domains showing functional sensitivity to substitutions are then improved by introducing additional or other variants at the substitution sites. Thus, while the site of introduction of the amino acid sequence variation is predetermined, the nature of the mutation need not be predicted. To optimize the performance of the mutation at a given site, alanine scanning or random mutagenesis of the target codon or region can be performed and the desired protein subunit variants expressed are tested for the optimal combination of the desired activity.

(B) Oligonucleotide-mediated mutagenesis.

Oligonucleotide-mediated mutagenesis is a method useful for preparing the substitution, deletion and insertion of DNA variants (e.g., Adelman et al., DNA 2: 183, 1983). The DNA of interest was altered by hybridizing an oligonucleotide that encodes a mutation of the template DNA, wherein the template is a single-stranded form of a plasmid or bacteriophage that contains an unaltered or native DNA sequence of the protein of interest. After hybridization, a DNA polymerase is used to synthesize the entire second complementary strand of the template, where the oligonucleotide primer is then incorporated and will encode a selected DNA change of the desired protein. In general, oligonucleotides containing at least 25 nucleotides are used. The optimal oligonucleotide has 12 to 15 nucleotides that are completely complementary to the template on each side of the nucleotide (s) that encode the mutation. This ensures that the oligonucleotide will correctly hybridize to the single-stranded DNA template molecule. Oligonucleotides are readily synthesized using a method well known in the art described by Crea et al., (Proc. Natl. Acad. Sci. USA, 75: 5765 (1978)).

(C) Cassette mutagenesis

Another method for preparing variants, which is cassette mutagenesis, is based on the method described by Wells et al., Gene, 34: 315 (1985). The starting material is a plasmid (or other vector) that includes the protein subunit DNA to be mutated. Codon (s) have been identified in the protein subunit DNA to mutate. There must be a single restriction endonuclease site on each side of the designated mutation site (s). If such restriction sites do not exist, they can be generated using the oligonucleotide-mediated mutagenesis described above by introducing them into the appropriate sites for the desired 63 teine subunit DNA. After the restriction sites were introduced into the plasmid, the plasmid was cleaved at these sites for linearization. A double stranded oligonucleotide encoding the DNA sequence between the restriction sites containing the desired mutation (s) was synthesized using standard procedures. Two strands were synthesized separately and then hybridized together using standard methods. This double-stranded oligonucleotide is referred to herein as a cassette. This cassette is labeled with 3 'and 5' ends that are comparable to the ends of the linearized plasmid so that it can be directly ligated into the plasmid. This plasmid now contains the mutated desired protein subunit DNA sequence.

(D) Combinatorial mutagenesis

Combinatorial mutagenesis can also be used to prepare mutants (Ladner et al., WO 88/06630). In this method, amino acid sequences for a group of homologs or for other related proteins are arranged. It is preferred to promote the highest possible homology. In order to generate a degenerate set of combinatorial sequences, all amino acids that appear at a given position of the aligned sequence can be selected. Combination mutagenesis at the nucleic acid level generates a varied library of variants and is encoded by a varied gene library. For example, a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that a degenerate set of potential sequences is expressible as individual peptides or, alternatively, as a set of larger fusion proteins that contains a set of degenerate sequences.

Other modifications of H. pylori nucleic acids and polypeptides.

In order to increase solubility, increase stability (e.g., ex vivo storage time and resistance to proteolytic cleavage in vivo), it is possible to modify the structure of the H. pylori polypeptide. A modified H. pylori protein or peptide can be produced wherein the amino acid sequence is altered by amino acid substitution, deletion, or addition as described herein.

The H. pylori peptide can also be modified by substitution of cysteine residues. Preferably, alanine, serine, threonine, leucine or glutamic acid residues are used to minimize dimerization through disulfide bonds. In addition, the amino acid side chains of the protein fragments of the invention may be modified. Another modification is cyclization of the peptide.

In order to increase the stability and / or reactivity of the H. pylori polypeptide, it may be modified by incorporating one or more polymorphisms into the amino acid sequence of a protein that results from any natural allelic variant. In addition, D-amino acids, non-natural amino acids, or non-amino acid analogs may be substituted or added to produce a modified protein of the invention. Further, the H. pylori polypeptide can be modified using polyethylene glycol (PEG) according to the method described by A. Sehon et al. (Wie et al., Supra) to produce a PEG conjugated protein. In addition, PEG may be added during chemical protein synthesis. Other modifications of H. pylori proteins include reduction / alkylation (Tarr, Methods of Protein Microcharacterization, J. E. Silver ed., Humana Press, Clifton NJ 155-194 (1986)); acylation (Tarr, Methods of Protein Microcharacterization, J. E. Silver ed., Humana Press, Clifton NJ 155-194 (1986)); chemical coupling with a suitable carrier (Mishell and Shiigi, eds, SELECTED Methods in Cellular Immunology, WH Freeman, San Francisco, CA (1980), US Patent 4,939,239; or gentle application of formalin (Marsh, (1971) Int. Allergy and Appl. Immunol., 41: 199-215).

An amino acid fusion moiety may be added to the peptide backbone to purify and potentially increase the solubility of the H. pylori protein or peptide. For example, hexahistidine may be added to the protein for purification by immobilized metal ion affinity chromatography (Hochuli, E. et al., (1988) Bio / Technology, 6: 1321-1325). In addition, in order to isolate peptides that do not carry irrelevant sequences, specific endoprotease cleavage sites may be inserted between the fusion and peptide sequences.

In order to allow for appropriate antigenic processing of epitopes in a H. pylori polypeptide, canonical protease sensitive sites may be included between regions, each containing at least one epitope via recombination or synthesis methods. For example, charged amino acid pairs, such as KK or RR, may be inserted between regions into proteins or fragments during their recombinant construction. The resulting peptide remains susceptible to cathepsin and / or other trypsin-like enzymes that will form portions of the protein that contain one or more epitopes. In addition, such charged amino acid residues may result in increased solubility of the peptide.

Primary methods for testing polypeptides and analogs.

A variety of methods are used to test the resulting mutant gene products. Methods for scanning large gene libraries often include cloning the gene library into replicable expression vectors, transforming suitable cells with the resulting vector library, and expressing the genes under conditions in which detection of the desired activity, e.g. in this case, binding to an H. pylori polypeptide or interaction protein makes it possible to relatively easily isolate a vector encoding a gene whose product has been detected. Each of the methods described below serves as an analysis of a large number of sequences produced, for example, by random mutagenesis.

(A) Two-hybrid systems.

Two-hybrid assays such as the system described above (as well as other assay methods described herein) can be used to identify polypeptides, e.g. fragments or analogs of a naturally occurring H. pylori polypeptide, e.g. cellular proteins or randomly generated proteins that bind to a H. pylori protein. (The H. pylori domain is used as protein bait, and the variant library is expressed as fish fusion proteins.) By analogy, a two-hybrid assay (with other assay methods described herein) can be used to find polypeptides that bind H. pylori polypeptide.

(B) Display libraries.

In one approach to screening assays, candidate peptides appear on the surface of a cell or viral particle and the ability of certain cells or viral particles to bind to a suitable receptor protein via a surface product is measured. This test is called the “panoramic test”. For example, a gene library is cloned into a bacterial cell surface membrane protein gene to produce a fusion protein detected by a panoramic assay (Ladner et al., WO 88/06630; Fuchs et al., (1991) Bio / Technology 9: 1370-1371; and Goward et al. al., (1992) TIBS 18: 136-140 In a similar manner, a detectably labeled ligand can be used to identify potentially functional peptide homologues Fluorescently labeled ligands, e.g., receptors, can be used to detect a homologue that retains binding activity to The use of fluorescently labeled ligands allows visualization of cells that can be inspected and separated using a fluorescence microscope or, if the cell morphology so permits, can be separated on a fluorescent activated cell sorter.

The gene library can be expressed as a fusion protein on the surface of the viral particle. For example, in a filamentous phage system, foreign peptide sequences may be expressed on the surface of the infected phage, which constitutes two substantial advantages. At first; since these phages can be applied to affinity matrices at a concentration of more than 10 phages per milliliter, large quantities of phage can be tested at one time. Secondly; since each infectious phage has a gene product on its surface, then if a particular phage is obtained from an affinity matrix in low yield, the phage can be amplified by another cycle of infection. Groups of nearly identical filamentous phages of E. coli M13, fd., And fl are most commonly used to display phage libraries. Either the glll or gVIII phage coat protein can be used to prepare fusion proteins without damaging the viral particle package. Foreign epitopes can be expressed at the N-terminus of the pili protein, and phage carrying such epitopes can be obtained from a number of phages lacking this epitope (Lander et al. PCT Application WO 90/02909; Garrard et al., PCT Application WO 92 / Marks et al (1992) J. Biol Chem 267: 16007-16010 Griffiths et al (1993) EMBO J 12: 725-734 Clackson et al (1991) Nature 352: 624- And Barbas et al (1992) PNAS 89: 4457-4461).

The E. coli maltose receptor (outer membrane protein, LamB) is used as a fusion partner (Cherbit et al., (1986) EMBO 5, 3029-3037). Oligonucleotides were inserted into plasmids that encode the LamB gene to produce peptides fused to one of the extracellular loops of the protein. These peptides are capable of binding to ligands, e.g. to antibodies, and may elicit an immune response when the cell is administered to animals. Other cell surface proteins, e.g. OmpA (Schorr et al., (1991) Vaccines 91, pp. 387-392), PhoE (Agterberg et al., (1990) Gene 88, 37-45) and PAL (Fuchs et al., (1991) Bio / Tech 9, 1369-1372), as well as large surface bacterial structures serve as tools for peptide expression. The peptides can be fused with pilin, a protein that polymerizes to form a pilus - channel suitable for the interbacterial alteration of genetic information (Thiry et al. (1989) Appl. Environ, Microbiol. 5, 984993). Because of its role in interacting with other cells, pilus provides useful support for presenting peptides to the environment. Another large surface structure suitable for the representation of the peptide is the bacterial motor organ which is the flagellum. Fusion of peptides with the flagellin protein subunit offers a dense array of copies of peptides on host cells (Kuwajima et al., (1988) Bio / Tech. 6, 1080-1083). Surface proteins of other bacterial species can also serve as fusion partners for peptides. Such examples of proteins are Staphylococcus protein A and Neisseria outer membrane protease (Hansson et al., (1992) J. Bacteriol. 174, 4239-4245 and Klasser et al., (1190) EMBO J. 9, 19911999).

In the filamentous phage and LamB systems described above, the peptide and its coding DNA are physically joined by contamination of the DNA with particles (cells or phages) carrying the peptide on their surface. The capturing peptide retains the particle or DNA with it. An alternative scheme uses a LacI DNA binding protein to form a peptide-DNA bond (Cull et al., (1992) PNAS USA 89: 1865-1869). This system uses a plasmid containing the LacI gene which carries an oligonucleotide cloning site at its 3'-end. Arabinose-induced induction produces a fusion protein with the LacI peptide. This fusion retains the natural ability of LacI to bind to a short DNA sequence known as the LacO operator (LacO). By installing two copies of LacO on an expression plasmid, the Lac1-peptide fusion tightly binds to the plasmid encoding it. Since plasmids in each cell contain only a single oligonucleotide sequence and each cell expresses only a single peptide sequence, the peptide becomes specifically and stably linked to the DNA sequence that directs its synthesis. Library cells are poorly lysed and peptide-DNA complexes are exposed to a matrix of immobilized receptors to yield complexes that contain active peptides. The associated plasmid DNA is then reintroduced into the cells, amplified and sequenced to determine the identity of the peptide ligands. To demonstrate the practical utility of the method, a large random library of dodecapeptides was prepared and selected on the basis of monoclonal antibodies raised against the opioid peptide dynorphin B. A group of peptides was obtained. All peptides are related to a recognition sequence corresponding to a portion of dynorphin B that contains six residues (Cull et al., (1992) Proc. Natl. Acad. Sci U.S.A 89-1869).

This scheme also sometimes shows that peptides carried on plasmids differ from phage expression methods, in two important features. At first; peptides are captured at the C-terminus of the fusion protein, resulting in expression of library members as free carboxyl-terminus peptides. Both filament pIII and pVIII coat proteins are anchored in phage via their C-terminus, and the host foreign peptides are placed in the outwardly extending region of the N-terminus. In some phage embodiments, the peptides displayed are present just at the N-terminus of the fusion protein (Cwirla, et al., (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 6378-6382). The second difference is a number of biological dispositions that affect the population of peptides currently present in libraries. LacI fusion molecules remain in the cytoplasm of the host cells. Phage coat fusions are exposed to the cytoplasm briefly during translation, but are then rapidly secreted through the inner membrane of the periplasmic region while remaining anchored in the membrane by their hydrophobic C-terminal regions. Peptides protrude into the periplasm by their N-terminus while waiting to be included in phage particles. Peptides in LacI and phage libraries can vary substantially due to the action of various proteolytic activities. In order to be incorporated into phage, the phage coat proteins require transport through the inner membrane and signal peptidase processing. Certain peptides have been implicated in deletion of these procedures and are present in libraries (Gallop et al., (1994) J. Med. Chem. 37 (9): 1233-1251). These certain layouts do not affect the LacI display system.

Number of small peptides available in recombinant peptides. random libraries is enormous. Libraries containing 10 ⁷ to 10 ⁹ independent clones are routinely prepared. Libraries were sized so large that they contained 10 ¹¹ recombinants, but this size was practically limiting for the clone library. This size limitation of the library occurs in the step of transforming DNA that contains random segments into bacterial host cells. In order to lift this limitation, an in vitro system based on imaging nascent peptides in polyzomal complexes has been developed. This way of expressing a library has the potential to produce libraries 3 to 6 orders larger than currently available phage / phagemid libraries. Further, the construction of libraries, peptide expression and screening are performed in a total cell free format.

In one application of this method (Gallop et al. (1994) J. Med. Chem. 37 (9): 1233-1251), a library of molecular DNA encoding 10 ¹² decapeptides was constructed. Said library was expressed in an in vitro E. coli S30 bacterial system that combines transcription and translation. The conditions were chosen to delay the ribosomes to the mRNA, causing a substantial portion of the RNA to accumulate in the polysomes, resulting in complexes that contain nascent peptides that are still linked to their coding RNA. The polysomes are sufficiently powerful to be purified based on affinity at the immobilized receptors in the very same way as the more commonly used recombinant libraries for peptide imaging are tested. RNA is obtained from the binding complexes by conversion to cDNA and amplified by PCR to provide a template for further synthesis and testing. The polysome imaging method may be coupled to a phage display system. Then, na69 follows several rounds of testing, cDNA from the polysomes was cloned into a phagemid vector. This vector serves as a peptide expression vector, expressing peptides fused to envelope proteins, and further serves as a DNA sequencing vector for peptide identification. In phage expression of peptides derived from polysomes, either affinity selection can be continued, or peptides can be tested for binding activity by phage ELISA or individual clones, or tested for binding specificity in a complete phage ELISA assay (Barret, et al., (1992) Anal Biochem 204, 357-364). One DNA sequence was produced by the phagemid host to identify active peptide sequences.

Secondary testing of polypeptides and analogs.

The high throughput assay described above may be followed by secondary screening to identify other biological activities that, for example, will allow one of skill in the art to distinguish the agonist from the antagonist. The type of secondary testing depends on the desired activity to be tested. For example, an assay can be developed in which the ability to inhibit the interaction between a protein and its ligand can be used to identify an antagonist from a group of peptide fragments isolated by primary testing, as described above.

Methods for generating fragments and analogs and assaying their activity are well known in the art. Once the basis of the sequence is known, it is only routine to obtain analogs and fragments.

Peptide mimics of H. pylori polypeptides.

The invention also allows the reduction of protein binding domains of H. pylori polypeptides to produce mimics, e.g. peptide or non-peptide agents. Peptide mimics are capable of disrupting the binding of a polypeptide to their ligand, e.g. in the case of a H. pylori polypeptide that binds to a naturally occurring ligand. Critical residues of the H. pylori polypeptide that are involved in the molecular recognition of the polypeptide and can be used in the production of peptide mimetics derived from H. pylori that reversibly or irreversibly inhibit the binding of the H. pylori peptide to the interaction polypeptide (EP patent application) -412,762A and Ep-B31,080A).

Mutagenesis scanning can be used to map the amino acid residues of a particular H. pylori polypeptide that are involved in binding to an interaction polypeptide, forming peptidomimetic agents (e.g., diazepine or isocholine derivatives) that mimic the binding of these residues to the interaction polypeptide and thereby interfere with the function of a H. pylori polypeptide. For example, non-hydrolyzable peptide analogs of such residues may be generated using benzodiazepine (e.g., Freindinger et al., In Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., Huffman et al., in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gamma-lactam rings (Garvey et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), ketónmetylénových pseudopeptides (Ewenson et al. (1986) J. Med. Chem. 29: 295; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9 ° ¹ American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), beta-loops of dipeptide nuclei (Nagai et al. (1985) Tetrahedron Lett 26: 647; and Sato et al., (1986) J. Chem. Soc. Perkin. Trans. 1: 1231) and beta-aminoalcohols (Gordon et al., (1985) Biochem. Biophys. Res. Commun. 126: 419; and Dann et al., ( 1986) Biochem Biophys Res. Commun. 134: 71).

VI. Vaccine formulations for H. pylori nucleic acids and polypeptides.

The present invention also discloses vaccine compositions which serve to protect against H. pylori infection or to treat H. pylori infection, a gram-negative spiral microaerophilic bacterium. In one embodiment, the vaccine compositions comprise one or more immunogenic components, such as a H. pylori surface protein or a portion thereof, and a pharmaceutically acceptable carrier. Examples of nucleic acids of the invention are those listed in the Sequence Listing which encode H. pylori surface proteins. Any nucleic acid encoding an immunogenic H. pylori protein or a portion thereof that is expressible in a cell may be used according to the invention. Vaccines have therapeutic and prophylactic uses.

The invention provides a composition for protection against H. pylori infection comprising at least one immunogenic fragment of H. pylori protein and a pharmaceutically acceptable carrier. Preferred fragments include peptides that contain at least 10 amino acids of the 71 new residues, preferably about 10 to 20 amino acid residues, and preferably about 12 to 16 amino acid residues are used.

For example, the immunogenic components of the invention can be obtained by screening for polypeptides that are recombinantly produced from the corresponding nucleic acid fragment that encodes a full-length H. pylori protein. In addition, the fragments can be chemically synthesized using methods well known in the art, such as F-Moc or t-Boc solid phase Merrifield chemistry.

In one embodiment, the immunogenic components are identified by the ability of the peptide to stimulate T cells. Peptides that stimulate T cells, as determined, for example, by T cell proliferation or cytokine secretion, as described herein, comprise at least one T cell epitope. T cell epitopes are believed to be involved in the initiation and perceptions of the immune response to a protein allergen that is responsible for the clinical symptoms of allergy. These T cell epitopes are reported to trigger early T-helper-level steps in binding to a suitable HLA molecule on the surface of the antigen present in the cell, stimulating T cell subpopulation with the relevant epitope receptor. These facts lead to T cell proliferation, lymphokine secretion, local inflammatory responses, complementation of other immune cells at the antigen / T cell interaction site, and activation of the B cell cascade leading to antibody production. A T cell epitope is a basic element or smallest unit recognized by a T cell receptor, wherein the epitope comprises amino acids essential for receptor recognition (e.g., about 6 or 7 amino acid residues). Amino acid sequences that mimic T cell epitope sequences are within the scope of the invention.

In another embodiment, the immunogenic components of the invention have been identified by gene vaccination. The basic protocol is based on the idea that expression libraries containing all or parts of the genome of a pathogen, e.g. The H. pylori genome can provide protection when used to genetically immunize a host. This immunization with an expression library (ELI) is an analogue for expressive cloning and involves the reduction of a genomic expression library of a pathogen, e.g. H. pylori bacteria, into plasmids that can act as a gene vaccine. Plasmids can also be designed to encode a genetic adjuvant that can dramatically stimulate a humoral response. These genetic adjuvants can be incorporated into distant sites and function equally well inside and outside the cell.

This is a new approach to vaccine production that has many of the benefits of living / attenuated pathogens but does not risk infection. The expression library of pathogenic DNA is used to immunize the host, exhibiting the effects of the live vaccine antigen without any danger. Random fragments from the H. pylori genome or cosmid or plasmid clones as well as PCR products from genes identified by genomic sequencing can be used to immunize a host. The feasibility of this approach has been demonstrated using Mycoplasma pulmonis (Barry et al., Nature 377: 632-635, 1995), where even a partial expression library of Mycoplasma pulmonis, which is a natural pathogen in rodents, provides protection against pathogen attack.

ELI is a method that allows the production of a non-infectious multiparous vaccine, even if little is known about the biology of the pathogen, because ELI uses the immune system to test candidate genes. Once these genes have been isolated, they can be used as genetic vaccines or for the development of recombinant protein vaccines. Thus, ELI allows vaccine production in a systematic, highly mechanized manner.

Testing of the immunogenic components can be performed using one or more of several different methods. The in vitro stimulating activity of the T cells of a peptide is assayed by contacting a peptide known or believed to be immunogenic with the antigen of the cells present, which are suitable MHC molecules in a T cell culture. The presence of an immunogenic H. pylori peptide in conjunction with suitable T cell MHC molecules along with the necessary costimulation allows signal transmission to the T cell, inducing the production of increased amounts of cytokines, particularly interleukin-2 and interleukin-4. The presence of intereleukin-2 or other known cytokines may be tested in the culture supernatant obtained. In the case of interleukin-2, any assay of several commonly available, such as e.g. the assay described in Proc. Natl. Acad. Sci. USA, 86: 1333 (1989). The interferon production assay available from Genzyme Corporation (Cambridge, MA) can also be used.

Alternatively, a conventional T cell proliferation assay measures the incorporation of tritiated thymidine. T cell proliferation is measured in vitro by determining the amount of labeled thymidine incorporated into the replicating DNA of the cultured cells. Therefore, the rate of DNA synthesis and the rate of cell division can be quantified.

The vaccine composition of the invention comprising immunogenic components (e.g., an H. pylori polypeptide or fragment thereof, or a nucleic acid encoding an H. pylori polypeptide or fragment thereof) preferably comprises a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" means a carrier that does not cause an allergic reaction or has no other adverse effect on the patients to which it is administered. Suitable pharmaceutically acceptable carriers include e.g. one or more of the group consisting of water, saline, phosphate-buffered saline, dextrose, glycerol, ethanol, and the like, as well as combinations thereof. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary agents, such as wetting and emulsifying agents, preservatives, or buffers, which increase the possible shelf life or potency of the antibodies. For vaccines of the invention that contain H. pylori polypeptides, the polypeptide is administered together with a suitable adjuvant.

It will be appreciated that the therapeutically effective amount of the DNA or protein of the invention depends upon the administration schedule, the unit dose of the antibodies administered, whether the protein or DNA is administered in combination with other therapeutic agents, the immune status and health of the patient and the therapeutic activity of the protein or DNA.

The vaccine compositions are conveniently administered parenterally, e.g. injection either subcutaneously or into a muscle. Methods of intramuscular immunization are described by Wolff et al., (1990) Science 247: 1465-1468 and Sedegah et al. (1994) Immunology 91: 9866-9870. Other modes of administration include oral and pulmoral formulations, suppositories, and transdermal applications. In inducing protection against H. pylori infection, oral immunization is preferred over parental methods (Czinn et al., (1993) Vaccine 11: 637-642). Oral formulations include normally employed excipients such as e.g. mannitol in a pharmaceutical grade suitable for use, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like.

The vaccine composition of the invention may include an adjuvant which includes, but is not limited to, aluminum hydroxide; N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP); Nacetyl-nor-muramyl-L-alanyl-D-isoglutamine (GGP 11637, nor-MDP); N-acetylmuramyl-Lalanyl-D-isoglutaminyl-L-alanine-2- (1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) ethylamine (GGP 19835A, MTP-PE); RIBI, which contains three components from bacteria; monophosphoryl lipid A; trehalose dimycoloate; cell wall skeleton (MPL + TDM + CWS) in 2% squalen / Tween 80 emulsion; and cholera toxin. Other substances that may be used are nontoxic derivatives of cholera toxin including subunit B and / or conjugates or genetically manipulated fusions of the H. pylori polypeptide with cholera toxin or its B subunit, procholeragenoid, fungal polysaccharides, including schizophyllin, muramyldipeptide , phorbol esters, E. coli labile toxin, bacterial lysates that do not contain H. pylori, block polymers or saponins.

Other suitable delivery methods include biodegradable microcapsules or immunostimulating complexes (ISCOMs) or liposomes, genetically manipulated attenuated live vectors or bacteria, and recombinant (chimeric) virus-like particles. The amount of adjuvant used depends on the type of adjuvant used. If e.g. mucosal adjuvant cholera, preferably from about 5 pg to about 50 pg, e.g. in the range of 10 pg to 35 pg. When used in the form of microcapsules, the amount used depends on the amount contained in the microcapsule to achieve the desired dose. Determination of this amount is routine to one skilled in the art.

Carrier systems suitable for use in humans may include capsules from which the active agent is released in the intestines, thereby protecting the antigen from the acidic environment in the stomach, and which includes H. pylori polypeptide in insoluble form as fusion proteins. Suitable carriers for the vaccines of the invention are intestinal encapsulated capsules and polylactide glycolide microspheres. Suitable solvents are 0.2 N NaHCO 3 and / or saline.

The vaccines of the invention can be administered to adults and children as a primary prophylactic agent, as a secondary prevention after H. pylori has been successfully exterminated in an infected individual. They can be used as a therapeutic agent to induce an immune response in a susceptible host to prevent infection by H. pylori. The vaccines of the invention are administered in an amount determined by one skilled in the art. In adults, a suitable dose is in the range of 10 pg to 10 g, preferably 10 pg to 100 mg, for example 50 pg to 50 mg. A suitable adult dose may also be in the range of 5 µg to 500 mg. A similar dose range may also be applied to children. One skilled in the art will recognize that the optimal dose may be more or less dependent on the patient's body weight, disease, mode of administration, and other factors. Those skilled in the art also know that a suitable dose can be obtained based on the results obtained with oral vaccines, e.g. a vaccine based on E. coli lysate (6 mg daily, total amount 540 mg) and enterotoxigenic purified E. coli antigen (4 doses of 1 mg) (Schulman et al., J. Urol. 150: 917-921 (1993); Boedecker et al., American Gastroenterological Assoc., 999: A-222 (1993)). The number of doses depends on the disease, formulation and efficacy resulting from clinical trials. During the course of treatment, 3 to 8 doses may be administered on a primary immunization schedule lasting one month (Boedeker, American Gastroenterological Assoc. 888: A-222 (1993)).

It will be appreciated that some vaccine compositions of the invention are useful only for the prevention of H. pylori infection and some are useful for the treatment of H. pylori infection and some are useful for both the prevention and treatment of H. pylori infection. In a preferred embodiment of the invention, the vaccine composition provides protection against H. pylori infection by stimulating humoral and / or cell-mediated immunity against H. pylori. It is understood that amelioration of any symptom accompanying H. pylori infection is a desired goal, which includes determining the dose of the medicament used to treat the disease caused by H. pylori.

VII. Antibodies that react with H. pylori polypeptides.

The invention also provides antibodies that specifically react with a H. pylori polypeptide. Anti-protein / antipeptide antisera or monoclonal antibodies can be prepared according to standard protocols (e.g., Antibodies: A Laboratory Manual ed. Harlow and Lane (Cold Spring Harbor Press: 1988)). Mammals, such as a mouse, hamster, or rabbit, can be immunized with an immunogenic form of the peptide. Methods that confer the immunogenicity of a protein or peptide include conjugation of carriers or other methods well known in the art. The immunogenic portion of the H. pylori polypeptide can be administered in the presence of an adjuvant. Progress of immunization can be monitored by detecting antibody titer in plasma or serum. Standard ELISA or other immunoassays can be used in conjunction with an immunogen that serves as an antigen to estimate antibody levels.

In a preferred embodiment of the invention, the antibodies are immunospecific for antigenic determinants of H. pylori polypeptides of the invention, e.g. the antigenic determinants of the polypeptide set forth in the Sequence Listing, or a related human or non-human mammalian homolog (e.g., 90% homologous, more preferably at least 95% homology). In another preferred embodiment of the invention, the antibodies against H. pylori do not give a substantial cross-reaction (i.e., they react specifically) with a protein that is, for example, less than 80% homologous to the sequence indicated in the sequence protocol. The term "do not give a substantial cross-reaction" means that the antibodies have a binding affinity for a non-homologous protein of less than 10%, preferably less than 5%, more preferably less than 1% of the binding affinity of the protein contained in the sequence protocol. In the most preferred embodiment, there is no cross-reactivity between bacterial and mammalian antigens.

The term antibody herein includes fragments thereof that also specifically react with H. pylori polypeptides. Antibodies can be divided into fragments using conventional methods and then tested for their applicability in the same manner as described above for whole antibodies. F (ab ') ₂ fragments can be generated by applying pepsin to the antibody. The resulting F (ab ') ₂ fragment can be treated to reduce disulfide bridges and produce Fab' fragments. The antibody of the invention further comprises bispecific and chimeric molecules having anti-77. pylori part.

Monoclonal and polyclonal antibodies (Ab) directed against H. pylori polypeptides or H. pylori polypeptide variants and antibody fragments such as Fab'a F (ab ') ₂ can be used to block the action of H. pylori polypeptide and allow studying the role of a particular H. pylori polypeptide of the invention in deviating or unwanted intracellular signaling as well as normal cellular functions of H. pylori. Antibodies against the .beta., pylori polypeptide of the invention are administered by microinjection.

Antibodies that specifically bind to H. pylori epitopes can also be used in immunochemical staining of samples to assess the amount and pattern of expression of H. pylori antigens. Antibodies to the H. pylori polypeptide can be used for diagnosis in immunoprecitation and immunoblotting to detect and evaluate the amount of H. pylori in tissues or body fluids as part of a clinical trial procedure. The ability to monitor the amount of H. pylori polypeptide in an individual may allow the efficacy of a given treatment regimen to be determined in an individual affected by the disease. The amount of H. pylori polypeptide can be measured in cells that are found in body fluids, such as urine samples, or can be measured in tissues obtained by gastric biopsies. For example, diagnostic assays using antibodies against H. pylori may include immunoassays leading to early diagnosis of H. pylori infections. The invention can also be used as a method of detecting antibodies contained in samples of individuals infected with this bacterium using H. pylori specific antigens.

Another use of antibodies against H. pylori polypeptide is in immunoassay of cDNA libraries in expression vectors such as Xgt11, λgt18-23, λΖΑΡ and ÁORF8. Mediator libraries of this type have coding sequences incorporated in the correct reading frame and are oriented so that fusion proteins can be produced. E.g. Ägt11 produces fusion proteins whose N-terminus contains β-galactosidase amino acid sequences and their C-terminus contains a foreign polypeptide. Antigenic epitopes of the H. pylori polypeptide can then be detected by antibodies. Such a method is to react antibodies against H. pylori polypeptide with antigens on nitrocellulose filters lifted from infected plates. The phage detected by this assay can then be isolated from infected plates. The presence of H. pylori gene homologs can be detected and cloned from other species, and altered isoforms (including spliced variants) can also be detected and cloned.

VIII. Kits comprising the nucleic acids, polypeptides or antibodies of the invention.

The nucleic acid, polypeptides and antibodies of the invention may be combined with other agents to form kits. Kits for diagnostic purposes typically contain in the tubes nucleic acid, polypeptides or antibodies or other suitable substances. The kits typically contain other reagents that are suitable for hybridization reactions, polymerase chain reactions (PCR), or for reconstitution of lyophilized components such as aqueous media, salts, and the like. The kits may also contain sample processing agents such as detergents, chaotropic salts and the like. The kits may further include articles suitable for immobilization, such as particles, supports, cells, rods, and the like. Further, they may include labeling items such as dyes, development agents, radioisotopes, fluorescent agents, luminescent or chemoluminescent agents, enzymes, and the like. Based on the amino acid and nucleic acid sequence information provided herein, a kit can be readily assembled for a particular purpose. The kits may further include instructions for use.

IX. Drug testing using H. pylori polypeptides.

In order to make isolated and recombinant H. pylori polypeptides available, the invention describes an assay that can be used to test drugs that are either agonists or antagonists of normal cellular function, in this case H. pylori polypeptides or their role in intracellular signaling. Such inhibitors or potentiators can be used as novel therapeutic agents for combating H. pylori infection in humans. A variety of assays are sufficient and will be used by one skilled in the art in accordance with the invention.

For drug testing programs that test libraries of substances and natural extracts, high throughput tests are used to maximize the number of substances tested over a given period of time. Often, priming assays are those that take place in non-cellular systems, e.g. they proceed with purified or semi-purified proteins. These assays are designed to allow rapid development and relatively easy detection of changes in molecular targets that are mediated by the test substance. The effects of cell toxicity and / or bioavailability of a test substance can generally be ignored in in vitro systems. The assay, instead of focusing primarily on the effect of the drug on the molecular target, may show a change in binding affinity to other proteins or a change in the enzymatic properties of the molecular target. According to an exemplary assay of the invention, the substance is contacted with an isolated and purified H. pylori polypeptide.

Screening assays can be constructed in vitro with a purified H. pylori polypeptide or fragment thereof. Such a pylori bacterium polypeptide has an enzymatic activity that produces a detectable reaction product. The efficacy of a substance can be estimated by generating a dose-response curve from data obtained using various concentrations of the test substance. A control test may also be run to obtain baseline values. Suitable products include those exhibiting different absorption, fluorescence or chemiluminescence properties, for example because detection can be readily automated. In order to identify those agents that inhibit and enhance the activity of the H. pylori polypeptide, a variety of synthetic and naturally occurring substances can be tested. Some of these active agents can directly or chemically alter membrane permeability or solubility, also inhibit or enhance the same activity (e.g., enzymatic activity) in whole living H. pylori cells.

Other embodiments of the invention.

A number of nucleic acids and corresponding polypeptides of the invention have been previously disclosed in U.S.S.N. No. 08 / 761,318, filed Dec. 6, 1996 (GTN-009CP2), U.S.S.N.

No. 08 / 736,905 filed October 25, 1996 (GTN-010CP) and U.S.S.N. No. 08 / 738,859, filed October 28, 1996 (GTN-009CP), which is a sequel to U.S.S.N. No. 08 / 625,811, filed Mar. 29, 1996 (GTN-009), and U.S.S.N. No. 08 / 758,731 filed April 2, 1996 (GTN-010).

Overview of the figures in the drawing

In the picture no. 1 is a bar graph depicting the antibody titer in the sera of mice immunized with the specific antigens of H. pyroli.

In the picture no. 2 is a bar graph depicting the antibody titer in the mucosa of mice that have been immunized with specific antigens of H. pyroli.

In the picture no. 3 is a bar graph depicting therapeutic immunization of mice infected with specific antigens dissolved in HEPES buffer.

In the picture no. 4 is a bar graph depicting therapeutic immunization of mice infected with specific antigens dissolved in a buffer containing DOC.

In the picture no. 5 is a graph showing the activity of recombinant PPIase.

In the picture no. 6 is a graph depicting PPIase activity in H. pylori extract.

In the picture no. 7 is a graph showing a decrease in glutamate racemase activity with L-serine-Osulfate.

Picture no. 8 depicts the amino acid sequence alignment in a portion of the sequence of the 12 H. pylori proteins (shown by a one letter amino acid code and denoted by amino acid sequence ID numbers; shows the sequence from left to right from end to C-terminus).

Picture no. 9 depicts a portion of the N-terminus of nine H. pylori proteins (represented by a single letter amino acid code and denoted by amino acid sequence ID numbers; shows a left to right sequence from the N-terminus to the C-terminus).

DETAILED DESCRIPTION OF THE INVENTION

Example # 1: Cloning and sequencing of H. pylori DNA.

The chromosomal DNA of H. pylori was isolated according to the basic DNA protocol of Schleif R.F. and Wensink P.C., Practical Methods in Molecular Biology, p. 98, Springer-Verlag, NY., 1981, with some minor changes. A cell pellet was formed, resuspended in TE (10 mM Tris, 1 mM EDTA, pH 7.6) and GES lysis buffer (5.1 M guanidine thiocyanate, 0.1 M EDTA, pH 8.0, 0, was added). 5% N-lauryl sarcosine). The suspension was cooled and ammonium acetate (NFL / Ac) was added in an amount to a final concentration of 2.0 M. DNA was extracted first with chloroform, then with phenol-chloroform, and again extracted with chloroform. The DNA was precipitated with isopropanol, washed twice with 70% EtOH, dried and resuspended in TE.

Isolated whole genomic H. pylori DNA was fragmented (Bodenteich et al., Automated DNA Sequencing and Analysis J.C. Venter et al. Ed., Academic Press, 1994) to a mean size of 2000 bp. Then the DNA was concentrated and separated on a standard 1% agarose gel. Some fractions corresponding to approximately 900 to 1,300 bp, 1300 to 1,700 bp, 1,700 to 2,200 bp, 2,200 to 2,700 bp, were excised from the gel and purified with a GneClean kit (BiolOl, Inc.).

The purified DNA fragments were blunt-ended using T4 DNA polymerase. The DNA was then ligated into a single BstXI linker adapter, which is present in a 100-1000 fold excess. These linkers are complementary to the BstXI digested pMPX vectors, while the overhangs are not complementary to each other. For this reason, the linkers will not be concatemerized nor the cleaved vectors will simply be ligated to each other. The inserts with the linkers were separated from the linkers that were not incorporated on a 1% agarose gel and isolated using the GeneClean kit. Linker inserts were then ligated to each of the 20 pMPX vectors to construct a series of subclone libraries. The vectors contain the LacZ gene outside the frame at the cloning site. This cloning site is incorporated into the frame when the adapter dimer is cloned, as indicated by its blue color.

All subsequent steps follow the multiplex DNA sequence protocols described in Church G.M. and Kieffer-Higgins S., Science 240: 185-188, 1988. Only the major modifications are highlighted here. Each of the 20 vectors was then transformed into competent DH5α cells (Gibco / BRL), a transformation protocol for DH5α). Libraries were determined by plating on antibiotic plates containing ampicillin, methicillin and LPTG / Xgal. Plates were incubated overnight at 37 ° C. Transformants were then used to further load the clones on the plates and all were collected. Clones were isolated and transferred to 40 ml culture growth medium. The culture was cultured overnight at 37 ° C. DNA was isolated using a Qiagen Midi-prep kit and Tip-100 columns (Qiagen, Inc.). 100 μg of DNA was thus recovered from a single pool. 15 96-cell DNA plates were prepared to obtain a 5 to 10-fold excess sequence with an average length of 250 to 300 bases.

These isolated DNA samples were then sequenced using multiple DNA sequencing, which is based on chemical degradation methods (Church G. M. and KiefferHiggins S., Science 240: 185-188, 1988) or according to Sequithr (Epicenter Technologies) dideoxy sequence protocol. Sequencing reactions were electrophoretized and transferred to a nylon membrane by direct transfer of 40 cm gel electrophoresis (Richterich P. and Church G.M., Methods in Enzymology 218: 187-222, 1993) or by electroblotting (Church, supra). Twenty-four samples were analyzed on the gel. Chemical membranes generated 45 membranes and 8 were formed by dideoxy sequencing. DNA was covalently bound to membranes by exposure to UV light and hybridized with labeled oligonucleotides that are complementary to the tag-carrying sequences of the vectors (Church, supra). The membranes were washed to remove non-specific bound probes and exposed to X-ray film to visualize the individual sequence leaderboards. After autoradiography, the hybridized probe was removed by incubation at 65 ° C and the hybridization was repeated with another tag sequence. The membrane produced by chemical sequencing was hybridized 38 times and dideoxy sequencing membranes were hybridized 10 times. Thus, a large number of exposed films were prepared from each gel, each containing new sequencing information. Each processed blot was initially hybridized to a probe that revealed an internal standard sequence that was added to each collection.

The films were digitally processed using a laser-scanned densitometer (Molecular Dynamics, Sunnyvale, CA). Digitized films were processed on a computer (VaxStation 4000's) using REPLICA ™ (Church et al., Automated DNA Sequencing and Analysis (J.C.

Venter, ed., Academic Press, 1994). Processing of the digitized film includes straightening lines, adjusting the contrast to enhance the contrasts, and improving resolution through an iterative Gaussian distribution. The sequences were then automatically loaded into REPLICA ™ and displayed for interactive correction before being stored in the database. Sequence corrections were performed by rapid visual scanning of the film. This was followed by a mouse click on certain strips of the displayed film to modify the base name. For typical chemical sequencing sequences processed on a REPLICA ™ -based program, the error rate is 2-5%, with most errors occurring near the end of the sequence reading. A number of sequence errors can be determined and corrected because the same parts of the genomic DNA sequences are read several times, thus creating adequate sequence redundancy for editing. Each sequence automatically receives a corresponding number, the number corresponding to the microtiter plate and probe information and the track number (corresponding to the microtiter plate columns). This number serves to permanently identify the sequence so that it is always possible to identify the origin of any particular sequence without having to return to a specialized database.

By routine route, the H. pylori sequence was assembled using the FALCON program (Church, Church et al., Automated DNA Sequencing and Analysis (J.C. Venter, ed.), Academic Press, 1994). This upgrade program is fast and suitable for most sequences. The assembled "contigs" were displayed using a modified version of GelAssemble developed by Genetics Computer Group (GCG) (Devereux et al., Nucleic Acid Res. 12: 387-95, 1984). This program works with REPLICA ™. This allows multiple sequence gels to be immediately retrieved from the REPLICA ™ database and displayed, allowing rapid scanning of “contigs” and correction of gel paths if there are some differences between different sequence readings in the assembly.

Example 2: Identification, Cloning and Expression of Nucleic Acid Bacteria, pylori.

Expression and purification of H. pylori polypeptides of the invention can be performed in essentially the same manner as described below.

To perform the cloning, expression and purification of membrane and secreted bacterial proteins, pylori, the pET gene expression system (Novagen) was selected for use in the cloning and expression of recombinant proteins in E. coli. The DNA sequence that encodes the peptide tag, His-Tag, is fused to the 3-terminus of DNA sequences of interest to purify the recombinant protein product. The 3 'end was chosen for fusion to avoid altering any signal sequence at the 5' end. The exception is ppiB, a gene whose cloning gives control in expression studies. The H. pylori ppiB gene sequence contains the DNA sequence encoding the His-Tag gene fused to the 5'-end of the full-length gene because the protein product of this gene does not contain a signal sequence and is expressed as a cytosolic protein.

PCR amplification and cloning of nucleic acids that contain ORFs encoding membrane and secreted H. pylori polypeptides.

Nucleic acids that were selected (e.g., nucleic acids listed in the Sequence Protocol) for cloning from H. pylori J99 strain were prepared for amplification cloning by polymerase chain reaction (PCR). Synthetic oligonucleotide primers that are specific for the 5 'and 3' ends of the open reading frames (ORFs) were obtained from GibcoBRL Life Technologies (Gaithersburg MD, USA). All of the previously mentioned primers (specific for the 5 'end of the sequence) were. designed to include a Nco cloning site at the furthest 5'-end site. These primers were designed to allow translation initiation of a protein at a methionine residue followed by a valine residue and a coding sequence of the native H. pylori native DNA sequence. All reverse primers (specific to the 3 'end of any H. pylori ORF) include an EcoRI site at the farthest 5' end, allowing cloning of each H. pylori sequence into the pET28b reading frame. The vector pET-28b provides a sequence encoding an additional 20 amino acids of the C-terminus that includes six histidine residues (at the extreme end of the C-terminus) and containing His-Tag. The exception, as noted earlier, is the vector construction for the ppiB gene. A synthetic oligonucleotide primer specific for the 5-terminus of the ppiB gene encodes a BamH1 site at its farthest 5'-end and a primer for the 3'-terminus of the ppiB gene encodes an XhoI site at its farthest 5'-end.

Genomic DNA prepared from H. pylori J99 strain is used in PCR amplification reactions as a source of template DNA (Current Protocols in Molecular Biology,

John Wiley &amp; Sons, Inc., F. Ausubel et al, eds., 1994). In order to amplify the DNA sequence containing the H. pylori ORF, genomic DNA (50 nanograms) was added to a reaction tube containing 2mM MgCk, 1 micromolar synthetic oligonucleotide primers (forward and reverse primers) flanking the particular H. pylori ORF, 0.2 mM each of deoxynucleotide triphosphate; dATP, dGTP, dCTP, dTTP and 2.5 units of thermostable DNA polymerase (Amplitaq, Roche Molecular Systems, Inc., Branchburg, NJ, USA) with a final volume of 100 microliters.

After thermal cycling reactions, each amplified DNA sample is washed and purified using a Qiaquick Spin PCR purification kit (Qiagen, Gaithersburg, MD, USA). All amplified DNA samples are digested with a restriction endonuclease, e.g. Ncol and EcoR1 (New England Biolabs, Beverly, MA, USA) (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994). DNA samples were electrophoresed on a 1.0% NuSeive agarose gel (FMC BioProducts, Rockland, ME USA). DNA is visualized by exposure to ethidium bromide and long wave UV radiation. DNA that is included in the excised strips isolated from the agarose gel is purified according to the Bio 101 GeneClean Kit protocol (Bio 101 Vista, CA, USA).

Cloning of H. pylori nucleic acids into an expression vector.

For cloning, the vector pET-28b was prepared by digesting with endonucleases e.g. Ncol and EcoR1 (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc. F. Ausubel et al., Eds., 1994). In the case of cloning of the ppiB gene, the vector pET-28a, which encodes a His-Tag, is fused to the 5'-end of the inserted gene. For cloning, a restriction site found in the ppiB gene was used and was prepared by digestion with BamHI and XhoI restriction endonucleases.

This is followed by cloning of the DNA inserts (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994) into the cleaved expression vector pET-28b. An exception is the amplified ppiB gene insert, which is cloned into the pET-28a expression vector. The ligation reaction products are then used to transform the E. coli strain BL21 (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994) as described below.

Transformation of competent bacteria with recombinant plasmids.

Competent bacteria, which are E. coli BL21 strain or E. coli BL21 (DE3) strain, were transformed with recombinant pET expression plasmids carrying cloned H. pylori sequences according to standard methods (Current Protocols in Molecular Biology, John Wiley and Sons). , Inc., F. Ausubel et al., Eds., 1994). 1 μΐ of the ligation reaction is mixed with 50 microliters of electrocompetent cells and high voltage pulses are applied. Thereafter, the samples are incubated in 0.45 ml SOC medium (0.5% yeast extract, 2.0% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgsO _4, and 20 mM glucose) at 37 ° C with stirring for one hour. Samples are then plated on LB agar plates containing 25 micrograms / ml kanamycin sulfate and cultured overnight. Transformed BL21 colonies were isolated and inserted clones analyzed.

Identification of recombinant expression vectors using H. pylori nucleic acid.

Individual BL21 clones transformed with recombinant pEt-28b-H.pylori ORFs are analyzed by PCR amplification of cloned inserts using forward and reverse primers that are the same as used in the original PCR amplification cloning reactions. The primers are specific for each H. pylori sequence. Incorporation of H. pylori sequences into the expression vector was verified by successful amplification (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994).

Isolation and preparation of nucleic acids from transformants.

Single clones of recombinant pET-28b vectors that carry properly cloned H. pylori ORFs were isolated and incubated overnight in 5 ml LB broth with 25 micrograms / ml kanamycin sulfate. The following day plasmid DNA was isolated and purified using the plasmid isolation protocol (QiagenQiagen Inc., Chastworth, Ca, USA).

Expression of recombinant H. pylori sequences in E. coli.

The pET vector can be propagated in any strain of E. coli K-12, e.g., HMS174, HB101, Jml09, DH5, etc., for cloning or plasmid preparation. Hosts suitable for expression include strains of E. coli that contain a chromosomal copy of a gene encoding a T7 RNA polymerase. These hosts are the bacteriophage DE3 lysogens, a bacteriophage lambda derivative that carry the lacI gene, the lacUV5 promoter, and the gene encoding the T7 RNA polymerase. T7 RNA polymerase is induced by the addition of isopropyl-β-D-thiogalactoside (IPTG). T7 RNA polymerase transcribes any target plasmid, such as pEt-28b, that carries the gene of interest. The genes used here are: BL21 (DE3) (Studier, F.W., Rosenberg, A. H., Dunn, J. J., and Dudendorff, J. W. (1990) Meth. Enzymol. 185, 60-89).

For expression by the H. pylori sequence, 50 nanograms of plasmid DNA, which was isolated as described above, were used to transform competent BL21 (DE3) as described above (Novagen as part of the pET expression system kit). The lacZ gene (beta-galactosidase) is expressed in pET-Systems which are described for the construction of H. pylori recombinants. The transformed cells are cultured in SOC medium for 1 hour and the culture is then plated on LB agar plates containing 25 micrograms / ml kanamycin sulfate. The next day, bacterial colonies are collected and grown in LB medium containing kanamycin sulfate (25 micrograms / ml) until an optical density of 0.5 to 1.0 OD units at 600 nM is achieved. At this point, 1 millimolar IPTG is added to the culture and further cultivation is continued for three hours, inducing expression of the gene of recombinant H. pylori DNA constructs.

After induction of gene expression by IPTG, pellets of bacteria are generated by centrifugation on a Sorvall RC-3B centrifuge at 3500 x g for 15 minutes at 4 ° C. The pellet is resuspended in 50 ml cold 10 mM Tris-HCl, pH 8.0, 0.1M NaCl and 0.1 mM EDTA (STE buffer). The cells are then centrifuged at 2000 x g for 20 minutes at 4 ° C. The wet pellet is weighed and frozen at -80 ° C. This is then retained until it is used for protein purification.

Example 3: Purification of recombinant proteins from E. coli.

Analytical methods.

Concentrations of isolated proteins were determined spectrophotometrically using absorption coefficients calculated from amino acid content (Perkins, S.J. 1986 Eur. J. Biochem. 157, 169-180). Protein concentration is measured according to the method of Bradford, M.M. (1976) Anal. Biochem. 72, 248-254; and Lowry, O.H., Rosebrough, N., Farr, A.L. & Randall, R.J. (1951) J. Biol. Chem. 193, p. 265-275, using the serum albumin standard.

SDS polyacrylamide gels (with 12% or 4.0 to 25% acrylamide gardener) were purchased from BioRad (Hercules, CA, USA) and stained with Coomasie Blue. Molecular weight markers include rabbit skeletal myosin (200,000), E. coli galactosidase (116,000), rabbit muscular phosphorylase (97,400), bovine serum albumin (66,200), ovalbumin (45,000), bovine carbon dioxide anhydrase (31,000), soybean trypsin inhibitor (21,500), egg white lysozyme (14,400), and bovine aprotinin (6,500).

1. Purification of soluble proteins.

All steps were carried out at 4 ° C. Thawed cells were resuspended in lysis buffer (20 mM Tris, pH7.9, 0.5 M NaCl, 5 mM imidazole with 10% glycerol, 0.1% mercaptoethanol, 200 g / ml lysozyme, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 10 µg. / ml of each of leupeptin, aprotin, pepstatin, L1-chloro-3- [4-tosylamido] -7-amino-2-heptanone (TLCK), L1-chloro-3- [4-tosylamido] -4-phenyl-2 -butanone (TPCK) and soybean trypsin inhibitor are passed several times through a small volume microfluidizer (Model M-110S, Microfluidocs International Corporation, Newton, MA) The resulting homogenate was prepared with 0.1% Brij 35 and centrifuged at 100,000 x G for a period of time. 1 hour to give pure supernatant (i.e., crude extract).

Following filtration through a 0.8 µp Supor filter (Gelman Sciences, FRG), the crude extract was applied directly to Ni ²⁺ -nitrolotriacetate-agarose (NTA) with a 5 ml bed volume (Hochuli, E., Dbeli, H). and Schacheer, A. (1987) J. Chromatography 411,17788

184), which is pre-equilibrated with a lysis buffer containing 10% glycerol, 0.1% Brij 35 and 1 mM PMSF. The column is washed with 250 ml (50 times bed volume) lysis buffer containing 10% glycerol, 0.05% bri 35, 1 mM PMSF and either 20, 100, 200 or 500 mM imidazole. For each fraction was monitored by absorbance at OD 8o ₂ nm, and peak fractions were analyzed by SDS-PAGE assay.

. Purification of insoluble proteins from inclusions.

The following steps are carried out at 4 ° C. Cell pellets were resuspended in lysis buffer with 10% glycerol, 200 µg / ml lysozyme, 5 mM EDTA, 1 mM PMSF and 0.1% mercaptoethanol. The suspension was passed through a device that disrupts the cells. The resulting homogenate was prepared in 0.2% deoxycholate, stirred for 10 minutes, then centrifuged at 20,000 x g for 30 minutes. The pellets were washed with lysis buffer containing 10% glycerol, 10 mM EDTA, 1% Triton X-100, 1 mM PMSF and 0.1% mercaptoethanol, then washed several times with lysis buffer containing 1 M urea, 1 mM PMSF and 0.1% mercaptoethanol. The resulting white pellet is primarily formed by inclusions and does not contain intact cells and membrane material.

Dialysis and concentration of protein samples.

Urea is slowly removed from protein samples by dialysis against Tris-buffered saline (TBS; 10 mM Tris pH 8.0, 150 mM NaCl) containing 0.5% deoxycholate (DOC), and the urea concentration is subsequently reduced by 6M, 4M, 3M, 2M, IM, 0.5M and finally TBS without urea. Each dialysis step is carried out for a minimum of 4 hours at room temperature.

After dialysis, the samples are concentrated by pressure filtration using an Amicon apparatus where they are mixed. Protein concentrations are measured using the methods of Perkinson (1986 Eur. J. Biochem. 157, 169-180), Bradford ((1976) Anal. Biochem. 72, 248-254) and Lowry ((1951) J. Biol. Chem. 193, pp. 265-275).

Example 4: Determination of antigenicity of antigens located in the outer membrane of H. pylori.

Purification of the outer membranes of H. pylori bacteria may be carried out according to the following protocol below.

H. pylori strains J99 (ATCC # 55679) and Ah244 are cultured on chocolate blood agar containing 5% (v / v) horse blood at 37 ° C in an atmosphere containing 10% CO 2 for 48 hours. The bacteria were collected in suspension in 20 mM Tris pH7.5. Cells were centrifuged at 12,000 x g for 20 minutes at 4 ° C and washed 3 times with 20 mM Tris pH 7.5. Cells were resuspended in 20 mM Tris pH 7.5 and opened by sonication on ice (8 beats for 30 seconds at 60 watts with a 60 second pause between beats. DNase (0.1 mg) and RNase (0.1 mg) were added to the cell suspension. 0.5 mg) and the mixture was incubated for 30 minutes at room temperature The cell suspension was centrifuged at 12,000 xg for 20 minutes at 4 ° C. The supernatant was returned and centrifuged once more All membranes were removed from the supernatant centrifugation at 40,000 xg for 30 minutes at 4 ° C. The pellet is washed twice with 20 mM Tris, pH 7.5 Protein content is assayed by the Bradford Bovine Serum Albumin (BSA) protein assay, which is used as a standard. The concentration of the suspension is then adjusted to contain 1 mg of protein per milliliter of suspension, and the membranes are dissolved after addition of N-lauryl-sarcosine to the suspension at a rate of 6 mg of N-lauryl-sarcosine per mg of protein. The incubators were incubated for 30 minutes at room temperature in the presence of N-lauryl-sarcosine. The outer membranes were centrifuged at 40,000 x g for 30 minutes at 4 ° C. The pellet was washed 3 times with Milli Q water, aliquoted and stored at -20 ° C until use.

Identification of H. pylori outer membrane antigens.

The outer membrane antigens can be identified according to the protocol below. Proteins were separated on sodium dodecylsulfate polyacrylic gels (SDSPAGE) according to the method of Laemmli, U.K. (1970) Nature (London) Volume 277, 680685. Samples were prepared by suspending in standard buffer and heating at 100 ° C for 10 minutes. Single cells (0.75 mm) of 8 x 10 cm minigels were loaded with 1-5 mg of proteins. The separated proteins were then transferred to PVDF membranes as described below.

Electroblotting of the separated proteins onto PVDF membranes is performed on a BioRad Mini-Trans blotter electrophoretic device. Immobilon-P ^SQ PVDF membrane is used. Electroblotting is performed for 60 minutes at 50 V using CAPS transfer buffer (10 mM 3- [cyclohexylamino] -1-propanesulfonic acid, 10% methanol). The membrane is stained with 0.2% Ponceau S and stained with Milli Q water.

Antigens are then identified using Western immunoblotting. For electroblotting, non-specific binding sites are blocked with 5% non-fat dry milk in 10 mM Tris-HCl 0.9% NaCl, pH7.5. The membrane is incubated with normal mouse serum at the appropriate dilution, which is contained in 10 mM Tris-HCl-0.9% NaCl-0.5% Tween 20-0.5% BSA, pH 7.5 for 2 hours and at a temperature of 37 ° C and washed 3 times with 10 mM Tris-HCl-0.9% NaCl-0.5% Tween 20, pH7.5 (TTBS). Goat anti-mouse Ig alkaline phosphatase was then added to 10 mM Tris-HCl-0.9% NaCl-0.5% Tween 20-0.5% BSA, pH7.5 and incubated for 1 hour at After this incubation, the membrane was washed 3 times with TTBS. The bands that reacted were visualized using a suitable substrate for alkaline phosphatase 5-bromo-4-chloro-3-indolylphosphate (Bio-Rad) and nitrotetrazolium blue (Bio-Rad), which is used as a color developing agent.

In amino acid microsquencing, proteins that are determined to be immunoreactive are cleaved from fresh immobilized membranes and sequenced on a Worcestre Foundation microsquencing apparatus. The membranes from which the protein bands were excised are then subjected to a western immunoblot as described above to confirm that the correct bands were excised.

Example 5: Analysis of Protein B, Pylori Proteins as Vaccine Candidates

To investigate the immunomodulatory effect of H. pylori proteins, a H. pylori mouse / bacterium model was used. This model mimics human infection caused by H. pylori in many respects. The focus is on the effect of oral immunization of animals infected with H. pylori to test therapeutic oral immunotherapy.

The animals

Female SPF BALB / c mice were obtained from the Bomholt Breeding Center (Denmark). They were kept in normal macrolone cages with free water supply and feeding. At delivery, the animals were 4-6 weeks old.

infection

After minimal acclimation of one week, the animals were infected with a H. pylori type 2 strain (VacA negative) (strain 244, originally isolated in a patient with ulcers). It has previously been shown that this strain can well colonize mouse stomach. The bacteria were cultured overnight on Bruccel broth supplemented with 10% fetal calf serum at 37 ° C in a microaerophilic atmosphere (10% CO ₂ , 5% O ₂ ). The animals received an oral dose of omeprazole (400 μηιοΐ / kg) and 3-5 hours after this oral soil inoculation with H. pylori (approximately 10 ⁸ cfu / animal; cfu is the number of units that make up the colonies). Positive infection was demonstrated in some animals 2 to 3 weeks after inoculation.

antigens

Recombinant H. pylori antigens were selected based on their association with externally exposed H. pylori cell membrane. These antigens were selected from the following groups: (1) outer membrane proteins; (2) periplastic / secreted proteins; (3) outer surface proteins; and (4) inner membrane proteins. All recombinant proteins were constructed for purification with the hexa-His-tag and a control protein that was not derived from Helicobacter pylori (β-galactosidase from E. coli; LacZ) was constructed in the same manner.

All antigens were used in dissolved form, i.e. dissolved in HEPES buffer or another buffer containing 0.5% deoxycholate (DOC).

Antigens are listed in Table 2. 8 below.

Table no. 8

Helicobacter pylori proteins

Outer membrane proteins protein 1 protein 2 protein 3 protein 4 protein 5

Periplastic / secreted proteins protein 6

Other cellular envelope proteins protein 7 protein 8

Proteins associated with flagela protein 9

Control proteins β-galactosidase (LacZ)

Immunization of animals in each group was immunized four times for 34 days (on day 1, 15, 25 and 35). Purified antigens were administered in solution or suspension at a dose of 100 µg per mouse. The animals also received 10 μg per mouse (CT) cholera toxin at each immunization. Omeprazole (400 μιηοΐ / kg) was orally administered to animals 4-5 hours prior to immunization as a way to protect antigens against acid degradation. Infected control animals received buffer HEPES and CT or buffer

DOC and CT. Animals were sacrificed 2-4 weeks after final immunization. The general course of immunization is shown in Table 2. 9 below.

Table no. 9

Study of therapeutic immunization course.

Mice were infected with H. pylori Ah244 strain 30 days.

substance mouse strain n = 10 Dose / Mouse dosing data 1st control, PBS Balb / c 0.3 ml 0, 14, 24, 34 2. cholera toxin Balb / c 0.3 ml 0, 14, 24, 34 3. Protein 1, 100 µg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 4. Protein 5, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 5. Protein 10, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 6. Protein 9, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 7. Protein 2, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 8. Protein 6, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 9. Protein 4, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 10. Protein 7, 100 µg / ml + 10µg CT Balb / c 0.3 ml 0, 14, 24, 34 11. Protein 8, 100 µg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34 12. Protein 3, 100 pg / ml + CT 10pg Balb / c 0.3 ml 0, 14, 24, 34

Analysis of infection.

Mucosal infection: Mice were sacrificed by CO 2 and cervical dislocation. Their belly was opened and their stomach removed. The stomach was washed with physiological saline after dissection due to greater curvature. Mucosa from the antrum and corpus area of 25 mm ² was scraped off with a surgical scalpel. This scrape was resuspended in Brukel's broth and plated on blood Skirov selective plates. The plates were incubated under microaerophilic conditions for 3-5 days and the number of colonies counted. The identity of H. pylori was determined based on a urease and catalase assay and direct microscopic observation or Gram staining.

The urease test was performed essentially as follows. The urine agar base concentrate was purchased from DFCO Laboratories, Detroit, MI (Catalog # 028461-3). The urine agar base concentrate was diluted 1:10 with water, 1 ml of the diluted concentrate was mixed with 100-200 µl of actively growing H. pylori cells. A change in the color of fucsin indicates that they are urease positive.

The catalase assay was performed according to the following procedure. Reagent Ν, Ν, Ν ', Ν tetramethyl-β-phenylenediamine was obtained from Sigma, St. St. Louis, MO (catalog number T3134). A reagent solution (1% w / v in water) was prepared. H. pylori cells were plated on Whatman filter paper and overlaid with a 1% solution. The color change to dark blue indicates that they are catalase positive.

Serum Antibodies: Blood was collected from all mice by heart puncture and serum was prepared. Serum antibodies were identified by a conventional ELISA method where specific Helicobacter pylori antigens were applied.

Mucosal Antibodies: 50% of the mice were finely scraped off a defined part of the corpus and 4 cm duodenum to detect the presence of antibodies in the mucosa. Antibody titers were determined by conventional ELISA, as used to detect serum antibodies.

Statistical analysis: The Wilcoxon-Mann-Whitney test was used to determine the substantial effects of antigens on Helicobacter pylori colonization. A P value of less than 0.05 is considered significant. Since anthrum is the principal site of Helicobacter colonization, emphasis has been placed on changes in anthral colonization.

The results.

Serum Antibodies: All tested antigens that were co-administered with CT gave rise to a measurable specific antibody titer in serum. The highest response was seen in proteins 3, 4, 9, 1 and 7. (Fig. 1).

Mucosal Antibodies: Specific antibodies to all tested antigens were observed in the mucosa. The strongest response was observed for protein 6, followed by proteins 1, 3 and 9 (Fig. 2).

Effects of Therapeutic Immunization: All control animals (BALB / c mice) were well colonized by H. pylori (strain AH244) in both stomach and anterior parts of the stomach. The antigens of the three proteins tested (proteins 4, 7 and 1) caused a substantial reduction and / or eradication of the H. pylori infection. In the case of proteins 8, 9 and 3, the degree of antrum colonization after immunization was lower than that of the control. The effect of proteins 5, 2 and 6 was not different from the control. The lacZ control protein, a non-H. pylori protein, had no eradication effect, and in fact, when applied, Helicobacter colonization was higher compared to the HEPES + CT control. All data for proteins dissolved in HEPES and DOC are shown in FIG. no. 3 and 4. Data is expressed as geometric mean value. N = 8-10 Wilcoxon-Mann-Whitney test * = p less than 0.05; x / 10 - number of mice showing eradication of H. pylori from the total number of mice tested.

The data presented indicates that all protein-associated H. pylori bacteria involved in the study result in stimulation of an immune response measurable by specific serum and mucosal antibodies when used as oral immunogens in conjunction with oral CT adjuvant. Most proteins in said animal model cause reduction and in some cases total elimination of H. pylori colonization. It should be noted that the reduction or destruction of colonization was accomplished by heterologous protection rather than homologous protection (the polypeptides are based on the H. pylori J99 strain sequence and used in therapeutic immunization studies against a different (AH244) vaccine strain), indicating vaccine potential against a wide range of H. pylori strains.

The greatest anthrum colonization was observed in animals treated with non-Helicobacier LacZ protein, indicating that the effect observed with Helicobacier pylori antigens was specific.

The data strongly support the use of said H. pylori proteins in pharmaceutical formulations which are administered to humans for the treatment and / or prevention of H. pylori infections.

Example 6: Sequence analysis of Helicobacier pylori strains genes.

Four genes from several H. pylori strains were cloned and sequenced to compare DNA and deduced amino acid sequences. This information was used to determine sequence changes between a H. pylori J99 strain and other H. pylori strains that were isolated from human patients.

Preparation of chromosomal DNA.

Cultures of H. pylori strains (as shown in Table 12) were cultured in BLBB (1% tryptone, 1% peptamine, 0.1% glucose, 0.2% yeast extract, 0.5% sodium chloride, 5%). % fetal bovine serum) up to an OD of ₆ oo 0.2. Cells were centrifuged on Sorvall RC-3B at 3500 xg, at 4 ° C and for 15 minutes. The pellet was resuspended in 10 mM Tris-HCl, 0.1 mM EDTA (TE) with a volume of 0.95 ml. Lysozyme was added to the suspension to give a final concentration of 1 mg / ml, SDS to a concentration of 1%, and RNase A + TI to a concentration of 0.5 mg / ml and 5 units / ml. The mixture was incubated for one hour at 37 ° C. Proteinase K was then added in an amount to a final concentration of 0.4 mg / ml and the sample incubated at 55 ° C for more than one hour. 0.65 M NaCl was added to the sample, mixed slowly and 0.15 mL of 10% CTAB in 0.7 M NaCl (final concentration was 1% CTAB / 70 mM NaCl) was added, followed by incubation for 20 min. minutes at 65 ° C. At this point, the samples were extracted with chloroform: isoamyl alcohol, phenol and again chloroform: isoamyl alcohol. DNA was precipitated with either ethanol (1.5 x volume) or isopropanol (0.6 x volume) at -70 ° C for 10 minutes, washed with 70% EtOH and resuspended in TE.

PCR amplification and cloning

Genomic DNA was prepared from twelve Helicobacter pylori strains and used as a template DNA source for PCR amplification reactions (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994). To amplify a DNA sequence containing an H. pylori ORF, into the reaction tube-charged 10 nanograms of genomic DNA, comprising 2 mM _MgCl2, 1 microgram synthetic oligonucleotide primers (forward and reverse primers, table no. 10), which line defined ORF of H. pylori, 0.2 mM of each deoxynucleotide triphosphate; dATP, dGTP, dCTP, dTTP and 0.5 units of thermally stable DNA polymerase (Amplitaq, Roche Molecular

Systems, Inc., Branchburg, NJ, USA), two duplicates each being processed and the final volume was 20 microliters.

Table no. 10

Oligonucleotide primers used in PCR amplification of H. pylori DNA sequences.

Outer membrane proteins ...... forward primer 5 'to 3' reverse primer 5 'to 3' Protein 11 (for strains AH4, AH15, AH61, 5294, 5640, AH 18 and Ah244) 5'- TTAACCATGGTGAAAA GCGATA-3 '(SEQ ID NO: 1091) 5'- TAGAATTCGCCTCTAAAAC TTTAG-3 '(SEQ ID NO: 1092) Protein 11 (for strains AH5, 5155, 7958, AH24 and J99) 5'- TTAACCATGGTGAAAA GCGATA-3 '(SEQ ID NO: 1093) 5'- TAGAATTCGCATAACGAT CAATC-3 '(SEQ ID NO. 1094) Protein 12 5'- ATATCCATGGTGAGTTT GATGA-3 '(SEQ ID NO: 1095) 5'- ATGAATTCAATTTTTTATT TTGCCA-3 '(SEQ ID NO: 1096) Protein 13 5'- AATTCCATGGCTATCCA AATCCG-3 '(SEQ ID NO: 1097) 5'- ATGAATTCGCCAAAATCG TAGTATT-3 '(SEQ ID NO: 1098) Protein 14 5'- GATACCATGGAATTTAT GAAAAAG-3 '(SEQ ID NO: 1099) 5'- TGAATTCGAAAAAGTGTA GTTATAC-3 '(SEQ ID NO: 1100)

In order to obtain DNA amplification products for each ORF using a Perkin Elmer Cetus / GeneAmp PCR System 9600 Thermal Cycler, the amplification reaction was performed under the conditions of:

Protein 12 and 14 sequences;

denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 30 ° C for 15 seconds and 72 ° C for 1.5 min.

cycles at 94 ° C for 15 seconds, 55 ° C for 15 seconds and 72 ° C for 1.5 min.

reactions were run at 72 ° C for 6 min.

Protein 11 sequences for strains AH5, 5155, 7958, AH24 and J99;

denaturation at 94 ° C for 2 min, cycles at 94 ° C for 15 seconds, 30 ° C for 15 seconds and 72 ° C for 1.5 minutes cycles at 94 ° C for 15 seconds, 55 ° C for 15 seconds and 72 ° C for 1.5 min.

reactions were run at 72 ° C for 6 min.

Protein 11 and Protein 13 sequences for strains AH4, AH15, AH61, 5294, 5640, AH18 and Hp244;

denaturation at 94 ° C for 2 min, cycles at 94 ° C for 15 seconds, 30 ° C for 20 seconds and 72 ° C for 1.5 minutes cycles at 94 ° C for 15 seconds, 55 ° C for 20 seconds and 72 ° C for 2 min.

reactions were run at 72 ° C for 8 min.

Upon completion of the thermal cyclic reactions, each pair of samples was pooled and used directly for cloning into a PCR cloning vector as described below.

Cloning of the p, pylori DNA sequences into the pCR TA cloning vector.

All amplified inserts were cloned into the pCR2.1 vector as described in the original TA cloning kit (Invitrogen, San Diego, CA). The ligation reaction products were then used to transform TOPIOF '(INVaF' for the H. pylori 350 sequence) of the E. coli strain as described below.

Transformation of competent bacteria with recombinant plasmids.

Competent bacteria of the E. coli TOPIOF 'strain or the E. coli INVaF' strain were transformed with recombinant pCR expression plasmids carrying cloned ppylori sequences according to standard methods (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., (Ausubel et al., Eds., 1994) 2 microliters of 0.5 micromolar BME were added to each tube of 50 microliters of competent cells, then 2 microliters of ligation reaction was mixed with the competent cells and incubated on ice for 30 minutes. The cells and ligation mixture were then subjected to a "heat shock" at 42 ° C for 30 seconds and then placed on ice for an additional 2 minutes, then the samples were incubated in 0.45 ml SOC medium (0.5 ml). % yeast extract, 2.0% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgSO ₄ and 20 mM glucose) at 37 ° C with stirring for one hour. Samples were then plated on LB agar plates containing 25 micrograms / ml kanamycin sulfate or 100 micrograms / ml ampicillin and grown overnight. Transformed TOPIOF 'or INVaF' colonies were isolated and analyzed for their cloned inserts as described below.

Identification of recombinant PCr plasmids carrying H. pylori sequences.

100

Individual TOPIOF 'or INVaF' clones transformed with recombinant pCR - /. pylori ORFs were analyzed by PCR amplification of the cloned inserts using the same forward and reverse primers that are specific for each H. pylori sequence used in the original PCR amplification cloning reactions. Successful amplification verified the integration of H. pylori sequences into the cloning vector (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994).

Single clones of recombinant pCR vectors carrying properly cloned H. pylori ORFs were isolated, subjected to sequencing analysis. Sequencing analysis was performed on an ABI sequencer using a standard protocol (Perkin Elmer) using vector-specific primers (found in PCRII or pCR2.I, Invitrogen, San Diego, CA) and ORF-specific sequence primers set forth in Table 2. 11 below.

Table no. 11 Oligonucleotide primers used in DNA sequencing of H. pylori bacteria.

Outer membrane proteins forward primers 5 'to 3' reverse primers 5 'to 3' protein 11 5'- CCCTTCATTTT AGAAATCG-3 '(SEQ ID NO: 1101) 5'- ATTTCAACCAATTCAATGCG3 '(SEQ ID NO: 1102) 5'- GCCCCTTTTGATTTGAAGCT3 '(SEQIDNO: 1103) 5'- TCGCTCCAAGATACCAAGAA GT-3 '(SEQ ID NO: 1104) 5'- CTTGAATTAGGGGCAAAGAT CG-3 '(SEQ ID NO: 1105) 5'- ATGCGTTTTTACCCAAAGAA GT-3 '(SEQ ID NO. 1106) 5 -CTTTGGGTAAAAACGCATC3 '(SEQ ID NO: 1108) 5 -CGATCTTTGATCCTAATTCA3 ' (SEQ ID NO: 1109) 5 -ATCAAGTTGCCTATGCTGA3 '(SEQ ID NO: 1110)

101

5'- ATAACGCCACTTCCTTATTGG T-3 '(SEQ ID NO: 1107) protein 12 5'- TTGAACACTTTTGATTATGCG G-3 '(SEQ ID NO: 1111) 5'- GTCTTTAGCAAAAATGGCGTC3 '(SEQIDNO: 1113) 5 - GGATTATGCGATTGTTTTAC AAG-3 '(SEQ ID NO: 1112) 5 - AATGAGCGTAAGAGAGCCTTC3 '(SEQ ID NO: 1114) protein 13 5 -CTTATGGGGGTATTGTCA3 '(SEQ ID NO: 1115) 5-AGCATGTGGGTATCCAGC3 '(SEQ ID NO: 1116) 5 -AGGTTGTTGCCTAAAGACT- 3 '(SEQ ID NO: 1117) 5 -CTGCCTCCACCTTTGATC-3 '(SEQ ID NO: 1118) protein 14 5'- ACCAATATCAATTGGCACT-3 '(SEQ ID NO: 1119) 5 -ACTTGGAAAAGCTCTGCA3 '(SEQ ID NO: 1120) 5 -CTTGCTTGTCATATCTAGC3 '(SEQ ID NO: 1121) 5 -GTTGAAGTGTTGGTGCTA-3 '(SEQ ID NO: 1122) 5'- CAAGCAAGTGGTTTGGTTTT AG-3 '(SEQ ID NO: 1123) 5'- GCCCATAATCAAAAAGCCCAT- 3 '(SEQ ID NO: 1125) 5 - TGGAAAGAGCAAATCATTGA AG-3 (SEQ ID NO: 1124) 5 - CTAAAACCAAACCACTTGCTT GTC-3 '(SEQ ID NO: 1126) vector primers 5 -GTAAAACGACGGCCAG-3 '(SEQ ID NO: 1127) 5 -CAGGAAACAGCTATGAC-3 '(SEQ ID NO: 1128)

The results

To determine the occurrence of PCR errors in these experiments, 5 individual protein 11 clones prepared from 5 separate PCR reaction mixtures from H. pylori J99 strain were sequenced. These clones were sequenced over the entire length of 897 nucleotides of the cumulative whole of the 4485 base DNA sequence. The DNA sequences of the five clones were compared to the DNA sequence of protein 11, obtained previously by a different method, i.e., random cloning and sequencing. The occurrence of PCR errors in these experiments described herein was determined to be 2 base changes from 4485 bases, which is equal to an estimate of error occurrence less than or equal to 0.04%.

102

DNA sequence analysis was performed for four different open reading frames, which were identified as genes and amplified by PCR from 12 different strains of Helicobacter pylori. The deduced amino acid sequences of three of the four open reading frames were then selected for the purpose of a study to demonstrate statistically significant BLAST homology to define proteins present in other bacterial species. These ORFs include: protein 11, which is a homologue of the val A & B genes that encode the ABC transporter into F. novicida; protein 12, which is a homologue of lipoprotein e (P4) present in the outer membrane of H. influenzae; protein 13, which is the outer membrane fecA receptor homologue in the transport of ferric dicitrate in E. coli. Protein 14 has been identified as an unknown open reading frame because it exhibits low homology to sequences that are published in databases.

To estimate the extent of conservation or variability in ORF in different strains of H. pylori, changes in DNA and deduced protein sequences were compared with the DNA and deduced protein sequences found in the H. pylori J99 strain (Table 12 below). in text). Results are reported as a percent identity of the H. pylori strain J99 sequenced by random cloning. To control any variation in the J99 strain sequence, each of the four open reading frames was cloned and sequenced against the bacterial J99 strain, and then the sequence information was compared to the sequence information that was taken from the inserts cloned by random sequencing of the J99 strain. The data suggest that there is a variation in the DNA sequence having a range corresponding to 0.12% changes (protein 14, strain J99) to about 7% changes (protein 11, strain AH5). The deduced protein sequences show either no variations (protein 14, strains Ah18 and AH24) or show up to 7.66% amino acid changes (protein 11, strain AH5).

103

Table no. 12

Multiple DNA sequence analysis of H. pylori vaccine candidate strains.

J99 protein # 11 11 12 12 13 13 14 14 length of sequenced area 248 if. 746 nt. 232 if. 696 nt. 182 if. 548 nt. 273 if. 819 nt. tested strain if Nuk if Nuk if Nuk if Nuk iden- tita iden- the iden- the identifi- the iden- the iden- the iden- the identity J99 100 % 100% 100% 100% 100% 100% 100% 100% AH244 95.1 6% 95,04 % n. d. n. d. 99.09 % 96,71 % 98.90 % 96.45% H4 95.9 7% 95,98 % 97,84 % 95.83 % n. d. n. d. 97.80 % 95.73% AH5 92.3 4% 93,03 % 98,28 % 96.12 % 98.91 % 96.90 % 98.53 % 95.73% AH15 95.1 6% 94,91 % 97.41 % 95,98 % 99.82 % 97.99 % 99.63 % 96.09% AH61 n.d. n.d. 97,84 % 95,98 % 99,27 % 97.44 % n. d. n. d. 5155 n. d. n. d. n. d. n. d. 99.45 % 97.08 % 98.53 % 95,60% 5294 94.3 5% 94.37 % 98,28 % 95,40 % 99.64 % 97.26 % 97.07 % 95.48% 7958 94.3 5% 94.10 % 97,84 % 95,40 % n. d. n. d. 99.63 % 96.46% 5640 95.1 6% 94.37 % 97.41 % 95.69 % 99.09 % 97.63 % 98.53 % 95.48% AH18 n. d. n. d. 98.71 % 95.69 % 99.64 % 97.44 % 100.00 % 95.97% AH24 94.7 5% 95,04 % 97,84 % 95,40 % 99,27 % 96,71 % 100.00 % 96.46%

n.d. means not performed

104

Example 7: Experimental knock-out protocol to determine genes of H. pylori that are essential as potential therapeutic targets.

Therapeutic targets selected from genes whose protein products are involved in essential cellular events such as envelope synthesis, DNA synthesis, transcription, translation, regulation and colonization / virulence.

The deletion protocol of H. pylori gene / ORF portions and insertional mutagenesis of the cassette encoding the kanmycine resistance has changed compared to published methods (LabigneRoussel et al., 1988, J. Bacteriology 170, pp. 1704-1708; Cover et al., 1994 (J. Biological Chemistry 269, pp. 10566-10573; Reyrat et al., 1995, Proc. Natl. Acad. Sci. 92, pp 8768-8772).

Identification and cloning of H. pylori gene sequences.

Genes or ORF (open reading frames) sequences selected as knock-out targets were determined from the genomic sequence of H. pylori and used to design primers for specific gene / ORF amplification. All synthetic oligonucleotide primers (Table 13) were designed using the OLIGO program (National Biosciences, Inc., Plymouth, MN 55447, USA) and obtained from Gibco / BRL Life Technologies (Gaithesburg, MD, USA). Specific primers (FI and R1) were selected that flank most or all of the ORFs, depending on its size. When the ORF is less than 800 to 1,000 base pairs, the selected flanking primers lie outside the open reading frame.

^ • 2 2 £ ‘C. 2 o. u <

<

<

<(J s?

<o <o

H <

<u U θ '8'

CZ)

§9 <about $ 3

O <

£ <

<

<

o u ŕ _ <

<with th <

<_>

□ <

<

ŕ o

o <u u o <o o

O Z o A f A

H ^ω u ω ou IS H ^<rn

CM co

O U O <o u "o υ U-

about

H <

<

<

<

H o O <C

<H O H H O O U o

z q

θ 'ω

en>

o F— <u <u H <

<

! -

U O O O

Ó t ^Z bs £?

<(U

C

CL

Ό

C> o

JU (U

CN

U-,

U Z H A u ex <ω

CZ) <

<

ίο u

about

H O <U

U <<

8a ^for AU θ 'o ω 8 33

Oligonucleotide sequences for "knock-out" genes / ORF f

CN • o · D 'o>

o c

o <U

O> N to -2> 5 3

P c NU c t> o <

<

U <

o A O CX o ω

F— oo <

<

O H O o θ '(J ω O ~

CZ)

H <-> oo o

<δ S

5ºC

Ιοί <

H

ABOUT

U <<

U O u <O ίο <o o 11 t

<

O O <c H <

F-

O o o oi m

U h

ABOUT

8 <3 o

cn oo o

CN

CL oo

CN

OO

TT m

CL

CQ

CL

CL <

<

at

O o U Q o o <O u <<a <o <

ABOUT

Z o

ω <z>

u o ω8

U < ^ω U ^{, Λ} <

<

<

<

o <<o o H 88 o f-

<

oo

0Ί

Ό <

<

U u Q U <“

U H A o <ω o <33

o o

H t

<

o <

2 O O o u

o <

<

o <

H <

O <o o <o <o <o

Ό

CM (N

ABOUT

FROM

Q <y ω

o h o- o

2Po P o ω <<52

Table no. 13 continued

O o o <o o o o <<

<

o <y <ω o oo

O <

<

P o <<o o <<<<

<o <<o

O u H v o 5 <<<<f- <

<

u o

about

H o

o u o o <o í- u <<

P <

about

H o

PP o <o o o o o o o

ίο ίΟ <

H <

<ίΟ. o p O H O O--3 ° * <a <PO O p ω o 52

qo (N

ABOUT

FROM

Q θ 'ω

ίΟ <

ABOUT

O o o p 2Item no

É ° bP <

<:

r o

o o

o <

p <

<

CM cm

CM ô

FROM

Q

O ω

oo

O <

f <

C <

H O <~ b o '

O H Í2

O \ t

° z < ^from OQO ~ <θ 'OS of 52

H

ABOUT

ABOUT

So H <O o o o o o H O O (<O

O <o o o o P P O

CXJ rCN <EN οω

CZ)

CN

ABOUT

ΓΜ

P ^z O so CZ H ^ω <&

O o

f— <

<

<y in P 2Č B o o ί - -

ο <

about

H

ABOUT

ABOUT

O o <o

about

CM

O z

Q

O ω

oo

<

ABOUT

E <o 2 <<P <o H O C t - t <<ҧ u <

O <

about

CM

CM o-z

Q

CZ H o CZ tu 52 V ω ω P P o o P 52 o o o o o <o o <P v 5 <

<ίο H

O <

<

at

P <o o o ο <

<o (- o o o o

from

Q θ 'tu </>

<o ίΟ <

<θ 'o ^ω <

about

M ^-

ABOUT

About <s>

ls o H Z

P2g <

ABOUT

P <

o o o o o <

o 2 o p <<H <

tu u_

CQ cm <£ EN) f

<

<u <0 u ω o

CO n

CN

ABOUT

FROM

Q

UJ oo

oo 'T

CN

ABOUT

FROM

Q ω

oo <

<

F <

OO 0 O ^ω o 'oo o O Ό _n cm lL - H § <t

H <

21 g 52 <o

CZ)

O <

0 <

<z F ^ω <52

Table no. 13 continued * 3

WHAT

CN

ABOUT

FROM

Q <y ω

CZ) <

F 0 0 0

Γ <0 0 tb b / w

H 0

WHAT

WHAT

CN ó

from

Q <y ω

oo

<

F

ABOUT

Ľ ^H í— n

N00 Op

OO

m oo

CN

ABOUT

FROM

Q σ

ω

CZ) <

F <

<

<

<

l · <o <o o o o o u

ct

CN

ABOUT

FROM

Q

CZ ω

<

U

É o

WHAT

T

CN

ABOUT

FROM

Q ω

CN ° ° 0 2 O Q O “Ô 0 <ω <

U

QO -, Ά 30 CN <

O T. 0 “F F 52 0

F <

F <0 8W

U U U 0 0 <0 0

WHAT

CN

ABOUT

FROM

Q ω

CZ)

ΓΟΟ

CN

F <

<

cz)

H <

<

<

<

O F 0 0 U cl

CN

I - O t * <Q <0 o ω ΰ oo

H <

<

<

what

CN

Q

U 2

8s

0 for ω <52 <

<

'ABOUT*

VO

CM ô

t * <q

F 0 U ^ω 0 52

<

t <

U

F u

F <

U u

<

what what

CN

0 <

H

8O

0 o <0 o 0 0 0 u 0 H o

rCN

ABOUT

FROM

Q ω

Ό rCN ó

from

O ω

0 52 'n

00 <CN or.

o <o FOZ ^p 0 and ω 0 S2

0

CN

ABOUT

FROM

Q

UJ

CZ) u

F <

t £ 8 k ý (- <0 <f— 0 0

WHAT

Ό

CN

Ô z

Q ω

oo ^{υ <<<} 0 0 H

CN

WHAT

CN

ABOUT

FROM

Q

't · rCN <g <Z 0 Q 0 “<0 <; ω 0

CZ)

0 0 ooο oo

CN

ABOUT

FROM

Q ω

CZ)

0 <<

<F <<0 <

ΓCO

CN

ABOUT

FROM

Q ω

<

<

<

WHAT

C-.

CN

ABOUT

FROM

Q

F <

<

<

ίΟ

U u

at

Oc rCN

F <

<

UF 0 FF ^ω <52 i—

Σ u

x ex

oc

NCO

oc

ABOUT

CQ x

CL

108

Genomic DNA prepared from HpJ99 strain Helicobacter pylori (ATCC55679) was used as template DNA source for ORF amplification by PCR (Polymerase Chain Reaction) (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., eds., 1994). The preparation of genomic DNA from H. pylori is described in Example 1. PCR amplification is carried out in a reaction tube containing 10 mM Tris pH 8.3, 50 mM KCl, 2 mM MgCL, 2 micromolar oligonucleotide primers (forward-F1). and reverse = R1), 0.2 mM of each deoxynucleotide triphosphate (dATP, dGTP, dCTP, dTTP) and 1.25 units of heat stable DNA polymerase (Amplitaq, Roche Molecular Systems, Inc., Branchburg, NJ, USA) were added 10 nanograms. genomic DNA of strain HpJ99, with a final volume of 40 microliters. PCR was performed on a Perkin Elmer Cetus / GeneAmp PCR System 9600 thermal cycler. The conditions of the thermal cycles that are used to achieve amplification of the DNA products for each knock-out target are shown in Table 1. 14th

Table no. 14

PCR conditions

MurC denaturation at 94 ° C for 2 min, cycles at 94 ° C for 15 sec, 48 ° C for 15 sec and 72 ° C for 1.5 min.

final adjustment was performed at 72 ° C for 20 min.

Sig 54 denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 50 ° C for 15 seconds, and 72 ° C for 1.5 min.

final adjustments were made at 72 ° C for 20 min.

109 lpxC denaturation at 94 ° C for 2 minutes, 94 ° C cycles for 15 seconds, 50 ° C for 15 seconds, and 72 ° C for 1.5 min.

final adjustments were made at 72 ° C for 20 min.

KO24, KO26, KO27 denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 50.5 ° C for 20 seconds and 72 ° C for 2 min.

final adjustments were made at 72 ° C for 20 min.

K.O29, a protein with a molecular weight of 26,000 denaturations at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 50.5 ° C for 20 seconds, and 72 ° C for 2 minutes.

final adjustments were made at 72 ° C for 20 min.

DnaE, glycyl denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 51 ° C for 15 seconds and 72 ° C for 1.5 min.

final adjustments were made at 72 ° C for 20 min.

Gltx denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 51 ° C for 15 seconds and 72 ° C for 1.5 min.

110 final adjustments were made at 72 ° C for 20 min.

KO28 denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 51 ° C for 15 seconds, and 72 ° C for 2 min.

final adjustments were made at 72 ° C for 20 min.

KO30 denaturation at 94 ° C for 2 minutes, 94 ° C cycles for 15 seconds, 51.5 ° C for 15 seconds, and 72 ° C for 1 min 45 seconds.

final adjustments were made at 72 ° C for 20 min.

Murl, M'urG denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 52 ° C for 15 seconds and 72 ° C for 1.5 min.

final adjustments were made at 72 ° C for 20 min.

DnaB, KdtA, LpxB denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 52 ° C for 15 seconds and 72 ° C for 1.5 min.

final adjustments were made at 72 ° C for 20 min.

111

Tsf, FlgE, FliM, Sig28, MurB denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 52 ° C for 15 seconds and 72 ° C for 1.5 min.

final adjustments were made at 72 ° C for 20 min.

PpiB denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 52 ° C for 15 seconds, and 72 ° C for 2.5 min.

final adjustments were made at 72 ° C for 20 min.

MurD, MurE, AlgA, MetL, FusA, SerS, Rnh denaturation at 94 ° C for 2 minutes, cycles at 94 ° C for 15 seconds, 55 ° C for 15 seconds and 72 ° C for 1, 5 min.

final adjustments were made at 72 ° C for 20 min.

After completion of the thermal cyclic reactions, each amplified DNA sample was visualized on a 2% TAE agarose gel stained with ethidium bromide (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994) for detection. whether the reaction produced a product of the expected size. The amplified DNA was then washed and purified using a Qiaquick Spin PCR purification kit (Qiagen, Gaithersburg, MD, USA).

PCR products were cloned into the pT7Blue T vector (Catalog No. 69820-1, Novagen, Inc., Madison, WI, USA) using the Current Protocols in Molecular Biology TA (John Wiley &amp; Sons, Inc., F. Ausubel et al.) al., eds., 1994). Ligation of the PCR product into the vector was performed by mixing a 6-fold excess of PCR product, 10 ng of vector pT7Blue-T (Novagen), 1 microliter of T4 DNA ligase buffer (New England Biolabs, Bevrly, MA, USA) and 200 µl.

112 units of T4 DNA ligase (New England Biolabs) with a final volume of 10 microliters. The ligation was carried out for 16 hours at 16 ° C.

Ligation products were electrophoretically introduced (Current Protocols in Molecular Biology, John Wiley &amp; Sons, Inc., F. Ausubel et al., Eds., 1994) into competent cells of E. coli XL-1 Blue or DH5-ot (Clontech Lab). , Inc., Palo Alto, CA, USA). 1 microliter of ligation reaction was mixed with 40 microliters of electrocompetent cells and high voltage pulses (25 microfarads, 2.5 kV, 200 ohms) were applied, after which the samples were incubated in 0.45 ml SOC medium (0.5% yeast). extract, 2% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgSO 4 and 20 mM glucose) at 37 ° C with stirring for one hour. Samples were then plated on LB agar plates (10 g / L Bactotrypton, 5 g / L Bacto Yeast Extract, 10 g / L Sodium Chloride), each containing 100 micrograms / ml ampicillin, 0.3% X-gal and 100% micrograms / ml IPTG. These plates were incubated overnight at 37 ° C. White ampicillin resistant colonies were selected, cultured in 5 ml of LB liquid medium containing 100 micrograms / ml ampicillin. Plasmid DNA was isolated using the Qiagen miniprep protocol (Qiagen, Gaithersburg, MD, USA).

To verify that the correct H. pylori inserts were cloned, this plasmid pT7Blue DNA was used as a template for PCR amplification of cloned inserts, using the same forward and reverse primers (F1 and R1) as used to initiate the amplification of the J99 strain. H. pylori bacteria. After visualizing the PCR product and primers on a 2% TAE ethidium bromide stained agarose gel, the correct product sizes were recognized, confirming that the correct inserts were cloned. For each knock-out target, two to six such verified clones were obtained, frozen and stored at -70 ° C. In order to minimize PCR error, plasmid PCR of these verified clones was mixed and used for subsequent cloning.

The gene / ORF sequences were again used to design a second pair of primers (F2 and R2) that flank the H. pylori DNA region to either be disrupted or deleted in the ORF (up to 250 base pairs), the primers oriented away from each other. The mixed circular plasmid DNA, which had previously been isolated from the clones, was used as templates for PCR. Because the amplification orientation of this pair of deletion primers was spaced apart, a portion of the ORF between the primers was not included in the resulting PCR product. The PCR product is a piece of linear DNA that contains H. pylori DNA at each end, and between them lies the DNA backbone of the pT Blue vector, resulting in a deletion of part of the ORF. To confirm that only one product of the correct size was amplified, the PCR product was visualized on a 1% TAE ethidium bromide stained agarose gel.

A cassette encoding kanamycin resistance (Labigne-Roussel et al., 1988, J. Bacteriology 170, pp. 1704-1708) was ligated into this PCR product using the TA cloning method used previously (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al., Eds., 1994). A kanamycin resistance cassette containing a Campylobacter-derived kanamycin resistance gene was obtained by digesting the recombinant plasmid pCTB8: Aan (Cover et al., 1994, J. Biological Chemistry 269, pp. 10566-10573) with EcoRI restriction endonuclease. . The correct 1.4 kb fragment was isolated on a 1% TAE gel and purified using a QIAquick extraction kit (Qiagen, Gaithersburg, MD, USA). The fragment was trimmed with the Klenow fragment by mixing 4 µg of DNA fragment, 1 microliter of dATP, dGTP, dCTP, dTTP at 0.5 mM, 2 microliters of Klenow buffer (New England Biolabs) and 5 units of Klenow into a 20 microliter reaction. DNA polymerase I large (Klenow) fragment (New England Biolabs). Everything was incubated at 30 ° C for 15 minutes and the enzyme deactivated by heating at 75 ° C for 10 minutes. The blunt-end kanamycin cassette was then purified using a Qiaquick column (Qiagen, Gaithersburg, MD, USA) to remove nucleotides. Previs OTO was prepared by mixing 5 micrograms of blunt-ended kanamycin cassette, 10 mM Tris pH 8.3, 50 mM KCl, 2 mM MgCl ₂ , 5 units of DNA polymerase (Amplitaq, Roche Molecular Systems, Inc.) into a 100 microliter reaction. Branchburg, NJ, USA), 20 microliters of 5 mM dTTP, all incubated at 37 ° C for 2 hours. The "Kan-T" cassette was purified using a QIAquick column (Qiagen, Gaithersburg, MD, USA). The deletion primer PCR product (F2 and R2) was ligated into the Kan-T cassette by mixing 10-25 ng of the PCR product generated using the deletion primers in a 10 microliter reaction, 50-75 ng of Kan-T cassette DNA, 1. microliter of 10 T4 DNA ligase reaction mixture, 0.85 microliters of T4 DNA ligase (New England Biolabs, Beverly, MA, USA) and incubated for 16 hours at 16 ° C.

The ligation products were transformed by electroporation into E. coli XL-1 Blue or DH5-α cells as described above. After the cells were transferred to SOC medium, the cells were plated on LB agar plates containing 100 micrograms / ml ampicillin and cultured overnight at 37 ° C. Duplicates containing 25 micrograms / ml were made to these plates

114 kanamycin and were also allowed to cultivate overnight. The resulting colonies contained both a gene encoding ampicillin resistance present in the pT7Blue vector and a newly introduced gene encoding kanamycin resistance. Colonies were transferred to LB medium containing 25 micrograms / ml kanamycin and plasmid DNA was isolated using the Qiagen miniprep protocol (Qiagen, Gaithersburg, MD, USA).

A number of assays were performed on these plasmids by PCR amplification to verify that kanamycin was introduced into the H. pylori gene / ORF and to determine the relative orientation of the insertion of the kanamycin resistance gene relative to the H. pylori gene / ORF. To verify that the kanamycin cassette was inserted into the H. pylori sequence, plasmid DNA was used as templates in PCR amplification with a set of primers (F1 and R1) that were originally used in cloning the H. pylori gene / ORF. The correct PCR product had the size of the deleted gene / ORF plus 1.4 kb, corresponding to the size of the kanamycin cassette. To avoid the opposite effects of the kanamycin resistance cassette on the expression of H. pylori genes, the orientation of the kanamycin resistance coding gene with respect to the knock-out gene / ORF was determined. Alternatively, both orientations (see below) were used to transform H. pylori cells. To determine the insertion orientation of the gene that encodes kanamycin resistance, primers were designed from the ends of the kanamycin resistance gene ("Kan-1" 5-ATCTTACCTATCACCTCAAAT-3 '(SEQ ID NO: 1285) and "Kan-2" 5 - AGACAGCAACATCTTTGTGAA-3 '(SEQ ID NO: 1286)). The relative orientation of the kanamycin cassette relative to the H. pylori sequence was determined using each of the cloning primers (F1 and R1) in conjunction with each of the Kan primers (forming four primer combinations). Positive clones were classified as either having the orientation indicated by the letter "A" (the same transcription direction exists for both the H. pylori gene and the kanamycin resistance gene) or indicated by the letter "B" (meaning that the transcription direction of the bacterium H. pylori is opposite to the transcription direction of the kanamycin resistance gene). Clones having the same orientation (A or B) were combined for further experiments and independently transformed into H. pylori cells.

115

Transformation of plasmid DNA into H. pylori cells.

Two strains of bacteria //, pylori ·, were used for transformation. the clinical isolate ATCC 55679 from which the H. pylori sequence database originated and the AH244 strain, an isolate that has been passaged and has the ability to colonize the stomach of mice. The cells to be transformed were cultured at 37 ° C, in an atmosphere of 10% CO 2, 100% humidity, either on blood agar plates or in liquid Brucella broth. The cells were cultured until the exponential phase was reached and then examined under a microscope to determine which cells were "healthy" (actively moving cells) and were not contaminated. For plate growth, cells were harvested by scraping from the plate with a sterile loop, suspended in 1 ml Brucella broth, centrifuged (1 minute, at the highest eppendorf microcentrifuge speed) and resuspended in 200 microliters of Brucella broth. After cultivation in liquid Brucella broth, cells were centrifuged (15 minutes at 3000 rpm in a Beckman TJ6 centrifuge) and the cell pellet was resuspended in 200 microliter Brucella broth. An aliquot of the cells was taken to determine the optical density at 600 nm to calculate the cell concentration. An aliquot (1 to 5 jednotβοο units / 25 microlitres) of resuspended cells was plated on pre-heated blood agar plates (sheep blood) and incubated at 37 ° C, 6% CO 2 and 100% humidity for a period of time. 4 hours. After the incubation described above, 10 microliters of plasmid DNA (at a concentration of 100 micrograms per microliter) was applied to the cells. Positive (plasmid DNA with ribonuclease H gene interrupted by kanamycin resistance gene) and negative (plasmid DNA free) control were also run in parallel. The plates were further cultured at 37 ° C, 6% CO ₂ and for an additional 4 hours. Cells were then spread on the above plates with a brucella-soaked wiper and cultured for 20 hours at 37 ° C in 6% CO ₂ . The cells were then transferred to blood agar plates (sheep blood) containing 25 micrograms / ml kanamycin and allowed to grow for 3 to 5 days at 37 ° C in an atmosphere of 6% CO ₂ at 100% humidity. When colonies appeared, they were isolated and re-cultured on fresh blood agar plates containing 25 micrograms / ml kanamycin.

Three sets of PCR reactions (three assays) were performed to verify that colonies of transformants were formed by homologous recombination at the correct position on the chromosome. The template for PCR (colony DNA) was obtained by rapid boiling. An aliquot of the colony (toothed with a toothpick) was transferred to 100 microliters of 1% Triton X-100, 20 mM Tris, pH 8.5 and boiled for 116 min for 6 min. An equal volume of phenol: chloroform (1: 1) was added and the mixture was vortexed. The mixture was centrifuged on a microcentrifuge for 6 min and the supernatant was used as template DNA for the PCR reaction with combinations of the following primers to verify homologous recombination of the correct position on the chromosome.

TEST 1. PCR with primers F1 and R1 (cloning primers that were originally used for gene / ORF amplification). A positive result of homologous recombination at the correct position on the chromosome should show a single PCR product whose expected size corresponds to the size of the deleted gene / ORF increased by the size of the added kanamycin cassette, which is 1.4 kilobases. The PCR product, which corresponds to the size of the gene / ORF, was verified that the gene had not been knocked out and that the transformant was not the result of homologous recombination at the correct location on the chromosome.

TEST 2: PCR with primer F3 (primer designed according to upstream gene / ORF sequences) and either Kan-1 or Kan-2 primer (primers designed according to the ends of the kanamycin resistance gene), depending on whether the plasmid DNA used is oriented “A” or “B”. A positive homologous recombination result at the correct position on the chromosome of the gene / ORF sequences upstream of the kanamycin resistance gene should exhibit a single PCR product whose expected size corresponds to the distance from position F3 to the site of incorporation of the kanamycin resistance gene. Neither the PCR product nor the incorrect size PCR product (s) confirmed that the plasmid had not been inserted into the correct site or that the gene had been knocked out.

TEST 3: PCR with primer R3 (primer designed according to sequences that are downstream of the gene / ORF) and either with Kan-1 or Kan-2, depending on whether plasmid DNA was used in the "A" or "B" orientation. A positive result of homologous recombination with the correct position downstream of the kanamycin resistance gene shows a single PCR product whose expected size corresponds to the distance between the insertion site of the kanamycin resistance gene and the downstream location of primer R3. Not even a PCR product. nor the incorrectly sized PCR product (s) confirmed that the plasmid had not been inserted into the correct site or that the gene had been knocked out.

Genes that are not essential for in vitro survival normally lead to the emergence of many transformants, as observed in the positive control of the ribonuclease H. gene. Lubo117 free transformants showing positive results in all three assays described above lead to the conclusion that the gene was not essential for in vitro survival.

Genes that are essential for in vitro survival normally show very few transformants. All transformants were tested. A negative result of any of the three assays described above for each transformant will lead to the conclusion that the gene was not damaged and that the gene was essential for in vitro survival.

In fact, no colonies emerged from the two independent transformants, while a positive control with the damaged ribonuclease H plasmid DNA produced transformants. Plasmid DNA was further analyzed by PCR for the presence of DNA from a population of transformants before plating to form colonies to confirm that DNA can enter cells and homologous recombination can occur at the right site. Plasmid DNA was incubated according to the previously described transformation protocol. Immediately after incubation with plasmid DNA, DNA was extracted from H. pylori cells and used as templates in TEST 2 and TEST 3 described above. Positive results in Tests 2 and 3 confirm that plasmid DNA can enter cells and cause homologous recombination in the correct position on the chromosome. When TEST 2 and TEST 3 are positive, then appropriate transformants were not obtained, indicating that the gene is essential and the cells where the gene has been damaged are unable to form colonies.

The genes used in these experiments were found to be essential, non-essential, or still under investigation as shown in Table 2. 15th

Claims (104)

PATENT CLAIMS An isolated nucleic acid comprising a nucleotide sequence encoding an H. pylori polypeptide selected from the group consisting of SEQ ID NO: 496, SEQ ID NO: 501, SEQ ID NO: 514, SEQ ID NO: 547, SEQ ID NO: 550 SEQ ID NO: 553, SEQ ID NO: 564, SEQ ID NO: 568, SEQ ID NO: 586, SEQ ID NO: 588, SEQ ID NO: 598, SEQ ID NO: 602, SEQ ID NO: 606, SEQ. SEQ ID NO: 614, SEQ ID NO: 632, SEQ ID NO: 636, SEQ ID NO: 652, SEQ ID NO: 654, SEQ ID NO: 655, SEQ ID NO: 660, SEQ ID NO. SEQ ID NO: 664, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 679, SEQ ID NO. 683, SEQ ID NO: 690, SEQ ID NO: 701, SEQ ID NO: 704, SEQ ID NO: 706, SEQ ID NO: 707, SEQ ID NO: 708, SEQ ID NO: 709, SEQ ID NO: 711, SEQ ID NO: 712, SEQ ID NO: 713, SEQ ID NO: 714, SEQ ID NO: 715, SEQ ID NO: 716, SEQ ID NO: 729, SEQ ID NO: 742, SEQ ID NO: 745, SEQ ID NO. NO. 746, SEQ ID NO: 754, SEQ ID NO: 758, SEQ ID NO: 773, SEQ ID NO: 776, SEQ ID NO: 777, SEQ ID NO: 802, SEQ ID NO: 809, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 817, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 821, SEQ ID NO. 822, SEQ ID NO. 842, SEQ ID NO: 843, SEQ ID NO: 844, SEQ ID NO. 855, SEQ ID NO: 865, SEQ ID NO: 880, SEQ ID NO: 890, SEQ ID NO: 903, SEQ ID NO: 913, SEQ ID NO: 916, SEQ ID NO: 924, SEQ ID NO: 928, SEQ ID NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 940, SEQ ID NO: 942, SEQ ID NO: 943, SEQ ID NO: 945, SEQ ID NO: 946, SEQ ID NO. NO: 956, SEQ ID NO: 958, SEQ ID NO: 960, SEQ ID NO: 1038, SEQ ID NO. 1043, SEQ ID NO. 1049, SEQ ID NO. 1050, SEQ ID NO. 1052, SEQ ID NO: 1053, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1081, SEQ ID NO: 1083, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 1297 and SEQ ID NO: 1298. 2. A recombinant expression vector comprising the nucleic acid of claim 1 operably linked to an element that regulates transcription. 3. A cell comprising the recombinant expression vector of claim 2. 379 A method of producing a H. pylori polypeptide comprising culturing the cell of claim 3 under conditions that permit expression of the polypeptide. 5. A probe comprising at least 8 nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 23, SEQ ID NO: 56, SEQ ID NO: 59 SEQ ID NO: 62, SEQ ID NO. 73, SEQ ID NO: 77, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 123, SEQ ID NO: 130, SEQ ID NO: 141, SEQ ID NO: 145, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 169, SEQ ID NO: 173, SEQ ID NO: 179, SEQ ID NO. NO: 184, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 199, SEQ ID NO: 210, SEQ ID NO: 213, SEQ ID NO. 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 221, SEQ ID NO: 222, SEQ ID NO. 223, SEQ ID NO: 224, SEQ ID NO. 225, SEQ ID NO. 238, SEQ ID NO. 251, SEQ ID NO. 254, SEQ ID NO: 255, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 282, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 311, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO: 331, SEQ ID NO: 351, SEQ ID NO. SEQ ID NO: 352, SEQ ID NO: 364, SEQ ID NO: 374, SEQ ID NO: 389, SEQ ID NO: 399, SEQ ID NO: 412, SEQ ID NO: 422, SEQ ID NO: 425, SEQ ID NO: 433, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 451, SEQ ID NO. 452, SEQ ID NO: 455, SEQ ID NO: 465, SEQ ID NO: 467, SEQ ID NO: 467, SEQ ID NO: 469, SEQ ID NO: 984, SEQ ID NO: 989, SEQ ID NO: 995, SEQ ID NO: 996, SEQ ID NO: 998, SEQ ID NO. 999, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO: 1027, SEQ ID NO: 1029, DD NO: 1031, ED NO: 1032, ID NO: 1294, ID NO: 1295, or a complement thereof. An isolated nucleic acid comprising a nucleotide sequence having a length of at least 8 nucleotides, wherein the sequence is capable of hybridizing to a nucleic acid having a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 23 SEQ ID NO: 56, SEQ ID NO: 62, SEQ ID NO: 62, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 107, SEQ. ID NO: 111, SEQ ID NO: 380 115, SEQ ID NO. 123, SEQ ID NO: 130, SEQ ID NO: 141, SEQ ID NO: 145, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 169, SEQ ID NO: 173, SEQ ID NO: 179, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 199, SEQ ID NO: 210, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 221, SEQ ID NO: 222, SEQ ID NO. 223, SEQ ID NO: 224, SEQ ID NO: 225, SEQ ID NO: 238, SEQ ID NO: 251, SEQ ID NO: 254, SEQ ID NO: 255, SEQ ID NO. 263, SEQ ID NO. 267, SEQ ID NO. 282, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 311, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO. 331, SEQ ID NO: 351, SEQ ID NO. 352, SEQ ID NO. 353, SEQ ID NO. 364, SEQ ID NO: 374, SEQ ID NO: 389, SEQ ID NO: 399, SEQ ID NO: 412, SEQ ID NO: 422, SEQ ID NO: 425, SEQ ID NO: 433, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO. 449, SEQ ID NO: 451, SEQ ID NO. 452, SEQ ID NO. 454, SEQ ID NO: 455, SEQ ID NO: 465, SEQ ID NO: 467, SEQ ID NO: 469, SEQ ID NO: 984, SEQ ID NO: 989, SEQ ID NO. 995, SEQ ID NO: 996, SEQ ID NO: 998, SEQ ID NO: 999, SEQ ID NO. 1009, SEQ ID NO. 1023, SEQ ID NO. 1027, SEQ ID NO: 1029, ID NO: 1031, ID NO: 1032, ID NO: 1294, ID NO: 1295, or a complement thereof. A vaccine composition suitable for preventing or treating H. pylori infection, comprising an effective amount of an isolated nucleic acid comprising a nucleotide sequence encoding a H. pylori polypeptide or fragment thereof, said nucleic acid comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 23, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO. NO: 95, SEQ ID NO: 97, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO. 115, SEQ ID NO: 123, SEQ ID NO. 130, SEQ ID NO NO. 141, SEQ ID NO: 145, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO. NO: 169, SEQ ID NO: 173, SEQ ID NO: 179, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO. NO. 187, SEQ ID NO. 188, SEQ ID NO. 192, SEQ ID NO. 199, SEQ ID NO. 210, SEQ ID NO NO: 213, SEQ ID NO: 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, SEQ ID NO. NO: 220, SEQ ID NO: 221, SEQ ID NO. 222, SEQ ID NO: 223, SEQ ID NO: 224, SEQ ID NO NO. 225, SEQ ID NO: 238, SEQ ID NO. 251, SEQ ID NO. 254, SEQ ID NO: 255, SEQ ID NO 381 NO: 263, SEQ ID NO: NO: 311, SEQ ID NO. NO: 327, SEQ ID NO: 352, SEQ ID NO: 399, SEQ ID NO: 437, SEQ ID NO: 451, SEQ ID NO: 467, SEQ ID NO: 996, SEQ ID NO: 1027, SEQ ID 267, SEQ ID NO: 318, SEQ ID NO: 329, SEQ ID NO: 353, SEQ ID NO: 412, SEQ ID NO: 438, SEQ ID NO: 452, SEQ ID NO: 469, SEQ ID NO: 998, SEQ ID NO: 1029, IDNO 282, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID 319, SEQ ID NO. 325, SEQ ID NO. 326, SEQ ID 330, SEQ ID NO: 331, SEQ ID NO: 351, SEQ ID 364, SEQ ID NO: 374, SEQ ID NO: 389, SEQ ID 422, SEQ ID NO: 425, SEQ ID NO: 433, SEQ ID NO. 447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID 454, SEQ ID NO. 455, SEQ ID NO: 465, SEQ ID NO: 989, SEQ ID NO: 995, SEQ ID NO: 995, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ 1031, IDNO: 1032, ID NO: 1294 and IDNO: 1295. The vaccine composition of claim 7, further comprising a pharmaceutically acceptable carrier. The vaccine composition of claim 8, wherein the pharmaceutically acceptable carrier is an adjuvant. A method of treating an H. pylori infection of an individual comprising administering to the individual the vaccine composition of claim 7 such that the H. pylori infection is treated. The method of claim 10, wherein the treatment is a prophylactic treatment. The method of claim 10, wherein the treatment is a therapeutic treatment. A method for detecting the presence of Helicobacter nucleic acid in a sample where it occurs 382 (a) contacting the sample with the probe of claim 5 under conditions in which a hybrid may be formed between the probe and the Helicobacter nucleic acid contained in the sample; and (b) detecting the hybrid resulting from step (a), wherein the detection of the hybrid indicates in the sample the presence of Helicobacter nucleic acid. 14. A recombinant or substantially pure preparation of a H. pylori polypeptide comprising SEQ ID NO: 496, SEQ ID NO: 501, SEQ ID NO: 514, SEQ ID NO: 547, SEQ ID NO: 550, SEQ ID NO: 553, SEQ ID NO: 564, SEQ ID NO: 568, SEQ ID NO: 586, SEQ ID NO: 588, SEQ ID NO: 598, SEQ ID NO: 602, SEQ ID NO: 606, SEQ ID NO. NO: 614, SEQ ID NO: 621, SEQ ID NO: 632, SEQ ID NO: 636, SEQ ID NO: 652, SEQ ID NO: 654, SEQ ID NO: 655, SEQ ID NO: 660, SEQ ID NO: 664, SEQ ID NO: 670, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 679, SEQ ID NO: 683, SEQ ID NO: 690, SEQ ID NO: 701, SEQ ID NO: 704, SEQ ID NO: 706, SEQ ID NO: 707, SEQ ID NO: 708, SEQ ID NO: 709, SEQ ID NO: 711, SEQ ID NO: 712, SEQ ID NO: 713, SEQ DD NO: 714, SEQ ID NO: 715, SEQ ID NO: 716, SEQ ID NO: 729, SEQ ID NO: 742, SEQ ID NO: 745, SEQ ID NO: 746, SEQ ID NO: 754, SEQ ID NO: 758, SEQ ID NO: 773, SEQ ID NO: 776, SEQ ID NO: 777, SEQ ID NO: 802, SEQ ID NO: 809, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 817, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 821, SEQ ID NO: 822, SEQ ID NO: 842, SEQ ID NO: 843, SEQ ID NO: 844, SEQ DD NO: 855, SEQ ID NO: 865, SEQ ID NO: 880, SEQ ID NO: 890, SEQ ID NO: 903, SEQ ID NO: 913, SEQ ID NO: 916, SEQ ID NO: 924, SEQ ID NO: 928, SEQ ED NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 940, SEQ ID NO: 942, SEQ ID NO: 943, SEQ ID NO: 945, SEQ ID NO: 946, SEQ ID NO. 956, SEQ ID NO: 958, SEQ ID NO: 960, SEQ ID NO: 1038, SEQ ID NO: 1043, SEQ ID NO: 1049, SEQ ID NO: 1050, SEQ ID NO: 1052, SEQ DD NO: 1053, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1081, SEQ ID NO: 1083, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 1297 and SEQ ID NO: 1298. 383 A vaccine composition suitable for preventing or treating H. pylori infection, comprising an effective amount of a purified H. pylori polypeptide or fragment thereof, wherein said H. pylori polypeptide is selected from the group consisting of SEQ ID NO: 496 SEQ ID NO: 501, SEQ ID NO: 514, SEQ ID NO: 547, SEQ ID NO: 550, SEQ ID NO: 553, SEQ ID NO: 564, SEQ ID NO: 568, SEQ ID NO: 586, SEQ. SEQ ID NO: 588, SEQ ID NO: 602, SEQ ID NO: 606, SEQ ID NO: 614, SEQ ID NO: 621, SEQ ID NO: 632, SEQ ID NO: 636, SEQ ID NO. SEQ ID NO. 654, SEQ ID NO: 655, SEQ ID NO: 660, SEQ ID NO: 664, SEQ ID NO: 670, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 679, SEQ ID NO: 683, SEQ ID NO: 690, SEQ ID NO: 701, SEQ ID NO: 704, SEQ ID NO: 706, SEQ ID NO: 707, SEQ ID NO: 708, SEQ ID NO: 709, SEQ CD NO: 711, SEQ ID NO: 712, SEQ ID NO: 713, SEQ ID NO: 714, SEQ ID NO: 715, SEQ ID NO: 716, SEQ ID NO: 729, SEQ ID NO. 742, SEQ ID NO: 745, SEQ ID NO: 746, SEQ ID NO: 754, SEQ ID NO: 758, SEQ ID NO: 773, SEQ ID NO: 776, SEQ ID NO: 777, SEQ ID NO: 802, SEQ ID NO: 809, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 817, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 821, SEQ ID NO. SEQ ID NO: 842, SEQ ID NO: 843, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 865, SEQ ID NO: 880, SEQ ID NO: 890, SEQ ID NO. 903, SEQ ID NO. 913, SEQ ID NO: 916, SEQ ID NO. 924, SEQ ID NO. 928, SEQ ID NO: 929, SEQ ID NO: 939, SEQ ID NO: 939, SEQ ID NO: 940, SEQ ID NO: 942, SEQ ID NO: 943, SEQ ID NO: 945, SEQ ID NO: 946, SEQ ID NO. 956, SEQ ID NO: 958, SEQ ID NO: 960, SEQ ID NO: 1038, SEQ ID NO: 1043, SEQ ID NO: 1049, SEQ ID NO: 1050, SEQ ID NO: 1052, SEQ ID NO: 1053, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1081, SEQ ID NO: 1083, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 1297, and SEQ ID NO: 1298. The vaccine composition of claim 15, further comprising a pharmaceutically acceptable carrier. 17. The vaccine composition of claim 16, wherein the pharmaceutically acceptable carrier is an adjuvant. 384 A method of treating an H. pylori infection of an individual comprising administering to the individual the vaccine composition of claim 15 such that the H. pylori infection is treated. The method of claim 18, wherein the treatment is a prophylactic treatment. The method of claim 18, wherein the treatment is a therapeutic treatment. The isolated nucleic acid comprises a nucleotide sequence encoding an H. pylori coat polypeptide or fragment thereof, wherein said nucleic acid is selected from the group consisting of SEQ ID NO. 255, SEQ ID NO: 263, SEQ ID NO: 285, SEQ ID NO: 311, SEQ ID NO: 327, SEQ ID NO. 329, SEQ ID NO: 331, SEQ ID NO. 353, SEQ ID NO: 364, SEQ ID NO: 412, SEQ ID NO: 433, SEQ ID NO: 449, SEQ ID NO: 452, SEQ ID NO: 469, SEQ ID NO: 989, SEQ ID NO: 1029, SEQ ID NO: 1032, SEQ ID NO: 286, SEQ ID NO. 326, SEQ ID NO. 374, SEQ ID NO: 399, SEQ ID NO: 422, SEQ ID NO. 454, SEQ ID NO: 465, SEQ ID NO: 998, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO: 1294, SEQ ID NO: 1295, SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 425, SEQ ID NO. 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO. 467, SEQ ID NO. 996, SEQ ID NO: 1027, SEQ ID NO: 1031, SEQ ID NO: 254, SEQ ID NO: 352 and SEQ ID NO: 389. The purified nucleic acid of claim 21, wherein said bacterial cell envelope polypeptide //. pylori or a fragment thereof is an outer membrane polypeptide of H. pylori or a fragment thereof that is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 255, SEQ ID NO: 263, SEQ ID NO: 285, SEQ ED NO: 311, SEQ. ID NO: 327, SEQ ID NO: 329, SEQ ID NO: 331, SEQ ID NO: 353, SEQ ID NO: 364, SEQ ED NO: 412, SEQ ID NO: 433, SEQ ID NO: 449, SEQ ID NO: 452, SEQ ID NO: 469, SEQ SEQ ID NO: 989, SEQ ID NO: 1029, SEQ ID NO: 1032, SEQ ID NO: 286, SEQ ID NO: 326, SEQ ID NO: 374, SEQ ID NO: 399, SEQ ID NO: 422, SEQ ID NO: 454, SEQ ID NO: 385 465, SEQ ID NO. 998, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO. 1294, SEQ ID NO: 1295, SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 425, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 467, SEQ ID NO: 996, SEQ ID NO: 1027, SEQ ID NO: 1031, SEQ ID NO: 254, SEQ ID NO: 352 and SEQ ID NO: 389. The purified nucleic acid of claim 22, wherein said bacterial outer cell membrane polypeptide //, pylori or a fragment thereof is a bacterium //, pylori polypeptide having a terminal phenylalanine residue, or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO SEQ ID NO: 263, SEQ ID NO: 285, SEQ ID NO. 311, SEQ ID NO: 327, SEQ ID NO. 329, SEQ ID NO. 331, SEQ ID NO. 353, SEQ ID NO: 364, SEQ ID NO. 412, SEQ ID NO: 433, SEQ ID NO: 449, SEQ ID NO: 452, SEQ ID NO: 469, SEQ ID NO. 989, SEQ ID NO. 1029 and SEQ ID NO. 1,032th The purified nucleic acid of claim 22, wherein said H. pylori outer cell membrane polypeptide or fragment thereof is H. pylori polypeptide having a C-terminal tyrosine cluster, or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO. SEQ ID NO: 326, SEQ ID NO. 374, SEQ ID NO: 399, SEQ ID NO: 422, SEQ ID NO: 454, SEQ ID NO: 465, SEQ ID NO: 998, SEQ ID NO: 1009, SEQ ID NO: 1023, SEQ ID NO: 1294 and SEQ ID NO: 1295. The purified nucleic acid of claim 22, wherein said outer cell membrane polypeptide //, pylori or a fragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster, or a fragment thereof encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 319, SEQ ID NO: 325, SEQ ID NO: 425, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 467, SEQIDNO SEQ ID NO: 1027 and SEQ ID NO: 1031. 386 26. A recombinant expression vector comprising the nucleic acid of claim 21 operably linked to an element that regulates transcription. 27. A cell comprising the recombinant expression vector of claim 26. A method of producing a ppylori polypeptide, which comprises culturing the cell of claim 27 under conditions that allow expression of the polypeptide. An isolated nucleic acid comprising a nucleotide sequence that encodes a polypeptide secreted by H. pylori or a fragment thereof comprises the nucleotide sequence of SEQ ID NO: 451. 30. A recombinant expression vector comprising the nucleic acid of claim 29 operably linked to an element that regulates transcription. 31. A cell comprising the recombinant expression vector of claim 30. A method of producing a bacterium, pylori, polypeptide, which comprises culturing the cell of claim 31 under conditions that allow expression of the polypeptide. An isolated nucleic acid comprising a nucleotide sequence encoding a cytoplasmic polypeptide of H. pylori or a fragment thereof was selected from the group consisting of SEQ ID NO. 455, SEQ ID NO: 351, SEQ ID NO: 318, SEQ ID NO: 330, and SEQ ID NO: 995. The purified nucleic acid of claim 33, wherein said H. pylori cytoplasmic polypeptide or fragment thereof is an H. pylori polypeptide that is involved in cofactor metabolism, or a fragment thereof, and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 455 . The purified nucleic acid of claim 33, wherein said H. pylori cytoplasmic polypeptide or fragment thereof is a H. pylori polypeptide that is involved in lipid metabolism, or a fragment thereof, and is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 351 . 36. A recombinant expression vector comprising the nucleic acid of claim 33 operably linked to an element that regulates transcription. 37. A cell comprising the recombinant expression vector of claim 36. A method of producing a pylori bacterium polypeptide, which comprises culturing the cell of claim 37 under conditions that allow expression of the polypeptide. An isolated nucleic acid that comprises a nucleotide sequence encoding a H. pylori cell polypeptide or fragment thereof was selected from the group consisting of SEQ ID NO: 267, SEQ ID NO: 282 and SEQ ID NO: 984. 388 40. A recombinant expression vector, wherein the nucleic acid of claim 39 is operably linked to an element that regulates transcription. 41. A cell comprising the recombinant expression vector of claim 40. A method of producing a H. pylori polypeptide, which comprises culturing the cell of claim 41 under conditions that allow expression of the polypeptide. 43. A vaccine composition for preventing or treating H. pylori infection, comprising an effective amount of the nucleic acid of claim 21. 44. The vaccine composition of claim 43, further comprising a pharmaceutically acceptable carrier. 45. The vaccine composition of claim 44, wherein the pharmaceutically acceptable carrier is an adjuvant. A method of treating an H. pylori infection of an individual comprising administering to the individual the vaccine composition of claim 43 such that the H. pylori infection is treated. The method of claim 46, wherein the treatment is a prophylactic treatment. 389 The method of claim 46, wherein the treatment is a therapeutic treatment. A vaccine composition suitable for the prevention or treatment of H. pylori infection comprising an effective amount of the nucleic acid of claim 29. 50. The vaccine composition of claim 49, further comprising a pharmaceutically acceptable carrier. 51. The vaccine composition of claim 50, wherein the pharmaceutically acceptable carrier is an adjuvant. 52. A method of treating a H. pylori infection in an individual comprising administering to the individual the vaccine composition of claim 49 such that the H. pylori infection is treated. The method of claim 52, wherein the treatment is a prophylactic treatment. The method of claim 52, wherein the treatment is a therapeutic treatment. 55. A vaccine composition suitable for preventing or treating H. pylori infection, comprising an effective amount of the nucleic acid of claim 33. 56. The vaccine composition of claim 55, further comprising a pharmaceutically acceptable carrier. 390 57. The vaccine composition of claim 56, wherein the pharmaceutically acceptable carrier is an adjuvant. 58. A method of treating H. pylori infection in an individual comprising administering to the individual the vaccine composition of claim 55 such that the H. pylori infection is treated. The method of claim 58, wherein the treatment is a prophylactic treatment. The method of claim 58, wherein the treatment is a therapeutic treatment. 61. A vaccine composition for preventing or treating H. pylori infection, comprising an effective amount of the nucleic acid of claim 39. 62. The vaccine composition of claim 61, further comprising a pharmaceutically acceptable carrier. 63. The vaccine composition of claim 62, wherein the pharmaceutically acceptable carrier is an adjuvant. 64. A method of treating a H. pylori infection in an individual comprising administering to the individual the vaccine composition of claim 61 such that the H. pylori infection is treated. The method of claim 64, wherein the treatment is a prophylactic treatment. 391 The method of claim 64, wherein the treatment is a therapeutic treatment. 67. The purified H. pylori cell envelope polypeptide or fragment thereof selected from the group consisting of SEQ ID NO: 746, SEQ ID NO: 754, SEQ ID NO: 776, SEQ ID NO: 802, SEQ ID NO: 818, SEQ ID NO. : 820, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 903, SEQ ID NO. 924, SEQ ID NO: 940, SEQ ID NO. 943, SEQ ID NO: 960, SEQ ID NO NO: 1043, SEQ ID NO: 1083, SEQ ID NO: 777, SEQ ID NO: 817, SEQ ID NO: 865, SEQ ID NO: 890, SEQ ID NO: 913, SEQ ID NO: 945, SEQ ID NO: 956, SEQ ID NO: 1052, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1297, SEQ ID NO: 1298, SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 916, SEQ ID NO: 928, SEQ ID NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 958, SEQ ID NO: 1050, SEQ ID NO: 1081, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO. NO: 745, SEQ ID NO: 843, SEQ ID NO: 880, and SEQ ID NO: 909. The purified polypeptide of claim 67, wherein said H. pylori cell envelope polypeptide or fragment thereof is an H. pylori outer membrane polypeptide or fragment thereof selected from the group consisting of SEQ ID NO: 746, SEQ ID NO: 754, SEQ. SEQ ID NO: 776, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 903, SEQ ID NO: 924, SEQ ID NO. SEQ ID NO: 943, SEQ ID NO: 960, SEQ ID NO: 1043, SEQ ID NO: 1083, SEQ ID NO: 777, SEQ ID NO: 817, SEQ ID NO: 865, SEQ ID NO: 890 , SEQ ID NO: 913, SEQ ID NO: 956, SEQ ID NO: 956, SEQ ID NO: 1052, SEQ ID NO: 1063, SEQ ID NO: 1077, SEQ ID NO: 1297, SEQ ID NO: 1298, SEQ ID NO: SEQ ID NO: 810, SEQ ID NO: 816, SEQ ID NO: 916, SEQ ID NO: 928, SEQ ID NO. 929, SEQ ID NO: 938, SEQ ID NO. 939, SEQ ID NO: 958, SEQ ID NO: 1050, SEQ ID NO: 1081, SEQ ID NO: 1085, SEQ ID NO: 1086, SEQ ID NO: 745, SEQ ID NO: 843 with SEQ ID NO: 880. The purified polypeptide of claim 68, wherein said outer membrane polypeptide of H. pylori or a fragment thereof is a H. pylori polypeptide with a terminal phenylalanine392 residue or fragment thereof, and is selected from the group consisting of SEQ ID NO: 746, SEQ ID NO: 754, SEQ ID NO. 776, SEQ ID NO: 802, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 844, SEQ ID NO: 855, SEQ ID NO: 903, SEQ ID NO: 924, SEQ ID NO: 940, SEQ ID NO: 943, SEQ ID NO: 960, SEQ ID NO: 1043, SEQ ID NO: 1083, and SEQ ID NO: 1086. The purified polypeptide of claim 68, wherein said H. pylori outer membrane polypeptide or fragment thereof is H. pylori polypeptide with a C-terminal tyrosine cluster or fragment thereof and is selected from the group consisting of SEQ ID NO: 777, SEQ ID NO. SEQ ID NO: 865, SEQ ID NO: 890, SEQ ID NO: 913, SEQ ID NO: 945, SEQ ID NO: 956, SEQ ID NO: 1052, SEQ ID NO: 1063, SEQ ID NO: 1077 , SEQ ID NO: 1297 and SEQ ID NO: 1298. The purified polypeptide of claim 68, wherein said H. pylori outer membrane polypeptide or fragment thereof is H. pylori polypeptide with a terminal phenylalanine residue and a C-terminal tyrosine cluster or fragment thereof, and is selected from the group consisting of SEQ ID NO: 810 SEQ ID NO: 816, SEQ ID NO: 916, SEQ ID NO. 928, SEQ ID NO: 929, SEQ ID NO: 938, SEQ ID NO: 939, SEQ ID NO: 958, SEQ ID NO. 1050, SEQ ID NO: 1081 and SEQ ID NO: 1085. 72. The purified H. pylori cell polypeptide or fragment thereof selected from the group consisting of SEQ ID NO: 758, SEQ ID NO: 773, SEQ ID NO: 808, and SEQ ID NO: 1038. 73. The purified H. pylori secreted polypeptide or fragment thereof comprising the amino acid sequence of SEQ ID NO: 942. 393 74. The purified H. pylori cytoplasmic polypeptide or fragment thereof is selected from the group consisting of SEQ ID NO: 946, SEQ ID NO: 842, SEQ ID NO: 809, SEQ ID NO: 821, and SEQ ID NO: 1049. The purified polypeptide of claim 74, wherein said H. pylori cytoplasmic polypeptide or fragment thereof is an H. pylori polypeptide that is involved in cofactor metabolism, or a fragment thereof, and comprises the amino acid sequence of SEQ ID NO: 946. The purified polypeptide of claim 74, wherein said cytoplasmic polypeptide of H. pylori or a fragment thereof is a bacterium //, a pylori involved in lipid metabolism, or a fragment thereof, and comprises the amino acid sequence of SEQ ID NO: 842. 77. A vaccine composition for preventing or treating H. pylori infection, comprising an effective amount of a H. pylori polypeptide of claim 67. 78. The vaccine composition of claim 77, further comprising a pharmaceutically acceptable carrier. 79. The vaccine composition of claim 78, wherein the pharmaceutically acceptable carrier is an adjuvant. 80. A method of treating H. pylori infection in an individual comprising administering to the individual the vaccine composition of claim 77 such that the H. pylori infection is treated. 394 The method of claim 80, wherein the treatment is a prophylactic treatment. The method of claim 80, wherein the treatment is a therapeutic treatment. 83. A vaccine composition for preventing or treating H. pylori infection, comprising an effective amount of a H. pylori polypeptide of claim 72. 84. The vaccine composition of claim 83, further comprising a pharmaceutically acceptable carrier. 85. The vaccine composition of claim 84, wherein the pharmaceutically acceptable carrier is an adjuvant. 86. A method of treating a H. pylori infection in an individual comprising administering to the individual the vaccine composition of claim 83 such that the H. pylori infection is treated. The method of claim 86, wherein the treatment is a prophylactic treatment. The method of claim 86, wherein the treatment is a therapeutic treatment. 395 89. A vaccine composition for preventing or treating H. pylori infection, comprising an effective amount of a H. pylori polypeptide of claim 73. 90. The vaccine composition of claim 89, further comprising a pharmaceutically acceptable carrier. 91. The vaccine composition of claim 90, wherein the pharmaceutically acceptable carrier is an adjuvant. 92. A method of treating a H. pylori infection in a subject comprising administering to the subject the vaccine composition of claim 89 such that the H. pylori infection is treated. 93. The method of claim 92, wherein the treatment is a prophylactic treatment. 94. The method of claim 92, wherein the treatment is a therapeutic treatment. 95. A vaccine composition for preventing or treating H. pylori infection, comprising an effective amount of a H. pylori polypeptide of claim 74. 96. The vaccine composition of claim 95, further comprising a pharmaceutically acceptable carrier. 396 97. The vaccine composition of claim 96, wherein the pharmaceutically acceptable carrier is an adjuvant. 98. A method of treating a H. pylori infection in an individual comprising administering to the individual the vaccine composition of claim 95 such that the H. pylori infection is treated. The method of claim 98, wherein the treatment is a prophylactic treatment. 100. The method of claim 98, wherein the treatment is a therapeutic treatment. 101. A method for detecting the presence of a Helicobacter nucleic acid in a sample, wherein (a) contacting the sample with the nucleic acid of claim 21 under conditions in which a hybrid between the probe and the Helicobacter nucleic acid contained in the sample may be formed; and (b) for detecting the hybrid resulting from step (a), and detecting the hybrid indicates the presence of the Helicobacter nucleic acid in the sample. 102. A method for detecting the presence of a Helicobacter nucleic acid in a sample, wherein (a) contacting the sample with the nucleic acid of claim 29 under conditions in which a hybrid between the probe and the Helicobacter nucleic acid contained in the sample may be formed; and (b) for detecting the hybrid resulting from step (a), and detecting the hybrid indicates the presence of the Helicobacter nucleic acid in the sample. 397 103. A method for detecting the presence of a Helicobacter nucleic acid in a sample, wherein (a) contacting the sample with the nucleic acid of claim 33 under conditions in which a hybrid can be formed between the probe and the Helicobacter nucleic acid contained in the sample; and (b) for detecting the hybrid resulting from step (a), and detecting the hybrid indicates the presence of the Helicobacter nucleic acid in the sample. 104. A method for detecting the presence of a Helicobacter nucleic acid in a sample, wherein (a) contacting the sample with the nucleic acid of claim 39 under conditions in which a hybrid may be formed between the probe and the Helicobacter nucleic acid contained in the sample; and (b) for detecting the hybrid resulting from step (a), and detecting the hybrid indicates the presence of the Helicobacter nucleic acid in the sample.