CN109355431A - The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously - Google Patents
The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously Download PDFInfo
- Publication number
- CN109355431A CN109355431A CN201811382365.XA CN201811382365A CN109355431A CN 109355431 A CN109355431 A CN 109355431A CN 201811382365 A CN201811382365 A CN 201811382365A CN 109355431 A CN109355431 A CN 109355431A
- Authority
- CN
- China
- Prior art keywords
- bovine
- virus
- respiratory syncytial
- fever virus
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The present invention relates to primer and probe, detection kit and the detection methods of a kind of dual real-time fluorescence quantitative PCR for detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus simultaneously.The primer and probe is based on bovine epizootic fever virus sequence and designs to obtain as detection sequence from 5 ' the 3413rd~3518 bit bases of end and Bovine Respiratory Syncytial virus sequence from 5 ' the 1847th~1988 bit bases of end.Easy to operate, high specificity, high sensitivity using detection of the invention will play a role in the detection of bovine epizootic fever virus and Bovine Respiratory Syncytial virus, strain identification and production of vaccine.
Description
Technical field
The invention belongs to animal pathogenic detection field, it is related to detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Method, in particular to dual real-time fluorescence that is a kind of while detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus are quantitative
The primer of PCR, TaqMan probe are being examined comprising the detection kit of the primer and probe and the primer, probe and kit
Survey the application in bovine epizootic fever virus and Bovine Respiratory Syncytial virus.
Background technique
Bovine Ephemeral Fever (Bovine ephemeral fever, BEF) is by bovine epizootic fever virus (Bovine ephemeral
Fever virus, BEFV) caused by beef cattle, milk cow, ox and buffalo a kind of acute, non-contact type infectious disease.The disease is
It is in periodic epidemic by arthropod-borne infection, is distributed widely in Asia, Africa and Oceania area.Again according to its epidemic characteristic
Referred to as temporary heat, stiff disease, Ephemeral fever.The disease is characterized in unexpected high fever, is short of breath, digestive function obstacle, walks lamely, stiff complete
Body is weak.Bovine epizootic fever virus belongs to Rhabdoviridae, ephemeral fever virus category, is sub-thread minus-stranded rna virus, size is about
14900bp, mature virion long 100~230nm, wide 45~100nm contain 10 open reading frame, and 3 ' to 5 ' ends are successively
For 3 '-N-P-M1-M2-G-GNS- α 1- α 2- α 3- β-γ-L-5 ', it is core respectively that 5 kinds, which are structural proteins, in encoded albumen
Albumen (nucleo protein, N), polymerase crosslinking protein (polymerase associate protein, P), polymerase
GAP-associated protein GAP (large RNA-dependent RNA polymerase, L), stromatin (matrix protein, M), sugar
Albumen (surface glycoprotein, G).Other is non-structural protein.The virus is to thermo-responsive, 56 DEG C, 10min or 37
DEG C, 18h can be by inactivation of virus, can be by inactivation of virus, and to chlorine in 8.0 or more dozens of minutes of 2.5 or less pH or pH
The sensitivities such as imitative, ether.
Bovine Respiratory Syncytial disease (Bovine respiratory syncytial, BRS) is by Bovine Respiratory Syncytial
One kind caused by viral (Bovine respiratory syncytial virus, BRSV) is acute, hot respiratory infectious disease,
Cardinal symptom is the symptoms such as high fever, cough, rhinorrhea and salivation, is the main disease for causing the respiratory disease of the ruminants such as ox
One of original.The disease is in worldwide distribution, very harmful to cattle-raising.It is reported that 15~18 monthly age ox disease incidence be up to 80~
100%, the case fatality rate of some cattle farms is 5~20%, causes very huge economic loss to cattle-raising.Many countries of European Union should
Disease is classified as the third-largest disease for being only second to bovine viral diarrhoea (BVD) and infectious bovine rhinotracheitis (IBR).Therefore, bovine respiratory
The diagnosis of plasomidum disease in order to domestic and international animal doctor circle concern emphasis.Bovine Respiratory Syncytial virus belongs to Paramyxoviridae
Pneumovirus, research shows that Bovine Respiratory Syncytial virus is similar to human respiratory syncytial precursor virus, virus in spherical or Filamentous,
Virion size is 80~860nm, there is cyst membrane, is sub-thread minus-stranded rna virus, and size is 15~16kb, contains 10 openings
Reading frame encodes 11 kinds of albumen, wherein nucleocapsid protein (Nucleocapsid protein, N), phosphoprotein P, big polymerase egg
White L is nucleocapsid protein, fusion protein (Fusion protein, F), attachment protein (Attachment protein, G), small
Hydrophobin (Small hydrophobic protein, SH) is transmembrane protein, and there are also 3 kinds of nonglycosylated stromatins
(Matrix protein, M), remaining is non-structural protein.
Currently, the method for common laboratory testing bovine epizootic fever virus and Bovine Respiratory Syncytial virus is main both at home and abroad
Be in Serologic test, including serum and experiment, complement fixation test, Immunofluorescence test, enzyme-linked immunosorbent assay and divide
Several major class such as sub- biological diagnosis, wherein the real-time fluorescence quantitative PCR detection technique in diagnosis of molecular biology is quick with it, simple
Just, accurately the advantages that, is as fast-developing detection means.
Real-Time Fluorescent Quantitative PCR Technique (Quantitative Real-time PCR, qPCR) is 1996 by the U.S.
What Applied Biosystems company released, which, which refers to, is added fluorophor in PCR reaction system, is believed using fluorescence
Number accumulation the entire PCR process of real-time monitoring, finally by standard curve to unknown template carry out quantitative analysis.Real time fluorescent quantitative
Experimental method PCR very effective as one, has been widely used in the every field of molecular biology research.With routine
PCR can quickly, sensitively detect viral RNA and DNA and DNA of bacteria compared to the technology, and this method is widely used in people at present
The diagnosis of class infectious disease and cause of disease be quantitative and the detection of animal pathogen, the inspection and quarantine of animal products, biological products mirror
Surely equal fields.Bovine epizootic fever virus and Bovine Respiratory Syncytial virus belong to respiratory disease, have bovine epizootic fever at present
The substance fluorescence quantifying PCR method of poison or Bovine Respiratory Syncytial virus, such as CN201210219927 disclose detection ox stream
The nucleotide sequence and kit of row fever virus, CN201710246638 disclose it is a kind of detect bovine epizootic fever virus primer and
Detection kit, but the method detection time of substance is longer, testing cost is higher.
Currently, vaccine inoculation is the main means of Epidemic disease prevention.In the production process of vaccine, accurately, specifically, rapidly
The content of detection bovine epizootic fever virus and/or Bovine Respiratory Syncytial viral antigen has important in terms of production of vaccine
Meaning, currently, the measurement of antigen titre depends on TCID in production process50, this method is cumbersome, and and operator
Proficiency have direct relationship.The present invention can implement quickly mirror to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
It does not detect, strong foundation can be provided for the bacterial screening in vaccine production process, it is ensured that the content of antigen in vaccine, to ox prevalence
The production of fever virus and bovine respiratory syncytial virus vaccine has certain directive function；It can also be clinically to ox prevalence
Fever virus and Bovine Respiratory Syncytial virus carry out investigation monitoring, and provide objective data for follow-up clinical disposition.Of the invention
Kit and detection method is easy to operate, high specificity, high sensitivity, reproducible, can also be the effect of subsequent inactivated vaccine
Force inspecting provides prior art basis, has a extensive future.
Summary of the invention
Bovine epizootic fever virus and Bovine Respiratory Syncytial virus are detected simultaneously the first purpose of the invention is to provide a kind of
Dual real-time fluorescence quantitative PCR primer and TaqMan probe.
The primer is based on bovine epizootic fever virus sequence from 5 ' the 3413rd~3518 bit bases of end and Bovine Respiratory Syncytial disease
Malicious sequence designs to obtain from 5 ' the 1847th~1988 bit bases of end as detection sequence.
Preferably, for detect bovine epizootic fever virus upstream primer nucleotide sequence as shown in SED ID NO:1 or
Its derived sequence, for detect bovine epizootic fever virus downstream primer nucleotide sequence is as shown in SEQ ID NO:2 or it spreads out
Raw sequence；For detect Bovine Respiratory Syncytial virus upstream primer nucleotide sequence as shown in SED ID NO:3 or its
Derived sequence, for detect Bovine Respiratory Syncytial virus downstream primer nucleotide sequence as shown in SEQ ID NO:4 or
Its derived sequence.
The TaqMan probe is based on bovine epizootic fever virus sequence and closes from 5 ' the 3413rd~3518 bit bases of end and bovine respiratory
Cell space virus sequence designs to obtain from 5 ' the 1847th~1988 bit bases of end as detection sequence.
Preferably, for detect bovine epizootic fever virus TaqMan probe nucleotide sequence as shown in SED ID NO:5
Or its derived sequence, the nucleotide sequence such as SEQ ID NO:6 of the TaqMan probe for detecting Bovine Respiratory Syncytial virus
Shown or its derived sequence；Probe passes through fluorescent marker, and 5 ' ends are marked with reporter fluorescence group, and 3 ' ends are marked with quenching fluorescence
Group.
It is highly preferred that the reporter fluorescence group of the TaqMan probe for detecting bovine epizootic fever virus is FAM, fluorescent quenching
Group is TAMRA；Reporter fluorescence group for detecting the TaqMan probe of Bovine Respiratory Syncytial virus is ROX, and fluorescence is quenched
The group that goes out is BHQ2；And 3 ' the phosphorylated processing in end of probe.
Bovine epizootic fever virus and Bovine Respiratory Syncytial virus are detected simultaneously a second object of the present invention is to provide a kind of
Dual real-time fluorescence quantitative PCR detection kit, it includes the primer of aforementioned present invention and TaqMan probes.
Preferably, which includes the reagent for being used for 25 μ L dual real-time fluorescence quantitative PCR reaction systems below:
III 12.5 μ L, TaKaRa Ex Taq HS of real-time fluorescence quantitative PCR reaction solution 2 × One step RT-PCR Buffer, 0.5 μ
II 0.5 μ L of L, Prime Script RT Enzyme MIX, for detecting the 1 μ L of upstream primer (10 μM) of bovine epizootic fever virus,
For detecting the 1 μ L of downstream primer (10 μM) of bovine epizootic fever virus, for detecting the upstream primer of Bovine Respiratory Syncytial virus
(10 μM) 1 μ L, for detecting the 1 μ L of downstream primer (10 μM) of Bovine Respiratory Syncytial virus, for detecting bovine epizootic fever virus
0.75 μ L of TaqMan probe (10 μM), for detecting the 0.5 μ L of TaqMan probe (10 μM) of Bovine Respiratory Syncytial virus,
RNA-free H2O 4.25μL。
Bovine epizootic fever virus and Bovine Respiratory Syncytial virus are detected simultaneously third object of the present invention is to provide a kind of
Dual real-time fluorescence quantitative PCR detecting method, this method is using above-mentioned primer and probe or detection kit to Bovine Ephemeral Fever
Virus and Bovine Respiratory Syncytial virus carry out the qualitative and quantitative analysis of non-diagnostic purposes.This method is related to in sample to be tested
Bovine epizootic fever virus and Bovine Respiratory Syncytial viral level are detected, and sample to be tested includes the raw materials for production of vaccine, inactivation
Liquid, concentrate and finished product carry out Quality Control to the viral level in each link of production of vaccine to realize.
Method includes the following steps:
1) establish standard curve: building carries the recombinant plasmid of bovine epizootic fever virus and carries Bovine Respiratory Syncytial respectively
The recombinant plasmid of virus prepares DNA standard items, respectively with 10 times of gradient dilutions at 1 × 108、1×107、1×106、1×105、1
×104、1×103、1×102、1×101Copy/μ L, using the standard items of various concentration as template, in primer of the invention and
Dual real-time fluorescence quantitative PCR is carried out under the guidance of TaqMan probe, after detection, with the concentration Log value (X of each standard items
Axis) it maps to its respective cycle number (Ct value) (Y-axis), draw standard curve；
2) the genome total serum IgE for extracting sample to be tested, using the total serum IgE of extraction as template, in primer of the invention and
Dual real-time fluorescence quantitative PCR is carried out under the guidance of TaqMan probe；
3) it is realized with the variation of obtained CT value or fluorescence signal to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Qualitative detection show that contained ox is popular in sample to be tested further according to the standard curve in the intensity and step 1) of fluorescence signal
The copy number of fever virus and Bovine Respiratory Syncytial virus realizes quantitative detection.
Preferably, the qualitative detection in this method step 3) uses following any method:
Result judgement method 1: positive control sample CT value < 37, experiment is set up when negative control sample CT value >=38, to
Determine that result is the positive when sample CT value < 37, judgement result is suspicious when CT value is 37~39, needs to recheck, value >=39 CT
When, then determine result for feminine gender；
Result judgement method 2: according to the variation of fluorescence signal, to the bovine epizootic fever virus and bovine respiratory in sample to be tested
Syncytial virus carries out qualitative detection, fluorescent amplification curve occurs and determines that sample is the positive.
Preferably, 25 μ L dual real-time fluorescence quantitative PCR reaction systems, packet are used in this method step 1) and step 2)
Contain: III 12.5 μ L, TaKaRa Ex of 2 μ L of template, real-time fluorescence quantitative PCR reaction solution 2 × One step RT-PCR Buffer
0.5 μ L, Prime Script RT Enzyme MIX of Taq HS, II 0.5 μ L, the upstream for detecting bovine epizootic fever virus is drawn
1 μ L of object (10 μM), for detecting the 1 μ L of downstream primer (10 μM) of bovine epizootic fever virus, for detecting Bovine Respiratory Syncytial disease
The 1 μ L of upstream primer (10 μM) of poison, for detecting the 1 μ L of downstream primer (10 μM) of Bovine Respiratory Syncytial virus, for detecting
The 0.75 μ L of TaqMan probe (10 μM) of bovine epizootic fever virus, for detecting the TaqMan probe of Bovine Respiratory Syncytial virus
(10 μM) 0.5 μ L, RNA-free H2O 4.25μL；Dual real-time fluorescence quantitative PCR reaction condition are as follows: first 52 DEG C of 15min reversions
Record, 95 DEG C of initial denaturation 1min；Then 95 DEG C of denaturation 30s, 54 DEG C of annealing 30s, totally 45 recycle.
The dual glimmering in real time of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously the present invention provides a kind of
Fluorescent Quantitative PCR method.Compared with the method for the present invention method quantitative with substance, accuracy, repeatability and susceptibility are simultaneously not less than
The quantitative approach of substance, therefore, the foundation of the method for the present invention be intended to shorten bovine epizootic fever and Bovine Respiratory Syncytial disease
The Molecular Detection time, the cost of detection is reduced, and accurately distinguishes two kinds of viruses.The present invention provide two pairs of autonomous Designs primer and
Two TaqMan probes, primer and probe are directed to the guarantor of bovine epizootic fever virus gene and Bovine Respiratory Syncytial viral gene respectively
Defending zone design.The present invention by establish for bovine epizootic fever virus gene and Bovine Respiratory Syncytial viral gene it is dual in real time
Fluorescence quantifying PCR method is able to carry out the qualitative detection of the non-diagnostic purposes of bovine epizootic fever and Bovine Respiratory Syncytial disease, and
Accurate quantification can be carried out to viral copy number.The present invention can also be mentioned with rationalization with seedling for the quality monitoring in vaccine production process
For strong foundation, it is ensured that the safety and reasonability of vaccine inoculation, to bovine epizootic fever virus and Bovine Respiratory Syncytial virus epidemic disease
The R&D and production of seedling has directive function.Detection method of the invention is easy to operate, high specificity, will in bovine epizootic fever virus and
It plays a significant role, has a extensive future in the detection of Bovine Respiratory Syncytial virus and vaccine development & production.
The present invention is described in further details With reference to embodiment.
Detailed description of the invention
Fig. 1 shows the dual real-time fluorescence quantitative PCR detection ox stream of bovine epizootic fever virus and Bovine Respiratory Syncytial virus
The standard items amplification curve of row fever virus；
Fig. 2 shows the dual real-time fluorescence quantitative PCR detection ox of bovine epizootic fever virus and Bovine Respiratory Syncytial virus streams
The standard items standard curve of row fever virus；
Fig. 3 shows bovine epizootic fever virus and the dual real-time fluorescence quantitative PCR detection ox of Bovine Respiratory Syncytial virus exhales
Inhale the standard items amplification curve of road syncytial virus；
Fig. 4 shows bovine epizootic fever virus and the dual real-time fluorescence quantitative PCR detection ox of Bovine Respiratory Syncytial virus exhales
Inhale the standard items standard curve of road syncytial virus；
Fig. 5 shows bovine epizootic fever virus and the dual real-time fluorescence quantitative PCR detection of Bovine Respiratory Syncytial virus is special
Property experiment amplification curve；
Fig. 6 shows the dual real-time fluorescence quantitative PCR Bovine Ephemeral Fever of bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Virus Standard product repeated experiment amplification curve；
Fig. 7 shows the dual real-time fluorescence quantitative PCR detection ox stream of bovine epizootic fever virus and Bovine Respiratory Syncytial virus
The standard curve of row fever virus standard items repeated experiment standard items；
Fig. 8 shows bovine epizootic fever virus and the dual real-time fluorescence quantitative PCR detection ox of Bovine Respiratory Syncytial virus exhales
Inhale road syncytial virus standard items repeated experiment amplification curve；
Fig. 9 shows the dual real-time fluorescence quantitative PCR bovine respiratory of bovine epizootic fever virus and Bovine Respiratory Syncytial virus
The standard curve of syncytial virus standard items repeated experiment standard items.
Specific embodiment
The present invention provides dual real-time fluorescence that is a kind of while detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus
The primer and TaqMan probe of quantitative PCR, detection while to realize bovine epizootic fever virus and Bovine Respiratory Syncytial virus.
Dual reality provided by the present invention for being detected to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
When quantitative fluorescent PCR primer are as follows:
For detect bovine epizootic fever virus upstream primer (BEFV-F) nucleotide sequence as shown in SED ID NO:1,
For detect bovine epizootic fever virus downstream primer (BEFV-R) nucleotide sequence as shown in SEQ ID NO:2；
For detecting the nucleotide sequence such as SED ID NO:3 of the upstream primer (BRSV-F) of Bovine Respiratory Syncytial virus
It is shown, the nucleotide sequence such as SEQ ID NO:4 institute of the downstream primer (BRSV-R) for detecting Bovine Respiratory Syncytial virus
Show.
The primer sequence as derived from above-mentioned primer also belongs to the present invention.Derived sequence refers in SEQ ID NO:1, SEQ ID
On the basis of NO:2, SEQ ID NO:3 and/or SEQ ID NO:4 by one to ten, preferably one to five, more preferable one to
The primer sequence of two, most preferably one bases replaced, missed or added.
It is provided by the present invention to be used to carry out dual real-time fluorescence to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
The TaqMan probe of quantitative PCR detection are as follows: for detecting the nucleosides of the TaqMan probe (BEFV-P) of bovine epizootic fever virus gene
Acid sequence is as shown in SED ID NO:5；For detecting the TaqMan probe (BRSV-P) of Bovine Respiratory Syncytial viral gene
Nucleotide sequence is as shown in SEQ ID NO:6；The probe passes through fluorescent marker, and 5 ' ends are marked with reporter fluorescence group, 3 ' ends
It is marked with quenching fluorescence group.
The sequence as derived from above-mentioned TaqMan probe also belongs to the present invention.Derived sequence refers in SEQ ID NO:5 and SEQ
On the basis of ID NO:6, is held at 5 ' ends of sequence and/or 3 ' and add again, reduce the sequence that one or more bases obtain.
The reporter fluorescence group of BEFV-P is FAM, fluorescent quenching group TAMRA；The reporter fluorescence group of BRSV-P is
ROX, fluorescent quenching group BHQ2.
TaqMan probe is extended when to prevent PCR amplification, and phosphatizing treatment is held in the 3 ' of probe.
The dual glimmering in real time of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously the present invention also provides a kind of
Fluorescent Quantitative PCR detection kit, it includes the primer of aforementioned present invention and TaqMan probes.
Specifically, which may include following being used for 25 μ L dual real-time fluorescence quantitative PCR reaction systems
Reagent: 2 μ L of template, real-time fluorescence quantitative PCR reaction solution 2 × One step RT-PCR Buffer III 12.5 μ L, TaKaRa
0.5 μ L, Prime Script RT Enzyme MIX II (being purchased from TakaRa company) of Ex Taq HS, 0.5 μ L, BEFV-F (10 μ
M) 1111 0.75 μ L of μ L, BEFV-P (10 μM) of μ L, BRSV-R (10 μM) of μ L, BRSV-F (10 μM) of μ L, BEFV-R (10 μM),
0.5 μ L, RNA-free H of BRSV-P (10 μM)2O 4.25μL。
The present invention further provides a kind of primer using above-mentioned dual real-time fluorescence quantitative PCR and TaqMan probe or
The method that detection kit carries out qualitative and quantitative analysis to bovine epizootic fever virus and Bovine Respiratory Syncytial virus.
Using primer provided by the present invention and TaqMan probe to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Carry out dual real-time fluorescence quantitative PCR detection, it may include following steps:
1) establish standard curve: respectively by carry bovine epizootic fever virus gene recombinant plasmid pCR-TOPO-BEFV and take
As standard items, (standard items are the present application to recombinant plasmid pCR-TOPO-BRSV with Bovine Respiratory Syncytial viral gene
Laboratory building, specific construction method embodiment 2 as detailed below where people), respectively with 10 times of gradient dilutions at 1 × 108、1×
107、1×106、1×105、1×104、1×103、1×102、1×101Copy/μ L, using the standard items of various concentration as mould
Plate, carries out dual real-time fluorescence quantitative PCR detection under the primer of aforementioned present invention and the guidance of TaqMan probe, and detection terminates
Afterwards, mapped with the concentration Log value (X-axis) of each standard items to its corresponding Ct value (Y-axis), draw respectively for bovine epizootic fever virus and
The standard curve of Bovine Respiratory Syncytial virus；
2) total serum IgE for extracting sample to be tested is visited using the RNA of extraction as template in the primer and TaqMan of aforementioned present invention
Dual real-time fluorescence quantitative PCR detection is carried out under the guidance of needle；
3) it is realized with the variation of obtained Ct value or fluorescence signal to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Qualitative detection obtains contained ox stream in sample to be tested further according to two standard curves in the intensity and step 1) of fluorescence signal
The copy number of row fever virus and Bovine Respiratory Syncytial virus realizes quantitative detection.
In the above-mentioned methods, the qualitative detection in step 3) uses following any method:
Result judgement method 1: positive control sample Ct value < 37, experiment is set up when negative control sample Ct value >=38, to
Determine that result is the positive when sample Ct value < 37, judgement result is suspicious when Ct value is 37~39, needs to recheck, value >=39 Ct
When, then determine result for feminine gender；
Result judgement method 2: according to the variation of fluorescence signal, to the bovine epizootic fever virus and bovine respiratory in sample to be tested
Syncytial virus carries out qualitative detection, fluorescent amplification curve occurs and determines that sample is the positive.
In the above-mentioned methods, the sample to be tested in step 2) specifically includes that serum, virocyte culture.
25 μ L dual real-time fluorescence quantitative PCR reaction systems in step 1) and step 2) can include: 2 μ L of template, in real time
12.5 μ L, TaKaRa Ex of fluorescence quantitative PCR reaction solution 2 × One step RT-PCR Buffer III (being purchased from TakaRa company)
0.5 μ L, Prime Script RT Enzyme MIX of Taq HS (being purchased from TakaRa company), II (being purchased from TakaRa company) 0.5 μ
1111 μ L, BEFV-P (10 μ of μ L, BRSV-R (10 μM) of μ L, BRSV-F (10 μM) of μ L, BEFV-R (10 μM) of L, BEFV-F (10 μM)
M) 0.75 0.5 μ L, RNA-free H of μ L, BRSV-P (10 μM)2O 4.25μL。
Real-time fluorescence quantitative PCR reaction condition in step 1) and step 2) can are as follows: first 52 DEG C of 15min reverse transcriptions, then 95
DEG C initial denaturation 1min；Then 95 DEG C of denaturation 30s, 54 DEG C of annealing 30s, totally 45 recycle.At the end of the extension of each circulation into
The detection of row fluorescence signal.
Embodiment
Method therefor is conventional method unless otherwise instructed in following embodiments, and specific steps can be found in:
" Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W.,
Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring
Harbor)。
The percent concentration is mass/mass (W/W, unit g/100g) percent concentration, matter unless otherwise instructed
Amount/volume (W/V, unit g/100mL) percent concentration or volume/volume (V/V, Unit/mL/100mL) percent concentration.
The acquirement approach of various biomaterials described in embodiment is to provide a kind of approach of experiment acquisition only to reach
Specifically disclosed purpose should not become the limitation to biological material source of the present invention.In fact, used biomaterial comes
Source be it is extensive, it is any keep on the right side of the law the biomaterial that can be obtained with moral ethics can be according to the prompt in embodiment
It is replaced.
The primer is synthesized by Huada gene company, and TaqMan probe is synthesized by Takara company.
Embodiment is implemented under the premise of the technical scheme of the present invention, gives detailed embodiment and specific
Operating process, embodiment will be helpful to understand the present invention, but the disclosure is not limited to the following embodiments.
The design of embodiment 1. carries out dual real-time fluorescence quantitative PCR to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
The primer and TaqMan probe of detection
It is retrieved from the nucleic acid database GenBank (http://www.ncbi.nlm.nih.gov) of NCBI and obtains Niu Liuhang
The sequence of fever virus (No. GenBank: NC_002526) and Bovine Respiratory Syncytial viral (No. GenBank: AF295543), is used
After DNA Man software is compared, determine the specific primer of bovine epizootic fever virus target sequence be from 5 ' end the 3058th~
4929 bit bases, the target sequence of the specific primer of Bovine Respiratory Syncytial virus are to hold the 1610th~2350 bit bases from 5 ',
On this basis again with Primer Express6.0 software design bovine epizootic fever virus and Bovine Respiratory Syncytial virus in the piece
Segment limit carries out the primer pair and TaqMan probe of dual real-time fluorescence quantitative PCR detection, separately designs 2 pairs of primers and 2 spies
Needle, and carried out preferably by substance quantitative fluorescent PCR, the final bovine epizootic fever virus objective gene sequence for determining that the present invention is optimal
For from 5 ' the 3413rd~3518 bit bases of end, Bovine Respiratory Syncytial virus objective gene sequence is from 5 ' ends the 1847th~1988
Bit base.
Primer and probe preferred process: respectively to 2 couples of designed BEFV and BRSV (BEFV1, BEFV2；BRSV1,
BRSV2) fluorescent quantitation primer and probe carry out substance real-time fluorescence quantitative PCR, and reaction system used and reaction condition are as follows:
1) 25 μ L substance real-time fluorescence quantitative PCR reaction system can include: 1 μ L of template, real-time fluorescence quantitative PCR reaction solution
2 × One step RT-PCR Buffer III (being purchased from TakaRa company), 12.5 μ L, TaKaRa Ex Taq HS (is purchased from TakaRa
Company) 0.5 μ L, Prime Script RT Enzyme MIX, II (being purchased from TakaRa company) 0.5 μ L, upstream primer F (10 μM)
1 μ L of 1 μ L, downstream primer R (10 μM), 1 μ L, RNA-free H of probe (10 μM)2O 7.5μL.Primer is diluted to 10ng/ μ L, instead
Answering final dosage in system is 10ng.TaqMan probe is diluted to 10ng/ μ L, and final dosage is 10ng in reaction system.
2) substance real-time fluorescence quantitative PCR reaction condition can are as follows: and first 52 DEG C, 15min reverse transcription；95 DEG C of initial denaturations again
1min；Then 95 DEG C of denaturation 30s, 54 DEG C of annealing 30s, totally 45 recycle.Fluorescence letter is carried out at the end of the extension of each circulation
Number detection.
Compare the attainable amplification value of CT value and plateau institute after reaction, filter out optimal bovine epizootic fever virus and
The primer and probe of Bovine Respiratory Syncytial virus dual real-time fluorescence quantitative PCR.
By preferred, present invention determine that bovine epizootic fever virus and Bovine Respiratory Syncytial virus are carried out it is dual glimmering in real time
The primer and TaqMan probe sequence of Fluorescent Quantitative PCR detection are as follows:
BEFV upstream primer (BEFV-F): 5 '-TAGATCAGGGTGCATTACTTCGCC-3 ' (SED ID NO:1),
BEFV downstream primer (BEFV-R): 5 '-GGCTTCTGTTGTATTAGGACATAG-3 ' (SED ID NO:2)；
BRSV upstream primer (BRSV-F): 5 '-GAGGTAGTAGGGTAGAAGGAATC-3 ' (SED ID NO:3),
BRSV downstream primer (BRSV-R): 5 '-CTTGTACGCTGGCATGACCAAGC-3 ' (SED ID NO:4)；
BEFV TaqMan fluorescence probe (BEFV-P):
5 '-(FAM) TATTACCCTCCTGCTGGATGCTTTTGGA (TAMRA) -3 ' (SED ID NO:5)
BRSV TaqMan fluorescence probe (BRSV-P): 5 '-(ROX)
TTGCAGGGTTATTCATGAATGCATATGGAG (BHQ2) -3 ' (SED ID NO:6).
The reporter fluorescence group of BEFV is FAM, fluorescent quenching group TAMRA；The reporter fluorescence group of BRSV is ROX,
Fluorescent quenching group is BHQ2.TaqMan probe is extended when to prevent PCR amplification, and phosphatizing treatment is held in the 3 ' of probe.
Embodiment 2. is using primer and TaqMan probe of the invention to bovine epizootic fever virus and Bovine Respiratory Syncytial disease
Poison carries out dual real-time fluorescence quantitative PCR detection
The total serum IgE of step 1 extraction sample
Bovine epizootic fever virus cell culture and Bovine Respiratory Syncytial virocyte culture to inactivation extract virus
Nucleic acid, there are two types of extracting methods, i.e. tradition Trizol extraction method and commercialization nucleic acid extraction kit extracts viral RNA, can be with
Appoint and selects one.Specific method is the following steps are included: with AxyprepTMBody Fluid Viral DNA/RNA Miniprep
For Kit.
1) sample to be tested, negative control, positive control are numbered respectively.
2) press kit specification, be pre-configured with the isopropanol containing 1% glacial acetic acid and in reagent Buffer W1A and
The dehydrated alcohol of designated volume is added in Buffer W2.
3) 200 μ L samples are transferred in 1.5mL centrifuge tube (if having bacterium or cell contamination in sample, it can be first
12000g is centrifuged 5min, takes 200 μ L of supernatant as sample).
4) into the sample of step 3), 200 μ L Buffer V-L is added and are stored at room temperature 5min after whirlpool concussion mixes,
Obtain mixed liquor.
5) into the mixed liquor of step 4), 75 μ L Buffer V-N are added, whirlpool concussion mixes, and 12000g is centrifuged 5min.
6) supernatant that centrifugation obtains in step 5) is transferred in 2mL centrifuge tube (providing in kit), 300 μ L is added
Isopropanol (contains 1% glacial acetic acid), and turned upside down 6-8 times is uniformly mixed.
7) pipe will be prepared to be placed in 2mL centrifuge tube (providing in kit), mixed liquor obtained in step 6) is moved into
It prepares in pipe, 1min is centrifuged with 6000g.
8) centrifugate is abandoned, pipe will be prepared and put back into 2mL centrifuge tube, 500 μ L Buffer W1A are added, are stored at room temperature
1min.1min is centrifuged with 12000g.
9) centrifugate is abandoned, pipe will be prepared and put back into 2mL centrifuge tube, 800 μ L Buffer W2 are added, are centrifuged with 12000g
1min。
10) pipe will be prepared to put back into 2mL centrifuge tube, 1min is centrifuged with 12000g.
11) pipe will be prepared to be placed in clean 1.5mL centrifuge tube (providing in kit), be added in the film center for preparing pipe
40 μ L are stored at room temperature 1min without enzyme water (Buffer TE).Nucleic acid is eluted with 12000g centrifugation 1min, obtains total rna solution.
The dual real-time fluorescence quantitative PCR standard curve of step 2 bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Foundation
1.PCR expands bovine epizootic fever virus and Bovine Respiratory Syncytial virus target fragment
The bovine epizootic fever virus and Bovine Respiratory Syncytial virus total RNA extract to step 1 carries out PCR amplification respectively, point
Do not obtain bovine epizootic fever virus and (primer be BEFV-F and BEFV-R) and Bovine Respiratory Syncytial it is viral (primer be BRSV-F with
BRSV-R target fragment), 25 μ L reaction systems are as follows:
The PCR amplification system of 1 bovine epizootic fever virus of table and Bovine Respiratory Syncytial virus
| Reagent name | Volume (μ L) |
| 2×One step RT-PCR BufferⅢ | 12.5 |
| TaKaRa Ex Taq HS | 0.5 |
| Prime Script RT Enzyme MIXⅡ | 0.5 |
| Upstream primer (10 μM) | 1 |
| Downstream primer (10 μM) | 1 |
| RNA template | 1 |
| RNA-free H2O | 8.5 |
2. prepared by standard items
1) bovine epizootic fever virus of purification and recovery and Bovine Respiratory Syncytial virus target fragment are cloned into pCR- respectively
Recombinant plasmid is built into TOPO carrier (being purchased from Invitrogen company).
2) by recombinant plasmid transformed to JM109 competent cell (be purchased from TaKaRa company), in Amp+LB solid culture
37 DEG C of base are incubated overnight.
3) positive colony is selected, Amp is seeded to+In LB liquid medium, 37 DEG C, 210rpm Zengjing Granule send bacterium solution
Huada gene company sequencing.
4) by it is above-mentioned 3) in the correct bacterium solution of sequencing, 37 DEG C after culture 6-12 hours, take bacterium solution extraction plasmid, that is, are prepared into
To DNA standard items.It is respectively designated as pCR-TOPO-BEFV and pCR-TOPO-BRSV.
3. the foundation of dual real-time fluorescence quantitative PCR standard curve
Recombinant plasmid pCR-TOPO-BEFV and the carrying of bovine epizootic fever virus target fragment are correctly carried to sequencing respectively
The DNA standard items that the recombinant plasmid pCR-TOPO-BRSV of Bovine Respiratory Syncytial virus target fragment is extracted, use Qubit
3.0 measurement concentration, and calculate the copy number of each standard items, according to 10 times of gradients by bovine epizootic fever virus and Bovine Respiratory Syncytial
Virus Standard product are diluted to 1 × 10 respectively8、1×107、1×106、1×105、1×104、1×103、1×102、1×101Copy/
μ L, each sample does 2 repetitions, using the standard items of various concentration as template, under the guidance of primer and TaqMan probe into
Row dual real-time fluorescence quantitative PCR detection.
The reaction system (25 μ L) of dual real-time fluorescence quantitative PCR is as follows:
The dual real-time fluorescence quantitative PCR reaction system of table 2 BEFV and BRSV
| Reagent name | Volume (μ L) |
| 2×One step RT-PCR BufferⅢ | 12.5 |
| TaKaRa Ex Taq HS | 0.5 |
| Prime Script RT Enzyme MIXⅡ | 0.5 |
| BEFV-F(10μM) | 1 |
| BEFV-R(10μM) | 1 |
| BRSV-F(10μM) | 1 |
| BRSV-R(10μM) | 1 |
| BEFV-P(10μM) | 0.75 |
| BRSV-P(10μM) | 0.5 |
| DNA profiling | 2.0 |
| RNA-free H2O | 4.25 |
The reaction condition of dual real-time fluorescence quantitative PCR are as follows: first 52 DEG C, 15min reverse transcription；95 DEG C of initial denaturation 1min again；
Then 95 DEG C of denaturation 30s, 54 DEG C of annealing 30s, totally 45 recycle.
Shown in dual real-time fluorescence quantitative pcr amplification curve such as Fig. 1 (BEFV) and Fig. 3 (BRSV) of standard items, standard items
Amplification curve is smooth serpentine curve, and corresponding standard concentration is respectively 1 × 10 to eight groups of lines from left to right in figure8、1
×107、1×106、1×105、1×104、1×103、1×102、1×101Copy/μ L.After detection, with each standard items
Concentration Log value (X-axis) maps to its corresponding Ct value (Y-axis), draws standard curve, standard curve such as Fig. 2 (BEFV) and Fig. 4
(BRSV) shown in, related coefficient is respectively R2=0.997 and R2=0.998, error is smaller, and standard curve is available, by standard curve
Obtained linear equation are as follows: y=-3.178x+44.047 (BEFV) and y=-3.402x+44.515 (BRSV).
The dual real-time fluorescence quantitative PCR of step 3 bovine epizootic fever virus and the clinical pathological material of disease of Bovine Respiratory Syncytial virus
Detection
The dual real-time fluorescence of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected while foundation with the present invention
Quantifying PCR method (protects the limited public affairs of clever biologics from golden space to collected 19 parts of bovine epizootic fever virus cell cultures
Department) and 12 parts of suspected infection Bovine Respiratory Syncytial virus nose of an ox swab (from pasture) and 3 parts of illness nose of an ox swabs (
From pasture), total serum IgE is extracted with step 1 the method, wherein 12 parts of bovine epizootic fever virus RNA and 12 parts of suspected infection oxen is taken to exhale
It inhales road syncytial virus RNA and is mixed to form sample 1~12, in addition 7 parts of bovine epizootic fever virus RNA are 13~19,3 parts of illness of sample
Bovine viral RNA is sample 20-22, respectively with bovine epizootic fever virus cell culture and the Bovine Respiratory Syncytial virus of inactivation
DNA standard items are positive control, using no enzyme water as negative control, and the dual real-time fluorescence quantifying PCR method described in step 2
It is detected.According to bovine epizootic fever virus and Bovine Respiratory Syncytial virus dual real-time fluorescence quantitative PCR detection as a result, to sample
This result is determined, and is quantified to the copy number of institute's virus infection.The results are shown in Table 3, sample 1-12 detected
It is determined as that BEFV is positive, BRSV is negative；Sample 13-19 is determined as that BEFV is positive, BRSV is negative；Sample 20 is determined as BEFV yin
Property, BRSV it is negative；Sample 21 is determined as that BEFV is positive, BRSV is positive；Sample 22 is determined as that BEFV is negative, BRSV is positive.As a result
Show that dual real-time fluorescence quantifying PCR method of the invention can detect and distinguish simultaneously bovine epizootic fever virus and bovine respiratory closes
Cell space virus.
The dual real-time fluorescence quantitative PCR detection result of 3 sample to be tested of table
Embodiment 3. detects the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus simultaneously
Detection kit
The dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected while of the invention
Detection kit includes the reagent for being used for 25 μ L dual real-time fluorescence quantitative PCR reaction systems below: real-time fluorescence quantitative PCR is anti-
Answer III 12.5 μ L, TaKaRa Ex Taq HS of liquid 2 × One step RT-PCR Buffer, 0.5 μ L, Prime Script RT
II 0.5 μ L of Enzyme MIX, for detecting the 1 μ L of upstream primer BEFV-F (10 μM) of bovine epizootic fever virus, for detecting ox stream
The 1 μ L of downstream primer BEFV-R (10 μM) of row fever virus, for detecting the upstream primer BRSV-F of Bovine Respiratory Syncytial virus
(10 μM) 1 μ L, for detecting the 1 μ L of downstream primer BRSV-R (10 μM) of Bovine Respiratory Syncytial virus, for detecting Niu Liuhang
The 0.75 μ L of TaqMan probe BEFV-P (10 μM) of fever virus, for detecting the TaqMan probe of Bovine Respiratory Syncytial virus
0.5 μ L, RNA-free H of BRSV-P (10 μM)2O 4.25μL。
The application method reference implementation example 2 of kit of the present invention.
4. specificity experiments of embodiment
RNA is extracted simultaneously to bovine parainfluenza virus (BPIV), bovine viral diarrhea virus (BVDV) according to the method for embodiment 2
Reverse transcription is carried out, rhinotracheitis virus (IBRV) directly extracts DNA, while with bovine epizootic fever virus and Bovine Respiratory Syncytial disease
Malicious DNA standard items are that positive control carries out under the guidance of primer of the present invention and TaqMan probe using no enzyme water as negative control
Dual real-time fluorescence quantitative PCR detection, PCR reaction system and reaction condition are referring to embodiment 2, to verify the special of this method
Property.
Testing result as shown in figure 5, bovine epizootic fever virus positive control and Bovine Respiratory Syncytial positive control CT value
Respectively 25/27 (< 37) is as a result positive；Negative control CT value is N/A (>=39), and test is set up；Bovine parainfluenza virus
(BPIV), the CT value of bovine viral diarrhea virus (BVDV) and infectious bovine rhinotrachetis virus (IBRV) it is equal > 39, and do not occur
Specific amplification curve, it is as a result negative.Testing result shows specifically detect bovine epizootic fever with method of the invention
Poison and Bovine Respiratory Syncytial virus.
5. sensitivity experiment of embodiment
According to described in embodiment 2, by bovine epizootic fever virus and Bovine Respiratory Syncytial Virus Standard product according to 10 times of gradients
It is diluted to 1 × 10 respectively8、1×107、1×106、1×105、1×104、1×103、1×102、1×101Copy/μ L, with difference
The standard items of concentration carry out dual real-time fluorescence quantitative PCR as template under the guidance of primer of the present invention and TaqMan probe
Detection, PCR reaction system and reaction condition are referring to embodiment 2, to verify the sensitivity of this method.
As a result as shown in figures 1 and 3, the amplification curve of bovine epizootic fever virus and Bovine Respiratory Syncytial virus shows ox stream
The dual real-time fluorescence quantitative PCR detection of row fever virus can be to 1 × 102Copy/μ L, the dual reality of Bovine Respiratory Syncytial virus
When fluorescence quantitative PCR detection can be to 1 × 101Copy/μ L, sensitivity are higher.
6. repeated experiment of embodiment
According to described in embodiment 2, by bovine epizootic fever virus and Bovine Respiratory Syncytial Virus Standard product according to 10 times of gradients
It is diluted to 1 × 10 respectively8、1×107、1×106、1×105、1×104、1×103、1×102、1×101Copy/μ L, with difference
The standard items of concentration do three repetitions as template respectively, carry out under the guidance of primer of the present invention and TaqMan probe double
Weight real-time fluorescence quantitative PCR detection, PCR reaction system and reaction condition are referring to embodiment 2, to verify this method repeatability, knot
Fruit bovine epizootic fever virus and the amplification curve of Bovine Respiratory Syncytial virus are as shown in Fig. 6, Fig. 8, standard curve such as Fig. 7 and Fig. 9
It is shown.Repeated result is as shown in table 4 and table 5.The amplification curve of each concentration gradient is relatively gathered as seen from the figure, recurring number
Without obvious gap, show bovine epizootic fever virus of the present invention and ox syncytial virus dual real-time fluorescence quantitative PCR detecting method
It is repeated preferably to recycle array internal standard deviation difference and be only up to 1.217, the coefficient of variation 3.25；Standard deviation is between group
1.12, the coefficient of variation 2.83.
Variation lines in 4 bovine epizootic fever virus of table and ox syncytial virus dual real-time fluorescence quantitative PCR repeated experiment group
Number
5 bovine epizootic fever virus of table and ox syncytial virus dual real-time fluorescence quantitative PCR repeated experiment between-group variation system
Number
Sequence table
<110>Jinyu Baoling Biology Drugs Co., Ltd
<120>primer of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously
And probe
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213>BEFV upstream primer (BEFV-F) (artificial sequence)
<400> 1
tagatcaggg tgcattactt cgcc 24
<210> 2
<211> 24
<212> DNA
<213>BEFV downstream primer (BEFV-R) (artificial sequence)
<400> 2
ggcttctgtt gtattaggac atag 24
<210> 3
<211> 23
<212> DNA
<213>BRSV upstream primer (BRSV-F) (artificial sequence)
<400> 3
gaggtagtag ggtagaagga atc 23
<210> 4
<211> 23
<212> DNA
<213>BRSV downstream primer (BRSV-R) (artificial sequence)
<400> 4
cttgtacgct ggcatgacca agc 23
<210> 5
<211> 28
<212> DNA
<213>BEFV TaqMan fluorescence probe (BEFV-P) (artificial sequence)
<400> 5
tattaccctc ctgctggatg cttttgga 28
<210> 6
<211> 30
<212> DNA
<213>BRSV TaqMan fluorescence probe (BRSV-P) (artificial sequence)
<400> 6
ttgcagggtt attcatgaat gcatatggag 30
Claims (10)
1. a kind of dual real-time fluorescence quantitative PCR for detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus simultaneously draws
Object, which is characterized in that the primer is based on bovine epizootic fever virus sequence from 5 ' the 3413rd~3518 bit bases of end and bovine respiratory
Syncytial virus sequence designs to obtain from 5 ' the 1847th~1988 bit bases of end as detection sequence.
2. primer according to claim 1, which is characterized in that for detecting the nucleosides of the upstream primer of bovine epizootic fever virus
Acid sequence is as shown in SED ID NO:1 or its derived sequence, the nucleotides sequence of the downstream primer for detecting bovine epizootic fever virus
Column are as shown in SEQ ID NO:2 or its derived sequence；For detecting the nucleotide of the upstream primer of Bovine Respiratory Syncytial virus
Sequence is as shown in SED ID NO:3 or its derived sequence, the nucleosides of the downstream primer for detecting Bovine Respiratory Syncytial virus
Acid sequence is as shown in SEQ ID NO:4 or its derived sequence.
3. a kind of dual real-time fluorescence quantitative PCR for detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus simultaneously
TaqMan probe, which is characterized in that the TaqMan probe is based on bovine epizootic fever virus sequence from 5 ' the 3413rd~3518, ends
Base and Bovine Respiratory Syncytial virus sequence design to obtain from 5 ' the 1847th~1988 bit bases of end as detection sequence.
4. TaqMan probe according to claim 3, which is characterized in that the TaqMan for detecting bovine epizootic fever virus is visited
The nucleotide sequence of needle is as shown in SED ID NO:5 or its derived sequence, for detecting Bovine Respiratory Syncytial virus
The nucleotide sequence of TaqMan probe is as shown in SEQ ID NO:6 or its derived sequence；The probe pass through fluorescent marker, 5 '
End is marked with reporter fluorescence group, and 3 ' ends are marked with quenching fluorescence group.
5. TaqMan probe according to claim 4, which is characterized in that described for detecting bovine epizootic fever virus
The reporter fluorescence group of TaqMan probe is FAM, fluorescent quenching group TAMRA；It is described to be used to detect Bovine Respiratory Syncytial
The reporter fluorescence group of the TaqMan probe of virus is ROX, fluorescent quenching group BHQ2；And 3 ' ends of the probe are through phosphorus
Acidification.
6. a kind of dual real-time fluorescence quantitative PCR detection examination for detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus simultaneously
Agent box, which is characterized in that the detection kit includes described in primer of any of claims 1 or 2 and claim 3 or 4
TaqMan probe.
7. detection kit according to claim 6, which is characterized in that the detection kit includes to be used for 25 μ L below
The reagent of dual real-time fluorescence quantitative PCR reaction system: real-time fluorescence quantitative PCR reaction solution 2 × One step RT-PCR
III 12.5 μ L, TaKaRa Ex Taq HS of Buffer, 0.5 μ L, Prime Script RT Enzyme MIX, II 0.5 μ L, is used for
The 1 μ L of upstream primer (10 μM) for detecting bovine epizootic fever virus, for detecting the 1 μ L of downstream primer (10 μM) of bovine epizootic fever virus,
For detecting the 1 μ L of upstream primer (10 μM) of Bovine Respiratory Syncytial virus, for detecting under Bovine Respiratory Syncytial virus
Primer (10 μM) 1 μ L is swum, for detecting the 0.75 μ L of TaqMan probe (10 μM) of bovine epizootic fever virus, for detecting bovine respiratory
0.5 μ L, the RNA-free H of TaqMan probe (10 μM) of syncytial virus2O 4.25μL。
8. a kind of dual real-time fluorescence quantitative PCR detection side for detecting bovine epizootic fever virus and Bovine Respiratory Syncytial virus simultaneously
Method comprising use TaqMan probe or claim 5 described in primer and claim 3 or 4 described in as claimed in claim 1 or 22
Or detection kit described in 6, the qualitative, fixed of non-diagnostic purposes is carried out to bovine epizootic fever virus and Bovine Respiratory Syncytial virus
Amount detection, which comprises the following steps:
1) establish standard curve: building carries the recombinant plasmid of bovine epizootic fever virus and carries Bovine Respiratory Syncytial virus respectively
Recombinant plasmid, prepare DNA standard items, respectively with 10 times of gradient dilutions at 1 × 108、1×107、1×106、1×105、1×
104、1×103、1×102、1×101Copy/μ L, using the standard items of various concentration as template, according to claim 1 or 2
Dual real-time fluorescence quantitative PCR is carried out under the guidance of primer and the TaqMan probe according to claim 3 or 4,
After detection, is mapped with the concentration Log value (X-axis) of each standard items to its corresponding Ct value (Y-axis), draw standard curve；
2) the genome total serum IgE for extracting sample to be tested, using the total serum IgE of extraction as template, according to claim 1 or 2
Dual real-time fluorescence quantitative PCR is carried out under the guidance of primer and TaqMan probe according to claim 3 or 4；
3) bovine epizootic fever virus and Bovine Respiratory Syncytial virus are determined with the variation realization of obtained CT value or fluorescence signal
Property detection, further according to the standard curve in the intensity and step 1) of fluorescence signal, obtain contained bovine epizootic fever in sample to be tested
The copy number of poison and Bovine Respiratory Syncytial virus realizes quantitative detection.
9. according to the method described in claim 8, it is characterized in that, the qualitative detection in the step 3) uses following
A kind of method:
Result judgement method 1: positive control sample CT value < 37, experiment is set up when negative control sample CT value >=38, to test sample
Determine that result is the positive when product CT value < 37, determine when CT value is 37~39 result be it is suspicious, when CT value >=39, then determine result
For feminine gender；
Result judgement method 2: according to the variation of fluorescence signal, in sample to be tested bovine epizootic fever virus and bovine respiratory close born of the same parents
Precursor virus carries out qualitative detection, fluorescent amplification curve occurs and determines that sample is the positive.
10. according to the method described in claim 8, it is characterized in that, using the 25 dual realities of μ L in the step 1) and step 2)
When quantitative fluorescent PCR reaction system, it includes 2 μ L of template, real-time fluorescence quantitative PCR reaction solution 2 × One step RT-PCR
III 12.5 μ L, TaKaRa Ex Taq HS of Buffer, 0.5 μ L, Prime Script RT Enzyme MIX, II 0.5 μ L is used
In the 1 μ L of upstream primer (10 μM) of detection bovine epizootic fever virus, for detecting downstream primer (10 μM) 1 μ of bovine epizootic fever virus
L, for detecting the 1 μ L of upstream primer (10 μM) of Bovine Respiratory Syncytial virus, for detecting Bovine Respiratory Syncytial virus
1 μ L of downstream primer (10 μM), for detecting the 0.75 μ L of TaqMan probe (10 μM) of bovine epizootic fever virus, for detecting ox breathing
0.5 μ L, the RNA-free H of TaqMan probe (10 μM) of road syncytial virus2O 4.25μL；Dual real-time fluorescence quantitative PCR is anti-
Answer condition are as follows: first 52 DEG C of 15min reverse transcriptions, 95 DEG C of initial denaturation 1min；Then 95 DEG C of denaturation 30s, 54 DEG C of annealing 30s, totally 45
Circulation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811382365.XA CN109355431A (en) | 2018-11-20 | 2018-11-20 | The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811382365.XA CN109355431A (en) | 2018-11-20 | 2018-11-20 | The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109355431A true CN109355431A (en) | 2019-02-19 |
Family
ID=65332445
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811382365.XA Pending CN109355431A (en) | 2018-11-20 | 2018-11-20 | The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355431A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212623A (en) * | 2011-06-02 | 2011-10-12 | 广东省农业科学院兽医研究所 | Two-color fluorescence quantitative polymerase chain reaction (PCR) combined detection method of swine fever virus and blue ear disease virus and kit thereof |
| CN102719566A (en) * | 2012-06-27 | 2012-10-10 | 北京森康生物技术开发有限公司 | Nucleotide sequences and kit for testing bovine ephemeral fever virus |
| CN103498009A (en) * | 2013-10-10 | 2014-01-08 | 中国农业科学院特产研究所 | Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof |
| CN104745731A (en) * | 2015-04-21 | 2015-07-01 | 天津出入境检验检疫局动植物与食品检测中心 | Triple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses, swine fever viruses and respiratory syndrome viruses and preparation method and application thereof |
| CN106167837A (en) * | 2016-08-31 | 2016-11-30 | 金宇保灵生物药品有限公司 | The real-time fluorescence quantitative PCR detection kit of bovine viral diarrhoea bovine diarrhoea virus and primer special thereof and probe |
| CN108411014A (en) * | 2018-04-28 | 2018-08-17 | 金宇保灵生物药品有限公司 | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida |
| CN108531659A (en) * | 2018-05-31 | 2018-09-14 | 广西壮族自治区兽医研究所 | A kind of RT-PCR primer and kit of quick detection bovine epizootic fever virus |
-
2018
- 2018-11-20 CN CN201811382365.XA patent/CN109355431A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212623A (en) * | 2011-06-02 | 2011-10-12 | 广东省农业科学院兽医研究所 | Two-color fluorescence quantitative polymerase chain reaction (PCR) combined detection method of swine fever virus and blue ear disease virus and kit thereof |
| CN102719566A (en) * | 2012-06-27 | 2012-10-10 | 北京森康生物技术开发有限公司 | Nucleotide sequences and kit for testing bovine ephemeral fever virus |
| CN103498009A (en) * | 2013-10-10 | 2014-01-08 | 中国农业科学院特产研究所 | Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof |
| CN104745731A (en) * | 2015-04-21 | 2015-07-01 | 天津出入境检验检疫局动植物与食品检测中心 | Triple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses, swine fever viruses and respiratory syndrome viruses and preparation method and application thereof |
| CN106167837A (en) * | 2016-08-31 | 2016-11-30 | 金宇保灵生物药品有限公司 | The real-time fluorescence quantitative PCR detection kit of bovine viral diarrhoea bovine diarrhoea virus and primer special thereof and probe |
| CN108411014A (en) * | 2018-04-28 | 2018-08-17 | 金宇保灵生物药品有限公司 | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida |
| CN108531659A (en) * | 2018-05-31 | 2018-09-14 | 广西壮族自治区兽医研究所 | A kind of RT-PCR primer and kit of quick detection bovine epizootic fever virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593893A (en) | African hog cholera virus fluorescent PCR quick detection kit | |
| CN110408726A (en) | The method for detecting 29 kinds of respiratory pathogens using Taqman low-density microfluidic chip technology | |
| CN107937613A (en) | Respiratory system common seven kinds of influenza virus pathogen real-time fluorescence multiple PCR primer probes and kit | |
| CN102337351B (en) | Typing detection kit for influenza virus | |
| CN106167833B (en) | A kind of while 8 kinds of entomophila encephalitis viruses of detection RT-PCR primers and probe combinations and kit | |
| Upadhayay et al. | Epidemiology and diagnosis of foot-and-mouth disease: A review | |
| CN109097495A (en) | Senecan virus and foot and mouth disease virus dual real-time fluorescence quantitative PCR detection kit | |
| CN106435033A (en) | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit | |
| CN107988433A (en) | Double PCR primer, detection method and the kit of a kind of grouper irido virus | |
| CN109913591A (en) | A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method | |
| CN106167837A (en) | The real-time fluorescence quantitative PCR detection kit of bovine viral diarrhoea bovine diarrhoea virus and primer special thereof and probe | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN102108414B (en) | Real-time fluorescence transcription-polymerase chain reaction (RT-PCR) detection method and kit for pike fry rhabdovirus (PFRV) | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN108330211A (en) | A group rotavirus/astrovirus/intestinal adenovirus nucleic acid multiple fluorescence PCR detection reagent box and application thereof | |
| CN103993102B (en) | A kind of detect adenovirus hominis, people's mycoplasma pneumoniae, the method for human bocavirus and test kit simultaneously | |
| CN106350609A (en) | Reagent and detection method for detecting vesicular stomatitis virus, and applications | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
| CN102108420B (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN101294226A (en) | RT-PCR method for testing hantavirus genome | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN105441593A (en) | Primer and probe sequence for detecting caprine PIV3 (Parainfluenza Virus 3) nucleotide fragment | |
| CN110468223A (en) | Primer, probe, kit and the method for mycoplasma pneumoniae and Bao Te Pseudomonas detection of nucleic acids based on dUTP/UNG method | |
| CN109355431A (en) | The primer and probe of the dual real-time fluorescence quantitative PCR of bovine epizootic fever virus and Bovine Respiratory Syncytial virus is detected simultaneously |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190219 |
|
| RJ01 | Rejection of invention patent application after publication |