CN107513583A - Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig - Google Patents
Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig Download PDFInfo
- Publication number
- CN107513583A CN107513583A CN201710786492.5A CN201710786492A CN107513583A CN 107513583 A CN107513583 A CN 107513583A CN 201710786492 A CN201710786492 A CN 201710786492A CN 107513583 A CN107513583 A CN 107513583A
- Authority
- CN
- China
- Prior art keywords
- appv
- pestivirus
- primer
- pig
- atypia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention belongs to biological technical field, and in particular to a kind of the absolute fluorescence quantification PCR primer and kit of the pestivirus for detecting atypia pig.Shown in nucleotide sequence SEQ ID NO.1~2 of the absolute fluorescence quantification PCR primer of the pestivirus of described detection atypia pig, the primer can be with the pestivirus NS3 genetic fragments of specific amplification atypia pig.Present invention also offers the method for a kind of kit of pestivirus for detecting atypia pig and the pestivirus of detection atypia pig, the kit have rapidly and efficiently, simple operation, high specific, high sensitivity, the beneficial effect such as identification is simple, cost is low.The pestivirus of atypia pig is quantitatively detected and determined by above-mentioned primer, kit and method for invention, can provide a kind of technical foundation to APPV Testing and appraisal with the copy number of the measure target gene of fast accurate.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of absolute fluorescence for the pestivirus for detecting atypia pig quantifies
PCR primer and kit.
Background technology
It is well known that flaviviridae pestivirus is one of infection important pathogen body artiodactylous.Wherein pestivirus except
Including representative CSFV (Classical swine fever virus, CSFV) and bovine viral diarrhea virus
Outside (Bovine viral diarrhoea virus, BVDV), in recent years, also Bungowannah is found that respectively at 2007
Virus, rhinolophine pestivirus (Rhinolophus affinis bats pestivirus, RaPestV- were found that in 2012
1) borwn rat pestivirus, was found that in 2014, a kind of pestivirus (An of new atypia pig was even more found that in 2015
Atypical porcine pestivirus, APPV).
APPV is to find that the research claims the serum sample to pig in the pig body by Hause in U.S. farm first in 2015
Product, which test and analyze, finds a kind of new virus, and it has 68% likelihood with RaPV, is left 25%~28% and others
Pestivirus is similar.Therefore, the virus is named as a kind of pestivirus (the An atypical porcine of new atypia pig
Pestivirus), referred to as " APPV ".The result of study also indicates that body of the pestivirus in U.S. pig of this new atypia pig
It is interior widely distributed.Then, in order to explore popularities of the APPV in European swinery, Germany also acquires part locality pig farm
The sample of interior pig is analyzed and researched, it is found that APPV also shows generally popular situation in German swinery.
Afterwards, there is researcher to go inoculation to be uninfected by farrowing sow by APPV vaccines, find the first-born of these first farrowing sows
Piglet largely suffer from piglet congenital tremors, and in addition, also other correlative studys also indicate that the congenital of APPV and piglet
Property is trembled relevant.And piglet congenital tremors are that a kind of universal phenomenon with newborn piglet occurs, in nineteen twenty-two by first
It was found that typically exhibiting muscular tremor feature locally or systemically during morbidity, light symptoms are shown as in ear and back leg presentation
Local vibration.Serious symptoms show as general tremor, standing or difficulty in walking, finally because lactation nursing difficulty is died of starvation or
Directly eliminate.
In China, piglet congenital tremors cause the very mortality of piglet to cause huge economic damage to pig industry
Lose.Have some report think piglet congenital tremors the cause of disease be development of fetus caused by the subalimentation in sow gestation later stage not
Entirely, or as caused by the virosis such as CSFV, PCV-II, Pseudorabies virus, but caused by being actually that cause of disease
Piglet congenital tremors, there has been no definite conclusion at present.But recent studies indicate that in APPV and piglet congenital tremors
Between there is obvious influence relation, APPV is probably one of major reason for causing piglet congenital tremors.
So far, in China, there has been no the relevant report studied on APPV.
The content of the invention
For overcome the deficiencies in the prior art and shortcoming, primary and foremost purpose of the invention is to provide a kind of detection atypia pig
Pestivirus absolute fluorescence quantification PCR primer.
Another object of the present invention is to provide a kind of kit for the pestivirus for detecting atypia pig, the kit includes
Above-mentioned absolute fluorescence quantification PCR primer.
It is still another object of the present invention to provide the absolute fluorescence quantification PCR primer of the pestivirus of above-mentioned detection atypia pig
With the application of the kit of the pestivirus of detection atypia pig.
The purpose of the present invention is achieved through the following technical solutions：
A kind of absolute fluorescence quantification PCR primer for the pestivirus for detecting atypia pig, includes primer APPV_NS3-F, primer
APPV_NS3-R, its nucleotide sequence are as follows：
Primer APPV_NS3-F：5’-CAGAGRAAAGGKCGAGTGGGT-3’；
Primer APPV_NS3-R：5’-ACCATAYTCTTGGGCCTGSAGG-3’；
A kind of kit for the pestivirus for detecting atypia pig, including the pestivirus of above-mentioned detection atypia pig are absolute glimmering
Fluorescent Quantitative PCR primer；
The kit of the pestivirus of described detection atypia pig preferably includes following component：2×One Step SYBR
Green Mix, One Step SYBR Green Enzyme Mix, the absolute fluorescence of pestivirus of above-mentioned detection atypia pig are determined
Measure PCR primer and without RNase water；
Described kit also includes positive criteria product and negative control；
The absolute fluorescence quantification PCR primer of the pestivirus of described detection atypia pig is viral with detection atypia pig
Application of the kit in the pestivirus of detection atypia pig；
Described application does not include disease treatment and diagnostic purpose；
A kind of method for the pestivirus for detecting atypia pig, is comprised the following steps：
(1) RNA of APPV viruses in porcine tissue or serum sample is extracted；
(2) it is cDNA by the RNA reverse transcriptions of the APPV viruses of step (1) extraction；
(3) common PCR primers pair are designed according to APPV conserved sequence, using the cDNA of reverse transcription in step (2) as template,
Enter performing PCR amplification, obtain purpose fragment；Wherein, common PCR primers to for：APPV_NS3-F and APPV_NS3-R；
(4) purpose fragment that step (3) amplification obtains connects PMD-18-T carriers through glue reclaim after purification, obtains recombinating matter
Grain；
(5) recombinant plasmid obtained using step (4) is template, and primer APPV_NS3-T7-F and APPV_NS3-R are as expansion
Increase primer, enter performing PCR amplification, obtain pcr amplification product；
(6) pcr amplification product obtained using step (5) amplification is transcribed into as template using in-vitro transcription kit
RNA；
(7) starting RNA copy numbers are calculated as standard items after the RNA doubling dilutions for obtaining step (6) transcription；
(8) quantitative fluorescent PCR is carried out using the standard items of the RNA of testing sample and each gradient dilution as reaction template
Reaction, the starting copy number of testing sample, as APPV content are calculated according to standard items quantitative fluorescent PCR standard curve；
Reverse transcription described in step (2) be preferably use random primer and reverse transcription MLV enzymes by RNA reverse transcriptions for
cDNA；
Reverse transcription described in step (2) is more preferably：
Prepare RNA primer mixed liquor reaction systems：The μ L of RNA (as template) 5.75 of the APPV viruses of step (1) extraction,
The μ L of random primer 1, altogether 6.75 μ L；70 DEG C of water-bath 10min, ice bath 2min；Reverse transcription system is prepared again：RNA primer mixed liquors
6.75 μ L, 5 × reverse transcription buffer 2 μ L, 10 μM of μ L of 0.25 μ L, MLV enzyme of dNTP0.5 μ L, RNase inhibitor 0.5, altogether 10
μL；30 DEG C of water-bath 10min, 42 DEG C of water-bath 1h, obtain cDNA；CDNA after reverse transcription can be stored in -20 DEG C；
Described in step (3) PCR amplification system be preferably：Premix Taq enzymes 12.5 μ L, no μ L of RNase water 6.5,
Each μ L of 0.5 μ L, cDNA template 5 of primer APPV_NS3-F and APPV_NS3-R；
Described in step (3) PCR amplification response procedures be preferably：98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 45s, 30 are followed
Ring；72℃10min；
The nucleotides sequence of APPV_NS3-T7-F described in step (5) is classified as：
Primer APPV_NS3-T7-F：GATCACTAATACGACTCACTATAGGGCAGAGGAAAGGCCGAGTGGG；
Described in step (5) PCR amplification system be preferably：Premix Taq enzymes 12.5 μ L, no μ L of RNase water 6.5,
Each 0.5 μ L of primer APPV_NS3-T7-F and APPV_NS3-R, the μ L of plasmid template 5；
Described in step (5) PCR amplification response procedures be preferably：98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 45s, 30 are followed
Ring；72℃10min；
The reaction system of quantitative fluorescent PCR described in step (8) is：2 × One Step SYBR Green Mix are buffered
10 μ L, One Step SYBR Green Enzyme Mix of liquid 1 μ L, each 0.4 μ L of fluorescence quantification PCR primer, no RNase water 6.2
The μ L of μ L, RNA template 2；
The response procedures of quantitative fluorescent PCR described in step (8) are：50℃3min；95℃5min；95 DEG C of 10s, 60 DEG C
30s, 40 circulations；
Testing sample and standard items described in step (8) carry out quantitative fluorescent PCR in same amplification system and reaction
Amplification, it ensure that the same amplification system of standard items and sample and with reaction；
The primer of quantitative fluorescent PCR described in step (8) is APPV_NS3-F and APPV_NS3-R；
Described method does not include disease treatment and diagnostic purpose；
The principle of the present invention：
The general principle of absolute fluorescence quantitative PCR is to draw standard curve using the standard items of concentration known, is then calculated
Go out the amount of unknown sample.First by standard items RNA doubling dilutions to various concentrations, then quantitative fluorescent PCR is carried out as template
Reaction.Using the logarithm value of standard items copy number as abscissa, the Ct values measured using quantitative PCR reaction draw bid as ordinate
Directrix curve.Log (initial concentration) and period are linear, and standard song can be made by the standard items of known starting copy number
Line, that is, obtain linear relationship existing for the amplified reaction.Institute in sample is calculated according to the Ct values and calibration curve equation of sample
The template amount contained.
The present invention is had the following advantages relative to prior art and effect：
(1) the invention provides a kind of absolute fluorescence quantification PCR primer of pestivirus for detecting atypia pig and detection are non-
The kit of the pestivirus of typical pig, the primer can be with the pestivirus NS3 genetic fragments of specific amplification atypia pig, to APPV
Testing and appraisal provide technical support.
(2) the invention provides it is a kind of detect atypia pig pestivirus kit, the kit have rapidly and efficiently,
Simple operation, high specific, high sensitivity, identification are simply, cost is low, do not need expensive instrument, are adapted to Site Detection etc. beneficial
Effect.
(3) for the present invention by the method for absolute fluorescence quantitative PCR, the pestivirus to atypia pig is that APPV carries out quantitative inspection
Survey and determine, a kind of technology base can be provided to APPV Testing and appraisal with the copy number of the measure target gene of fast accurate
Plinth.
Brief description of the drawings
Fig. 1 is regular-PCR purpose band electrophoretogram；Wherein, M：Maker, 1：Purpose fragment (117bp), 2：Negative control.
Fig. 2 is absolute fluorescence quantitative PCR canonical plotting.
Fig. 3 is absolute fluorescence quantification PCR primer to specificity experiments amplification figure.
Fig. 4 is absolute fluorescence quantification PCR primer to sensitivity experiments amplification figure.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are unlimited
In this.
Embodiment 1
Following methods step describes APPV RNA extractings in detail, prepared by plasmid, plasmid concentration measure, plasmid amplification curve
Foundation and the measure of the APPV contents in testing sample.The present invention is using absolute fluorescence quantifying PCR method detection APPV copies
Number.
(1) sample source：The present invention acquires in SOUTHERN CHINA Liang Jia plants one with congenital tremors sick pig
Serum sample and organ sample (including kidney, spleen, duodenum etc.)；According to APPV strains (No. GenBank：KY624591.1),
Identified, serum sample and organ sample are the APPV positives.
(2) design of RT-PCR primer
Postel is being obtained in 2016 APPV published from NCBI-Genebank using Primer express softwares
Gene order (KY624591.1), in NS3 gene regions, utilize the primer pair of the common reverse transcription PCR of Oligo7.0 designs, primer pair
Synthesized by Invitrogen Corp..The absolute fluorescence quantification PCR primer is to including absolute fluorescence quantitative PCR sense primer and definitely
Quantitative fluorescent PCR anti-sense primer, it is respectively：
APPV_NS3-F：5’-CAGAGRAAAGGKCGAGTGGGT-3’；
APPV_NS3-R：5’-ACCATAYTCTTGGGCCTGSAGG-3’；
Design another sense primer that T7 promoters are added at APPV_NS3-F 5 ' ends：
APPV_NS3-T7-F：GATCACTAATACGACTCACTATAGGGCAGAGGAAAGGCCGAGTGGG；
(3) blood serum sample is gathered, and processing is ground to tissue sample.According to Viral RNA/DNA
Extraction Kit Ver.5.0 specifications, using OMEGA viral RNAs extracts kit carry out RNA extractings (serum sample and
Renal tissue sample), by 560 μ L QVL Buffer, 5.6 μ L Carrier RNA, 10 μ L β-thioglycol add 1.5mL from
Heart pipe；140 μ L blood serum samples are added, fully mix 30s, are incubated at room temperature 5min；560 μ L absolute ethyl alcohols are added again, are sufficiently mixed
30s；Centrifugal column is put into collecting pipe, 650 μ L aforesaid liquids are transferred to centrifugal column, operation wants careful and rapid, 10000g
After centrifuging 30s, (collecting pipe) liquid is abandoned, and repeat this step；The 2mL collecting pipes renewed, add 500 μ L RWA, 10000g from
After heart 30s, liquid is abandoned；After adding 500 μ L RWB, 10000g centrifugations 30s, liquid is abandoned；After blank pipe 10000g centrifugations 3min, liquid is abandoned
Body；The 1.5mL Ep pipes renewed, add 30 μ L DEPC water, stand 3min, 10000g centrifugation 1min, gained liquid is to extract
RNA, in -80 DEG C preservation；
(4) using the blood serum sample RNA of step (3) extracting as template, using random primer 6N (Takara Bio Inc) and
RNA reverse transcriptions are cDNA by reverse transcription MLV enzymes, and process is：In 1.5mL centrifuge tube, the μ L of RNA templates 5.75 are added, at random
The μ L of primer 1,6.75 μ L, are placed in 70 DEG C of water-bath 10min, at once ice bath 2min by mixed liquor altogether；Again into centrifuge tube add 5 ×
The μ L of 2 0.5 μ L, RNase inhibitor of μ L, dNTP (10 μM), 0.25 μ L, MLV enzymes of reverse transcription buffer 0.5,10 μ L, will be mixed altogether
Liquid is placed in 30 DEG C of water-bath 10min, and 42 DEG C of water-bath 1h, products therefrom is cDNA, in -20 DEG C of preservations；
(5) cDNA obtained using reverse transcription in step (4) is template, including APPV_NS3-F/APPV_NS3-R primers
To PCR reaction systems in carry out regular-PCR amplification；Wherein, common PCR reaction system (25 μ L)：The μ of Premix Taq enzymes 12.5
L, no μ L of RNase water 6.5, each μ L of 0.5 μ L, cDNA template 5 of regular-PCR upstream and downstream primer (APPV_NS3-F/APPV_NS3-R).
Common PCR reaction program：98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 45s, 30 circulations；72℃10min；4 DEG C of preservations；
(6) it is ultraviolet by amplified production in the agarose gel electrophoresis that mass fraction is 1.5% after common PCR reaction terminates
Imaging system is taken pictures (see Fig. 1) purpose band 117bp, cuts purpose band.
(7) purpose band under cutting is carried out using Gel ExtraCtion Kit kits (OMEGA BIO-TEK)
Glue reclaim；
(8) purpose band after recovery purifying is connected into PMD-18-T carriers, 16 DEG C of constant temperature in constant-temperature metal bath instrument
18 hours；Routine transfection is into 300 μ L competent cell bacillus coli DH 5 alpha, by the competence Escherichia coli after the completion of transfection
On the LB solid mediums containing ammonia benzyl, 37 DEG C of constant temperature are incubated overnight DH5 α coated plates, and next day picking monoclonal bacterium colony, addition contains
Have in the LB fluid nutrient mediums of ammonia benzyl, 37 DEG C, 200r/min shaking table cultures 12 hours.Bacterium solution PCR detection bacterium solution transfection yin and yang attributes,
Illustrate to extract plasmid according to plasmid extraction kit (OMEGA BIO-TEK) after successful bacterium solution centrifugal concentrating will be transfected；Plasmid
Through being sequenced and comparing, correct rear use is checked；
(9) using institute's upgrading grain in step (8) as template, in the regular-PCR including APPV_NS3-T7-F/APPV_NS3-R
Enter performing PCR amplification in system；Common PCR reaction system (25 μ L)：Premix Taq enzymes 12.5 μ L, no RNase water 6.5 μ L, it is general
Logical PCR upstream and downstream primers (APPV_NS3-F/APPV_NS3-R) each 0.5 μ L, the μ L of plasmid template 5；
Common PCR reaction program：98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 45s, 30 circulations；72℃10min；4 DEG C of preservations；
(10) using pcr amplification product in step (9) as template, RNA is transcribed into using in-vitro transcription kit；Utilize
In-vitro transcription kit (Takara Bio Inc), prepare in-vitro transcription system (20 μ L)：The μ of 2 μ L, ATP solution of transcription buffer 2
2 μ L, CTP solution of L, GTP solution, 2 μ L, UTP solution 2 μ L, the μ L of RNase inhibitor 0.5, the μ L of t7 rna polymerase 2, no RNase water
6.5 μ L, linear die DNA1 μ L.By gentle centrifugation after above-mentioned system uniformly mixing, responsive transcription liquid is collected in reaction tube bottom
Portion, 42 DEG C are reacted 2 hours.The part extracted reaction solution carries out gel electrophoresis and confirms the RNA products after in-vitro transcription, and preserves and turn
The RNA recorded is in -80 DEG C.
(11) the RNA concentration transcribed using nucleic acid-protein analyzer (BIO-RAD) determination step (10), according to formula meter
Calculate：RNA copy numbers (copy number/μ L)=6.02 × 1023(copy number/μ L) × RNA concentration (g/ μ L)/RNA molecule amount (g/
mol).It is 8.323 × 10 that prepared RNA concentration, which is calculated,13Copy/μ L.
Using Primer express Software for Design absolute fluorescence quantification PCR primers pair, absolute fluorescence quantification PCR primer pair
Synthesized by Invitrogen Corp..Absolute fluorescence quantitative PCR sense primer is APPV_NS3-F：5’-
CAGAGRAAAGGKCGAGTGGG-3 ', absolute fluorescence quantitative PCR anti-sense primer are APPV_NS3-R：5’-
ACCATAYTCTTGGGCCTGSAG-3’.Take DEPC water to do 10 times of doubling dilutions to the RNA for determining copy number, take 10-1To 10-88 gradients do template and carry out absolute fluorescence quantitative PCR reaction.
Absolute fluorescence quantitative PCR reaction system：
Absolute fluorescence quantitative PCR response procedures：50℃3 min；95℃5 min；95 DEG C of 10 s, 60 DEG C of 30s, 40 are followed
Ring；
(12) according to the absolute fluorescence quantitative PCR reaction system and program in (9), 0 is taken-1To 10-7It is dense known to 8 gradients
Plasmid as template is spent, template is separately done with the RNA of renal tissue sample while carries out quantitative fluorescent PCR reaction, according to Log (templates
Copy number) with the corresponding relations (table 1) of period Ct values standard curve is generated, see Fig. 2.Ct values obtained by testing sample are substituted into mark
Quasi- product curvilinear equation can draw testing sample starting copy number, calculate the content of APPV in sample.Absolute fluorescence quantitative PCR
Amplified production length is 117bp.
The Log of table 1 (template copy numbers) and period Ct value corresponding relations
| Log (template copy numbers) | 10.22 | 9.22 | 8.22 | 7.22 | 6.22 | 5.22 | 4.22 |
| Ct values | 8.87 | 11.43 | 15.22 | 18.77 | 22.14 | 25.76 | 28.73 |
Analysis of experimental results：With Log (template copy numbers) for abscissa, period Ct values are ordinate, curve obtained side
Cheng Wei：Y=-3.3989X+43.245, R2=0.9986 (showing that linear relationship is good).Gained testing sample Ct values are 15.28,
Sample Ct values are substituted into calibration curve equation, 15.28=-3.3989X+43.245, i.e. X=(15.28-43.245)/- 3.3989
=8.23.The copy number of testing sample is drawn by Logarithmic calculation, i.e., (2 μ L) APPV copy numbers are 10 in testing sample8.23=
1.70×108, the concentration of the testing sample is 8.5 × 107Copy/μ L.
The absolute fluorescence quantification PCR primer of embodiment 2 is to specificity experiments
Using the RNA of the renal tissue sample in embodiment 1 as positive control, while extract CSFV (CSFV
(CSFV) vaccine strain GXW-07, in Application No. " 201310629121.8 ", the entitled " RT- of detection CSFV of application
Disclosed in LAMP nucleic acid test strips kit and application "), Latex agglutination test (Latex agglutination test GZ0409-31 strains,
In Application No. " 201310627844.4 ", the entitled " E III-indirect ELISA antibody of detection Latex agglutination test of application
Disclosed in detection kit and application "), pig parvoviral (porcine parvovirus inactivated vaccines WH-1 strains, purchased from animal before the section of Wuhan
Biological products Co., Ltd), Porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus CV777 strains, in Application No.
" 201310153789.X ", application is entitled " to be detected the RT-LAMP nucleic acid test-strip kit of Porcine epidemic diarrhea virus and answers
With " disclosed in) RNA carry out specific detection, it is fixed to, absolute fluorescence using the absolute fluorescence quantification PCR primer in embodiment 1
Measure PCR reaction systems and program carries out absolute fluorescence quantitative PCR, as a result followed in addition to positive control (RNA of renal tissue sample)
Number of rings is both greater than 34, i.e., does not have specific amplification, illustrates absolute fluorescence quantification PCR primer of the present invention to good special
Property (Fig. 3).
The absolute fluorescence quantitative PCR sensitivity experiments of embodiment 4
10 times of RNA made from the step of Example 1 (10) reverse transcription is incremental to be diluted and is used as absolute fluorescence quantitative PCR mould
Plate, take 10-5~10-9The RNA of extension rate does template, and each dilution factor respectively takes 2 μ L as template, by the absolute glimmering of embodiment 1
Fluorescent Quantitative PCR method is detected, and amplification curve is observed, in terms of there is the highest dilution of the template used amount of positive expecting curve
Calculate its sensitiveness.Amplification curve in Fig. 4 is from left to right followed successively by 10-5、10-6、10-7、10-8And 10-9Extension rate template
Amplification curve, last branch amplification curve are 10-9Extension rate template, i.e. minimum detectable activity are 11.43 copies/μ L.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Agricultural University Of South China
<120>Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> Artificial
<220>
<223>Primer APPV_NS3-F
<400> 1
cagagraaag gkcgagtggg t 21
<210> 2
<211> 22
<212> DNA
<213> Artificial
<220>
<223>Primer APPV_NS3-R
<400> 2
accataytct tgggcctgsa gg 22
<210> 3
<211> 46
<212> DNA
<213> Artificial
<220>
<223>Primer APPV_NS3-T7-F
<400> 3
gatcactaat acgactcact atagggcaga ggaaaggccg agtggg 46
Claims (10)
1. a kind of absolute fluorescence quantification PCR primer for the pestivirus for detecting atypia pig, it is characterised in that include primer APPV_
NS3-F, primer APPV_NS3-R, its nucleotide sequence are as follows：
Primer APPV_NS3-F：5’-CAGAGRAAAGGKCGAGTGGGT-3’；
Primer APPV_NS3-R：5’-ACCATAYTCTTGGGCCTGSAGG-3’.
2. a kind of kit for the pestivirus for detecting atypia pig, it is characterised in that including the detection SARS described in claim 1
The absolute fluorescence quantification PCR primer of the pestivirus of type pig.
3. the kit of the pestivirus of detection atypia pig according to claim 2, it is characterised in that including following component：
2 × One Step SYBR Green Mix, One Step SYBR Green Enzyme Mix, above-mentioned detection atypia pig
The absolute fluorescence quantification PCR primer of pestivirus and without RNase water.
4. the absolute fluorescence quantification PCR primer and Claims 2 or 3 of the pestivirus of the detection atypia pig described in claim 1
Application of the kit of the pestivirus of described detection atypia pig in the pestivirus of detection atypia pig.
A kind of 5. method for the pestivirus for detecting atypia pig, it is characterised in that comprise the following steps：
(1) RNA of APPV viruses in porcine tissue or serum sample is extracted；
(2) it is cDNA by the RNA reverse transcriptions of the APPV viruses of step (1) extraction；
(3) common PCR primers pair are designed according to APPV conserved sequence, using the cDNA of reverse transcription in step (2) as template, carried out
PCR is expanded, and obtains purpose fragment；Wherein, common PCR primers to for：APPV_NS3-F and APPV_NS3-R；
(4) purpose fragment that step (3) amplification obtains connects PMD-18-T carriers after glue reclaim, obtains recombinant plasmid；
(5) as template, primer APPV_NS3-T7-F and APPV_NS3-R draw the recombinant plasmid obtained using step (4) as amplification
Thing, enter performing PCR amplification, obtain pcr amplification product；
(6) pcr amplification product obtained using step (5) amplification is transcribed into RNA as template using in-vitro transcription kit；
(7) starting RNA copy numbers are calculated as standard items after the RNA doubling dilutions for obtaining step (6) transcription；
(8) it is anti-using the standard items of the RNA of testing sample and each gradient dilution as reaction template progress quantitative fluorescent PCR
Should, according to the starting copy number of standard items quantitative fluorescent PCR standard curve calculating testing sample, as APPV content.
6. the method for the pestivirus of detection atypia pig according to claim 5, it is characterised in that：
Reverse transcription described in step (2) is to use random primer and reverse transcription MLV enzymes by RNA reverse transcriptions for cDNA.
7. the method for the pestivirus of detection atypia pig according to claim 6, it is characterised in that：
Reverse transcription described in step (2) is：
Prepare RNA primer mixed liquor reaction systems：The μ L of RNA (as template) 5.75 of the APPV viruses of step (1) extraction, at random
The μ L of primer 1, altogether 6.75 μ L；70 DEG C of water-bath 10min, ice bath 2min；Reverse transcription system is prepared again：The μ of RNA primer mixed liquors 6.75
L, 5 × reverse transcription buffer 2 μ L, 10 μM of μ L of 0.25 μ L, MLV enzyme of dNTP0.5 μ L, RNase inhibitor 0.5, altogether 10 μ L；30
DEG C water-bath 10min, 42 DEG C of water-bath 1h, obtains cDNA；CDNA after reverse transcription can be stored in -20 DEG C.
8. the method for the pestivirus of detection atypia pig according to claim 5, it is characterised in that：
The nucleotides sequence of APPV_NS3-T7-F described in step (5) is classified as：
Primer APPV_NS3-T7-F：GATCACTAATACGACTCACTATAGGGCAGAGGAAAGGCCGAGTGGG；
The primer of quantitative fluorescent PCR described in step (8) is the primer APPV_NS3-F and primer described in claim 1
APPV_NS3-R。
9. the method for the pestivirus of detection atypia pig according to claim 5, it is characterised in that：
The reaction system of quantitative fluorescent PCR described in step (8) is：2 × One Step SYBR Green Mix buffer solutions 10
μ L, One Step SYBR Green Enzyme Mix 1 μ L, fluorescence quantification PCR primer each 0.4 μ L, no μ L of RNase water 6.2,
The μ L of RNA templates 2.
10. the method for the pestivirus of detection atypia pig according to claim 5, it is characterised in that：
The response procedures of quantitative fluorescent PCR described in step (8) are：50℃3min；95℃5min；95 DEG C of 10sec, 60 DEG C
30sec, 40 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710786492.5A CN107513583A (en) | 2017-09-04 | 2017-09-04 | Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710786492.5A CN107513583A (en) | 2017-09-04 | 2017-09-04 | Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107513583A true CN107513583A (en) | 2017-12-26 |
Family
ID=60723895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710786492.5A Pending CN107513583A (en) | 2017-09-04 | 2017-09-04 | Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107513583A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929606A (en) * | 2017-04-14 | 2017-07-07 | 华南农业大学 | A kind of Testing and appraisal non-typical swine fever virus（APPV）PCR primer and detection method and detection kit |
| CN108611442A (en) * | 2018-06-07 | 2018-10-02 | 西南民族大学 | The fluorescence quantitative RT-PCR primer and probe and method of a kind of detection pig atypia pestivirus and application |
| CN114015815A (en) * | 2021-12-17 | 2022-02-08 | 广西壮族自治区动物疫病预防控制中心 | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof |
| CN114015815B (en) * | 2021-12-17 | 2024-04-30 | 广西壮族自治区动物疫病预防控制中心 | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106801109A (en) * | 2017-03-24 | 2017-06-06 | 广东温氏食品集团股份有限公司 | One boar atypia pestivirus RT PCR detections specific primer, kit and detection method |
-
2017
- 2017-09-04 CN CN201710786492.5A patent/CN107513583A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106801109A (en) * | 2017-03-24 | 2017-06-06 | 广东温氏食品集团股份有限公司 | One boar atypia pestivirus RT PCR detections specific primer, kit and detection method |
Non-Patent Citations (4)
| Title |
|---|
| JIN YUAN等: "Atypical Porcine Pestivirus as a Novel Type of Pestivirus in Pigs in China", 《FRONTIERS IN MICROBIOLOGY》 * |
| 于浩等: "《生物信息实验指导》", 30 September 2009, 吉林大学出版社 * |
| 张爱联: "《生物化学与分子生物学实验教程》", 31 January 2009, 中国农业大学出版社 * |
| 李自刚等: "《生物检测技术》", 31 August 2016, 中国轻工业出版社 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929606A (en) * | 2017-04-14 | 2017-07-07 | 华南农业大学 | A kind of Testing and appraisal non-typical swine fever virus（APPV）PCR primer and detection method and detection kit |
| CN108611442A (en) * | 2018-06-07 | 2018-10-02 | 西南民族大学 | The fluorescence quantitative RT-PCR primer and probe and method of a kind of detection pig atypia pestivirus and application |
| CN108611442B (en) * | 2018-06-07 | 2021-09-24 | 西南民族大学 | Fluorescent quantitative RT-PCR primer and probe for detecting swine atypical pestivirus, method and application |
| CN114015815A (en) * | 2021-12-17 | 2022-02-08 | 广西壮族自治区动物疫病预防控制中心 | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof |
| CN114015815B (en) * | 2021-12-17 | 2024-04-30 | 广西壮族自治区动物疫病预防控制中心 | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN103275862B (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| CN105420379A (en) | Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof | |
| CN106801109B (en) | RT-PCR detection specific primer, kit and detection method for swine atypical pestivirus | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
| CN103789451A (en) | Fluorescent quantitative kit for detecting coxsackie viruses A6 and A10 | |
| CN106435039A (en) | Primers, probe, kit and method for detecting PRRS (porcine reproductive and respiratory syndrome) NADC-30 strain | |
| CN110938709A (en) | Visual nucleic acid detection kit and method for enteroviruses based on recombinase polymerase amplification technology | |
| CN102352416A (en) | Primer, probe and kit for detecting mouse hantaviruses | |
| CN104263857B (en) | A kind of nano PCR kit of quick detection mink enteritis virus and its application | |
| Li et al. | Rapid detection of porcine deltacoronavirus and porcine epidemic diarrhea virus using the duplex recombinase polymerase amplification method | |
| TWI377255B (en) | Nucleic acid detection | |
| CN107988436A (en) | A kind of PCR system and detection method for detecting pig virus Reproduction Disorder | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN107513583A (en) | Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN106435032B (en) | Duplex RT-PCR primer, kit and method for simultaneously amplifying North American type and European type porcine reproductive and respiratory syndrome viruses | |
| CN102108420B (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN103882149A (en) | Dual real-time fluorescence PCR detection method of type I and type II of porcine torque teno virus | |
| KR102267326B1 (en) | Method and kit for detecting coronavirus | |
| CN107267666A (en) | A kind of fluorescent quantitation RT PCR detection kits based on pig atypia pestivirus raq gene | |
| CN104372111B (en) | FMDV is universal and Asia 1 type bifluorescence quantitative detecting method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171226 |