RU2678870C1 - Set of reagents for detection of nucleic acid of gamboro disease virus - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: kit for the detection of RNA virus Gamboro disease is proposed, where this set includes oligonucleotides having the following sequence: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3. Invention can be used in the diagnosis of Gamboro disease in research institutions, veterinary laboratories and enterprises of biological industry.EFFECT: increasing the degree of specificity and sensitivity, as well as reducing the time of diagnosis while reducing the likelihood of technological errors during laboratory manipulations due to the convenient format of the proposed test system.5 cl, 2 dwg, 4 ex

Description

Technical field

The invention relates to veterinary medicine, namely, veterinary virology, in particular to a test system for detecting RNA of a particularly dangerous causative agent of Gamboro disease in birds. The invention can be used in the diagnosis of Gumboro disease in research institutions, veterinary laboratories and in enterprises of the biological industry.

State of the art

Gamboro Disease (also known as Chicken Infectious Bursitis, or Bursal Infectious Bursal Disease) is a highly contagious disease of young chickens caused by the Infectious Bursal Disease Virus (IBDV). The disease is characterized by damage to the factory bag, nephrosis, intramuscular hemorrhage, immunosuppression and diarrhea. Morbidity and mortality increase rapidly and reach a maximum on the 3-4th day of illness. In recent years, very virulent IBDV strains have appeared in Europe, Latin America, Southeast Asia, Africa and the Middle East, causing increased mortality in birds. The timely detection of a crane disease is important for the poultry economy, including due to the high contagiousness of the virus, the increased susceptibility of infected birds to other diseases and the negative effect for vaccination.

The basis of all antiepizootic measures is the identification of the pathogen. The formulation of the polymerase chain reaction (PCR) is necessary to clarify the etiology of the infectious disease. The real-time PCR method allows the identification of the pathogen genetic material in a biological sample in less than 3 hours and includes the following steps: isolation of nucleic acids - DNA and / or RNA, amplification and analysis of the results. The PCR reaction is based on a multiple increase in the desired DNA region using a special enzyme - thermostable DNA polymerase. In the case of research of RNA-containing material, this step is preceded by a reverse transcription reaction aimed at obtaining cDNA from RNA, and taking place in the presence of the reverse transcriptase enzyme.

Currently, there are several ways of stating PCR. Classical methods take up to two days and include up to 14 washing steps for preparing a clean nucleic acid sample and up to 6 steps for amplification.

Known test system for detecting a Gumboro disease pathogen strain by PCR (Tomás G, et al., Development of an RT-qPCR assay for the specific detection of a distinct genetic lineage of the infectious bursal disease virus. Avian Pathol., 2017 Apr; 46 (2): 150-156). The disadvantage of this test system is the oligonucleotide composition, which does not allow annealing of small amplicons (less than 200 pM) to increase the specificity of the test system. In addition, the length and spatial configuration of the oligonucleotide constructs are not optimized enough for two-stage PCR without elongation, which increases the PCR time.

Other methods for identifying Gumboro disease are also known, for example, WO 2010126351 A1, US 2005214316 A1, US 2006188871 A1, Peters M, et al., Journal of Virological Methods, vol. 127, no. 1, pages 87-95, July 2005.

The disadvantages of these methods are the lack of ergonomics, the complicated format of the PCR reaction, and not always good detection efficiency of the virus.

Despite the popularity of a number of methods for diagnosing Gamboro disease in birds, today there remains a need in the market for a convenient, fast and effective method for detecting the virus of infectious bursal disease. This invention has a number of properties necessary to solve this problem.

SUMMARY OF THE INVENTION

An object of the present invention is to provide a kit for detecting a nucleic acid of an infectious agent that causes Gamboro disease in birds in various materials using real-time PCR analysis.

The essential features that distinguish the present invention are: (a) an optimized oligonucleotide composition of synthetic primers and probes; (b) a convenient amplification mixture format for detecting nucleic acid in one step.

This problem is solved by creating a kit for the detection of Gamboro disease virus RNA, where the kit includes oligonucleotides having the following sequences: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, wherein the oligonucleotide with the sequence SEQ ID NO: 3 contains a HEX fluorescent dye attached at its 5'-end or 3'-end via a covalent bond, and contains a BHQ1 fluorescence quencher attached at the opposite end of the dye from the indicated oligonucleotide via a covalent bond.

In some embodiments of the invention, the kit is characterized in that it further comprises DNA polymerase and reverse transcriptase enzymes, as well as a mixture of four different deoxyribonucleotides. Deoxyribonucleotides must be suitable for incorporation into a growing DNA strand in a PCR reaction, and include deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate, and deoxythymidine triphosphate. In preferred embodiments of the invention, the DNA polymerase is Taq DNA polymerase, in other embodiments, another thermostable polymerase suitable for carrying out the PCR reaction may be used.

This problem is also solved by creating a method for the diagnosis of the Gamboro disease virus in birds, comprising at least the following stages: (a) take a sample of biological material from a bird, presumably infected with the virus; (b) isolate RNA from the specified sample; (c) carry out a PCR reaction using the above set of oligonucleotides; (d) upon detection of a signal in said PCR reaction, the presence of the Gamboro disease virus in the organism of said bird is detected. In preferred embodiments of the invention, the biological material is lymphoid tissue, such as, for example, lymph nodes, bursal tissue, spleen.

The technical result of the present invention is to increase the degree of specificity and sensitivity of the diagnostic test system, as well as reducing the time of diagnosis while reducing the likelihood of technological errors during laboratory manipulations due to the convenient format of the proposed test system.

Brief Description of Drawings

FIG. 1. Graph of fluorescence signal accumulation during amplification of a specific fragment of a pathogen nucleic acid, HEX channel. The abscissa indicates the number of cycles in the reaction; the ordinate indicates the normalized fluorescence intensity.

FIG. 2. Schedule of accumulation of the fluorescence signal, FAM channel, amplification of cKDNA of EKR. The abscissa indicates the number of cycles in the reaction; the ordinate indicates the normalized fluorescence intensity.

Detailed Disclosure of Invention

In the description of the present invention, the terms “includes” and “including” are interpreted as meaning “includes, inter alia,”. These terms are not intended to be construed as “consists of only”. Unless defined separately, technical and scientific terms in this application have standard meanings generally accepted in the scientific and technical literature.

One of the objectives of the present invention is to simplify the method of PCR analysis to determine the presence of pathogens of infectious diseases of birds. A significant difference of the claimed invention is the use of a reagent system containing, in a preferred embodiment, synthetic oligonucleotide constructs, genetically modified polymerase and reverse transcriptase enzymes, deoxynucleoside triphosphates, buffer components. In one embodiment of the invention, oligonucleotide constructs have the following composition:

SEQ ID NO: 1 - ACCGGCATCGACAATCTTATG (direct primer)

SEQ ID NO: 2 - TCCAACCAATGAGATAACCCAGCCA (reverse primer)

SEQ ID NO: 3 - 5'-HEX- CGTTGTTACAACTATCGTTAGCGG-BHQ1-3 '-

(oligonucleotide is a fluorescent probe, where BHQ1 denotes a dark fluorescence quencher attached to the 3'-terminal nucleotide G, and HEX denotes a HEX fluorescent dye attached to the 5'-terminal nucleotide C). In another embodiment of the invention, the dye can be attached to the 3'-terminal nucleotide using a covalent bond, and the quencher to the 5'-terminal nucleotide. The Gamboro disease virus RNA detection kit by PCR analysis may also include a positive control sample, which is a mixture of plasmids, one of which contains a site complementary to synthetic oligonucleotide constructs; the kit may also include a negative control sample.

The necessary technical result is achieved in the preparation of reagent components for detecting the nucleic acid of the causative agent of Gumboro disease. In preferred embodiments of the invention, the following components are used: at least three oligonucleotide constructs that are complementary to the conserved region of the genome of the specified pathogen in the region of the VP2 gene, including primers of 0.75 pmol / ml each, as well as an oligonucleotide fluorescent probe obtained by attaching a fluorescent dye and a fluorescence quencher to opposite ends of the oligonucleotide; genetically modified DNA polymerase and reverse transcriptase enzymes, 5 u / μl each; four types of deoxynucleoside triphosphates, 2.5 mM each; and buffer components. Using these components, the proposed diagnostic kit is able to amplify a specific section of the nucleic acid of the causative agent of Gamboro disease in a PCR reaction with the release of a fluorescent signal within 25-30 PCR cycles. This allows you to determine the presence of pathogens in samples of biological material within 2 hours.

You can use the invention with modifications. For PCR in the presence of an internal control sample (CTP), a synthetic plasmid or phage virus can be added to the reagent kit, and complementary CTP oligonucleotide constructs can be added to the amplification reagent kit, one of which is similarly modified with a fluorescent label. In this case, the fluorescence signal for a specific nucleic acid fragment and for a fragment of nucleic acid EKR should be recorded through different fluorescence channels, for example, FAM and HEX.

The following examples of the method are given in order to disclose the characteristics of the present invention and should not be construed as in any way limiting the scope of the invention.

Example 1. Pre-treatment of biological material.

Samples of poultry organs and tissues are homogenized, then a 10% suspension is prepared in sterile physiological saline (to prepare a suspension, use a sample volume corresponding to 100 μl in a microcentrifuge tube and then bring it to 1 ml with sterile saline solution). Centrifuge for 1 minute at 1,000 rpm. The supernatant is used to isolate RNA.

Example 2. The procedure for the isolation of RNA from a sample of biological material.

1. In 450 ml labeled tubes, add 450 μl of the 1st solution to isolate RNA containing cells lysing components.

2. Close the tubes and mix thoroughly in a microcentrifuge-vortex for 10 seconds.

3. Precipitate droplets from the caps of the tubes by centrifugation for 3-5 seconds on a microcentrifuge-vortex.

4. Incubate tubes at 60 ° C for 5 minutes. If suspended particles are in the tubes (from the test biological material), centrifuge them at 13 thousand rpm for 1 min and transfer the supernatant to another tube.

5. Pipette 13 μl of the internal control sample into each tube, close the tubes and mix thoroughly on a vortex, discard the droplets by centrifugation and incubate at 60 ° C for 5 min.

6. Carefully resuspend the sorbent, which can be used as diatomaceous earth, on the vortex and add 25 μl of the resuspended sorbent to each tube with a separate tip. Mix the contents of the tubes and incubate at room temperature for 5 minutes, stirring occasionally.

7. Centrifuge the tubes for sedimentation of the sorbent at 10 thousand rpm for 30 sec on a microcentrifuge and remove the supernatant from each tube with a separate tip using an aspirator with a flask trap.

8. Add 400 μl of the 2nd solution to the tubes to isolate RNA containing lysing components in a lower concentration. Vortex it until the sorbent is completely resuspended, centrifuge the tubes in a microcentrifuge at 10 thousand rpm for 30 seconds and remove the supernatant from each tube with a separate tip using an aspirator with a flask trap.

9. Add 500 μl of the 3rd solution to the test tubes to isolate RNA based on salts and alcohol. Vortex it until the sorbent is completely resuspended, centrifuge the tubes in a microcentrifuge at 10 thousand rpm for 30 seconds and remove the supernatant from each tube with a separate tip using an aspirator with a flask trap.

10. Repeat step 9.

12. Add 400 μl of the 4th solution to the tubes to isolate RNA containing acetone. Vortex it until the sorbent is completely resuspended, centrifuge the tubes in a microcentrifuge at 10 thousand rpm for 30 seconds and remove the supernatant from each tube with a separate tip using an aspirator with a flask trap.

11. Leave the tubes with the caps open at room temperature for 10 minutes. until the sorbent is completely dry.

13. Resuspend the sorbent in 200 μl of elution solution using a vortex. Warm up in a thermostat at a temperature of 60 ° C for 5 minutes, mix on a vortex and sediment the sorbent in a centrifuge at maximum microcentrifuge revolutions (12-14.5 thousand rpm) for 2 minutes. The supernatant contains purified RNA.

When setting up the amplification reaction, the sorbent should not be allowed to enter the reaction mixture.

Example 3. The procedure for the amplification of RNA virus kit of reagents.

Amplification kit complete set for 72 reactions for rotary type amplifiers

The reaction mixture, dispensed in 25 μl in 72 tubes per 0.2 ml of type eppendorf.

The negative control sample is OKO –1 ml.

Positive control sample - FFP 200 μl.

A mixture of enzymes - 36 μl.

Prepare the required number of tubes with the reaction mixture from the kit and arrange in accordance with a pre-prepared protocol.

Thaw the contents of the tubes completely.

If necessary, if part of the solution is on the inside of the tube cap, centrifuge the tubes for 3-5 seconds on a micro-centrifuge-vortex.

Add 0.5 µl of enzyme solution to all tubes with a tip with an aerosol filter.

Add to each tube with individual tips with aerosol filters of 10 μl:

in vitro negative control sample - OKO;

in test tubes of test samples — test RNA samples;

in a test tube of a positive control sample - FFP.

To reduce the risk of contamination, samples should be added in this order. The tube into which the sample was introduced should be immediately closed with a lid if possible.

Tubes are tightly closed and centrifuged for 15 seconds in a centrifuge or microcentrifuge-vortex.

Transfer the tubes to the instrument and carry out amplification and detection according to the instructions.

Tubes are tightly closed and centrifuged for 15 seconds in a centrifuge or microcentrifuge-vortex.

Create a sample location protocol.

To work with a set of reagents, the following channels are proposed:

HEX (specific signal)

FAM (internal control signal)

The amplification products are detected automatically by the device in each amplification cycle. Based on these data, the control program constructs the fluorescence signal accumulation curves for each of the channels specified for the samples.

The device was programmed as follows:

1 cycle of reverse transcription at 60 ° C for 15 minutes;

1 incubation cycle at 96 ° C for 2 minutes;

40 cycles of amplification: denaturation at 95 ° C for 15 seconds;

        annealing at 60 ° C for 25 seconds.

Example 4. Interpretation of the detection results.

If the Ct value on the HEX / Yellow channel is less than 35, then a specific pathogen nucleic acid is detected in the sample.

If the Ct value is absent on the HEX / Yellow channel, no specific pathogen nucleic acid was detected.

If the Ct value on the HEX / Yellow channel is more than 35, and on the FAM / Grean channel the Ct value is less than 37, then the result is doubtful.

If the Ct value on the HEX / Yellow channel is more than 35 or absent, and on the FAM / Grean channel the Ct value is more than 37 or absent, the result is invalid.

Repeated production is required if a dubious result is obtained:

in the FFP sample on the FAM / Green, HEX / Yellow channels there are no Ct or Ct values greater than 30 cycles (unreliable analysis result);

in the OKO sample on the FAM / Green, HEX / Yellow channels, there is a Ct value (unreliable analysis result);

for an invalid result (a repeat analysis of this sample from the isolation step is required; if express isolation was used, it is recommended to replace it with a sorbent one).

Obtaining Ct values for JCE and questionable results of the study may indicate the presence of intralaboratory contamination. It is recommended that decontamination measures be carried out before repeated PCR testing of the sample.

Although the invention has been described with reference to the disclosed embodiments, it should be apparent to those skilled in the art that the specific cases described in detail are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way. It should be understood that various modifications are possible without departing from the gist of the present invention.

Claims (9)

1. A kit for detecting RNA of the Gumboro disease virus, wherein said kit includes oligonucleotides having the following sequences: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, wherein the oligonucleotide with the sequence SEQ ID NO: 3 contains a fluorescent the HEX dye is attached at its 5'-end or 3'-end by covalent bonding and contains a BHQ1 fluorescence quencher attached at the opposite end of the dye to the indicated oligonucleotide via covalent bonding. 2. The kit according to claim 1, further comprising enzymes - DNA polymerase and reverse transcriptase, as well as a mixture of four different deoxyribonucleotides. 3. The kit of claim 1, wherein the DNA polymerase is Taq DNA polymerase. 4. A method for diagnosing the Gamboro disease virus in birds, comprising at least the following steps: (a) take a sample of biological material from a bird suspected to be infected with the virus; (b) isolate RNA from the specified sample; (c) carry out a PCR reaction using the kit according to any one of claims 1 to 3; (d) upon detection of a signal in said PCR reaction, the presence of the Gamboro disease virus in the organism of said bird is detected. 5. The method according to p. 4, characterized in that the biological material is lymphoid tissue.

Images