CN103498009B - Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof - Google Patents

Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof Download PDF

Info

Publication number
CN103498009B
CN103498009B CN201310470178.8A CN201310470178A CN103498009B CN 103498009 B CN103498009 B CN 103498009B CN 201310470178 A CN201310470178 A CN 201310470178A CN 103498009 B CN103498009 B CN 103498009B
Authority
CN
China
Prior art keywords
bovine
positive control
virus
control plasmid
pmd18
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310470178.8A
Other languages
Chinese (zh)
Other versions
CN103498009A (en
Inventor
郭利
王炜
杨艳玲
武华
张淑琴
李光玉
陈立志
程世鹏
杨福合
李春义
温永俊
王凤雪
孙娜
王建科
易立
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sinovet (beijing) Biotechnology Co ltd
Institute Special Animal and Plant Sciences CAAS
Original Assignee
Sinovet (beijing) Biotechnology Co ltd
Institute Special Animal and Plant Sciences CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sinovet (beijing) Biotechnology Co ltd, Institute Special Animal and Plant Sciences CAAS filed Critical Sinovet (beijing) Biotechnology Co ltd
Priority to CN201310470178.8A priority Critical patent/CN103498009B/en
Publication of CN103498009A publication Critical patent/CN103498009A/en
Application granted granted Critical
Publication of CN103498009B publication Critical patent/CN103498009B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and a preparation method of the multiplex-PCR detection kit and relates to the field of detection of main viruses of bovine respiratory diseases. The problem that four pathogens of the bovine respiratory disease complex cannot be simultaneously and effectively detected in a multiplex-PCR method for detecting the bovine respiratory disease complex is solved. The kit comprises MightyAmp DNA polymerase, a 2xBuffe Mix buffer solution, sterile double distilled water, and four pairs of specific primers for identifying infectious bovine rhinotracheitis virus, bovine respiratory syncytial virus, bovine viral diarrhea virus and bovine parainfluenza 3 virus respectively, and also comprises positive control plasmids of the four viruses. The kit can simultaneously detect nucleic acids containing the four viruses in the same reaction system, is high in specificity and sensitivity and can accurately detect hosts and pathogenetic animals which suffer from invisible infection or continuously take viruses in the group of cattle, infectivity is avoided, the safety is high, the result can be detected in a short time, and time and labor are saved.

Description

Cattle respiratory disease syndrome multiple PCR detection kit and preparation method thereof
Technical field
The present invention relates to the detection technique field of the main virus of cattle respiratory disease, be specifically related to a kind of cattle respiratory disease syndrome multiple PCR detection kit and preparation method thereof.
Background technology
Along with the fast development of China's foreign trade and cattle-raising, ox systemic disease happens occasionally and endangers serious, research shows, cattle respiratory disease syndrome (Bovine respiratorydisease compLex, be called for short BRDC) be one of Major Systems disease caused due to ox production and transport and early weaning, by multiple virulence factor or cause of disease comprise stress, virus and the acting in conjunction of bacterium cause, therefore the latent infection of virus is the major reason causing this disease, is also the starter causing cattle respiratory disease.In cattle respiratory disease, isolated virus mainly comprises infectious bovine rhinotrachetis virus (IBRV), Bovine Respiratory Syncytial virus (BRSV), bovine viral diarrhea virus (BVDV) and bovine parainfluenza type-3 virus (BPI3), these viruses usually form sustained and infect, and acute infection more easily causes large-area death, once infect, feeder cattle growth and the milk yield of milk cow and the quality of milk will be had a strong impact on.
At present, the serum neutralization test method and multi-joint PCR method that adopt national Specification is detected to cattle respiratory disease is syndromic, because cattle respiratory disease syndrome exists latent infection and long-term toxin expelling, serum neutralization test method complicated operation and wasting time and energy, imported product is expensive, testing cost is also higher, and is confined to laboratory operation, is difficult to realize promotion and application, multi-joint PCR method is efficiently sensitive to the syndromic detection of cattle respiratory disease, economical and convenient, be applicable to applying, multi-joint PCR method is also that conventional detection method has great significance in the diagnosis of disease, be more suitable for the syndromic detection of cattle respiratory disease, but, current multi-joint PCR method detect time mainly for Bovine Respiratory Syncytial virus (BRSV), the PCR detection method that bovine viral diarrhea virus (BVDV) and bovine parainfluenza type-3 virus (BPI3) are set up, because of infectious bovine rhinotrachetis virus (IBRV) genomic singularity, detect the syndromic four kinds of cause of diseases of cattle respiratory disease to same system simultaneously and bring extreme difficulties, and the clinical situation often occurring simultaneously to infect, therefore, in the urgent need to setting up a kind of multiple PCR detection kit that can detect the syndromic four kinds of cause of diseases of cattle respiratory disease simultaneously.
Summary of the invention
In order to solve the problem that effectively cannot detect the syndromic four kinds of cause of diseases of cattle respiratory disease that the syndromic multi-joint PCR method of existing detection cattle respiratory disease exists simultaneously, the invention provides a kind of cattle respiratory disease syndrome multiple PCR detection kit and preparation method thereof.
The technical scheme that the present invention adopts for technical solution problem is as follows:
Cattle respiratory disease syndrome multiple PCR detection kit, this test kit comprises:
MightyAmp archaeal dna polymerase, 2xBuffe Mix damping fluid, aseptic double-distilled water, four pairs of Auele Specific Primers and four positive control plasmid;
Described four pairs of Auele Specific Primers are respectively: the primer P of qualification infectious bovine rhinotrachetis virus 1and P 2, the primer P of qualification Bovine Respiratory Syncytial virus 3and P 4, the primer P of qualification bovine viral diarrhea virus 5and P 6, the primer P of qualification bovine parainfluenza type-3 virus 7and P 8:
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'，
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'，
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'，
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
Described four positive control plasmid are respectively: infectious bovine rhinotrachetis virus positive control plasmid, Bovine Respiratory Syncytial virus positive control plasmid, bovine viral diarrhea virus positive control plasmid and bovine parainfluenza type-3 virus positive control plasmid;
Described infectious bovine rhinotrachetis virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 306 bases is formed, described Bovine Respiratory Syncytial virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 600 bases is formed, described bovine viral diarrhea virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 130 bases is formed, and described bovine parainfluenza type-3 virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 425 bases is formed;
The pMD18-T recombinant plasmid that the pMD18-T recombinant plasmid that the described nucleotide fragments containing 306 bases is formed, the pMD18-T recombinant plasmid of the nucleotide fragments formation containing 600 bases, the pMD18-T recombinant plasmid of nucleotide fragments formation containing 130 bases and the nucleotide fragments containing 425 bases are formed all can be bred in bacillus coli DH 5 alpha competent cell.
The described sequence containing the nucleotide fragments of 306 bases is:
GCTCGCCAACTTCTTTCAGGGCCTGGGCGCCGTCGGGCAGGCGGTGGGCACGGTGGTGCTGGGCGCCGCGGGTGCCGCGCTCTCGACCGTGTCGGGCATCGCCTCGTTTATTGCGAACCCGTTCGGCGCGCTGGCCACGGGGCTGCTGGTGCTCGCCGGGCTGGTGGCCGCTTTCCTGGCGTACCGGTACATTTCCCGCCTCCGCAGCAACCCCATGAAGGCGCTGTACCCGATCACCACGCGCGCGCTCAAGGACGACGCCCGGGGCGCAACCGCCCCGGGCGAGGAAGAGGAGGAGTTTGACGC；
The described sequence containing the nucleotide fragments of 600 bases is:
TATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGT；
The described sequence containing the nucleotide fragments of 130 bases is:
GGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAG；
The described sequence containing the nucleotide fragments of 425 bases is:
GCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTT。
This test kit also comprises negative control, and described negative control is distilled water.
Described infectious bovine rhinotrachetis virus positive control plasmid is prepared by the following method: with the gB gene of infectious bovine rhinotrachetis virus for template, with P 1and P 2for primer carries out pcr amplification, obtain the amplified production that length is 306bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain infectious bovine rhinotrachetis virus positive control plasmid;
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'；
The sequence of the infectious bovine rhinotrachetis virus positive control plasmid obtained is:
ATGCAGTGAATGATTACGATTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGCTCGCCAACTTCTTTCAGGGCCTGGGCGCCGTCGGGCAGGCGGTGGGCACGGTGGTGCTGGGCGCCGCGGGTGCCGCGCTCTCGACCGTGTCGGGCATCGCCTCGTTTATTGCGAACCCGTTCGGCGCGCTGGCCACGGGGCTGCTGGTGCTCGCCGGGCTGGTGGCCGCTTTCCTGGCGTACCGGTACATTTCCCGCCTCCGCAGCAACCCCATGAAGGCGCTGTACCCGATCACCACGCGCGCGCTCAAGGACGACGCCCGGGGCGCAACCGCCCCGGGCGAGGAAGAGGAGGAGTTTGACGCAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTT。
Described Bovine Respiratory Syncytial virus positive control plasmid is prepared by the following method: with the NP gene of Bovine Respiratory Syncytial virus for template, with P 3and P 4for primer carries out pcr amplification, obtain the amplified production that length is 600bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain Bovine Respiratory Syncytial virus positive control plasmid;
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'；
The sequence of the Bovine Respiratory Syncytial virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTTATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGGC。
Described bovine viral diarrhea virus positive control plasmid is prepared by the following method: with the 5'-UTR gene of bovine viral diarrhea virus for template, with P 5and P 6for primer carries out pcr amplification, obtain the amplified production that length is 130bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine viral diarrhea virus positive control plasmid;
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'；
The sequence of the bovine viral diarrhea virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGAATCGTCGACCTGCAGGCAT。
Described bovine parainfluenza type-3 virus positive control plasmid is prepared by the following method: with the NP gene of bovine parainfluenza type-3 virus for template, with P 7and P 8for primer carries out pcr amplification, obtain the amplified production that length is 425bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine parainfluenza type-3 virus positive control plasmid;
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
The sequence of the bovine parainfluenza type-3 virus positive control plasmid obtained is:
ATGCAGTGAATGATTACGATTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGG。
The preparation method of cattle respiratory disease syndrome multiple PCR detection kit, condition and the step of the method are as follows:
(1) PCR reaction solution is prepared: described PCR reaction solution comprises MightyAmp archaeal dna polymerase, 2xBuffer Mix damping fluid, aseptic double-distilled water and four pairs of Auele Specific Primers;
Described four pairs of Auele Specific Primers are respectively: the primer P of qualification infectious bovine rhinotrachetis virus 1and P 2, the primer P of qualification Bovine Respiratory Syncytial virus 3and P 4, the primer P of qualification bovine viral diarrhea virus 5and P 6, the primer P of qualification bovine parainfluenza type-3 virus 7and P 8:
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'，
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'，
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'，
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
(2) four positive control plasmid are set up:
Described four positive control plasmid are respectively: infectious bovine rhinotrachetis virus positive control plasmid, Bovine Respiratory Syncytial virus positive control plasmid, bovine viral diarrhea virus positive control plasmid and bovine parainfluenza type-3 virus positive control plasmid;
Described infectious bovine rhinotrachetis virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 306 bases is formed, described Bovine Respiratory Syncytial virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 600 bases is formed, described bovine viral diarrhea virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 130 bases is formed, and described bovine parainfluenza type-3 virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 425 bases is formed;
The pMD18-T recombinant plasmid that the pMD18-T recombinant plasmid that the described nucleotide fragments containing 306 bases is formed, the pMD18-T recombinant plasmid of the nucleotide fragments formation containing 600 bases, the pMD18-T recombinant plasmid of nucleotide fragments formation containing 130 bases and the nucleotide fragments containing 425 bases are formed all can be bred in bacillus coli DH 5 alpha competent cell;
(3) negative control: described negative control is distilled water.
The described sequence containing the nucleotide fragments of 306 bases is:
GCTCGCCAACTTCTTTCAGGGCCTGGGCGCCGTCGGGCAGGCGGTGGGCACGGTGGTGCTGGGCGCCGCGGGTGCCGCGCTCTCGACCGTGTCGGGCATCGCCTCGTTTATTGCGAACCCGTTCGGCGCGCTGGCCACGGGGCTGCTGGTGCTCGCCGGGCTGGTGGCCGCTTTCCTGGCGTACCGGTACATTTCCCGCCTCCGCAGCAACCCCATGAAGGCGCTGTACCCGATCACCACGCGCGCGCTCAAGGACGACGCCCGGGGCGCAACCGCCCCGGGCGAGGAAGAGGAGGAGTTTGACGC；
The described sequence containing the nucleotide fragments of 600 bases is:
TATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGT；
The described sequence containing the nucleotide fragments of 130 bases is:
GGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAG；
The described sequence containing the nucleotide fragments of 425 bases is:
GCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTT。
Described Bovine Respiratory Syncytial virus positive control plasmid is prepared by the following method: with the NP gene of Bovine Respiratory Syncytial virus for template, with P 3and P 4for primer carries out pcr amplification, obtain the amplified production that length is 600bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain Bovine Respiratory Syncytial virus positive control plasmid;
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'；
The sequence of the Bovine Respiratory Syncytial virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTTATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGGC；
Described bovine viral diarrhea virus positive control plasmid is prepared by the following method: with the 5'-UTR gene of bovine viral diarrhea virus for template, with P 5and P 6for primer carries out pcr amplification, obtain the amplified production that length is 130bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine viral diarrhea virus positive control plasmid;
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'；
The sequence of the bovine viral diarrhea virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGAATCGTCGACCTGCAGGCAT；
Described bovine parainfluenza type-3 virus positive control plasmid is prepared by the following method: with the NP gene of bovine parainfluenza type-3 virus for template, with NP 1and NP 2for primer carries out pcr amplification, obtain the amplified production that length is 425bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine parainfluenza type-3 virus positive control plasmid;
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
The sequence of the bovine parainfluenza type-3 virus positive control plasmid obtained is:
ATGCAGTGAATGATTACGATTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGG。
The invention has the beneficial effects as follows:
1, four pairs of Auele Specific Primers are designed according to virus genomic conserved genetic sequences, obtain detecting the syndromic multiple PCR detection kit of cattle respiratory disease by assembling, compared with prior art, multiple PCR detection kit of the present invention can detect whether contain infectious bovine rhinotrachetis virus (IBRV) in same reaction system simultaneously, Bovine Respiratory Syncytial virus (BRSV), bovine viral diarrhea virus (BVDV) and bovine parainfluenza type-3 virus (BPI3) nucleic acid, there is higher specificity and susceptibility, there is features such as detecting simultaneously and differentiate four kinds of modal respiratory viral diseases of ox, can infect stealthy in cows or continue to be with malicious host and affected animal accurately to detect,
2, multiple PCR detection kit of the present invention can carry out rapid detection to the infectious bovine rhinotrachetis virus (IBRV) of the several samples such as cell culture, juice, tissue culture, nose swab and excrement swab, Bovine Respiratory Syncytial virus (BRSV), bovine viral diarrhea virus (BVDV) and bovine parainfluenza type-3 virus (BPI3), sample is applied widely, the reagent that test kit provides is without infectious, lifeless matter potential safety hazard composition, and safety in utilization is very high;
3, multiple PCR detection kit of the present invention can provide in 7 hours and carries out qualitative detection result receiving sample, time saving and energy saving, is a kind of effective tool detecting cattle respiratory disease syndrome and infect.
Accompanying drawing explanation
Fig. 1 is the specific detection electrophorogram of multiple PCR detection kit of the present invention;
In figure: 1 is DL2000DNAMARker, 2 is multiplex PCR result, 3 is the detected result of IBRV positive control recombinant plasmid, and 4 is IBRV negative control, and 5 is the detected result of BRSV positive control recombinant plasmid, 6 is BRSV negative control, 7 is the detected result of BVDV positive control recombinant plasmid, and 8 is BVDV negative control, and 9 is the detected result of BPI3 positive control recombinant plasmid, 10 is BPI3 negative control, and 11 is negative control (distilled water).
Fig. 2 is the specific detection electrophorogram of multiple PCR detection kit of the present invention;
In figure: M is DL2000DNA MARker, 1 is the primer P adding qualification bovine parainfluenza type-3 virus (BPI3) with the mixture of IBRV, BRSV and BVDV positive control recombinant plasmid 7and P 8detected result and with the mixture of BRSV, BVDV and BPI3 positive control recombinant plasmid for template add qualification infectious bovine rhinotrachetis virus (IBRV) primer P 1and P 2detected result, 2 be with the mixture of IBRV, BVDV and BPI3 positive control recombinant plasmid add qualification Bovine Respiratory Syncytial virus (BRSV) primer P 3and P 4detected result and with the mixture of IBRV, BRSV and BPI3 positive control recombinant plasmid add qualification bovine viral diarrhea virus (BVDV) primer P 5and P 6detected result, 3 is the detected result that is template with the mixture of IBRV, BRSV, BVDV and BPI3 positive control recombinant plasmid, and 4 is negative control (distilled water).
Fig. 3 is the sensitivity Detection electrophorogram of multiple PCR detection kit of the present invention;
In figure: the detectable level of IBRV positive control recombinant plasmid is 10ng/ μ L ~ 1.0pg/ μ L, the detectable level of BRSV positive control recombinant plasmid is 10ng/ μ L ~ 100pg/ μ L, the detectable level of BVDV positive control recombinant plasmid is 10ng/ μ L ~ 10pg/ μ L, and the detectable level of BPI3 positive control recombinant plasmid is 10ng/ μ L ~ 10pg/ μ L.
Fig. 4 is that the IBRV viral sample of multiple PCR detection kit of the present invention detects electrophorogram;
In figure: 1 is negative control, 2 is the detected result of IBRV virus, and 3 is DL2000DNAMARker.
Fig. 5 is that the BRSV of multiple PCR detection kit of the present invention is viral, BVDV is viral and BPI3 viral sample detects electrophorogram;
In figure: 1 is DL2000DNA MARker, 2 is the detected result of BRSV virus, and 3 is the detected result of BVDV virus, and 4 is the detected result of BPI3 virus, and 5 is negative control.
Fig. 6 is the clinical viral sample detection electrophorogram of multiple PCR detection kit of the present invention;
In figure: M is DL2000DNA MARker, 1 is the detected result of IBRV virus, and 2 is the weak positive findings of IBRV Viral diagnosis, 3 is the detected result of BRSV virus, 4 is that clinical sample detects negative findings, and 5 is the detected result of BVDV virus, and 6 is negative control (distilled water).
Fig. 7 is the clinical viral sample detection electrophorogram of multiple PCR detection kit of the present invention;
In figure: M is DL2000DNA MARker, 1 is negative control (distilled water), and 2 is IBRV virus and BPI3 virus mixed infection detected result, and 3 is the weak positive findings of IBRV Viral diagnosis.
Embodiment
Experiment material:
Infectious bovine rhinotrachetis virus (IBRV) virus strain, bovine viral diarrhea virus (BVDV) virus strain, bovine parainfluenza type-3 virus (BPI3) virus strain and bacillus coli DH 5 alpha competent cell are preserved by Gao Yun;
Bovine Respiratory Syncytial virus (BRSV) is so kind as to give by magnificent Witter (Beijing) Bioisystech Co., Ltd;
M-MLv ThermoScript II, MightyAmpDNA polysaccharase, DL2000DNA MARker and pMD18-T carrier are all purchased from precious biotechnology (Dalian) company limited;
Glue reclaims test kit purchased from Shanghai Hua Shun Bioisystech Co., Ltd;
Viral RNA extracts reagent and viral DNA extracts reagent all purchased from invitrogen company.
The assembling of embodiment 1 cattle respiratory disease syndrome of the present invention multiple PCR detection kit
(1) PCR reaction solution is prepared:
1. design four pairs of Auele Specific Primers according to virus genomic conserved genetic sequences, be respectively the primer P of qualification infectious bovine rhinotrachetis virus (IBRV) 1and P 2, the primer P of qualification Bovine Respiratory Syncytial virus (BRSV) 3and P 4, the primer P of qualification bovine viral diarrhea virus (BVDV) 5and P 6and the primer P of qualification bovine parainfluenza type-3 virus (BPI3) 7and P 8; The sequence of these eight primers is as follows:
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'，
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'，
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'，
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
2. the preparation of PCR reaction solution: PCR reaction solution by MightyAmp archaeal dna polymerase, 2xBuffer Mix damping fluid, aseptic double-distilled water and above-mentioned 1. in four pairs of Auele Specific Primers form.
(2) structure of positive control recombinant plasmid
1. infectious bovine rhinotrachetis virus (IBRV) positive control plasmid is prepared: utilize MDBK cell proliferation infectious bovine rhinotrachetis virus, extract reagent with reference to viral DNA after cultivating 40h and extract infectious bovine rhinotrachetis virus genomic dna, to extract the gB gene of product and infectious bovine rhinotrachetis virus for template, with 5'-GCTCGCCAACTTCTTTCAGGG-3'(P 1) and 5'-GCGTCAAACTCCTCCTCTTCCTC-3'(P 2) for primer carries out pcr amplification, obtain the amplified production (IBRV306bp object fragment) that length is 306bp, PCR reaction conditions is: 98 DEG C of 2min; 98 DEG C of 10s, 57 DEG C of 15s, 68 DEG C of 1min, 35 circulations; 68 DEG C of total elongation 10min, by amplified production reclaim and purifying rear clone to pMD18-T carrier, utilize pMD18-T vector construction IBRV positive control recombinant plasmid, finally obtain infectious bovine rhinotrachetis virus positive control plasmid, deliver to invitrogen company and check order;
2. Bovine Respiratory Syncytial virus (BRSV) positive control plasmid is prepared: utilize MDBK cell proliferation Bovine Respiratory Syncytial virus, with reference to reverse transcription after viral RNA extraction reagent extraction Bovine Respiratory Syncytial viral RNA after cultivation 40h, with the NP gene of reverse transcription product and Bovine Respiratory Syncytial virus for template, with 5'-TATGCTATGTCCCGATTGG-3'(P 3) and 5'-ACTGATTTGGCTAGTACACCC-3'(P 4) for primer carries out pcr amplification, obtain the amplified production (BRSV600bp object fragment) that length is 600bp, PCR reaction conditions is: 98 DEG C of 2min; 98 DEG C of 10s, 57 DEG C of 15s, 68 DEG C of 1min, 35 circulations; 68 DEG C of total elongation 10min, by amplified production reclaim and purifying rear clone to pMD18-T carrier, utilize pMD18-T vector construction BRSV positive control recombinant plasmid, finally obtain Bovine Respiratory Syncytial virus positive control plasmid, deliver to invitrogen company and check order;
3. bovine viral diarrhea virus (BVDV) positive control plasmid is prepared: utilize MDBK cell proliferation bovine viral diarrhea virus, with reference to reverse transcription after viral RNA extraction reagent extraction bovine viral diarrhea virus RNA after cultivation 40h, with the 5'-UTR gene of reverse transcription product and bovine viral diarrhea virus for template, with 5'-GGTAGCAACAGTGGTGAGTTC-3'(P 5) and 5'-CTCAGGTTAAGATGTGCTGTG-3'(P 6) for primer carries out pcr amplification, obtain the amplified production (BVDV130bp object fragment) that length is 130bp, PCR reaction conditions is: 98 DEG C of 2min; 98 DEG C of 10s, 57 DEG C of 15s, 68 DEG C of 1min, 35 circulations; 68 DEG C of total elongation 10min, by amplified production reclaim and purifying rear clone to pMD18-T carrier, utilize pMD18-T vector construction BVDV positive control recombinant plasmid, finally obtain bovine viral diarrhea virus positive control plasmid, deliver to invitrogen company and check order;
4. bovine parainfluenza type-3 virus (BPI3) positive control plasmid is prepared: utilize MDBK cell proliferation bovine parainfluenza type-3 virus, with reference to reverse transcription after viral RNA extraction reagent extraction bovine parainfluenza type-3 virus RNA after cultivation 40h, with the NP gene of reverse transcription product and bovine parainfluenza type-3 virus for template, with 5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'(P 7) and 5'-AACCCCTTCCTCAATCCTGATATAC-3'(P 8) for primer carries out pcr amplification, obtain the amplified production (BPI3425bp object fragment) that length is 425bp, PCR reaction conditions is: 98 DEG C of 2min; 98 DEG C of 10s, 57 DEG C of 15s, 68 DEG C of 1min, 35 circulations; 68 DEG C of total elongation 10min, by amplified production reclaim and purifying rear clone to pMD18-T carrier, utilize pMD18-T vector construction BPI3 positive control recombinant plasmid, finally obtain bovine parainfluenza type-3 virus positive control plasmid, deliver to invitrogen company and check order;
5. positive control recombinant plasmid set up result: above-mentioned four positive control recombinant plasmids are after order-checking, and carry out nucleic acid comparison and find that the nucleic acid homology of genes involved reaches more than 99%, this shows that obtained positive control recombinant plasmid is positive plasmid.
(3) negative control is set: negative control is distilled water.
The using method of embodiment 2 cattle respiratory disease syndrome of the present invention multiple PCR detection kit
(1) to sample extraction sample DNA to be detected, sample to be detected comprises cell culture, juice, tissue culture, nose swab and excrement swab etc.;
(2) determination of multi-PRC reaction condition
Through the optimization of the condition to reaction density and annealing temperature, determine in 25 μ L reaction systems, MightyAmp archaeal dna polymerase 0.625U, 2xBuffer Mix damping fluid 12.5 μ L, primer P 1, P 2, P 3, P 4, P 5, P 6, P 7, P 8each 0.5 μ L(10pmol), sample 2.0 μ L to be detected, remaining complements to 25 μ L by aseptic double-distilled water, and PCR reaction conditions is: 98 DEG C of 2min; 98 DEG C of 10s, 57 DEG C of 15s, 68 DEG C of 1min, 35 circulations; 68 DEG C of total elongation 10min;
(3) with the sample DNA extracted for template, sample DNA, positive control plasmid, negative control are joined respectively in the pipe containing MightyAmp archaeal dna polymerase, 2xBuffer Mix damping fluid, aseptic double-distilled water and four pairs of Auele Specific Primers, 98 DEG C of 2min; 98 DEG C of 10s, 57 DEG C of 15s, 68 DEG C of 1min, 35 circulations; 68 DEG C of total elongation 10min,
(4) get 5 μ LPCR products, detect with 1.5% agarose gel electrophoresis;
(5) result of determination: if increased 306bp fragment from sample to be detected, then contain infectious bovine rhinotrachetis virus in this sample to be detected; If increased 600bp fragment from sample to be detected, then viral containing Bovine Respiratory Syncytial in this sample to be detected; If increased 130bp fragment from sample to be detected, then contain bovine viral diarrhea virus in this sample to be detected; If increased 425bp fragment from sample to be detected, then contain bovine parainfluenza type-3 virus in this sample to be detected; If two, three or four target sizes bands detected simultaneously, then the virus simultaneously containing this object representations in this sample to be detected.
The specificity experiments of embodiment 3 multiple PCR detection kit of the present invention
1. respectively with IBRV, BRSV, BVDV and BPI3 positive control recombinant plasmid and negative control (distilled water) for template, carry out the specificity experiments of multiple PCR detection kit;
2. the primer P of qualification bovine parainfluenza type-3 virus (BPI3) is added with the mixture of IBRV, BRSV and BVDV positive control recombinant plasmid 7and P 8, its hybrid template is carried out to the specificity experiments of multiple PCR detection kit;
3. the primer P of qualification bovine viral diarrhea virus (BVDV) is added with the mixture of IBRV, BRSV and BPI3 positive control recombinant plasmid 5and P 6, its hybrid template is carried out to the specificity experiments of multiple PCR detection kit;
4. the primer P of qualification Bovine Respiratory Syncytial virus (BRSV) is added with the mixture of IBRV, BVDV and BPI3 positive control recombinant plasmid 3and P 4, its hybrid template is carried out to the specificity experiments of multiple PCR detection kit;
5. with the mixture of BRSV, BVDV and BPI3 positive control recombinant plasmid for template add qualification infectious bovine rhinotrachetis virus (IBRV) primer P 1and P 2, its hybrid template is carried out to the specificity experiments of multiple PCR detection kit;
6. with the mixture of IBRV, BRSV, BVDV and BPI3 positive control recombinant plasmid for template, carry out the specificity experiments of multiple PCR detection kit.
Experimental result: as shown in Figure 1, respectively with IBRV, BRSV, BVDV and BPI3 positive control recombinant plasmid for there is 306bp, 600bp, 130bp and 425bp band of its correspondence in template, all negative controls all do not amplify any band; As shown in Figure 2, three kinds of mixed samples add non-specific primer and then occur the band that Auele Specific Primer is corresponding, and negative control (distilled water) does not then amplify any band.
The sensitivity experiments of embodiment 4 multiple PCR detection kit of the present invention
Respectively with IBRV, BRSV, BVDV and BPI3 positive control recombinant plasmid of different concns for template, carry out the sensitivity experiments of multiple PCR detection kit, wherein, the detectable level of IBRV positive control recombinant plasmid is 10ng/ μ L ~ 1.0pg/ μ L, the detectable level of BRSV positive control recombinant plasmid is 10ng/ μ L ~ 100pg/ μ L, the detectable level of BVDV positive control recombinant plasmid is 10ng/ μ L ~ 10pg/ μ L, and the detectable level of BPI3 positive control recombinant plasmid is 10ng/ μ L ~ 10pg/ μ L.
Experimental result: as shown in Figure 3, the minimal detectable concentration of IBRV positive control recombinant plasmid is 1.0pg/ μ L, the lowest detection result of BRSV positive control recombinant plasmid is 100pg/ μ L, BVDV positive control recombinant plasmid lowest detection result is 10pg/ μ L, and the lowest detection result of BPI3 positive control recombinant plasmid is 10pg/ μ L.
Embodiment 5 utilizes multiple PCR detection kit of the present invention to detect clinical viral sample
(1) viral nucleic acid template (extraction of viral RNA and viral DNA) is prepared
Extract reagent with reference to viral RNA and extract the total serum IgE of clinical sample, and utilize M-MLV ThermoScript II to carry out reverse transcription, extract its cDNA as the viral pcr template of BVDV, BRSV and BPI3 these three, extract the DNA of clinical sample, as IBRV template.
(2) multi-PRC reaction
With the RNA reverse transcription product of the DNA extraction thing of IBRV virus and BRSV, BVDV, BPI3 Viral extraction for template, join respectively and comprise in the multi-PRC reaction system of mix primer, adopt multiplex PCR optimum reaction condition to detect viral template.
(3) detected result
As shown in Figure 4, Figure 5 and Figure 6, IBRV is viral, BRSV is viral and viral 306bp, 600bp and 130bp band occurring its correspondence respectively of BVDV, has sample IBRV virus in the weak positive; As shown in Figure 7, clinical sample detects ibr virus and BPI3 virus mixed infection and BPI3 simple infection.
Obviously, above-described embodiment is only for clearly example being described, and the restriction not to embodiment; For person of an ordinary skill in the technical field, can also make other changes in different forms on the basis of the above description; Here exhaustive without the need to also giving all embodiments; And thus the apparent change of extending out or variation be still among the protection domain of the invention.

Claims (6)

1. cattle respiratory disease syndrome multiple PCR detection kit, is characterized in that, this test kit comprises:
MightyAmp archaeal dna polymerase, 2xBuffer Mix damping fluid, aseptic double-distilled water, four pairs of Auele Specific Primers and four positive control plasmid;
Described four pairs of Auele Specific Primers are respectively: the primer P of qualification infectious bovine rhinotrachetis virus 1and P 2, the primer P of qualification Bovine Respiratory Syncytial virus 3and P 4, the primer P of qualification bovine viral diarrhea virus 5and P 6, the primer P of qualification bovine parainfluenza type-3 virus 7and P 8:
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'，
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'，
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'，
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
Described four positive control plasmid are respectively: infectious bovine rhinotrachetis virus positive control plasmid, Bovine Respiratory Syncytial virus positive control plasmid, bovine viral diarrhea virus positive control plasmid and bovine parainfluenza type-3 virus positive control plasmid;
Described infectious bovine rhinotrachetis virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 306 bases is formed, described Bovine Respiratory Syncytial virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 600 bases is formed, described bovine viral diarrhea virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 130 bases is formed, and described bovine parainfluenza type-3 virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 425 bases is formed;
The pMD18-T recombinant plasmid that the pMD18-T recombinant plasmid that the described nucleotide fragments containing 306 bases is formed, the pMD18-T recombinant plasmid of the nucleotide fragments formation containing 600 bases, the pMD18-T recombinant plasmid of nucleotide fragments formation containing 130 bases and the nucleotide fragments containing 425 bases are formed all can be bred in bacillus coli DH 5 alpha competent cell;
Described infectious bovine rhinotrachetis virus positive control plasmid is prepared by the following method: with the gB gene of infectious bovine rhinotrachetis virus for template, with P 1and P 2for primer carries out pcr amplification, obtain the amplified production that length is 306bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain infectious bovine rhinotrachetis virus positive control plasmid;
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'；
The sequence of the infectious bovine rhinotrachetis virus positive control plasmid obtained is:
ATGCAGTGAATGATTACGATTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGCTCGCCAACTTCTTTCAGGGCCTGGGCGCCGTCGGGCAGGCGGTGGGCACGGTGGTGCTGGGCGCCGCGGGTGCCGCGCTCTCGACCGTGTCGGGCATCGCCTCGTTTATTGCGAACCCGTTCGGCGCGCTGGCCACGGGGCTGCTGGTGCTCGCCGGGCTGGTGGCCGCTTTCCTGGCGTACCGGTACATTTCCCGCCTCCGCAGCAACCCCATGAAGGCGCTGTACCCGATCACCACGCGCGCGCTCAAGGACGACGCCCGGGGCGCAACCGCCCCGGGCGAGGAAGAGGAGGAGTTTGACGCAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTT；
Described Bovine Respiratory Syncytial virus positive control plasmid is prepared by the following method: with the NP gene of Bovine Respiratory Syncytial virus for template, with P 3and P 4for primer carries out pcr amplification, obtain the amplified production that length is 600bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain Bovine Respiratory Syncytial virus positive control plasmid;
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'；
The sequence of the Bovine Respiratory Syncytial virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTTATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGGC；
Described bovine viral diarrhea virus positive control plasmid is prepared by the following method: with the 5'-UTR gene of bovine viral diarrhea virus for template, with P 5and P 6for primer carries out pcr amplification, obtain the amplified production that length is 130bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine viral diarrhea virus positive control plasmid;
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'；
The sequence of the bovine viral diarrhea virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGAATCGTCGACCTGCAGGCAT；
Described bovine parainfluenza type-3 virus positive control plasmid is prepared by the following method: with the NP gene of bovine parainfluenza type-3 virus for template, with P 7and P 8for primer carries out pcr amplification, obtain the amplified production that length is 425bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine parainfluenza type-3 virus positive control plasmid;
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
The sequence of the bovine parainfluenza type-3 virus positive control plasmid obtained is:
ATGCAGTGAATGATTACGATTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGG。
2. cattle respiratory disease syndrome multiple PCR detection kit according to claim 1, is characterized in that, the described sequence containing the nucleotide fragments of 306 bases is:
GCTCGCCAACTTCTTTCAGGGCCTGGGCGCCGTCGGGCAGGCGGTGGGCACGGTGGTGCTGGGCGCCGCGGGTGCCGCGCTCTCGACCGTGTCGGGCATCGCCTCGTTTATTGCGAACCCGTTCGGCGCGCTGGCCACGGGGCTGCTGGTGCTCGCCGGGCTGGTGGCCGCTTTCCTGGCGTACCGGTACATTTCCCGCCTCCGCAGCAACCCCATGAAGGCGCTGTACCCGATCACCACGCGCGCGCTCAAGGACGACGCCCGGGGCGCAACCGCCCCGGGCGAGGAAGAGGAGGAGTTTGACGC；
The described sequence containing the nucleotide fragments of 600 bases is:
TATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGT；
The described sequence containing the nucleotide fragments of 130 bases is:
GGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAG；
The described sequence containing the nucleotide fragments of 425 bases is:
GCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTT。
3. cattle respiratory disease syndrome multiple PCR detection kit according to claim 1, it is characterized in that, this test kit also comprises negative control, and described negative control is distilled water.
4. prepare the method for cattle respiratory disease syndrome multiple PCR detection kit according to claim 1, it is characterized in that, condition and the step of the method are as follows:
(1) PCR reaction solution is prepared: described PCR reaction solution comprises MightyAmp archaeal dna polymerase, 2xBuffer Mix damping fluid, aseptic double-distilled water and four pairs of Auele Specific Primers;
Described four pairs of Auele Specific Primers are respectively: the primer P of qualification infectious bovine rhinotrachetis virus 1and P 2, the primer P of qualification Bovine Respiratory Syncytial virus 3and P 4, the primer P of qualification bovine viral diarrhea virus 5and P 6, the primer P of qualification bovine parainfluenza type-3 virus 7and P 8:
P 1：5'-GCTCGCCAACTTCTTTCAGGG-3'，
P 2：5'-GCGTCAAACTCCTCCTCTTCCTC-3'，
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'，
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'，
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
(2) four positive control plasmid are set up:
Described four positive control plasmid are respectively: infectious bovine rhinotrachetis virus positive control plasmid, Bovine Respiratory Syncytial virus positive control plasmid, bovine viral diarrhea virus positive control plasmid and bovine parainfluenza type-3 virus positive control plasmid;
Described infectious bovine rhinotrachetis virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 306 bases is formed, described Bovine Respiratory Syncytial virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 600 bases is formed, described bovine viral diarrhea virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 130 bases is formed, and described bovine parainfluenza type-3 virus positive control plasmid is the pMD18-T recombinant plasmid that the nucleotide fragments containing 425 bases is formed;
The pMD18-T recombinant plasmid that the pMD18-T recombinant plasmid that the described nucleotide fragments containing 306 bases is formed, the pMD18-T recombinant plasmid of the nucleotide fragments formation containing 600 bases, the pMD18-T recombinant plasmid of nucleotide fragments formation containing 130 bases and the nucleotide fragments containing 425 bases are formed all can be bred in bacillus coli DH 5 alpha competent cell;
(3) negative control: described negative control is distilled water.
5. the preparation method of cattle respiratory disease syndrome multiple PCR detection kit according to claim 4, is characterized in that, the described sequence containing the nucleotide fragments of 306 bases is:
GCTCGCCAACTTCTTTCAGGGCCTGGGCGCCGTCGGGCAGGCGGTGGGCACGGTGGTGCTGGGCGCCGCGGGTGCCGCGCTCTCGACCGTGTCGGGCATCGCCTCGTTTATTGCGAACCCGTTCGGCGCGCTGGCCACGGGGCTGCTGGTGCTCGCCGGGCTGGTGGCCGCTTTCCTGGCGTACCGGTACATTTCCCGCCTCCGCAGCAACCCCATGAAGGCGCTGTACCCGATCACCACGCGCGCGCTCAAGGACGACGCCCGGGGCGCAACCGCCCCGGGCGAGGAAGAGGAGGAGTTTGACGC；
The described sequence containing the nucleotide fragments of 600 bases is:
TATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGT；
The described sequence containing the nucleotide fragments of 130 bases is:
GGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAG；
The described sequence containing the nucleotide fragments of 425 bases is:
GCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTT。
6. the preparation method of cattle respiratory disease syndrome multiple PCR detection kit according to claim 4, it is characterized in that, described Bovine Respiratory Syncytial virus positive control plasmid is prepared by the following method: with the NP gene of Bovine Respiratory Syncytial virus for template, with P 3and P 4for primer carries out pcr amplification, obtain the amplified production that length is 600bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain Bovine Respiratory Syncytial virus positive control plasmid;
P 3：5'-TATGCTATGTCCCGATTGG-3'，
P 4：5'-ACTGATTTGGCTAGTACACCC-3'；
The sequence of the Bovine Respiratory Syncytial virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTTATGCTATGTCCCGATTGGGGAGAGAAGATACCCTTAAAATACTCAAAGATGCAGGCTACCAAGTGAGGGCCAATGGGGTTGATGTGATAACACATCGACAGGATGTGAATGGAAAAGAAATGAAATTTGAAGTGCTAACATTAGTCAGCTTAACATCAGAAGTTCAAGGTAATATAGAAATAGAGTCAAGGAAGTCTTACAAAAAGATGCTAAAAGAGATGGGAGAGGTAGCTCCAGAATACAGACATGACTTTCCTGATTGTGGTATGATAGTGCTATGTGTTGCTGCTTTGGTTATAACAAAATTAGCAGCAGGTGATAGGTCAGGCCTCACTGCAGTCATTAGGAGAGCCAACAATGTACTAAGGAATGAAATGAAACGATACAAAGGACTCATCCCGAAAGATATAGCCAACAGCTTCTATGAAGTATTTGAAAAGTACCCTCATTACATAGATGTATTCGTACATTTTGGCATTGCTCAATCCTCAACTAGAGGAGGTAGTAGGGTAGAAGGAATCTTTGCAGGGTTATTCATGAATGCATATGGAGCAGGTCAAGTGATGTTAAGATGGGGTGTGCTAGCCAAATCAGTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGGC；
Described bovine viral diarrhea virus positive control plasmid is prepared by the following method: with the 5'-UTR gene of bovine viral diarrhea virus for template, with P 5and P 6for primer carries out pcr amplification, obtain the amplified production that length is 130bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine viral diarrhea virus positive control plasmid;
P 5：5'-GGTAGCAACAGTGGTGAGTTC-3'，
P 6：5'-CTCAGGTTAAGATGTGCTGTG-3'；
The sequence of the bovine viral diarrhea virus positive control plasmid obtained is:
TTACGTGCATTCGATTTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGGTAGCAACAGTGGTGAGTTCGTTGGAAGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTCGGAGGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGAATCGTCGACCTGCAGGCAT；
Described bovine parainfluenza type-3 virus positive control plasmid is prepared by the following method: with the NP gene of bovine parainfluenza type-3 virus for template, with NP 1and NP 2for primer carries out pcr amplification, obtain the amplified production that length is 425bp, amplified production is reclaimed also purifying rear clone and, to pMD18-T carrier, obtain bovine parainfluenza type-3 virus positive control plasmid;
P 7：5'-GCTCTTCTCTTTTTGTCCCATTCTT-3'，
P 8：5'-AACCCCTTCCTCAATCCTGATATAC-3'；
The sequence of the bovine parainfluenza type-3 virus positive control plasmid obtained is:
ATGCAGTGAATGATTACGATTCGAGCTCGGTACCCGGGGATCCTCTAGAGATTGCTCTTCTCTTTTTGTCCCATTCTTTGGACAACGAAAAGCAACATGCACAACGAGCCGGATTTCTAGTCTCTCTGTTATCAATGGCCTATGCCAACCCAGAATTGTATTTAACATCAAATGGTAGTAATGCAGATGTTAAGTATGTCATCTACATGATAGAGAAAGACCCAGGAAGACAAAAATATGGTGGGTTAGTAGTCAAGACTAGAGAGATGGTTTATGAAAAGACAACCGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGATAATATGTTGCAAAATGGTAGAGGCACTTCTACAATTGAGGATCTTGTTCATACTTTTGGGTATCCATCATGTCTTGGAGCTCTAATAATCCAGATTTGGATAATACTTGTCAAGGCTATAACCAGTATATCAGGATTGAGGAAGGGGTTAATCGTCGACCTGCAGGCATGCAAGCTTGGCACTGG。
CN201310470178.8A 2013-10-10 2013-10-10 Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof Expired - Fee Related CN103498009B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310470178.8A CN103498009B (en) 2013-10-10 2013-10-10 Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310470178.8A CN103498009B (en) 2013-10-10 2013-10-10 Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof

Publications (2)

Publication Number Publication Date
CN103498009A CN103498009A (en) 2014-01-08
CN103498009B true CN103498009B (en) 2015-01-21

Family

ID=49863269

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310470178.8A Expired - Fee Related CN103498009B (en) 2013-10-10 2013-10-10 Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof

Country Status (1)

Country Link
CN (1) CN103498009B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2768753C2 (en) * 2020-07-22 2022-03-24 Федеральное государственное бюджетное учреждение науки Сибирский федеральный научный центр агробиотехнологий Российской академии наук (СФНЦА РАН) Set of synthetic oligonucleotide primers and probes for detecting bovine respiratory syncytial infection virus and bovine gapdh gene and method for detecting rna of respiratory syncytial infection virus in cattle

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2587323C1 (en) * 2015-01-26 2016-06-20 Федеральное государственное бюджетное научное учреждение "Прикаспийский зональный научно-исследовательский ветеринарный институт" (ФГБНУ "Прикаспийский зональный НИВИ" ФАНО России") Method of producing hyperimmune serum against cattle parainfluenza-3
CN104726614A (en) * 2015-03-31 2015-06-24 河南牧业经济学院 Detection primer, kit and detection method of infectious bovine rhinotracheitis virus
CN104862419B (en) * 2015-06-01 2018-05-01 山东省农业科学院奶牛研究中心 A kind of primer, probe and kit for detecting infectious bovine rhinotrachetis virus
CN105132590B (en) * 2015-10-15 2022-02-08 上海市农业科学院 LAMP visual detection method of infectious bovine rhinotracheitis virus
CN107058619A (en) * 2017-03-10 2017-08-18 中国农业科学院特产研究所 Bovine Respiratory Syncytial virus nano PCR detection kits and preparation method thereof
CN107058620A (en) * 2017-03-10 2017-08-18 中国农业科学院特产研究所 Infectious bovine rhinotrachetis virus nano PCR detection kits and preparation method thereof
CN106906307A (en) * 2017-03-10 2017-06-30 中国农业科学院特产研究所 The type of bovine parainfluenza virus 3 virus nano PCR detection kits and preparation method thereof
CN107058618A (en) * 2017-03-10 2017-08-18 中国农业科学院特产研究所 Bovine viral diarrhea virus nano PCR detection kits and preparation method thereof
CN107012260A (en) * 2017-05-08 2017-08-04 河南科技大学 Neospora, Brucella and infectious bovine rhinotrachetis virus multiplex-nested PCR detection primer, kit and detection method
CN107881259A (en) * 2017-11-15 2018-04-06 广西壮族自治区兽医研究所 A kind of pcr amplification primer thing of quick detection infectious bovine rhinotrachetis virus and its application
CN109355431A (en) * 2018-11-20 2019-02-19 金宇保灵生物药品有限公司 The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously
CN110669873B (en) * 2019-11-14 2022-11-25 贵州大学 Detection method for rapidly detecting six-cow respiratory syndrome multiple PCR system
CN112593013B (en) * 2020-12-29 2022-07-05 西北农林科技大学 Double RPA detection kit for bovine parainfluenza virus and bovine respiratory syncytial virus
CN113136455A (en) * 2021-04-23 2021-07-20 河北农业大学 Multiplex fluorescence quantitative PCR method and kit for detecting BVDV, BCoV, BRV and IBRV
CN113234860B (en) * 2021-05-31 2023-04-18 中国农业科学院特产研究所 Dual detection primer and probe combination for bovine viral diarrhea virus and bovine parainfluenza virus type 3

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103160615B (en) * 2013-03-06 2015-04-15 厦门出入境检验检疫局检验检疫技术中心 Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2768753C2 (en) * 2020-07-22 2022-03-24 Федеральное государственное бюджетное учреждение науки Сибирский федеральный научный центр агробиотехнологий Российской академии наук (СФНЦА РАН) Set of synthetic oligonucleotide primers and probes for detecting bovine respiratory syncytial infection virus and bovine gapdh gene and method for detecting rna of respiratory syncytial infection virus in cattle

Also Published As

Publication number Publication date
CN103498009A (en) 2014-01-08

Similar Documents

Publication Publication Date Title
CN103498009B (en) Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof
Hoffmann et al. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses
Zhu et al. Isolation and genetic characterization of bovine parainfluenza virus type 3 from cattle in China
CN102181581B (en) Ternary PCR (polymerase chain reaction) kit for canine distemper virus, enteritis parvovirus and Aleutian disease virus
CN110777220B (en) Primer group, probe, RPA test strip kit and identification method
Oem et al. Molecular characterization of a Korean bovine parainfluenza virus type 3 isolate
CN107988340B (en) PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof
CN103725796B (en) Mark parting fluorescence PCR detection kit and preparation thereof in a kind of bovine viral diarrhea virus
CN103160615B (en) Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method
CN103757139A (en) Canine distemper virus and canine parvovirus duplex TaqMan-MGB fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof
Feng et al. Coxsackievirus cloverleaf RNA containing a 5′ triphosphate triggers an antiviral response via RIG-I activation
CN104745730A (en) Fluorescent PCR (Polymerase Chain Reaction) detection reagent for African swine fever virus CP204L genes and preparation method and application thereof
US10233509B2 (en) Method for detection CPV 2a, 2b, and 2c and for discrimination wild type from vaccine type
Posuwan et al. Prevalence of respiratory viruses isolated from dogs in Thailand during 2008-2009
CN107400736A (en) The type adenovirus ring mediated isothermal amplification detection primer group of duck 2 and kit
CN107058618A (en) Bovine viral diarrhea virus nano PCR detection kits and preparation method thereof
CN113444743A (en) Construction method of sheep mycoplasma pneumonia bivalent nucleic acid vaccine containing adjuvant gene
CN109593743A (en) Novel C RISPR/ScCas12a albumen and preparation method thereof
CN106801054B (en) Pseudosciaena crocea interferon h gene promoter sequence and application thereof
CN102534052B (en) Nucleic-acid sequence-based amplification (NASBA) method for detecting swine influenza virus (SIV)
CN107881259A (en) A kind of pcr amplification primer thing of quick detection infectious bovine rhinotrachetis virus and its application
CN102586485B (en) Real time-loop-mediated isothermal amplification (RT-LAMP) detection primers for performing differential diagnosis on canine distemper virus wild strains and vaccine strains and application of primers
CN110157836B (en) Primer, probe and method for detecting IBRV and BVDV
CN102936619A (en) Method for quantitative determination of escherichia coli RNA, and specialized standard substance and application thereof
Bremer et al. Discrimination between sheep-associated and wildebeest-associated malignant catarrhal fever virus by means of a single-tube duplex nested PCR

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20150121

Termination date: 20201010

CF01 Termination of patent right due to non-payment of annual fee