RU2768753C2 - Set of synthetic oligonucleotide primers and probes for detecting bovine respiratory syncytial infection virus and bovine gapdh gene and method for detecting rna of respiratory syncytial infection virus in cattle - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: disclosed is a set of synthetic oligonucleotide primers and probes for detecting bovine respiratory syncytial infection virus (BRSV) and bovine GAPDH gene, characterized by that synthetic oligonucleotide primers and probes have nucleotide sequences: SEQ ID NO: 1–6. Also disclosed is a method for detecting RNA virus of respiratory syncytial infection in cattle using said kit.EFFECT: group of inventions provides a highly specific and sensitive method based on a polymerase chain reaction (PCR) using real-time hybridisation-fluorescence detection, enabling detection and estimation of bovine BRSV virus concentration in biomaterial samples.2 cl, 1 dwg, 3 tbl, 4 ex

Description

The invention relates to biotechnology, namely to genetic engineering, and can be used in veterinary virology for the diagnosis of infectious diseases of agricultural animals, in particular, respiratory syncytial infection in cattle, as well as for assessing the concentration of the virus in the organs and tissues of diseased animals.

Bovine respiratory syncytial virus (BRSV) is one of the etiological agents of respiratory diseases in cattle. This virus causes respiratory syncytial infection (RSI) in cattle, which is registered in all countries of the world where an intensive type of animal husbandry is developed.

In susceptible animals, the virus causes bronchiolitis, bronchitis, interstitial pneumonia, and emphysema. RSI bovine can act as a model of human RSI with similar symptoms, and unlike other laboratory models (cotton rats or monkeys), RSI can be used to assess the dynamics of clinical symptoms and virus concentration at each stage of the disease.

Until now, the main method for detecting the virus and assessing its concentration is the isolation of the virus in cell cultures. Isolation of BRSV is difficult due to its extreme lability and is possible only at an early stage of infection, and the probability of virus isolation decreases with the appearance of signs of the disease. The best results are obtained by infecting cell cultures as soon as possible after taking the material, avoiding its freezing (Syurin V.N., Samuylenko A.Ya., Solovyov B.V., Fomina N.V. Viral diseases of animals. - M. : VNI-TIBP. - 1998. - 928 p.). Quantification of the virus is possible only in specially designed experiments on gnotobiont calves using a highly pathogenic strain of the BRSV virus adapted for cell cultures (Kimman TG, Zimmer GM, Straver PJ, de Leeuw PW Diagnosis of bovine respiratory syncytial virus infections improved by virus detection in lung lavage samples American Journal of Veterinary Research 1986 47 (1): 143-147.

Thus, the main disadvantage of the isolation of the bovine respiratory syncytial infection virus in cell culture is the duration of the procedure up to one or more months, as well as the inability to quantify the virus in naturally infected animals.

Promising in this direction may be the use of real-time PCR.

There is a known method for detecting BRSV by real-time PCR using commercial kits, where the detection of RNA of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene of cattle (Timsit E., Le Drean E., Maingourd C.) is used as an internal amplification control. et al., Detection by real-time RT-PCR of a bovine respiratory syncytial virus vaccine in calves vaccinated intrana-sally, Veterinary Record 2009; 165: 230-233).

The disadvantage of this method is the inability to quantify the virus.

A method is known for detecting and assessing the concentration of human respiratory syncytial infection virus (HRSV) RNA in biomaterial samples from laboratory animals and cell cultures, in which amplification of the β-actin gene was used to standardize the calculation of the number of copies of BRSV virus RNA in biomaterial samples. The virus concentration was determined as the number of copies per 10 ⁵ copies of the β-actin gene RNA (Boukhvalova MS, Prince GA, Blanco JC The cotton rat model of respiratory viral infections. Biologicals. 2009; 37: 152-159).

The disadvantages of this method include the fact that a set with an alkylating dye SYBR Green is used for its formulation and it is necessary to set up two independent reactions, which can adversely affect the accuracy of the concentration estimate.

The most acceptable from the point of view of the described shortcomings and taken as a prototype is a method based on the use of Taq Man PCR with a labeled probe to detect the BRSV virus, and PCR with an alkylating dye is used to detect the RNA of the β-actin gene in cattle (Boxus M., Letellier C, Kerkhofs, P. Real Time RT-PCR for the detection and quantitation of bovine respiratory syncytial virus Journal of Virological Methods 2005; 125(2): 125-130. At the same time, to calculate the concentration of two labels, amplification is carried out with calibration controls, which are 10-fold dilutions of the plasmid with cloned fragments of the BRSV and bovine β-actin genes with a known concentration. Quantitative assessment of the concentration of viral RNA in the sample is carried out relative to the concentration of β-actin gene RNA and is defined as the number of copies per 10 ⁵ copies of β-actin gene RNA.

The disadvantages of this method include the fact that different analyzes are used to determine the concentration of BRSV RNA and bovine β-actin RNA and it is not without the disadvantages of the above method.

The technical objective of the invention was the development of a highly specific and sensitive method based on polymerase chain reaction (PCR) using real-time hybridization-fluorescence detection, which makes it possible to detect the concentration of BRSV virus in samples of biological material samples from sick animals.

The essence of the invention lies in the fact that a set of synthetic oligonucleotide primers and probes is proposed for detecting the bovine respiratory syncytial infection virus (BRSV) and the GAPDH gene of cattle, according to the invention, synthetic oligonucleotide primers and probes have the nucleotide sequences: SEQ ID NO: 1-6.

The essence of the invention also lies in the fact that in the method for detecting RNA of the virus of respiratory syncytial infection in cattle, including the isolation of RNA from samples of samples of biological material from cattle, reverse transcription and PCR with hybridization-fluorescence detection in real time using panels of positive control samples with a known concentration, according to the invention, use a set of synthetic oligonucleotide primers and probes with nucleotide sequences SEQ ID ΝΟ: 1-6, the study of each sample is carried out by multiplex PCR for simultaneous detection of the RNA gene of the bovine respiratory syncytial infection virus cattle and the GAPDH gene.

The invention is illustrated by the following examples.

Example 1. Obtaining synthetic oligonucleotide primers. The search for new synthetic oligonucleotide primers and probes is based on the complete genome of the bovine respiratory syncytial virus (BRSV) strain "A51908" presented in the GenBank database (http://www.ncbi.nlm.nih.gov/GenBank/ GenBankSearch.html), using the Lasergen software package. The obtained sequences of several pairs of primers and probes are additionally tested for specificity using PCR modeling in the program "Vector NTI Suite" with the sequences of the genome of the bovine parainfluenza-3 virus and other closely related viruses.

The final selection of primers and probes is based on the following criteria: high fragment and RNA similarity index of different strains of BRSV virus, high annealing temperature (GC method), long consensus length.

The chemical synthesis of primers and probes is carried out by the amidophosphite method on an ASM-102U automatic synthesizer. The concentration of synthetic oligonucleotide primers and probes in the mother liquor is determined by the spectrometric method.

Similarly, primers and probes are selected to detect the GAPDH gene in cattle.

Characteristics of the selected primers and probes are presented in Table 1.

Thus, synthetic oligonucleotide primers were chosen that are complementary to a highly conserved region of the BRSV genome, the region of the N glycoprotein gene and the bovine GAPDH gene.

Example 2. Method for detecting RNA of respiratory syncytial infection virus and GAPDH gene of cattle. The method is carried out in several stages.

Stage 1. Isolation of virus RNA and the bovine gene

Isolation of RNA is carried out in a standard way using a commercial kit "Ribo-Sorb" produced by Federal State Institution "Central Research Institute of Epidemiology" of Rospotrebnadzor.

Stage 2. Reverse transcription reaction to obtain cDNA.

Carried out in a standard way using a commercial kit "Reverta-L" produced by the same institute.

To a tube containing 9.5 µl of the reaction mixture: RT buffer (50 mM Tris-HCl [pH 8.3], 3 mM MgC12, 75 mM KCl, 10 mM DTT), 0.1 mM. dNTP, 0.1 μg of RT primer) and 0.5 μl of revertase from the Reverta-L kit, add 10 μl of the RNA probe, mix gently and place in a thermostat at 37°C for 30 minutes. Then add 20 µl of DNA buffer, mix thoroughly and use for PCR.

Stage 3. Setting up a polymerase chain reaction

polymerase chain reaction. Composition of the reaction mixture: PCR buffer (60 mM Tris-HCl [pH 8.5], 1.5 mM MgCl ₂ , 25 mM KCl, 10 mM 2-mercaptethanol, 0.1% Triton X-100), 0.2 mM dNTP , 0.2 µg of each primer, 0.1 µg of each probe, 1.25 U of Taq-DNA polymerase, 5 µl of cDNA.

Temperature regime for PCR: 95°C - 5 min - 1 cycle; 95°C - 10 sec., 57°C - 15 sec., 72°C - 30 sec. - 55 cycles.

The measurement of fluorescence is carried out at a temperature of 57°C on the channel FAM and ROX. At the same time, the FAM channel takes into account the reaction to detect the RNA of the nucleoprotein N gene of the BRSV virus, and the ROX channel - the RNA of the bovine GAPDH gene.

Samples with a Ct value not exceeding 45 are considered positive.

Example 3. Determination of the concentration of bovine RSI virus in biomaterial samples

By molecular transformation of competent Escherichia coli bacterial cells with the pDrive plasmid containing specific DNA inserts, positive control samples (PCR) are obtained separately for each analysis to control amplification.

The concentration of plasmid DNA was determined using a Quant-iT dsDNA, HS reagent kit (Invitrogen, USA) and a QUBIT fluorimeter (Invitrogen, USA).

To determine the concentration of each analyte in the sample, prepare 10-fold dilutions of the FQS.

The PCR mixture is added to a 96-well plate for research and added with separate pipettes to the corresponding dilution wells of positive controls or cDNA of the studied samples of biomaterial samples. The plate is sealed with film and placed in a cycler for the reaction to proceed.

After passing the reaction, threshold cycles Ct for each sample are taken into account.

Next, build a standard curve of average Ct values for 10-fold dilutions of FQS individually for each analyzed gene. Using a standard curve, the Ct values of each sample are recalculated into relative units (log ₁₀ ) for each analyzed gene and normalized to the GAPDH gene. To do this, 5 (the average concentration of GAPDH gene RNA in the sample) is divided by the GAPDH value for each sample and multiplied by the value of units for the RSI virus N glycoprotein gene. Thus, the concentration of BRSV virus is expressed as N log ₁₀ bovine PCI/5 log ₁₀ GAPDH in the sample.

Example 4. Sensitivity assessment and detection of BRSV virus RNA in samples of biological material obtained from sick animals and reference strains.

To assess the sensitivity of the reaction, positive control samples (PCR) with a known concentration are titrated by the 10-fold dilution method. The study is carried out in triplicate. Dilutions of PQS contribute 5 μl per reaction.

The control strain of the BRSV virus "RSV No. 3" with a titer of 10 ⁴ TCD _50/ml is titrated by 10-fold dilutions in saline to a dilution of 10 ^-7 degrees, each dilution is subjected to a study in PCR.

To test for the presence of BRSV virus RNA, samples of nasal and eye secretions, swabs from the nasal mucosa, scrapings from the tracheal mucosa, tracheal and bronchial mucus, samples of the lungs and bronchi are used.

Liquids and samples of mucous secretions are taken in a volume of at least 1 ml, pieces of 1×1×1 cm ³ in size are cut out of the lung tissue.

Culture fluid, samples of strains and isolates of the BRSV virus, samples of nasal and eye secretions, tracheal and bronchial mucus are used for RNA isolation without prior preparation.

A 10% suspension in sterile saline is preliminarily prepared from samples of organs and tissues, the mixture is transferred into plastic test tubes with a capacity of 1.5 ml, centrifuged in a centrifuge at 10 × 10³ rpm for 5 minutes. For RNA isolation, 100 μl of the clarified supernatant obtained after centrifugation is used.

Thick samples of nasal secretions and mucus are diluted with sterile saline (approximately 1:5), mixed thoroughly, centrifuged at 10×10 ³ rpm for 5 minutes, and 100 μl of the clarified supernatant is used for RNA isolation. Further procedure according to example 2 and 3.

Note: The initial concentration of positive samples was 2.5×10 ¹⁰ GE/ml for BRSV, and 1.2×10 ¹⁰ GE/ml for GAPDH. Mean Ct ± standard deviation (St.O). Coefficient of variation (KB).

The sensitivity of the reaction to detect the N BRSV nucleoprotein gene was 2.5×10 ³ genomic equivalents per 1 cm ³ and the GAPDH gene was 1.2×10 ³ genomic equivalents per 1 cm ³ with a strong linear relationship (R ² ) 0.9873 and 0.9976, respectively. The reproducibility coefficient for different dilutions ranged from 0.32 to 3.57%, which indicates a high efficiency of the reaction (table 2).

By testing tenfold dilutions of the BRSV control strain "RS-B" at a predetermined concentration of 10 ^3.5 TCD _50/ cm ³ , the efficiency of the reaction for quantifying viral RNA concentration was evaluated. The sensitivity limit of the reaction was 10 ^0.5 TCC _50/ cm ³ (Figure 1), which corresponded to 3 log ₁₀ PCO/cm ³ .

The developed kit was used to study 273 animal biomaterial samples. The virus was detected in 53 samples, which accounted for 19.4% (Table 3).

Table 3 shows that the virus genome was more often detected in the lungs - 10.61% of positive samples, in samples of tracheal and bronchial exudates - 4.03%, nasal secretions - 2.2% and in the bronchi - 1.1%. Less commonly, the virus was found in the mucous membrane of the trachea and bronchi, as well as in the pulmonary lymph nodes - 0.73% of positive samples each. The concentration of the virus in the biomaterial samples varied, which may indicate different stages of infection in the animals at which they were selected. The maximum concentrations of the virus genome were determined in the lungs (1.3±0.5 - 4.8±0.47 log ₁₀ copies of BRSV/GAPDH RNA), nasal secretions (1.5±0.75 - 2.1±0.25 log ₁₀ copies of BRSV/GAPDH RNA) and exudate of the trachea, bronchi and nasal sinuses (0.3±0.21 - 2.8±0.15 log ₁₀ copies of BRSV/GAPDH RNA).

The results obtained in 100% of cases coincided with the data obtained in the study of the same biomaterial samples using a previously developed test system with electrophoretic detection of amplification products.

Thus, the proposed method allows you to effectively detect BRSV RNA in samples of various biomaterials from sick animals.

Sequence listing

<110> Federal State Budgetary Institution of Science Siberian Federal Scientific Center for Agrobiotechnologies of the Russian Academy of Sciences (SFSC RAS) <120> A set of synthetic oligonucleotide primers and probes for detecting bovine respiratory syncytial infection virus and the bovine GAPDH gene and a method for detecting bovine respiratory syncytial infection virus RNA <130> <160> 7 <210> one <211> 24 <212> RNA <213> BRSV <400> ATGCTGCAGGACTAGGTATAATGG 24 <210> 2 <211> 26 <212> RNA <213> BRSV <400> ACACTGTAATTGATGACCCCCATTCTC 26 <210> 3 <211> 25 <212> RNA <213> BRSV <400> ATGCTGCCAAAGCATATGCGGAACA 25 <210> 4 <211> 22 <212> RNA <213> Bos taurus <400> GATCGTGAAGGTCGGAGTCAAC 22 <210> five <211> twenty <212> RNA <213> Bos taurus <400> GTGATTGATGGCGACCATGT twenty <210> 6 <211> 19 <212> RNA <213> Bos taurus <400> CTGGTCACCAGGGCTGTT 19 <210> 7 <400> 7

Claims (2)

1. A set of synthetic oligonucleotide primers and probes for detecting the bovine respiratory syncytial infection virus (BRSV) and the bovine GAPDH gene, characterized in that the synthetic oligonucleotide primers and probes have the nucleotide sequences: SEQ ID NO: 1-6. 2. A method for detecting RNA of the bovine respiratory syncytial infection virus, including the isolation of RNA from samples of biological material samples from cattle, reverse transcription and real-time PCR with hybridization-fluorescence detection using a panel of positive control samples with a known concentration , characterized in that a set of synthetic oligonucleotide primers and probes according to claim 1 is used, the study of each sample is carried out by multiplex PCR to simultaneously detect the RNA gene of the bovine respiratory syncytial infection virus and the GAPDH gene.

Images