RU2658428C9 - Agent for treatment of human body states related to p4ha1 gene reduced expression and/or reduced quantity of prolyl 4-hydroxylase alpha 1 protein on basis of gene-therapeutic substances with p4ha1 gene, method of manufacture and operation - Google Patents

Abstract

FIELD: biology.SUBSTANCE: invention relates to molecular biology, biotechnology, genetic engineering and medicine and is a means for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and/or a decrease in the amount of protein spilled 4-hydroxylase alpha 1, based on gene therapy substances with the P4HA1 gene, at least one gene therapeutic substance selected from the group of gene therapeutic substances, each representing a genetic construct based on a vector plasmid comprising the cDNA of the P4HA1 gene, with the coding sequence of the protein spilled 4-hydroxylase alpha 1, with deletions 5'- and 3'-non-translated regions, namely the unmodified cDNA gene obtained from the site P4HA1 SEQ ID No: 1, or a modified cDNA of the P4HA1 gene, wherein the modified cDNA of the P4HA1 gene is SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level of expression of the P4HA1 gene in eukaryotic cells.EFFECT: invention effectively increases the amount of protein spilled 4-hydroxylase alpha 1 in eukaryotic cells and to obtain a highly effective agent for the treatment of human body conditions associated with a decrease in the level of expression of the P4HA1 gene and/or a decrease in the amount of the prolyl 4-hydroxylase alpha 1 protein.7 cl, 20 dwg, 18 ex

Description

The scope of the invention

The invention relates to molecular biology, biotechnology, genetic engineering and medicine and can be used to correct the pathological conditions of cells of various organs and tissues, as well as the human organs and tissues associated with a decrease in the expression level of the P4HA1 gene and / or a decrease in the amount of prolyl protein 4- hydroxylase alpha 1, in particular, for therapeutic purposes.

Previous level

Collagen glycoprotein is the most abundant protein not only in the extracellular matrix, but also throughout the human body. It makes up one third of all body proteins and 70% of all skin proteins. Collagen is the basis of connective tissue, the structural basis of the skin, cartilage, synovial fluid of the joints, bronchi, lung tissue, vascular wall, intervertebral discs, intestinal walls and stomach. In collagen, one-third of amino acid residues is glycine and another third is for proline and hydroxyproline. Hydroxyproline, represented in collagen by a very large number of residues, stabilizes the triple helix of collagen in relation to the action of proteases. In this connection, collagen provides structural support to the tissue, gives it strength and durability.

Collagen is synthesized in fibroblasts as a high molecular weight precursor procollagen. Collagen polypeptide chains are synthesized on membrane-bound ribosomes and enter the lumen of the endoplasmic reticulum in the form of larger precursors (pro-alpha chains) with additional amino acid residues (propeptides) at the N- and C-termini, as well as a short N-terminal signal peptide, necessary for admission of the resulting polypeptide into the endoplasmic reticulum. Further, some residues of proline and lysine are hydroxylated. The hydroxyl groups of these amino acids form intercoiled hydrogen bonds, which is necessary for the correct three-dimensional folding of newly synthesized procollagen chains.

The formation of hydroxyprolyl and hydroxylyl is catalyzed by iron-containing enzymes — prolyl hydroxylase and lysyl hydroxylase, which are found in the microsomal fraction of many tissues (skin, liver, lungs, heart, skeletal muscle, granulating wound surfaces). These enzymes are peptidyl hydroxylases, since hydroxylation occurs only after incorporation of proline or lysine into the polypeptide chain.

Prolyl-4-hydroxylase is an oxidoreductase class enzyme that catalyzes hydroxylation at position 4 of specific proline residues in the nascent procollagen chains. The enzyme requires Fe2 + activity, ascorbate and α-ketoglutarate for activity, and the reaction is necessary for the thermal stability of the triple helix structure of collagen. The enzyme is a tetramer containing 2α- and 2β-chains; The β chain in monomeric form is an enzyme disulfide isomerase of proteins. At the same time, the α-subunit contains catalytic and peptide-substrate binding domains, but is inactive in the absence of the β-subunit. The enzyme is an oxygenase with a mixed function and functions with the participation of molecular oxygen.

In vitro expression of active recombinant prolyl-4-hydroxylase from its subunits was successfully obtained by co-infection of insect cells Spodoptera frugiperda and Trichoplusia ni (Vuori, K., et al. (1992) Proc Natl Acad Sci USA 89, 7467-7470) with recombinant baculoviruses or cotransfection with expression vectors in mammalian cell lines COS-1 (John, DC and Bulleid, NJ (1996) Biochem J 317 (Pt 3), 659-665) and HEK293 (Wagner, K., et al. (2000) Biochem J352 Pt 3, 907-911), in Pichia pastoris yeast (Vuorela, A., et al. (1997) Embo J16, 6702-6712) and Saccharomyces cerevisiae (Toman, PD et al. (2000) J Biol Chem 275 23303-23309).

The expression systems for the production of recombinant collagens are also E. coli cells, transgenic animals and plants. However, almost all of the above expression systems have their drawbacks. For example, the E. coli expression system does not have post-translational modification, and the yeast expression system does not have prolyl-4-hydroxylase activity, although the yield of collagens in Pichia pastoris is the highest among these expression systems. The mammalian cell line expression system has a low yield and limits for specific types of tissue, and the insect cell expression system has a low prolyl-4-hydroxylase activity. As for transgenic animals (silkworm or mice) or plants (tobacco), in them the products of collagen were excessively “sewn”. In addition, it is difficult to restore or purify recombinant collagens due to cell lysis. Therefore, the creation of an effective expression system for the production of high-yield collagens is very important.

Known gene P4HA1 prolyl 4-hydroxylase alpha polypeptide I Homo sapiens, encoding the catalytic α (I) subunit of the main isoenzyme C-P4H (C-P4H-I) (https://cgwb.nci.nih.gov/cgi-bin/ hgGene? hgg_gene = uc001jth.3 & hgg_prot = Q5VSQ6 & hgg_chrom = chr10 & hgg_start = 74766979 & hgg_end = 74856732 & hgg_type = knownGene & db = hg19 & hgsid = 1030298). The P4HA1 gene is located at position 10q22.1 of the chromosome, has a length of more than 69 kb, and consists of 16 exons. The P4HA1 gene protein catalyzes the formation of 4-hydroxyproline, which is necessary for the correct three-dimensional folding of newly synthesized procollagen chains.

Human biallelic P4HA1 gene mutations were studied in a family with congenital connective tissue disorder, which manifested itself as early articular hypermobility, articular contractures, muscle weakness and bone dysplasia, as well as high myopia, confirming clinical improvement in motor function over time in the surviving patient. As in the null P4ha1 mice that die prenatally, muscle tissue from the P1 and P2 generations showed reduced immunoreactivity of collagen IV on the membrane of the basal muscle. Patients were heterozygous for the mutant gene, which resulted in a decrease, but not absence, of the P4HA1 protein level and C-P4H prolyl-4-hydroxylase activity in dermal fibroblasts compared to control samples. Differential scanning calorimetry showed reduced thermal stability of collagen in dermal fibroblasts obtained from patients, compared with control samples. Mutations affecting the C-P4Hs family of proteins and, in particular, C-P4H-I, should be considered in patients with congenital connective tissue / myopathy disorders with joint hypermobility, contractures, mild skeletal dysplasia and high myopia (Yaqun Zou, Sandra Donkervoort et al. Human Molecular Genetics, Volume 26, Issue 12, June 15, 2017, pages 2207-2217, https://doi.org/10.1093/hmg/ddx110).

WO 2014170460 (A2) describes a method for obtaining collagen from sea sponges (Chondrosia reniformis) in Pichia pastoris yeast. In particular, three vector designs were created:

- with the cDNA encoding the alpha subunit of the prolyl-4-hydroxylase (pPinkHC \ <ho pPinkLC \ and vectors),

- with the cDNA encoding the beta-subunit of the prolyl-4-hydroxylase (pPIC6B \ PDI-vector),

- with cDNA encoding non-fibrillar collagen protein C. Reniformis (pPICZB \ ColCH).

The application describes a method which involves the joint transformation of a yeast strain with two different vectors containing: the first is the coding sequence for the alpha subunit, the second is the coding sequence of the beta subunit of the enzyme prolyl-4-hydroxylase, followed by transformation with a vector containing one coding sequence of marine sponge collagen protein.

The disadvantage of this approach is that the expression system of yeast cells, which according to the literature does not possess significant prolyl-4-hydroxylase activity, is chosen for the expression of the genes of the marine sponge prolyl 4-hydroxylase. This patent application does not consider the possibility of expression in human cells as a gene therapeutic agent, taking into account the individual characteristics of the patient, in connection with which a group of variations may be necessary for this agent.

For the prototype, the authors decided on the patent US 7759090 (B2), which describes an expression system for the production of collagen. In particular, stably transfected insect cell lines containing cDNA encoding human α and β subunits of human prolyl-4-hydroxylase in Trichoplusia ni and Drosophila melanogaster S2 cells are shown. Additionally, the participation of prolyl-4-hydroxylase in the assembly of three alpha chains with the formation of minicollagen XXI of the trimeric type, which contains an intact C-terminal non-collagen domain (NC1) and a collagen domain (COL1) in the Drosophila system, was characterized. Minicollagen XXI, co-expressed prolyl-4-hydroxylase, contained a sufficient amount of hydroxyproline to form heat-resistant pepsin-resistant triple helix.

One embodiment of the invention describes a recombinant insect cell comprising a transfected gene encoding prolyl 4-hydroxylase. This gene includes the α-subunit and / or β-subunit of the prolyl-4-hydroxylase. The recombinant insect cell further includes a transfected gene encoding a collagen (COL1) domain and a C1-terminal domain (NC1) of type XXI collagen.

The genes encoding the α-subunit and β-subunit of human prolyl-4-hydroxylase were cloned together in the pIZ / V5-His expression vector under the control of the OplE2 promoter derived from the polypeptide virus (in the InsectSelect system), and in the Drosophila inducible expression system (DES ®) (Invitrogen) the α-subunit and β-subunit prolyl-4-hydroxylase coding genes were cloned separately in the pMT / V5-HisA expression vector under the control of the metallothionein promoter, which is induced by the addition of copper or cadmium ions.

It was shown that P4Hα- and P4Hβ-subunits are able to assemble into the active α2β2 tetramer. The resulting prolyl-4-hydroxylase provides collagen synthesis with stable triple helix. The total activity of prolyl-4-hydroxylase in stably transfected Trichoplusia ni P4H cells increased only 2 times compared with the endogenous enzyme in the control without transfection of cells, and in the Drosophila S2 system, was 3-4 times higher than in the Trichoplusia ni system. This is due to the higher copy number of the recombinant plasmid vectors that were used to transfect the genome of Drosophila S2 cells. Comparison of the levels of P4Hα and P4Hβ expression in lysates of Trichoplusia ni cells showed that the expression level of the P4Hα protein is about 5 times less than that of P4Hβ. To express P4H in an inducible Drosophila expression system, Drosophila S2 cells were co-transfected with pMT / P4Hα, pMT / P4Hβ, and pCoHygro in a ratio of 10: 10: 1 using Effectene transfection reagent (Qiagen). Collagen domains were introduced into cells by transformation with the pMT / BiP-mC21 vector. Thus, recombinant collagen was obtained using the expression system of three genes in Drosophila melanogaster cells.

The disadvantage of this approach is that the system of expression of insect cells, which according to literature data has a low prolyl-4-hydroxylase activity, is chosen for the expression of human prolyl 4-hydroxylase subunit genes. Also, the possibility of expression in human cells as a gene therapeutic agent is not considered, taking into account the individual characteristics of the patient, in connection with which a group of variations may be needed for this agent.

DISCLOSURE OF INVENTION

The objective of this invention is the creation of highly effective means for treating conditions of the human body associated with a decrease in the expression level of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, based on the gene-therapeutic substances with the P4HA1 gene, which are a group of gene-therapeutic substances in which, taking into account the individual characteristics of the patient, an increase in the level of P4HA1 gene expression and / or an increase in the amount of prolyl 4-hydroxylase a fa 1 in cells of organs and tissues and / or organs and tissues

This problem is solved due to the fact that an agent has been created for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, based on the gene-therapeutic substances with the P4HA1 gene, which is at least one gene therapeutic substance selected from the group of gene therapeutic substances, each of which represents a genetic construct based on a vector plasmid, including the cDNA of the P4HA1 gene, encoding the latter with prolyl 4-hydroxylase alpha 1 protein, with deletions of 5'- and 3'-untranslated regions, namely, obtained on the basis of the region of unmodified cDNA of the P4HA1 gene SEQ ID No: 1, or modified cDNA of the P4HA1 gene, while as a modified cDNA P4HA1 gene uses SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level of expression of the P4HA1 gene in eukaryotic cells, in particular in cells human organs and tissues, and capable of increasing the amount of prolyl 4-hydroxylase alpha 1 protein in the cells of organs and tissues and / or human organs and tissues, in particular in hematopoietic cells, or mesenchymal stem cells, or chondroblasts, or myocytes, or myoblasts, or fibroblasts, or osteoblasts, or keratocytes, or epithelial cells, or corneal cells, or endothelial cells, or epithelial cells, in combination with or without a transport molecule when transfected with these gene-therapeutic substances mi cells of human organs and tissues and / or in human organs and tissues, in particular, in connective tissue structures, or skin, or joints, or cartilage tissue, or bone tissue, or muscle tissue, or tendons, or ligaments, or blood vessels or the wall of the arteries, or the cornea of the eye, or the sclera, or the placenta, or dentin, or the stroma of the internal organs in combination with or without a transport molecule with the introduction of these gene-therapeutic substances into human organs and tissues. At the same time, the genetic construct with the modified cDNA of the P4HA1 gene contains a nucleotide sequence that includes the protein coding region of the P4HA1 cDNA, which carries modifications that do not affect the structure of the prolyl 4-hydroxylase alpha 1 protein, namely: nucleotide substitutions that do not lead to amino acid substitutions or breakage of the amino acid chain. Or a genetic construct with a modified cDNA of the P4HA1 gene contains a nucleotide sequence that includes the protein coding region of the cDNA of the P4HA1 gene, which carries modifications affecting the structure of the prolyl 4-hydroxylase alpha 1 protein, namely nucleotide substitutions leading to amino acid substitutions or breakage of the amino acid chains. Or a genetic construct with a modified cDNA of the P4HA1 gene contains a nucleotide sequence that includes the protein coding region of the cDNA of the P4HA1 gene, which carries modifications that do not affect the structure of the prolyl 4-hydroxylase alpha 1 protein, namely: nucleotide substitutions that do not lead to amino acid substitutions or breakage of the amino acid chain, in combination with modifications affecting the structure of the protein prolyl 4-hydroxylase alpha 1, namely: nucleotide substitutions leading to amino acid substitutions or breakage of amino acid enu. Liposomes or dendrimers of the 5th generation and above, or amphiphilic block copolymers, or transfection reagent based on Polyethylenimine (PEI) are used as a transport molecule.

The method of obtaining agents for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein consists in obtaining each gene therapeutic substance from the group of gene therapeutic substances, thereby obtaining the cDNA of the P4HA1 gene, then cDNA is placed in a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, increasing and isolating the required amount of genetic construct ktsii, then combine the genetic construct with a transport molecule to transfect the resulting gene-therapeutic substance of the cells of organs and tissues and / or introduce the resulting gene-therapeutic substance into human organs and tissues, using the cDNA of the P4HA1 gene with the coding sequence of the prolyl 4-hydroxylase alpha protein 1, with deletions of 5'- and 3'-untranslated regions, namely, obtained on the basis of a portion of the unmodified cDNA of the P4HA1 gene SEQ ID No: 1, or of the modified cDNA of the P4HA1 gene, while as a modification p4NA1 gene is used, or SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination these genetic constructs.

A method of using an agent for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, which consists in transfecting a gene therapeutic substance selected from the group of created gene-therapeutic substances, organ cells and tissues of the patient and / or in the introduction into the patient's organs and tissues of autologous patient cells transfected with a gene therapeutic substance selected from the group of gene therapeutic substances created According to claim 1, and / or in the introduction into the patient's organs and tissues of a gene therapeutic substance or several substances selected / selected from the group of gene therapeutic substances created according to claim 1., or a combination of the indicated methods.

List of figures

FIG. one

The nucleotide sequence of the unmodified cDNA of the P4HA1 gene is presented, the sequence of which is homologous to that given in the GenBank database under the number NM_000917 P4HA1SEQ ID No: 1.

FIG. 2

The nucleotide sequence of the modified cDNA of the gene P4HA1, SEQ ID No: 2, which

contains 2 nucleotide substitutions G> C in positions 730, 790; 3 nucleotide substitutions T> G in positions 511, 649, 1123; 4 nucleotide substitutions A> G in positions 487, 502, 646, 727; 2 nucleotide substitutions T> C in positions 500, 644, which do not lead to changes in the amino acid sequence of the protein prolyl 4-hydroxylase alpha 1.

FIG. 3

The nucleotide sequence of the modified cDNA of the gene P4HA1, SEQ ID No: 3, which

contains 3 nucleotide substitutions G> C in positions 730,790,1828; 6 nucleotide substitutions T> G in positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G in positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C in positions 500, 644, which do not lead to changes in the amino acid sequence of the protein prolyl 4-hydroxylase alpha 1.

FIG. four

The nucleotide sequence of the modified cDNA of the gene P4HA1, SEQ ID No: 4, which

contains 28 non-synonymous nucleotide substitutions: 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 13370T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 G> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, leading to changes in the amino acid sequence of the protein prolyl 4-hydroxylase alpha 1.

FIG. five

The nucleotide sequence of the modified cDNA of the gene P4HA1, SEQ ID No: 5 is presented, which contains 28 non-synonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 1337 C> T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 C> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, leading to changes in the amino acid sequence of the protein prolyl 4-hydroxylase alpha 1, as well as 3 nucleotide G> C substitutions at positions 730, 790, 1828; 6 nucleotide substitutions T> G in positions 511, 649, 1123, 1192, 1249, 1801; 6 nucleotide substitutions A> G in positions 487, 502, 646, 727, 1429, 1816; 2 nucleotide substitutions T> C in positions 500, 644.

FIG. 6

The nucleotide sequence of the modified cDNA of the gene P4HA1, SEQ ID No: 6, which

contains a deletion from 1490 to 1544 bp, resulting in changes in the amino acid sequence of the prolyl 4-hydroxylase alpha 1 protein.

FIG. 7

The nucleotide sequence of the modified cDNA of the gene P4HA1, SEQ ID No: 7, which

contains 3 nucleotide substitutions G> C in positions 730, 790, 1828; 6 nucleotide substitutions T> G in positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G in positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C in positions 500, 644; a deletion from 1490 to 1544 bp, resulting in changes in the amino acid sequence of the prolyl 4-hydroxylase alpha 1 protein.

FIG. eight

For the purpose of subsequent correct determination of the gene-therapeutic effect after transfection of fibroblasts with the gene-therapeutic substance with the cDNA of the P4HA1 gene, analysis of the endogenous expression of the P4HA1 gene in the culture of primary fibroblasts was performed. The figure shows the graphs of the accumulation of polymerase chain reaction (PCR) products, corresponding to:

1 - cDNA of the P4HA1 gene, fibroblasts with reduced expression of the P4HA1 gene

2 - cDNA of the gene P4HA1, fibroblasts with normal expression of the gene P4HA1

3 - B2M cDNA, fibroblasts with reduced P4HA1 gene expression

4 - B2M cDNA, fibroblasts with normal expression of the P4HA1 gene

The B2M gene (Beta-2-microglobulin) listed in the GenBank database under the number NM 004048.2 was used as a reference gene.

FIG. 9

In order to confirm the increase in P4HA1 gene expression in fibroblast cell culture with reduced P4HA1 gene expression when these cells are transfected with the gene therapeutic substance from the P4HA1 gene cDNA, the accumulation graphs of PCR products corresponding to:

1 - cDNA of the P4HA1 gene in fibroblasts with normal expression of the P4HA1 gene,

2 - cDNA of the P4HA1 gene in fibroblasts with reduced expression of the P4HA1 gene prior to transfection of HTS from the cDNA of the P4HA1 gene

3 - cDNA of the P4HA1 gene in fibroblasts with reduced expression of the P4HA1 gene after transfection of HTS from the cDNA of the P4HA1 gene

4 - cDNA of the P4HA1 gene in fibroblasts with reduced expression of the P4HA1 gene after transfection with a vector without the cDNA of the P4HA1 gene

5-cDNA of the B2M gene in fibroblasts with normal expression of the P4HA1 gene,

6-cDNA of the B2M gene in fibroblasts with reduced expression of the P4HA1 gene prior to transfection of HTS from the cDNA of the P4HA1 gene

7-cDNA of the B2M gene in fibroblasts with reduced expression of the P4HA1 gene after transfection of HTS from the cDNA of the P4HA1 gene

8 - B2M cDNA in fibroblasts with reduced P4HA1 gene expression after transfection with a vector without the P4HA1 gene cDNA

From the graphs, it follows that in the case of transfection with a vector without inserting the cDNA of the P4HA1 gene, the level of the cDNA of the P4HA1 gene in fibroblasts did not change, and in the case of transfection with a vector with the P4HA1 cDNA, the level of fibroblast cDNA P4NA1 gene in normal fibroblasts).

FIG. ten

In order to confirm the increase in the amount of prolyl 4-hydroxylase alpha 1 protein in fibroblast cell culture with normal expression of the P4HA1 gene when these cells are transfected with the gene-therapeutic substance containing the P4HA1 cDNA gene, a graph of the change in the amount of prolyl 4-hydroxylase alpha 1 of untransfected fibroblasts (culture A) is presented transfected with pCDNA 3.1 (+) vector not containing P4HA1 cDNA (culture B) and transfected with a gene therapeutic substance based on the genetic construct pCDNA 3.1-P4HA1SEQ ID No: 1 (to ultura C). It follows from the graph that upon transfection of fibroblasts with a gene therapeutic substance with the cDNA of the P4HA1 gene, the amount of prolyl 4-hydroxylase alpha 1 in the cell lysate increases.

FIG. eleven

In order to confirm the increase in the amount of protein prolyl 4-hydroxylase alpha 1 in human skin, when fibroblasts are injected into the cell culture cell, the transfected gene-therapeutic substance provides an analysis of the change in the amount of prolyl protein 4-hydroxylase alpha 1 in patients' skin. At the same time, three variants of autologous fibroblast culture were introduced to the patients - non-transfected (A), transfected with the vector pCMV6-XL5 (B) and transfected with the gene-therapeutic substance based on pCMV6-P4HA1SEQ ID No: 7 (C) - into the forearm skin. The quantitative protein level of prolyl 4-hydroxylase alpha 1 in intact skin was also analyzed. An increase in the amount of prolyl 4-hydroxylase alpha 1 protein in the patient's skin in the injection area of fibroblasts transfected with the gene-therapeutic substance with the cDNA of the P4HA1 gene (C) was shown.

FIG. 12

In order to confirm the increase in the amount of prolyl 4-hydroxylase alpha 1 protein to various individual levels in cell cultures of fibroblasts of patients when these cells are transfected with genetically therapeutic substances with modified and unmodified cDNA of the P4HA1 gene, depending on the presence and type of one or another modification of the cDNA of the gene P4HA1 presents an analysis of changes in the quantitative level of prolyl 4-hydroxylase alpha 1 protein in human skin fibroblast cultures depending on the presence and type of modifications in the kDN R4NA1 gene used to transfect fibroblasts.

Fibroblast cultures 28 patients were divided into 8 parts each from (A) to (H); the first parts (A) of cell cultures of patients were transfected with the pCMV6-P4HA1SEQ ID No: 1 gene-therapeutic substance, parts (B) were transfected with the pCMV6-P4HA1SEQ ID No: 2 gene-therapeutic substance, parts (C) were transfected with the pCMV6-P4HA1SEQ gene-therapeutic substance ID No: 3, parts (D) were transfected with the gene-therapeutic substance pCMV6-P4HA1SEQ ID No: 4, parts (E) were transfected with the gene-therapeutic substance pCMV6-P4HA1SEQ ID No: 5, parts (F) were transfected with the gene-therapeutic substance pCMV6- P4HA1SEQ ID No: 6, Part (G) Transfected with the Gene-Therapeutic Substance pCM V6-P4HA1SEQ ID No: 7, part (H) was transfected with the vector plasmid that did not contain the cDNA of the P4HA1 gene.

According to the analysis of the quantitative protein level of prolyl 4-hydroxylase alpha 1, indicators were selected regarding each part of the cell culture from each patient, which showed the highest amount of prolyl protein 4-hydroxylase alpha 1 and combined them into seven groups, based on the following criteria:

In group 1, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1SEQ ID No: 1,

in group 2, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1 SEQ ID No: 2,

in group 3, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1 SEQ ID No: 3,

in group 4, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1 SEQ ID No: 4,

in group 5, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1 SEQ ID No: 5,

in group 6, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1 SEQ ID No: 6,

in group 7, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of pCMV6-P4HA1 SEQ ID No: 7.

None of the cell cultures showed that the greatest amount of prolyl 4-hydroxylase alpha 1 protein is present when transfected with a vector without the insertion of the cDNA of the P4HA1 gene.

Figure 12 for each group of cell cultures shows diagrams of protein concentration of prolyl 4-hydroxylase alpha 1 (averaged within the group, if the group includes more than one cell culture) for all genetically therapeutic substances participating in the experiment, after transfection of these cell cultures with gene-therapeutic substances containing modified and unmodified cDNA of the P4HA1 gene.

It follows from the figure that achieving the highest amount of prolyl 4-hydroxylase alpha 1 in cultures of skin fibroblasts of various patients when they are transfected with gene therapeutic substances is associated with the individual characteristics of patients and depends on the presence and type of modifications in the cDNA of the P4HA1 gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Legend:

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 1 (A)

portions of cell cultures transfected with CTA P4HA1 SEQ ID No: 1 (A)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 2 (B)

parts of cell cultures transfected with CTA P4HA1 SEQ ID No: 2 (B)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 3 (С)

parts of cell cultures transfected with CTA P4HA1 SEQ ID No: 3 (C)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 4 (D)

portions of cell cultures transfected with CTA P4HA1 SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 5 (Е)

portions of cell cultures transfected with CTA P4HA1 SEQ ID No: 5 (E)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 6 (F)

portions of cell cultures transfected with CTA P4HA1 SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 7 (G)

portions of cell cultures transfected with CTA P4HA1 SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

parts of cell cultures transfected with placebo (N)

FIG. 13

In order to confirm the increase in P4HA1 gene expression in keratocyte cell culture and epithelial cells of the cornea of the eye upon transfection of these cells with a gene therapeutic substance with the P4HA1 gene cDNA, the accumulation graphs of PCR products corresponding to:

1 - cDNA of the P4HA1 gene, keratocytes before transfection

2 - cDNA of the P4HA1 gene, corneal epithelium before transfection

3 - cDNA of the P4HA1 gene, keratocytes after transfection

4 - cDNA of the P4HA1 gene, corneal epithelium after transfection

5 - B2M cDNA, keratocytes before transfection

6 - B2M cDNA, corneal epithelium before transfection

7 - B2M cDNA, keratocytes after transfection

8 - B2M cDNA, corneal epithelium after transfection

The B2M gene was used as a reference.

From the figure, it follows that as a result of transfection, the level of the specific cDNA of the P4HA1 gene in the culture of keratocytes and in the culture of the epithelium repeatedly increased.

FIG. 14

In order to confirm the increase in P4HA1 gene expression in cell culture of chondroblasts, upon transfection of these cells with the gene therapeutic substance from the cDNA of the P4HA1 gene, graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the P4HA1 gene, before transfection

2 - cDNA of the P4HA1 gene, after transfection

3 - B2M cDNA, before transfection

4 - B2M cDNA, after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of the specific cDNA of the P4HA1 gene increased many times.

FIG. 15

In order to confirm the increase in the amount of protein prolyl 4-hydroxylase alpha 1 in human skin with the introduction of the gene-therapeutic substance into the skin, an analysis of changes in the quantitative level of prolyl protein 4-hydroxylase alpha 1 in the skin is presented. At the same time, the patient was injected with a gene therapeutic substance containing the genetic construct pCMV6-P4HA1 SEQ ID No: 4 (B) with a transport molecule and placebo in parallel, which is a combination of the vector plasmid pCMV-XL5 not containing the cDNA of the P4HA1 gene with the transport molecule (A) - in the skin of the forearm. An increase in the amount of prolyl 4-hydroxylase alpha protein was shown in patient's skin biopsy specimen of patient 1B, which was injected with a gene therapeutic substance containing the genetic construct with the cDNA of the P4HA1 gene, indicating the effectiveness of the gene therapeutic substance.

Legend:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of GTS

FIG. sixteen

In order to confirm the increase in the amount of protein, prolyl 4-hydroxylase alpha 1

in human cartilage tissue with the introduction of the gene-therapeutic substance into the cartilage tissue, the analysis of the change in the quantitative level of prolyl 4-hydroxylase alpha 1 in cartilage tissue is presented. At the same time, the patient was injected with a gene-therapeutic substance containing a vector plasmid with the cDNA of the gene P4HA1pCDNA 3.1 P4HA1SEQ ID No: 5 (B) with a transport molecule and in parallel was administered a placebo pCDNA 3.1 (+), which is a combination of a vector plasmid that does not contain the cDNA of the P4HA1 gene with transport molecule (A) - in the cartilage tissue.

An increase in the quantitative protein level of prolyl 4-hydroxylase alpha was shown in the lysate of the cartilage tissue biopsy specimen of patient 1B, which was injected with a gene therapeutic substance containing the genetic construct with the P4HA1 gene cDNA, which indicates the effectiveness of the gene therapeutic substance.

Legend:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of GTS

FIG. 17

In order to confirm the increase in the amount of protein prolyl 4-hydroxylase alpha 1 in human muscle tissue with the introduction of the gene-therapeutic substance into muscle tissue, an analysis of the change in the amount of prolyl protein 4-hydroxylase alpha 1 in muscle tissue is presented. At the same time, the patient was injected with a gene-therapeutic substance containing the vector plasmid with the cDNA of the gene P4HA1-pCMV6-Kan / Neo P4HA1SEQ ID No: 6 (B) with the transport molecule and in parallel was administered the placebo pCMV6-Kan / Neo, which is a combination of the vector plasmid not containing cDNA of the P4HA1 gene with a transport molecule (A) - into the muscle tissue in the area of the forearm. An increase in the amount of prolyl 4-hydroxylase alpha 1 protein was shown in the muscle tissue biopsy specimen of patient 1B, which was injected with a gene therapeutic substance containing the genetic construct with the cDNA of the P4HA1 gene, which indicates the effectiveness of the gene therapeutic substance.

Legend:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of GTS

FIG. 18

In order to confirm the increase in the amount of prolyl 4-hydroxylase alpha 1 protein to a different individual level, when genetically therapeutic substances with modified and unmodified cDNA of the P4HA1 gene were introduced into the skin of patients, the quantitative level of prolyl 4-hydroxylase alpha 1 protein in human skin was analyzed depending on the type and type modifications in the cDNA of the P4HA1 gene.

Each of the 24 patients selected at random was injected into the skin of the forearm 7 gene-therapeutic substances pCMV6- SEQ ID No: 1, pCMV6- SEQ ID No: 2, pCMV6-SEQ ID No: 3, pCMV6-SEQ ID No : 4, pCMV6- SEQ ID No: 5, pCMV6-SEQ ID No: 6, pCMV6-SEQ ID No: 7, and placebo pCMV6-XL5.

According to the analysis of the amount of protein prolyl 4-hydroxylase alpha 1 in biopsy samples, indicators were selected for each biopsy from each patient, which showed the highest quantitative levels of prolyl protein 4-hydroxylase alpha 1 and combined them into seven groups, based on the following criteria:

In group 1, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the administration of pCMV6-P4HA1 SEQ ID No: 1,

in group 2, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 2,

in group 3, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the administration of pCMV6-P4HA1 SEQ ID No: 3,

in group 4, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the administration of pCMV6-P4HA1 SEQ ID No: 4,

in group 5, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the administration of pCMV6-P4HA1 SEQ ID No: 5,

in group 6, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the administration of pCMV6-P4HA1 SEQ ID No: 6,

in group 7, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 7.

None of the biopsy specimens showed that the greatest amount of prolyl 4-hydroxylase alpha 1 was present when placebo was administered.

Figure 18 for each group of biopsy specimens shows diagrams of protein concentration of prolyl 4-hydroxylase alpha 1 (averaged within the group, if the group includes more than one biopsy) for all genetically-therapeutic substances participating in the experiment, after administration to patients of these gene-therapeutic substances containing modified and unmodified cDNA of the P4HA1 gene.

From this example, it follows that achieving an increase in the amount of prolyl 4-hydroxylase alpha 1 in skin biopsies of various patients when they are injected into the skin with gene therapeutic substances is associated with individual patient characteristics and depends on the presence and type of modifications in the cDNA of the P4HA1 gene gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Legend:

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 1 (А)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 1 (A)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 2 (B)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 2 (B)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 3 (С)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 3 (C)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 4 (D)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 4 (D)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 5 (Е)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 5 (E)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 6 (F)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 6 (F)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 7(G)

biopsies of patients after administration of CTA P4HA1 SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (Н)

patient biopsy after placebo (N)

FIG. nineteen

In order to determine the gene-therapeutic substance most effective for a particular patient, the quantitative level of prolyl 4-hydroxylase alpha 1 protein in the cell lysates of fibroblasts of this patient, transfected with various genetic constructs containing unmodified or modified cDNA of the P4HA1 gene, was analyzed.

According to the analysis of the amount of prolyl 4-hydroxylase alpha 1 protein in a patient's fibroblast culture, a variant of the gene therapeutic substance was isolated, transfected with the highest concentration of prolyl 4-hydroxylase alpha 1 protein in the cell culture lysate. In this experiment, the highest concentration of prolyl 4-hydroxylase alpha 1 protein in the lysate was observed upon transfection with a gene-therapeutic substance based on pCMV6-P4HA1SEQ ID No: 3, containing the modified P4HA1 cDNA as shown in figure 19.

Thus, the most effective gene therapeutic substance applied to this patient was chosen for subsequent transfection of the patient’s cells as part of a therapeutic procedure.

Legend:

1 - cell lysate after transfection of CTA P4HA1SEQ ID No: 1 (A)

2 - cell lysate after transfection of CTA P4HA1SEQ ID No: 2 (B)

3 - cell lysate after transfection of CTA P4HA1SEQ ID No: 3 (C)

4 - cell lysate after transfection of CTA P4HA1SEQ ID No: 4 (D)

5 - cell lysate after transfection of CTA P4HA1SEQ ID No: 5 (E)

6 - cell lysate after transfection of CTA P4HA1SEQ ID No: 6 (F)

7 - cell lysate after transfection of CTA P4HA1SEQ ID No: 7 (G)

8 - cell lysate after placebo transfection (H)

FIG. 20

In order to determine the gene-therapeutic substance most effective for a specific patient, the amount of prolyl 4-hydroxylase alpha 1 protein was analyzed in the lysates of this patient’s skin biopsy specimens after administering to it gene-therapeutic substances containing unmodified or modified cDNA of the P4HA1 gene.

According to the results of analyzing the amount of prolyl 4-hydroxylase alpha 1 protein, a variant of the gene therapeutic substance was isolated in the lysate of the patient's skin biopsy specimens, with the introduction of which revealed the highest concentration of prolyl protein 4-hydroxylase alpha 1 in the biopsy lysate. In this experiment, the highest concentration of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of a gene-therapeutic substance based on pCMV6 P4HA1SEQ ID No: 4, containing the modified P4HA1 cDNA, as shown in figure 20.

Thus, the most effective gene-therapeutic substance with respect to this patient was chosen for its subsequent administration to the patient as part of a therapeutic procedure.

Legend:

1 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 1 (A)

2 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 2 (B)

3 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 3 (C)

4 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 4 (D)

5 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 5 (E)

6 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 6 (F)

7 - lysate biopsy after the introduction of the CTA P4HA1 SEQ ID No: 7 (G)

8 - lysate biopsy after administration of placebo (H)

Implementation of the invention.

With a decrease in the expression of genes encoding collagen synthesis proteins, for example, the P4HA1 gene, there is a decrease in the quality of the structure of the organs and tissues of the body. So mice, homozygous for zero mutation, demonstrate a high level of mortality during organogenesis in the embryonic period of development, the presence of capillary ruptures, and impaired formation of the basement membrane. http://www.jbc.org/content/282/4/2512.

The advantages of using the genetic construct with the P4HA1 gene to correct the expression of the P4HA1 gene and the amount of prolyl 4-hydroxylase alpha 1 protein in human organs and tissues:

1) it is easier to provide a higher and stable level of the target protein in the cells,

2) transportation of the gene-therapeutic substance to a larger spectrum of human organs and tissues cells, as well as more efficient intracellular transportation of the gene-therapeutic substance is provided.

3) individual patient characteristics are taken into account.

Thus, to create a group of gene therapeutic substances according to this invention, the P4HA1 gene was chosen, rather than the prolyl 4-hydroxylase alpha 1 protein encoded by this gene.

To obtain a group of gene therapeutic substances, the following actions are carried out:

1. Obtaining a region of unmodified cDNA of the P4HA1 gene containing the protein coding region of the P4HA1 gene and deletion of 5'-untranslated regions or deletion of 3'-untranslated regions, cloning it into an intermediate plasmid, re-cloning it into expression vector plasmids under the control of eukaryotic regulatory elements for expression target gene in such a way that the resulting genetic constructs contain the coding nucleotide sequence of the prolyl 4-hydroxylase alpha 1 cDNA sequence, which is a region of modified cDNA of the P4HA1 gene and which is used for further modifications.

2. Introduction of modifications to the nucleotide sequence of the P4HA1 gene to create a series of cDNAs of the P4HA1 gene, which ensure that the level of translation of the prolyl 4-hydroxylase alpha 1 protein sufficient to combat the pathological manifestations.

3. Cloning of the unmodified cDNA region of the P4HA1 gene and the modified cDNA of the P4HA1 gene obtained on its basis into vector plasmids capable of ensuring the effective expression of this cDNA in cells of human organs and tissues.

4. Transformation of each of the obtained genetic constructs of bacterial E.coli cells, analysis of transformed clones for the presence, orientation and copy number of the cDNA insert and building up the selected clones to obtain the required number of plasmid DNA variants for further work.

5. Isolation of a number of genetic constructions containing modified cDNA of the P4HA1 gene and a portion of the unmodified cDNA of the P4HA1 gene to create a group of gene-therapeutic substances on their base.

6. Creation of a group of gene therapeutic substances, each of which includes a genetic construct with modified cDNA of the P4HA1 gene and a portion of the unmodified cDNA of the P4HA1 gene, or a combination of this construct with a transport molecule for efficient transfection of various types of organ and tissue cells and / or introduction into organs and human tissue.

To prove the effectiveness of the created gene-therapeutic substances that lead to an increase in the expression of the P4HA1 gene, the following studies are carried out:

A) Growing cultures of various cell types from biopsy specimens of various human organs and tissues, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells.

B) Isolation of RNA from cell culture, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, and analysis of the expression of the P4HA1 gene from the genome of these cells.

C) Transfection of a cell culture, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, with gene-therapeutic substances containing the unmodified and / or modified cDNA of the P4HA1 gene and parallel transfection of the same cell culture with a vector plasmid that does not contain the cDNA gene P4HA1 in various combinations.

D) Comparative analysis of changes in cDNA level and / or changes in the amount of prolyl 4-hydroxylase alpha 1 protein after transfection in various cell combinations, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, with unmodified and therapeutically containing / or modified cDNA of the P4HA1 gene and parallel transfection of the culture of these same cells with a vector plasmid that does not contain the cDNA of the P4HA1 gene. This analysis is carried out, in particular, before the intended therapy in order to determine the gene-therapeutic substance most effective for the patient.

E) Introduction to patients in organs and tissues of cell culture with cDNA of the P4HA1 gene, for example, the introduction into the human skin of autologous fibroblasts transfected with the gene therapeutic substance with the cDNA of the P4HA1 gene and parallel administration to patients in organs and tissues, for example, in the skin, cultures these same untransfected and transfected cells without inserting the cDNA of the P4HA1 gene and / or introducing gene-therapeutic substances to patients in organs and tissues, for example, introducing non-modified genic-therapeutic substances into human skin bathroom and / or modified cDNAs R4NA1 and placebo in various combinations.

F) Comparative analysis of the amount of prolyl 4-hydroxylase alpha 1 protein in human organs and tissues, in particular in human skin, after the introduction of untransfected and transfected cells with gene-therapeutic substances containing the cDNA of the P4HA1 gene and vector plasmids that do not contain the cDNA of the P4HA1 gene and / or gene-therapeutic substances containing unmodified or modified cDNA of the P4HA1 gene, as well as placebo.

G) Introduction to patients in organs and tissues, for example, cartilage tissue, or muscle tissue, of gene-therapeutic substances containing unmodified and / or modified cDNA of the P4HA1 gene, as well as placebo.

H) Comparative analysis of the amount of prolyl 4-hydroxylase alpha 1 protein in human organs and tissues, in particular in cartilage tissue or human muscle tissue, after administration of gene-therapeutic substances containing unmodified and / or modified P4HA1 cDNA as well as placebo.

I) Introduction to patients in organs and tissues, for example, the introduction into the patient's skin of gene-therapeutic substances containing unmodified and modified cDNA of the P4HA1 gene.

J) Comparative analysis of the amount of prolyl 4-hydroxylase alpha 1 protein in the patient’s organs and tissues, in particular in the skin, after the administration of gene-therapeutic substances containing unmodified and modified cDNA of the P4HA1 gene. This analysis is carried out, in particular, before the intended therapy in order to select the gene-therapeutic substance that is most effective for a patient from the group of gene-therapeutic substances.

Example 1

Obtaining and cloning unmodified cDNA of the gene P4HA1.

The unmodified cDNA of the P4HA1 gene is a sequence of nucleotides that has high homology with the nucleotide sequence of the gene and the P4HA1 mRNA listed in the GenBank database under the number NM_000917; Nucleotides 242 through 1846 are translated into the amino acid sequence of the protein prolyl 4-hydroxylase alpha 1, corresponding to that given in GenBank under the number NP_000908.2.

Total RNA is obtained from human blood cells using the PAXGeneBlood RNA Kit (Qiagen, Germany) and used to produce total cDNA by reverse transcription using RevertAid reverse transcriptase (ThermoScientific, USA) and random 9-nucleotide primers according to the method of reverse transcriptase manufacturer. Then, using the total cDNA as a template and specific, pre-kinated primers complementary to nucleotides 162-181 5 'GGCGACTGGGGGTGAAGAG 3' (P4HA1-F1) and 2336-2314 5 'AGGGCAATCACATGGAACCCAGT 3' (P4HA1-R1) from the RR sequence patterns NM_ NM_000917), a region of unmodified cDNA of the P4HA1 gene is obtained, containing the coding sequence of the prolyl 4-hydroxylase alpha 1 protein, and partial deletions of the 5'- and 3'-untranslated regions. Polymerase chain reaction (PCR) is performed using Phusion DNA Polymerase (ThermoScientific, USA), giving blunt-ended products, on a Master CyclerGradient amplifier (Eppendorf, USA) in 50 μl. the reaction mixture containing 0.5 μl of the total cDNA of the first chain, 0.1 μM of each primer P4HA1 F1 and P4HA1 R1, 250 μM of each deoxynucleotide triphosphate (dATP, dCTP, dTTP and dGTP), 100 mM Tris-HCl (pH 8.85 at 20 ° C), 50 mM ammonium sulfate, 250 mM potassium chloride, 0.01% Tween-20 and 5 units. Pfu DNA polymerase (PhusionThermoScientific, USA) under the following conditions: initial denaturation at + 98 ° C for 30 s, 35 cycles, including denaturation at + 98 ° C for 10 s, annealing of primers at + 64 ° C for 30 with and elongation at + 68 ° C for 4 minutes.

The amplification product is isolated from the agarose gel using the QIAquickGelExtractionKit kit (Qiagen, Germany)

The amplified 2175 bp cDNA fragment carrying the unmodified cDNA region of the P4HA1 gene is cloned into the plasmid vector pUC19 (NEB, USA, cat number N3041S). DNA of the vector plasmid pUC19 (NEB, USA, catalog number N3041S) is hydrolyzed with a restriction enzyme, giving blunt ends, for example, Smal (NEB, USA) and treated with alkaline phosphatase. The amplified cDNA fragment and the linearized plasmid pUC19 are ligated with 400,000 units / ml phage T4 DNA ligase. (NEB, USA, cat number M0202S) at the rate of 1 μl of the enzyme per 1 μg of DNA. Ligation is carried out in a volume of 20 µl in the presence of 2 mM ATP, 50 mM Tris-HCl, pH 7.6, 10 mM MgCl ₂ , 10 mM DTT for 10 hours at + 16 ° C.

The resulting mixture transform E. coli Top 10 competent cells (http://molbiol.ru/protocol/03_04.html), which are seeded on L-agar Petri dishes containing 100 μg / ml ampicillin and 40 μl per cup of solutions 100 mM IPTG and 2% X-gal. Individual colonies are analyzed for the presence of the insert by PCR with primers P4HA1 - F1 and P4HA1 - R1 and confirmed by sequencing according to the Sanger method.

Example 2

Obtaining genetic constructs with a plot of unmodified cDNA of the gene P4HA1

For expression of a region of unmodified cDNA of the P4HA1 gene in cells of human organs and tissues, the cDNA version of the P4HA1 gene of Example 1 is placed in a vector plasmid, the choice of which uses the following selection criteria:

1) the plasmid must necessarily replicate in E. coli, preferably with a high copy number;

2) the plasmid must contain a bacterial selection factor, or another selection factor that does not contain antibiotic resistance genes;

3) the plasmid should contain eukaryotic regulatory elements - a mandatory promoter and terminator (polyadenylation signal), for example, an enhancer and intron (s) element (s);

4) the plasmid should have a convenient polylinker for cloning.

5) The plasmid may contain nucleotide sequences with regulatory elements for replication in mammalian cells, such as, for example, SV40 ori from the monkey virus SV40 or ori P / EBNA-1 from human Epstein-Barr.

6) The plasmid may also contain additional regulatory elements that enhance protein translation, for example, binding sites with the transcription factor NFkB, which ensures active transport of plasmid DNA into the cell nucleus for more efficient transcription of the target gene. Examples of such plasmids can be pCMV6-XL5, pCMV6-Kan / Neo (OriGene, USA), VTvaf17 (Cell and Gene Therapy Ltd, UK) or pCDNA 3.1 (+) (ThermoFisherScientific, USA), or plasmid vectors of viral origin - for example, human adenovirus 5th serotype.

When cloning a region of unmodified cDNA of the P4HA1 gene into pCDNA 3.1 (+), the coding nucleotide sequence is placed under the control of the human cytomegalovirus promoter CMV, which is effective in eukaryotic cells, and the bovine growth hormone gene signal. This plasmid also has a bacterial selection factor - the ampicillin resistance gene, and a eukaryotic selection factor - the neomycin resistance gene.

When cloning a region of unmodified cDNA of the P4HA1 gene into pCMV6-XL5, pCMV6-Kan / Neo, the coding nucleotide sequence is placed under the control of the human cytomegalovirus promoter CMV, effective in eukaryotic cells, and the human growth hormone gene polyadenylation signal. This plasmid also has a bacterial selection factor - the ampicillin resistance gene.

When cloning a region of unmodified cDNA of the P4HA1 gene into VTvaf17, the coding nucleotide sequence is placed under the control of the promoter of the human elongation factor EF1A gene with its own enhancer effective in eukaryotic cells and the human growth factor gene polyadenylation signal. Also, this plasmid has a selection factor that provides the possibility of positive selection without the use of antibiotics.

To obtain genetic constructs with a region of unmodified cDNA of the P4HA1 gene, the vector plasmid pUC19-P4HA1 according to Example 1 with a section of the unmodified P4HA1 cDNA containing the protein coding region of the P4HA1 gene and partial deletions of 5'- and 3'-untranslated regions, is used as a template for amplification with the following primer pairs:

Amplification is carried out under the conditions shown in Example 1. Next, the amplification products are reprecipitated with ethyl alcohol, the precipitates are washed with 70% ethanol and dissolved in 1 × TE buffer, and then subjected to restriction with endonucleases Kpn I and Eco RV.

Restriction products are separated by electrophoresis in a gel with 1% agarose, stained with a solution of ethidium bromide and DNA fragments corresponding to the KpnI-P4HA1-EcoRV insert gene, and the linearized plasmid pCMV6-XL5 and pCMV6-Kan / Neo and pCDNA 3.1 (+) cutout plasmid pCMV6-XL5 and pCMV6-Kan / Neo and pCDNA 3.1 (+) are cut out. isolated from the gel using a QIAquickGelExtractionKit gel extraction kit (Qiagen, Germany) and mixed. The resulting mixture of restriction fragments are ligated using phage T4 DNA ligase. The ligation is carried out for 10-15 minutes at room temperature, and then at 12 ° C for 10 hours. The ligated DNA is used to transform E. coli cells according to the standard procedure using calcium chloride (Maniatis T., et al. Molecular cloning M., Mir, 1984). Transformed cells are selected on agar LB medium with ampicillin (100 μg / ml). Plasmid DNA from ampicillin-resistant colonies was isolated using the QiagenSpinMiniprepKit plasmid kit (Qiagen, Germany), analyzed by restriction enzymes KpnI and EcoRV using hydrolysis and selected genetic design (s) of DNA constructs using DNA sequencing of the genetic constructs (Se) Se and genetic sequencing of the genetic constructs (ies) using DNA sequencing of the genetic constructs by Se and Se, using the DNA method of DNA Seen, and the genetic design (s) of the DNA construct (s) using DNA sequencing of the genetic constructs using the Se method of DNA synthesis and DNA selection.

Bacteria containing the resulting genetic constructs based on the pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) vectors are grown on liquid LB with ampicillin, lysed and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid for isolation of the corresponding genes -therapeutic substances.

In this way, expression genetic constructs based on the pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) vectors are obtained, which contain a nucleotide sequence of 1605 bp in length, which includes the protein-coding region of the P4HA1 gene and does not contain non-translated 5 'and 3' regions of the gene with the primary structure shown in FIG. 1 Seq ID No1.

Example 3

Modifications of the cDNA of the P4HA1 Gene in Genetic Designs to Produce Gene-Therapeutic Substances Based on Them.

Modifications of Seq ID: 2, 3 are carried out in such a way as not to affect the primary protein structure of prolyl 4-hydroxylase alpha 1, namely, nucleotide substitutions are performed that do not lead to amino acid substitutions or breakage of the amino acid chain, and, accordingly, do not affect the encoded amino acid sequence. Modifications of Seq ID: 5, 7 are carried out in such a way that deletions and / or nucleotide substitutions are performed, leading to a combination of variants that do not contain amino acid substitutions or breaks in the amino acid chain with variants that contain amino acid substitutions or breaks in the amino acid chain, and, accordingly, affect the amino acid sequence encoded by this sequence and affecting the primary structure of the protein prolyl 4-hydroxylase alpha 1. Modifications of Seq ID: 4, 6 are carried out in such a way that the primary structure of the protein pr is affected lil 4-hydroxylase alpha 1, namely, performed by nucleotide substitutions or deletions of amino acid substitutions leading to amino acid chain or breakage, and correspondingly affecting the encoded amino acid sequence this sequence.

In particular, to obtain modified cDNA of the P4HA1 gene in order to increase the efficiency of transcription and translation of the prolyl 4-hydroxylase alpha 1 protein, in cells of human tissues and organs in the region of the unmodified cDNA sequence of the P4HA1 gene, they are modified by replacing the minor codons with synonymous major in such a way that substitutions do not lead to changes in the amino acid sequence of the protein or breakage of the amino acid chain during translation, do not worsen the transcript processes AI and translation.

All modifications are carried out in several stages by PCR mutagenesis using the QuikChP4HA1e II XL kit or QuikChP4HA1e Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA), according to the manufacturer's recommendations.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

To the plasmid DNA obtained in Example 2, in the amount of 10-50 ng, 50-100 ng of primer is added, containing the necessary substitution, insertion or deletion of a length of 19-45 bp. and conduct PCR in QuikChP4HA1e Multi reaction buffer (AgilentTechnologies, USA) with a mixture of QuikChP4HA1e Multi mix enzymes (AgilentTechnologies, USA) under the following conditions: 95 ° C, 1 min; further from 30 to 35 cycles: 95 ° С 1 minute, 55 ° С 1 minute, 65 ° С 2 minutes / 1000 bp After PCR, 1-2 μl of Dpn I restriction enzyme is added to the amplification mixture and incubated for 1-2 hours at 37 ° C. The resulting mixture transform competent E.coli cells Top 10 (http://molbiol.ru/protocol/03_04.html), which are sown on L-agar plates containing 100 μg / ml ampicillin. Transformed colonies are analyzed for mutation content by sequencing plasmid DNA according to the Sanger method.

To obtain the modified cDNA of the P4HA1 gene of SEQ ID No 2, sequential PCR mutagenesis is performed on the plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 with primers, the complementary regions of the unmodified cDNA of the P4HA1 gene listed in GenBank under the number NM_000917:

P4HA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G in positions 487,502; replacing T> C in position 500 and replacing T> G in position 511;

P4HA1 626-666 F:

Complementary to nucleotides 626-666, with the substitution A> G in position 646; replacing T> C in position 644 and replacing T> G in position 649;

P4HA1 710-748 F:

Complementary to nucleotides 710-748, with the substitution A> G in position 727 and the substitution G> C in position 730;

P4HA1 774-805 F:

Complementary to nucleotides 774-805, with the substitution G> C at position 790;

P4HA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

The nucleotide sequence thus modified for cDNA P4HA1 SEQ ID No: 2, length 1605 bp contains 2 nucleotide substitutions G> C in positions 730,790; 3 nucleotide substitutions T> G in positions 511, 649, 1123; 4 nucleotide substitutions A> G in positions 487, 502, 646, 727; 2 nucleotide substitutions T> C in positions 500, 644; which do not lead to changes in the amino acid sequence of the protein encoded by the sequence of the P4HA1 gene and has the primary structure shown in FIG. 2

To obtain the modified cDNA of the P4HA1 gene of SEQ ID No 3, sequential PCR mutagenesis is performed on the plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 with primers, the complementary regions of the unmodified cDNA of the P4HA1 gene listed in GenBank under the number NM_000917:

1. P4HA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G in positions 487,502; replacing T> C in position 500 and replacing T> G in position 511;

2. P4HA1 626-666 F:

Complementary to nucleotides 626-666, with the substitution A> G in position 646; replacing T> C in position 644 and replacing T> G in position 649;

3. P4HA1 710-748 F:

Complementary to nucleotides 710-748, with the substitution A> G in position 727 and the substitution G> C in position 730;

4. P4HA1 774-805 F:

Complementary to nucleotides 774-805, with the substitution G> C at position 790;

5. P4HA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

6. P4HA1 1177-1210 F:

Complementary to nucleotides 1177-1210, with the substitution T> G at position 1192;

7. P4HA1 1240-1267 F:

Complementary to nucleotides 1240-1267, with the substitution T> G at position 1249;

8. P4HA1 1316-1357 F:

Complementary to nucleotides 1316-1357, with substitutions A> G at position 1327, 1336;

9. P4HA1 1418-1450 F:

Complementary to nucleotides 1418-1450, with the substitution A> G at position 1429;

10. P4HA1 1794-1841 F:

Complementary to nucleotides 1794-1841, with the substitution T> G at position 1801; with the replacement of A> G at position 1816; with the replacement of G> C in position 1828;

The nucleotide sequence thus modified for cDNA P4HA1 SEQ ID No: 3, length: 1605 bp. contains 3 nucleotide substitutions G> C in positions 730, 790, 1828; 6 nucleotide substitutions T> G in positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G in positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C in positions 500, 644; which do not lead to changes in the amino acid sequence of the protein encoded by the sequence of the P4HA1 gene and has the primary structure shown in FIG. 3

To obtain the modified cDNA of the P4HA1 gene of SEQ ID No 4, sequential PCR mutagenesis is performed on the plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 with a synthesized fragment DNA length 182 np:

The nucleotide sequence thus modified for cDNA P4HA1 SEQ ID No: 4, length 1605 bp, contains 28 nonsynonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 1337C> T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 G> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, resulting in 10 amino acid substitutions and has the primary structure shown in FIG. four.

To obtain the modified cDNA of the P4HA1 gene of SEQ ID No 5, sequential PCR mutagenesis is performed on the plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1, first with two chains 182 bp DNA fragment

and then with the following primers:

1. P4HA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G in positions 487,502; replacing T> C in position 500 and replacing T> G in position 511;

2. P4HA1 626-666 F:

Complementary to nucleotides 626-666, with the substitution A> G at position 646; replacing T> C in position 644 and replacing T> G in position 649;

3. P4HA1 710-748 F:

Complementary to nucleotides 710-748, with the substitution A> G at position 727 and the replacement G> C at position 730;

4. P4HA1 774-805 F:

Complementary to nucleotides 774-805, with the substitution G> C at position 790;

5. P4HA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

6. P4HA1 1177-1210 F:

Complementary to nucleotides 1177-1210, with the substitution T> G at position 1192;

7. P4HA1 1240-1267 F:

Complementary to nucleotides 1240-1267, with the substitution T> G at position 1249;

8. P4HA1 1418-1450 F:

Complementary to nucleotides 1418-1450, with the substitution A> G at position 1429;

9. P4HA1 1794-1841 F:

Complementary to nucleotides 1794-1841, with the substitution T> G at position 1801; with the replacement of A> G at position 1816; with the replacement of G> C in position 1828;

The nucleotide sequence thus modified for cDNA P4HA1 SEQ ID No: 5, length 1602 bp contains 3 nucleotide substitutions G> C in positions 730, 790, 1828; 6 nucleotide substitutions T> G in positions 511, 649, 1123, 1192, 1249, 1801; 6 nucleotide substitutions A> G in positions 487, 502, 646, 727, 1429, 1816; 2 nucleotide substitutions T> C in positions 500, 644; not leading to changes in the amino acid sequence of the protein, as well as 28 non-synonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 13370T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 G> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, resulting in 10 amino acid substitutions, and has the primary structure shown in FIG. five.

To obtain the modified cDNA of the P4HA1 gene of SEQ ID No 6, sequential PCR mutagenesis is performed on the plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 with a synthesized fragment DNA length 90 N. p .:

The nucleotide sequence thus modified for cDNA P4HA1 SEQ ID No: 6, length 1551 bp contains a deletion from 1490 to 1544 bp and has the primary structure shown in FIG. 6

To obtain the modified cDNA of the P4HA1 gene of SEQ ID No 7, sequential PCR mutagenesis is carried out on the plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1, first with two chains DNA fragment length 90 n.

and then with primers complementary to the unmodified regions of the cDNA P4HA1 given in GenBank under the number NM_000917:

1. P4HA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G in positions 487, 502; replacing T> C in position 500 and replacing T> G in position 511;

2. P4HA1 626-666 F:

Complementary to nucleotides 626-666, with the substitution A> G at position 646; replacing T> C in position 644 and replacing T> G in position 649;

3. P4HA1 710-748 F:

Complementary to nucleotides 710-748, with the substitution A> G at position 727 and the replacement G> C at position 730;

4. P4HA1 774-805 F:

Complementary to nucleotides 774-805, with the substitution G> C at position 790;

5. P4HA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

6. P4HA1 1177-1210 F:

Complementary to nucleotides 1177-1210, with the substitution T> G at position 1192;

7. P4HA1 1240-1267 F:

Complementary to nucleotides 1240-1267, with the substitution T> G at position 1249;

8. P4HA1 1316-1357 F:

Complementary to nucleotides 1316-1357, with substitutions A> G at position 1327, 1336;

9. P4HA1 1418-1450 F:

Complementary to nucleotides 1418-1450, with the substitution A> G at position 1429;

10. P4HA1 1794-1841 F:

Complementary to nucleotides 1794-1841, with the substitution T> G at position 1801; with the replacement of A> G at position 1816; with the replacement of G> C in position 1828;

The nucleotide sequence thus modified for cDNA P4HA1 SEQ ID No: 7, length 1551 bp contains 3 nucleotide substitutions G> C in positions 730,790,1828; 6 nucleotide substitutions T> G in positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G in positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C in positions 500, 644; deletion from 1490 to 1544 bp and has the primary structure shown in FIG. 7

Thus, expression vectors based on the plasmid pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are obtained, in which a portion of the unmodified cDNA of the P4HA1 gene (SEQ ID No: 1) and the modified nucleotide cDNA sequences of the P4HA1 gene (SEQ ID No: 2, 3, 4, 5, 6, 7) encoding the protein prolyl 4-hydroxylase alpha 1.

Bacteria containing the resulting genetic constructs based on the pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) vectors are grown on liquid LB with ampicillin, lysed and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid for isolation of the corresponding genes -therapeutic substances.

The resulting expression vectors are used to create genetically therapeutic substances on their basis, which are then used to transfect eukaryotic cells of organs and tissues and / or injections into human organs and tissues. As a control plasmid, the initial vector pCMV6 - XL5, (pCMV6-Kan / Neo) or pCDNA 3.1 (+) was used without inserting the cDNA of the P4HA1 gene.

Example 4

Building up a genetic construct in a bacterial culture.

To obtain preparative amounts of a vector plasmid containing one of the cDNA variants of the P4HA1 gene, the resulting constructs of example 3 transform E. coli bacterial cells (Maniatis T., et al. Molecular cloning. M., Mir, 1984) and grow the resulting clones of bacteria, containing the design, in the presence of a bacterial selection factor - ampicillin resistance.

The ligase mixture of example 3 is used to transform competent cells of E. coli strain XLblue. The preliminary selection of clones containing the cDNA insert of the P4HA1 gene in the correct orientation and a single copy is carried out by hydrolysis of the plasmid DNA with restrictases Kpn I and Eco RV and analysis of restriction products by electrophoresis in 1.2% agarose gel. Selected clones are used for preparative expansion of plasmid DNA for the purpose of further transfection into cultures of fibroblasts (epithelial cells of the oral mucosa, or epithelial cells of the cornea of the eye, etc.).

To obtain preparative amounts of the genetic expression constructs of Example 3, 20 ml of E. coli overnight culture was grown in LB medium with 150 μg / ml of ampicillin. This culture was inoculated with 500 ml of LB medium with 100 μg / ml of ampicillin, growth was carried out in a shaker-incubator for 16 hours at 37 ° C and 200 rpm. Plasmid DNA isolation was performed using the EndoFreePlasmidMaxiKit kit (Qiagen, Germany). The yield was 350 μg of DNA.

Example 5

Cultivation of eukaryotic cells, for example, fibroblasts for subsequent transfection of the gene therapeutic substance and analysis of the expression of the P4HA1 gene.

For subsequent transfection of the gene-therapeutic substance containing one of the cDNA variants of the P4HA1 gene in Example 3, primary cultures of human fibroblasts are grown from skin samples of patients.

Using a device for taking a skin biopsy Epitheasy 3.5 (MedaxSRL), a sample of skin biopsy is taken from an ultraviolet-protected zone, for example, behind the auricle or from the lateral inner surface in the elbow joint area of at least 10 cubic meters mm, weight - not less than 11 mg. The patient's skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The primary cell culture is grown on Petri dishes at 37 ° C in an atmosphere containing 5% CO ₂ in DMEM with 10% fetal calf serum and ampicillin 100 U / ml. Trypsinization and reseeding is done every 5 days, for trypsinization, the cells were washed with PBS solution and incubated for 30 minutes at 37 ° C in a solution containing 0.05% trypsin and 1 mM EDTA. To neutralize trypsin, 5 ml of culture medium was added to the cells and the suspension was centrifuged at 600 rpm for 5 minutes. The growth of a fibroblast culture after 4-5 passages was carried out in 75 ml culture flasks in medium containing 10 g / l DMEM, 3.7 g / l Na ₂ CO ₃ , 2.4 g / l HEPES, 10% fetal serum and 100 U / ml ampicillin . The culture medium was changed every 2 days. The total duration of the growth of culture did not exceed 25-30 days. An aliquot containing 10 ⁶ cells was taken from the cell culture.

A portion of the fibroblast culture, designed to isolate RNA, followed by analysis of the transcription of the P4HA1 gene, was centrifuged at 1000 rpm for 20 minutes and washed twice in PBS buffer solution by centrifugation at 600 rpm for 5 minutes. The cells were then resuspended in 1.5 ml of the stabilizing reagent RNAlater and stored at 4 ° C for 10 days for the subsequent isolation of RNA.

RNA isolation was performed using an RNeasyMiniKit kit. (Qiagen, Germany). Selected RNA was analyzed spectrophotometrically, measuring the ratio of optical density at 260 and 280 nm, as well as using capillary electrophoresis on a QIAxcel device (Qiagen, Germany), using an RNA Qiality Control cartridge. For further work, only those samples were used for which the total amount of isolated RNA was at least 50 μg of RNA, the ratio D260: D280 was at least 1.8, and the ratio of the 28S: 18S bands on capillary electrophoresis was no lower than 1: 1.

The synthesis of the total cDNA of the first chain was performed using RevertAid reverse transcriptase (Thermo Scientific, USA), as recommended by the manufacturer. 1-2 μg of total RNA was used as a template for the synthesis of the first strand of cDNA. 100-200 units were added to the reaction mixture for reverse transcription. reverse transcriptase and 10 pM random 9-nucleotide primer.

Example 6

Analysis of the endogenous expression of the P4HA1 gene in a culture of primary fibroblasts.

Analysis of the expression of the P4HA1 gene from the fibroblast genome is carried out with the aim of subsequent correct determination of the gene therapeutic effect after transfection of these cells with genetic constructs with the cDNA of the P4HA1 gene.

Cell lines of fibroblasts of the skin, fibroblasts with low expression of the P4HA1 gene and fibroblasts with normal expression of the P4HA1 gene are used for analysis, from which RNA is isolated according to standard methods (Maniatis T. et al. Molecular cloning. M., Mir, 1984).

The isolated RNA is analyzed by real-time PCR (SYBR GreenRealTimePCR). For amplification of cDNA (542-642 bp) specific for the P4HA1 gene, direct primer P4HA1 FA1 is used.

and reverse primer P4HA1 -RA1

The length of the amplification product is 68 nucleotides. The beta-2-microglobulin B2M gene is used as a reference gene, the expression level of which in fibroblasts is comparable to that in the normal P4HA1 gene.

PCR amplification is performed using the GreenBuantitect RT-PCR Kit (Qiagen, USA) SYBR reagent kit or another real-time PCR kit in a 20 μl amplification mixture containing: 25 μl QuantiTect SYBR Green RT-PCR MasterMix, 2.5 mM magnesium chloride, 0.5 μm of each primer, 5 μl of total RNA. The reaction is carried out on a CFX96 amplifier (Bio-Rad, USA) under the following conditions: 1 cycle of reverse transcription at 50 ° C - 30 minutes, denaturation 98 ° C - 15 minutes, then 40 cycles, including denaturation 94 ° C -15 s, annealing of primers 59 ° С - 30 s and elongation 72 ° С - 30 s

As a positive control, the concentration of amplicons obtained by PCR on matrices, which are plasmids in known concentrations, containing the cDNA sequences of the P4HA1 and B2M genes, is used. Deionized water was used as a negative control (PCR product accumulation curves of negative and positive controls to simplify visualization are not shown in FIG. 8). The number of PCR products - cDNA of the P4HA1 and B2M genes obtained as a result of amplification is estimated in real time using the software of the Bio-RadCFXManager 2.1 amplifier.

According to the analysis of P4HA1 gene expression in different cultures of fibroblasts (with low P4HA1 gene expression and with normal P4HA1 gene expression) clones were selected from patients of the same age and one type of aging, in which the amount of the PCR product corresponding to the cDNA of the P4HA1 gene was 10 -20 times lower than that of B2M cDNA. The accumulation curves of specific PCR products are shown in figure 8.

Example 7

Transfection of a fibroblast cell culture with reduced expression of the P4HA1 gene with a gene-therapeutic substance in order to confirm an increase in the expression of the P4HA1 gene in the culture of these cells.

To evaluate the efficacy of a gene-therapeutic substance containing unmodified cDNA of the P4HA1 gene in Example 2, this gene-therapeutic substance is transfected to a primary culture of human fibroblasts with reduced P4HA1 gene expression, selected in Example 6.

This culture of fibroblasts is grown in culture flasks (25 cm ² ) until the moment when the cells cover 50-70% of the surface of the bottle. The resulting cells are transfected with the gene-therapeutic substance based on pCMV6-P4HA1 SEQ ID No: 1 in the presence of a transport molecule (eg dendrimer) and the vector pCMV6-XL5 as a control.

A 6-well plate with DMEM medium with 10% fetal calf serum (1.6 ml per well) was seeded with fibroblasts at a rate of 1-4 × 10 ⁵ cells per well. Incubated the cells for 18 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then 2 μg of plasmid DNA was dissolved in serum-free DMEM with Tris-HCl buffer 20 mM with 1 mM EDTA, pH 7-8 (the minimum DNA concentration was 0.1 μg / μl). The final volume of the mixture was 100 μl.

The 6th generation SuperFect Transfection Reagent solution (Qiagen, Germany) was used as a transport molecule.

The preparation of the DNA dendrimer complex was carried out according to the manufacturer’s method (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some changes: 5 μl (0.5 μg / μl) solution was added to 15 μl of dendrimer solution (concentration 3 μg / μl) plasmid DNA and thoroughly mixed. Then incubated the mixture of DNA with dendrimer for 5-10 minutes at a temperature of 15-25 ° C.

Media were carefully removed from the wells of the cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml of PBS buffer. To the solution containing the DNA dendrimer complexes, 600 μl of DMEM medium with fetal serum was added and the mixture was transferred to the wells of the cell plate. Cells were incubated with the complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . The medium was then carefully removed and the cell layer was washed with 3 ml of PBS buffer. The culture medium was then added and incubated for 24-48 hours at 37 ° C and in an atmosphere containing 5% CO ₂ , after which the level of the cDNA of the P4HA1 gene and the control cDNA of the B2M gene was assessed using real-time amplification as described in Example 6. Results analysis is shown in figure 9.

From the graphs it follows that in the case of transfection with a vector without inserting cDNA of the P4HA1 gene, the level of cDNA of the P4HA1 gene in fibroblasts did not change, and in the case of transfection with a vector with the cDNA of P4HA1 gene, the level of fibroblast cDNA with reduced expression of the P4HA1 gene increased many times (to a level higher than cDNA of the P4HA1 gene in normal fibroblasts).

It was shown that in cells transfected with the gene-therapeutic substance based on pCMV6-P4HA1 SEQ ID No: 1, the expression of the target P4HA1 gene is enhanced.

Example 8

Transfection of a fibroblast cell culture with normal expression of the P4HA1 gene with a gene-therapeutic substance with the cDNA of the P4HA1 gene in order to confirm an increase in the amount of prolyl protein 4-hydroxylase alpha 1 in the culture of these cells.

To assess changes in the amount of prolyl 4-hydroxylase alpha 1 protein, we used human skin fibroblast culture as in Example 5, 6th generation SuperFect Transfection Reagent dendrimers (Qiagen, Germany) were used as a transport molecule, and plasmid DNA-free dendrimers were used as controls (A), the vector plasmid pCDNA 3.1 (+), not containing the cDNA of the P4HA1 gene (B), as transferable agents - a gene therapeutic substance based on the vector plasmid pCDNA 3.1 (+), containing the cDNA of the P4HA1 gene - pCDNA 3.1 P4HA1 EQ ID No: 1 (C), Preparation of DNA Dendri Complex measures and transfection of fibroblasts were performed according to Example 7.

After transfection, 0.1 ml of 1N HCl was poured into 0.5 ml of the culture fluid, mixed thoroughly and incubated for 10 minutes at room temperature. Then the mixture was neutralized by adding 0.1 ml of 1.2N NaOH / 0.5M HEPES (pH 7-7.6) and thoroughly mixed.

The supernatant was collected and used to quantify the target protein. Quantitative determination of the cDNA product of the P4HA1 gene was carried out by ELISA using the Human P4HA1 ELISA Kit (MyBioSource, USA), according to the manufacturer’s method https://www.mvbiosource.com/imaqes/tds/protocol manuals / 000000-799999 /MBS763203.pdf

Optical density was measured at a wavelength of 450 nm using an automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness TechNology Inc., USA) and is proportional to the concentration of protein in the sample. The numerical value of the concentration is determined using a calibration curve constructed from calibrators with a known concentration of the P4HA1 gene protein, which is part of the kit. The difference between the optical density (OD) values of the calibrators supplied in triplicate did not exceed 10%.

Statistical processing of the results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). Thus, it was shown that transfection of fibroblasts by the obtained gene-therapeutic substance carrying the cDNA of the P4HA1 gene leads to an increase in the amount of prolyl 4-hydroxylase alpha 1 in fibroblast cells. The results are shown in figure 10.

Example 9

Introduction to the human skin of a cell culture of fibroblasts transfected with a gene-therapeutic substance with the cDNA of the P4HA1 gene in order to confirm the increase in the amount of protein prolyl 4-hydroxylase alpha 1 in human skin biopsy specimen.

In order to analyze changes in the amount of prolyl 4-hydroxylase alpha 1 in human tissues, three variants of autologous fibroblasts untransfected (A) transfected with a vector without insertion, for example, pCMV6-XL5 (B) and transfected with gene-therapeutic substance based on pCMV6- P4HA1 SEQ ID No: 7 (C) in combination with transport molecules - liposomes TRANSFAST TM Transfection Reagent (PROMEGA, USA),

The preparation of a suspension of liposomes was carried out according to the manufacturer's method (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) with some changes: 0.4 ml of sterile water of Nuclease-Free was added to 0.4 mg of liposome powder. The suspension was well stirred by agitation. The resulting intermediate suspension of liposomes was kept for 18 hours at a temperature of -20 ° C, then thawed at room temperature, resuspended by shaking or on a desktop mixer of the type "VORTEX".

To prepare the complex of DNA-liposomes, 400 μl of plasmid DNA solution (with a concentration of 150 μg / ml) were added to 400 μl of a solution of liposomes (with a concentration of 1 mg / ml) and thoroughly mixed. Then, a mixture of DNA with liposomes was incubated for 5–10 minutes at a temperature of 15–25 ° C and then used as a gene therapeutic substance.

For the subsequent transfection of cells with a gene-therapeutic substance, primary cultures of human fibroblasts were grown from skin samples from patients in example 5.

For transfection, medium was carefully removed from the wells of the cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml of PBS buffer. 600 μl of DMEM medium with fetal serum was added to the solution containing DNA-liposyme complexes, and the mixture was transferred to the wells of the cell plate. Cells were incubated with the complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . The medium was then carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then added to the culture medium and incubated for 24-48 hours at 37 ° C in an atmosphere containing 5% CO ₂ .

A portion of the cell culture was centrifuged at 700 rpm, the cells were washed twice with saline, resuspended in saline at the rate of 1 million cells in 200 μl and used to administer to the patient. The introduction was carried out by a tunnel method using a 30G needle to a depth of 3 mm. The centers of the introduction of fibroblast cultures were located at a distance of 3-5 cm from each other.

Determining the amount of prolyl 4-hydroxylase alpha 1 protein was performed in lysates of patient's skin biopsies using ELISA using the P4HA1 elisa kit (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken on day 3 after administration of the fibroblast suspension. Biopsy sampling was performed from fibroblast suspension injection sites as well as from intact skin using an Epitheasy 3.5 skin biopsy device (MedaxSRL). The patient's skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The volume of the biopsy sample is at least 10 cubic meters. mm, weight - not less than 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was collected and used to quantify the target protein.

As can be seen from figure 11, an increase in the amount of prolyl 4-hydroxylase alpha 1 protein occurred in the patient's skin in the area of introduction of fibroblasts transfected with the gene-therapeutic substance based on pCMV6-P4HA1 SEQ ID No: 7, which may indicate increased P4HA1 gene expression. While the introduction of control cultures of fibroblasts (untransfected and transfected with a vector without the insertion of the P4HA1 cDNA gene pCMV6-XL5) did not change the amount of 4-hydroxylase alpha 1 in the skin.

Thus, the effectiveness of a gene-therapeutic substance when a cell culture of fibroblasts transfected with the obtained gene-therapeutic substance carrying a modified P4HA1 cDNA gene is introduced into human skin, leads to an increase in the expression level of the P4HA1 gene, namely, an increase in the amount of prolyl 4- protein hydroxylase alpha 1 in the skin in the injection area.

Example 10

Transfection of fibroblast cultures from biopsy specimens of a group of different patients with gene therapeutic substances containing modified cDNA of the P4HA1 gene and a region of unmodified cDNA of the P4HA1 gene.

In order to confirm the individual nature of the increase in P4HA1 gene expression to different levels during transfection of cell cultures of fibroblasts of patients with genetic therapeutic substances modified with cDNA of the P4HA1 gene and a portion of the unmodified cDNA of the P4HA1 gene, the quantitative level of the prolyl alpha 4-hydroxylase alpha 1 protein in cell fibroblasts of fibroblasts was analyzed. gene-therapeutic substances according to example 3, containing the modified cDNA of the gene P4HA1 and the area of unmodified kDN To the P4HA1 gene in the patient group depending on the presence and type of modifications in the P4HA1 gene cDNA.

The sequence of the unmodified cDNA of the P4HA1 gene is shown in FIG. 1, SEQ ID No: 1., the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Fibroblast cultures were grown from similar skin biopsy specimens selected from the inner side surface zone in the elbow joint zone. 28 patients randomly selected according to Example 5, aliquots were selected and the protein level of prolyl 4-hydroxylase alpha 1 was evaluated in cell lysates. The cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in lytic buffer containing 25 mM XEPES pH 7.9, 100 MMNaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonylfluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm, the protein concentration in the supernatant was determined by the Bradford method ([Bradford MM (1976) Anal. Biochem. 72: 248-254.]).

Then each of the 18 fibroblast cultures was divided into 8 parts. One part, designated (A), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 1, containing the unmodified cDNA of the P4HA1 gene (SEQ ID No: 1.) in example 2 in combination with the transport molecule - dendrimer in example 7.

The second part, designated (B), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 2, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 2.) in example 3 in combination with the transport molecule - dendrimer in example 7.

The 3rd part, designated (C), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 3, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 3.) of Example 3 in combination with the transport molecule - dendrimer according to example 7.

The 4th part, designated (D), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 4, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 4) of example 3 in combination with the transport molecule - dendrimer according to example 7.

The 5th part, designated (E), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 5, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 5.) of Example 3 in combination with the transport molecule - dendrimer according to example 7.

The 6th part, designated (F), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 6, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 6.) of example 3 in combination with the transport molecule - dendrimer according to example 7.

The 7th part, designated (G), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 7, containing the modified variant of the cDNA of the P4HA1 gene (SEQ ID No: 7.) of Example 3 in combination with the transport molecule - dendrimer according to example 7.

The 8th part, designated (H), was transfected according to example 7 with the vector plasmid pCMV6-XL5, which does not contain the cDNA of the P4HA1 gene of example 3 in combination with the transport molecule - dendrimer of example 7.

Quantitative determination of the cDNA product of the P4HA1 gene was carried out by ELISA using the Human P4HA1 ELISA kit (MyBioSource, USA), as described in Example 8.

According to the results of determining the quantitative protein level, prolyl 4-hydroxylase alpha 1 selected indicators for each part of the cell culture from each patient, which showed the highest quantitative levels of protein and combined them into seven groups, based on the following criteria:

In group 1, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of unmodified cDNA of the P4HA1 gene of SEQ ID No: 1. This group included 7 of 28 cultures.

In group 2, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of the modified cDNA of the P4HA1 gene of SEQ ID No: 2. This group included 3 cultures out of 28.

In group 3, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed when transfecting the modified cDNA of the P4HA1 gene of SEQ ID No: 3. This group included 6 cultures out of 28.

In group 4, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of the modified cDNA of the P4HA1 gene of SEQ ID No: 4. This group included 4 cultures out of 28.

In group 5, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of the modified cDNA of the P4HA1 gene of SEQ ID No: 5. This group included 3 cultures out of 28.

In group 6, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of the modified cDNA of the P4HA1 gene of SEQ ID No: 6. This group included 3 cultures out of 28.

In group 7, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed upon transfection of the modified P4HA1 cDNA of SEQ ID No: 7. This group included 2 cultures out of 28.

None of the cell cultures transfected with the gene-therapeutic substance with the vector plasmid that does not contain the P4HA1 cDNA gene showed the highest quantitative level of the prolyl 4-hydroxylase alpha 1 protein, in contrast to the cell cultures transfected with the gene-therapeutic substances with genetic constructs, containing cDNA gene P4HA1.

Figure 12 for each group of cell cultures shows diagrams of protein amount of prolyl 4-hydroxylase alpha 1 (averaged within the group if the group includes more than one cell culture) for all genetically-therapeutic substances participating in the experiment, after transfection of these cell cultures with gene therapeutic substances containing the modified and unmodified region of the cDNA of the P4HA1 gene.

From this example, it follows that the achievement of the greatest amount of prolyl 4-hydroxylase alpha 1 in cultures of skin fibroblasts of various patients when they are transfected with gene therapeutic substances is associated with the individual characteristics of patients and depends on the presence and type of modifications in the cDNA of the P4HA1 gene -therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Consequently, to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of patient’s biopsy specimens or cells grown from these biopsy specimens to determine the greatest effectiveness of the therapeutic effect created by the gene-therapeutic substances is necessary. therapeutic substances.

Example 11

Transfection of keratocyte cell culture and epithelial cells of the eye with a gene-therapeutic substance without a transport molecule in order to confirm an increase in the expression of the P4HA1 gene in these cell cultures.

In order to determine the effectiveness of the gene-therapeutic substance containing the P4HA1 cDNA in various cell types, keratocytes and epithelial cells of the human cornea were transfected without using transport molecules.

The biopsy material from the limbus area in the form of a circle with a diameter of 1-1.5 mm was placed in a Petri dish in Hanks' balanced salt solution, a dispase (20 μl 25 U / ml) and gentamicin were added and incubated for 24 hours at +4. Then the epithelial layer was separated from the stroma and both tissues were cut into 1-2 mm3 pieces.

Suspension of epithelial cells was obtained by incubating tissue pieces in Trypsin-EDTA solution for 15 minutes at + 37 ° C. Trypsinization was stopped by adding soybean trypsin inhibitor in PBS. Cell suspensions were washed by centrifugation at 700 rpm and resuspended in serum-free DMEM with gentamycin. Cells were grown in 25 cm ² vials with 5 ml of medium at 37 ° C and in an atmosphere containing 5% CO ₂ . After 24 hours, the medium with non-adherent cells was removed and 5 ml of fresh medium was added. Reseeding produced every 7 days at a ratio of 1: 2 - 1: 3.

A keratocyte suspension was obtained by incubating in RPMI-1640 medium with a collagenase of 300 units / ml for 2 hours. Then the cells were washed and resuspended in DMEM with 20% calf serum and antibiotic antimycotics. Cells were grown in 25 cm ² vials with 1 ml of medium at + 37 ° C and in an atmosphere containing 5% CO ₂ . Reseeding produced every 7 days at a ratio of 1: 4.

Since the efficiency of keratocyte transfection is low, a gene-therapeutic substance based on the plasmid pCMV6-Kan / Neo P4HA1 SEQ ID No: 2 was used, containing an additional selection factor, the neor gene, conferring resistance to the antibiotic geneticin.

The gene therapeutic substance was added to the cells and the cells were incubated for 1 hour at 37 ° C. After incubation, serum-free DMEM medium was added to the epithelial cells and DMEM medium containing 10% fetal calf serum to keratocytes and continued to incubate for 24 hours. After 24 hours of incubation, cells were seeded in a new DMEM medium containing 400 μg / mL of the selection factor antibiotic G418 (Geneticin). The surviving cells were cultured for 2 weeks in 25 cm3 vials with 5 ml of medium with G418. A total of 24 samples of cultures of epithelial cells and 24 samples of cultures of keratocytes were grown.

Every 24 hours, an aliquot of 500 μl of suspension was taken from each culture in order to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using an RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with similar concentrations and pooled. The analysis of the level of specific cDNA of the P4HA1 gene was performed using real-time amplification by the method and with the primers of example 6, using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-RadUSA) and Bio-RadCFXManager 2.1 software. The greatest increase in the expression (transcription) of the P4HA1 gene was observed on day 3 for epithelial cells and on day 5 for keratocytes.

Figure 13 shows the accumulation curves of a specific amplification product corresponding to the cDNA of the P4HA1 gene in keratocytes and corneal epithelial cells.

It has been shown that keratocytes and epithelial cells of the human cornea, transfected with the gene-therapeutic substance based on pCMV6-Kan / Neo P4HA1 SEQ ID No: 2, without a transport molecule, increase the expression of the target P4HA1 gene.

Example 12

Transfection of a cell culture of chondroblasts with a gene-therapeutic substance in order to confirm the increase in P4HA1 gene expression in these cell cultures.

In order to determine the efficacy of a gene-therapeutic substance containing the cDNA of the P4HA1 gene in various cell types, as well as to assess the effect of the transport molecule on the success of transfection with this substance, human chondroblasts were transfected using amphiphilic block copolymers as a transport molecule.

Cartilage biopsies with a mass of 50-150 mg were crushed into fragments up to 10 mm3 and incubated in a buffer solution with collagenase II, hyaluronidase and trypsin for 48 hours at + 37 ° C. Cells were washed with serum-free DMEM medium, resuspended in the same medium with gentamicin and grown at + 37 ° C and in an atmosphere containing 5% CO ₂ in vials of 75 cm ² with 15 ml of medium. The growth was carried out in a serum-free medium, since in monolayer culture chondrocytes change shape and biochemical properties. Reseeding was performed every 4 days at a ratio of 1: 3, cells were removed from the surface of the vial with trypsin-EDTA solution with 0.02% Versene solution.

Amphiphilic block copolymers were used to transfect cells with the gene-therapeutic substance containing the cDNA of the P4HA1 gene. The methodology was applied according to (IntJPharm, 2012, 427, 80-87) or in (Macromol. Biosci. 2011, 11, 652-661), with some changes. The block copolymer was synthesized from a mixture of linear polyethylenimine (PEI) (Polyscience Inc., USA) and bifunctional polyethylene glycol (PEG) N-hydroxysuccinimidyl-75-N- (3-maleimidopropionyl) -amido-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - tetracosaxapent-heptacontanoate (MAL-dPEG ™ -NHS ester, Quanta BioDesign, Ltd., USA) in borate buffer. Polyplex was prepared 1 hour prior to introduction into the cells by mixing the solution of the block copolymer with the DNA of the genetic construct pCMV6-Kan / Neo P4HA1SEQ ID No: 3 with the modified P4HA1SEQ ID No: 3 cDNA. The transfection mixture was added to the cell suspension in 1 ml of culture medium DMEM with 10% fetal serum and ampicillin.

Since a structure containing the selection factor (resistance to geneticin) was used for transfection, the cells after transfection were grown in 25 cm3 vials with 5 ml of geneticin medium for 12 days, changing the medium every 4 days. Every 24 hours, an aliquot of 500 μl of suspension was taken from each culture in order to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with similar concentrations and pooled. The analysis of the level of specific cDNA P4HA1 was performed using real-time amplification by the method and with the primers of example 6, using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-Rad, USA) and Bio-RadCFXManager 2.1 software . The largest increase in P4HA1 transcription was observed on day 5. Figure 14 shows the accumulation curves of the specific amplification product corresponding to the cDNA of the P4HA1 gene.

It has been shown that in chondroblasts transfected with the pCMV6-Kan / Neo pCMV6-Kan / Neo P4HA1SEQ ID No: 3 gene, using the amphiphilic block copolymers as the transport molecule, an increase in the expression of the target gene P4HA1 is observed.

Example 13

Introduction to the human skin of a gene-therapeutic substance with the cDNA of the P4HA1 gene in order to confirm the increase in the amount of prolyl 4-hydroxylase alpha 1 protein in human skin.

In order to analyze the increase in the quantitative protein level of prolyl 4-hydroxylase alpha, 1 patient was injected with a gene therapeutic substance containing the genetic construct with the cDNA of the P4HA1 gene (B) with the transport molecule and in parallel was administered with a placebo, which is a combination of the vector plasmid that does not contain the cDNA of the P4HA1 gene with the transport molecule (A) - in the skin of the forearm.

TRANS FAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as a transport molecule in Example 9. Next, the pCMV6 P4HA1 genetic construct SEQ ID No: 4, which contains the modified P4HA1 cDNA (SEQ ID No: 4) and plasmid pCMV6-XL5 used as a placebo - which does not contain the cDNA of the P4HA1 gene, each of which was dissolved in sterile water, the degree of purification of Nuclease-Free. To obtain the gene therapeutic substances, DNA-liposome complexes according to Example 9 were prepared.

The resulting gene-therapeutic substance and placebo were used for administration to the patient. The introduction was carried out by a tunnel method using a 30G needle to a depth of 3 mm. The volume of the injected solution of the gene therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 3-5 cm from each other.

The amount of prolyl 4-hydroxylase alpha 1 protein was evaluated in the lysates of the patient’s skin biopsies using an ELISA test (ELISA) using the Human P4HA1 ELISA Kit (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken on day 3 after the administration of the gene therapeutic substance. The biopsy was taken from the skin in the area of the introduction of the gene-therapeutic substance and placebo, as well as from intact skin, using the device for taking a biopsy Epitheasy 3.5 (Medax SRL) further, as described in example 9.

It was shown that the amount of prolyl 4-hydroxylase alpha 1 protein increased in the patient's skin in the area of injection of the gene-therapeutic substance with the P4HA1 cDNA, while the amount of prolyl 4-hydroxylase alpha 1 in the skin did not change with placebo. The result indicates increased expression of the P4HA1 gene when using the gene-therapeutic substance with the P4HA1 cDNA and, accordingly, the effectiveness of the gene-therapeutic substance with the P4HA1 gene cDNA. The results are reflected in figure 15.

Example 14

Introduction to the human cartilage tissue of a gene-therapeutic substance with the cDNA of the P4HA1 gene in order to confirm the increase in the amount of prolyl protein 4-hydroxylase alpha 1 in human cartilage tissue.

In order to analyze changes in the amount of prolyl 4-hydroxylase alpha protein, 1 patient was injected with a gene therapeutic substance containing a genetic construct with the cDNA of the P4HA1 gene (B) with a transport molecule and in parallel was administered a placebo, which is a combination of the vector plasmid that does not contain the cDNA of the P4HA1 gene with a transport molecule (A) - in the cartilaginous tissue of the auricles from the back side.

Genetic design of pCDNA 3.1 P4HA1 SEQ ID No: 5, which contains modified cDNA of the P4HA1 gene (SEQ ID No: 5), and plasmid pCDNA 3.1, used as a placebo, which does not contain the cDNA of the P4HA1 gene, each of which was dissolved in sterile water of degree cleanup nuclease-free. Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. To obtain genetically therapeutic substances, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

The calculation of the amount of reagent was carried out according to the formula proposed by the manufacturer:

V (μL) = (pDNA (μg) × 3 × N / P) / 150

where N / P is the ratio between the amount of nitrogenous residues in jetPEI and the number of phosphate groups of nucleic acids. In this experiment, the ratio N / P = 6 was used, that is, 20 μg of pDNA - 2.4 μl of jetPEI.

The resulting gene-therapeutic substance and placebo were used for administration to the patient. The introduction was carried out by a tunnel method using a 30G needle to a depth of 1-2 mm in the cartilage tissue of the auricles on the back side. The volume of the injected solution of the gene therapeutic substance and placebo is about 0.2 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 2-3 cm from each other.

The amount of prolyl 4-hydroxylase alpha 1 protein was evaluated in the lysates of the patient's cartilage tissue biopsies by ELISA (ELISA) using the Human P4A1 ELISA kit (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken on day 3 after the administration of the gene therapeutic substance. Biopsy was taken from areas of cartilage tissue in the area of injection of the gene-therapeutic substance, as well as from intact areas and in the area of placebo, using percutaneous puncture biopsy using a disposable manual biopsy needle, then in example 9.

It was shown that the amount of prolyl 4-hydroxylase alpha 1 protein increased in the cartilage tissue of the patient with the P4HA1 gene cDNA, while the amount of prolyl 4-hydroxylase alpha 1 in cartilage tissue did not change with placebo. The result indicates increased expression of the P4HA1 gene when using the gene-therapeutic substance with the P4HA1 cDNA and, accordingly, the effectiveness of the gene-therapeutic substance with the P4HA1 gene cDNA. The results are reflected in figure 16.

Example 15

Introduction to the human muscle tissue of a gene-therapeutic substance with the cDNA of the P4HA1 gene in order to confirm the increase in the amount of prolyl protein 4-hydroxylase alpha 1 in human muscle tissue.

In order to analyze changes in the amount of prolyl 4-hydroxylase alpha protein, 1 patient was injected with a gene therapeutic substance containing a vector plasmid with the cDNA of the P4HA1 gene (B) with a transport molecule and in parallel was administered a placebo, which is a combination of the vector plasmid that does not contain the P4HA1 gene with a transport molecule (A) - in the muscle tissue in the area of the forearm.

Liposome powder TRANSFAST TM Transfection Reagent (PROMEGA, USA) was used as a transport molecule according to Example 9. Next, the pCMV6-Kan / Neo P4HA1 genetic construct SEQ ID No: 6, which contains the modified cDNA of the P4HA1 gene (SEQ ID No: 6), and plasmid pCMV6-Kan / Neo, used as a placebo, which does not contain the cDNA of the P4HA1 gene, each of which was dissolved in sterile water Nuclease-Free Purification.

To obtain the gene therapeutic substances, DNA-liposome complexes according to Example 9 were prepared.

The resulting gene-therapeutic substance and placebo were used for administration to the patient. The introduction was carried out by a tunnel method using a 30G needle to a depth of 15-20 mm. The volume of the injected solution of the gene therapeutic substance and placebo is about 0.5 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 5-7 cm from each other

The amount of prolyl 4-hydroxylase alpha 1 protein was measured in lysates of biopsy specimens of a patient’s muscle tissue by ELISA using ELISA kit Human P4HA1 (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken on day 3 after the administration of the gene therapeutic substance. Biopsy sampling was performed from muscle tissue sites in the area of administration of the gene therapeutic substance, as well as from intact muscle sites and in the placebo administration zone, using an automatic biopsy device MAGNUM (BARD, USA), then in Example 9.

It was shown that the amount of prolyl 4-hydroxylase alpha 1 protein increased in the muscle tissue of the patient in the area of injection of the gene-therapeutic substance with the c4NA of the P4HA1 gene, while the amount of prolyl 4-hydroxylase alpha 1 in the muscle tissue did not change with the introduction of placebo. The result indicates increased expression of the P4HA1 gene when using the gene-therapeutic substance with the P4HA1 cDNA and, accordingly, the effectiveness of the gene-therapeutic substance with the P4HA1 gene cDNA. The results are reflected in figure 17

Example 16

Introduction to the group of different patients of gene therapeutic substances containing modified P4HA1 cDNA and a region of unmodified P4HA1 cDNA.

In order to confirm the individual nature of the increase in the expression level of the target P4HA1 gene to different levels when genetically therapeutic substances with modified and unmodified cDNA of the P4HA1 gene were injected into the skin of patients, the amount of prolyl 4-hydroxylase alpha 1 was analyzed in the lysate of skin biopsies of the patient group depending on the presence of and the type of modifications in the cDNA of the P4HA1 gene.

The sequence of the unmodified cDNA of the P4HA1 gene is shown in FIG. 1, SEQ P4HA1 ID No: 1, the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ P4HA1 ID No: 2, SEQ P4HA1 ID No: 3, SEQ P4HA1 ID No: 4 , SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

The genetic constructs, one of which contains the unmodified cDNA region of the P4HA1 gene (SEQ ID No: 1), the second genetic construct contains the modified cDNA region of the P4HA1 gene (SEQ ID No: 2), the third genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 3), the fourth genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 4), the fifth genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 5), the sixth genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 6), se maya genetic construct comprises a cDNA R4NA1 modified gene (SEQ ID No: 7), eighth genetic construct (placebo) is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. To obtain genetically therapeutic substances, DNA complexes were prepared in combination with transport molecules - liposomes according to example 9.

The obtained seven variants of the gene therapeutic substances and placebo were used for the introduction into the skin of patients. The introduction was carried out by a tunnel method using a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene-therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Each of the 24 patients, who were selected at random, were injected 7 gene-therapeutic substances and placebo into the skin of the forearm.

Biopsy specimens were taken 72 hours after the administration of the gene therapeutic substances. Biopsy was taken from the sites of administration of gene-therapeutic substances, placebo, as well as from intact skin, using a device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient's skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The volume of each biopsy sample is at least 10 cubic meters. mm, weight - not less than 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was collected and used to quantify the target protein.

And biopsy obtained after the introduction of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 1, containing the unmodified cDNA of the P4HA1 gene (SEQ ID No: 1.) in example 2 in combination with transport molecules - liposomes in example 9.

B - biopsy obtained after administration of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 2, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 2.) of Example 3 in combination with the transport molecules of the liposomes of Example 9.

C - biopsy obtained after administration of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 3, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 3.) in example 3 in combination with transport molecules - liposomes in example 9.

D - biopsy obtained after administration of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 4, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 4.) in example 3 in combination with transport molecules - liposomes in example 9.

E - biopsy obtained after administration of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 5, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 5) in example 3 in combination with transport molecules - liposomes in example 9.

F - biopsy obtained after the introduction of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 6, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 6) in example 3 in combination with transport molecules - liposomes in example 9.

G - biopsy obtained after administration of the gene-therapeutic substance on the basis of pCMV6- SEQ ID No: 7, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 7.) in example 3 in combination with transport molecules - liposomes in example 9.

H - biopsy obtained after the introduction of the vector plasmid pCMV6-XL5, not containing the cDNA of the P4HA1 gene in example 3 in combination with transport molecules - liposomes in example 9.

The amount of prolyl 4-hydroxylase alpha 1 protein was determined in nine skin biopsies from each patient (from A to H and in the intact skin biopsy) 72 hours after administration of the gene therapeutic substances by ELISA using Human P4HA1 ELISA kit Kit (MyBioSource, USA) as described in Example 8.

According to the results of the quantitative analysis of the protein prolyl 4-hydroxylase alpha 1, we selected indicators for each biopsy from each patient, which showed the highest levels of protein prolyl 4-hydroxylase alpha 1 and combined them into seven groups, based on the following criteria:

In group 1, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed when the unmodified cDNA of the P4HA1 gene was introduced: SEQ ID No: 1. This group included 3 biopsies from 24.

In group 2, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of the modified cDNA of the P4HA1 gene of SEQ ID No: 2. This group included 3 of 24 biopsies.

In group 3, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of the modified cDNA of the P4HA1 gene SEQ ID No: 3. This group included 4 of 24 biopsies

In group 4, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of the modified P4HA1 DNA of SEQ ID No: 4. This group included 4 of 24 biopsies.

In group 5, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of the modified cDNA of the P4HA1 gene SEQ ID No: 5. This group included 3 biopsies from 24

In group 6, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of the modified cDNA of the P4HA1 gene SEQ ID No: 6. This group included 4 of 24 biopsies.

In group 7, the highest amount of prolyl 4-hydroxylase alpha 1 protein was observed with the introduction of the modified cDNA of the P4HA1 gene SEQ ID No: 7. This group included 3 of 24 biopsies.

None of the biopsy specimens in which the gene-therapeutic substances of the placebo were introduced — the vector plasmid containing the cDNA of the P4HA1 gene — did not detect the greatest amount of prolyl 4-hydroxylase alpha 1 protein, in contrast to biopsy specimens in which the gene-therapeutic substances with genetic constructs containing the cDNA of the P4HA1 gene.

Figure 18 for each group of biopsy specimens shows diagrams of protein concentrations (averaged within the group, if the group includes more than one biopsy) for all genetically-therapeutic substances participating in the experiment, after administering these gene-therapeutic substances to the patients, containing the modified and unmodified cDNA region of the P4HA1 gene.

From this example, it follows that the achievement of the highest amount of prolyl 4-hydroxylase alpha 1 in skin biopsies of various patients when they are injected into the skin of gene therapeutic substances is associated with individual patient characteristics and depends on the presence and type of modifications in the cDNA of the P4HA1 gene in the gene therapeutic substance.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Consequently, to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of patient’s biopsy specimens or cells grown from these biopsy specimens to determine the greatest effectiveness of the therapeutic effect created by the gene-therapeutic substances is necessary. therapeutic substances.

Example 17

Transfection of a patient's fibroblast cell line with various gene-therapeutic substances containing modified P4HA1 cDNA and a region of unmodified P4HA1 cDNA for the purpose of personalized selection of the most effective gene-therapeutic substance from the group of gene-therapeutic substances for this patient for subsequent transfection of the patient's cells into this substance within the therapeutic procedure.

In order to determine the gene-therapeutic substance most effective for a particular patient, the amount of prolyl 4-hydroxylase alpha 1 protein was analyzed in the cell lysates of fibroblasts of this patient, transfected with various gene-therapeutic substances containing a portion of unmodified cDNA of the P4HA1 gene and / or modified cDNA of the P4HA gene .

The sequence of the unmodified cDNA of the P4HA1 gene is shown in FIG. 1, SEQ P4HA1 ID No: 1, the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ P4HA1 ID No: 2, SEQ P4HA1 ID No: 3, SEQ P4HA1 ID No: 4 , SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

Fibroblast cultures from a patient’s biopsy were grown according to Example 5, aliquots were taken and cell lysis was performed: a cell pellet corresponding to 2 × 10 ⁶ cells, washed with phosphate buffer and resuspended in ice in lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm.

Then the patient's fibroblast culture was divided into 8 parts. The first part, designated (A), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 1, containing a portion of the unmodified cDNA of the P4HA1 gene (SEQ ID No: 1.) in example 2 in combination with the transport molecules - liposomes according to example 9.

The second part, designated (B), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 2, containing a region of the modified cDNA of the P4HA1 gene (SEQ ID No: 2.) of example 3 in combination with transport molecules - liposomes according to example 9.

The third part, designated (C), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6- SEQ ID No: 3, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 3.) in example 3 in combination with transport molecules - liposomes in example 9.

The fourth part, designated (D), was transfected according to example 7 with a gene-therapeutic substance on the basis of the vector pCMV6-SEQ ID No: 4, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 4.) in example 3 in combination with the transport molecules - liposomes in example 9.

The fifth part, designated (E), was transfected according to example 7 with a gene-therapeutic substance on the basis of the vector pCMV6- SEQ ID No: 5, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 5.) in example 3 in combination with transport molecules - liposomes in example 9.

The sixth part, designated (F), was transfected according to example 7 with a gene-therapeutic substance on the basis of the vector pCMV6- SEQ ID No: 6, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 6.) in example 3 in combination with transport molecules - liposomes in example 9.

The seventh part, designated (G), was transfected according to example 7 with a gene-therapeutic substance based on the vector pCMV6-SEQ ID No: 7, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 7.) according to example 3 in combination with transport molecules - liposomes in example 9.

The eighth part, designated (H), was transfected in example 7 with the vector plasmid pCMV6-XL5, which does not contain the cDNA of the P4HA1 gene in example 3 in combination with the transport molecules - liposomes in example 9.

Determining the amount of prolyl 4-hydroxylase alpha 1 protein in the patient's fibroblast cell lysates was performed 72 hours after transfection by ELISA (ELISA) using the Human P4HA1 ELISA kit (MyBioSource, USA), as described in Example 8.

Based on the results of determining the amount of prolyl 4-hydroxylase alpha 1 protein, a variant of the gene therapeutic substance was isolated in the patient's fibroblast culture, transfected with the most prolyl 4-hydroxylase alpha 1 protein in the cell culture lysate, which ultimately indicates the greatest expression of the P4HA1 gene . In this experiment, the highest amount of prolyl 4-hydroxylase alpha 1 in the lysate was observed during transfection with the pCMV6 P4HA1 base of the gene-therapeutic substance SEQ ID No: 3 containing the unmodified cDNA of the P4HA1 gene, as shown in Figure 19.

Thus, the most effective gene therapeutic substance applied to this patient was chosen for subsequent transfection of the patient’s cells as part of a therapeutic procedure.

Example 18

Introduction into the patient's skin of various gene-therapeutic substances containing modified cDNA of the P4HA1 gene and a region of unmodified cDNA of the P4HA1 gene to select from the group of gene-therapeutic substances the most effective gene-therapeutic substance applicable to this patient for the subsequent administration of this substance to the patient as part of a therapeutic procedure .

In order to determine the gene-therapeutic substance most effective for a particular patient, the amount of prolyl 4-hydroxylase alpha 1 was analyzed in the lysates of this patient’s skin biopsy specimens, after the introduction of gene-therapeutic substances containing modified cDNA of the P4HA1 gene and / or a region of unmodified cDNA of the P4NA1 gene.

The sequence of the unmodified cDNA of the P4HA1 gene is shown in FIG. 1, SEQ P4HA1 ID No: 1, the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ P4HA1 ID No: 2, SEQ P4HA1 ID No: 3, SEQ P4HA1 ID No: 4 , SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

The patient was injected with 7 gene-therapeutic substances and placebo in the skin of the forearm.

The first gene-therapeutic substance (A) based on pCMV6- SEQ ID No: 1, containing a region of unmodified cDNA of the P4HA1 gene (SEQ ID No: 1.) in example 2 in combination with the transport molecule - dendrimer of example 7.

The second gene-therapeutic substance (B) based on pCMV6-SEQ ID No: 2, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 2.) of example 3 in combination with the transport molecule - dendrimer of example 7.

The third gene-therapeutic substance (C) based on pCMV6-SEQ ID No: 3, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 3.) in example 3 in combination with the transport molecule - dendrimer in example 7.

The fourth gene-therapeutic substance (D) based on pCMV6- SEQ ID No: 4, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 4.) in example 3 in combination with the transport molecule - dendrimer in example 7.

The fifth gene-therapeutic substance (E) based on pCMV6-SEQ ID No: 5, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 5.) in example 3 in combination with the transport molecule - dendrimer in example 7.

The sixth gene-therapeutic substance (F) based on pCMV6- SEQ ID No: 6, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 6.) in example 3 in combination with the transport molecule - dendrimer in example 7.

The seventh gene-therapeutic substance (G) based on pCMV6- SEQ ID No: 7, containing the modified cDNA of the P4HA1 gene (SEQ ID No: 7.) in example 3 in combination with the transport molecule - dendrimer in example 7.

The eighth vector plasmid pCMV6-XL5, not containing the cDNA of the P4HA1 gene in example 3 in combination with the transport molecule - dendrimer in example 7.

The genetic constructs, one of which contains the unmodified cDNA region of the P4HA1 gene (SEQ ID No: 1), the second genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 2), the third genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No : 3), the fourth genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 4), the fifth genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 5), the sixth genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 6 ), the seventh eticheskaya construct contains the modified cDNA R4NA1 gene (SEQ ID No: 7), eighth plasmid (placebo) is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. For the preparation of gene therapeutic substances, DNA-dendrimer complexes according to Example 7 were prepared.

The obtained seven variants of the gene therapeutic substances and placebo were used for administration to the patient. The introduction was carried out by a tunnel method using a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene-therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Biopsy specimens were taken 72 hours after the administration of the gene therapeutic substances. Biopsy sampling was carried out from the sites of administration of gene therapeutic substances, placebo, as well as from intact skin using a device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient's skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was at least 10 cu. mm, weight - not less than 11 mg.

The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was collected and used to quantify the target protein.

The amount of prolyl 4-hydroxylase alpha 1 protein was determined in nine patient's skin biopsy specimens 72 hours after the administration of the gene therapeutic substances by ELISA (ELISA) using the Human P4HA1 ELISA kit (MyBioSource, USA), as described in Example 8 .

Based on the results of determining the amount of prolyl 4-hydroxylase alpha 1 protein, a variant of the gene therapeutic substance was isolated in the lysate of the patient’s skin biopsies, the introduction of which has the greatest amount of prolyl 4-hydroxylase alpha 1 protein in the cell culture lysate, which ultimately indicates the greatest gene expression P4NA1. In this experiment, the highest amount of the target protein, prolyl 4-hydroxylase alpha 1 in the skin biopsy lysate was noted with the introduction of the pCMV6 P4HA1-based gene-therapeutic substance SEQ ID No: 4, containing the modified cDNA of the P4HA1 gene, as shown in figure 20

Thus, the most effective gene-therapeutic substance with respect to this patient was chosen for its subsequent administration to the patient as part of a therapeutic procedure.

Created a remedy for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, consisting of one or more gene-therapeutic substances from the group of gene-therapeutic substances for the correction of pathological conditions of cells of organs and tissues and / or human organs and tissues resulting from insufficient expression of the P4HA1 gene, the method for its production and use.

Created tool for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, consisting of one or more gene-therapeutic substances from the group of gene-therapeutic substances using one of the modified cDNAs of the P4HA1 gene or a section of the unmodified cDNA of the P4HA1 gene allows in practice to use the gene therapeutic substances in the group to increase prolyl 4-hydrox to the required level of protein Laz 1 alpha, in various cells of organs and tissues and / or organs and human tissues by increasing gene expression R4NA1.

As a result of conducting preliminary studies of the patient’s biopsy or of cells grown from these biopsy specimens, it is necessary to choose which variant of the gene therapeutic substance from the established group of gene therapeutic substances for this patient in order to increase the amount of prolyl 4-hydroxylase alpha 1 protein, in the cells of these organs and tissues and / or organs and tissues to the required level in relation to a specific patient. In cases where the use of a gene-therapeutic substance with a region of unmodified cDNA of the P4HA1 gene does not lead to the desired change in the amount of prolyl 4-hydroxylase alpha 1 protein, in cells of organs and tissues and / or organs and tissues, it is necessary to use a substance based on modified cDNA P4HA1 gene, resulting in more efficient expression of the P4HA1 gene.

When using the claimed gene-therapeutic substance, no exogenous genetic material is inserted into the cell's genome.

The group of gene-therapeutic substances provides a high level of expression of the P4HA1 gene, increasing the amount of prolyl 4-hydroxylase alpha 1 protein in organ and tissue cells and / or human organs and tissues, in particular, in hematopoietic cells, or mesenchymal stem cells, or chondroblasts, or myocytes, or myoblasts, or fibroblasts, or osteoblasts, or keratocytes, or epithelial cells, or corneal cells, or endothelial cells, or epithelial cells, in combination with or without a transport molecule transfecting these gene-therapeutic substances of human cells and organs and / or in human organs and tissues, in particular, in connective tissue structures, or skin, or joints, or cartilage, or bone tissue, or muscle tissue, or tendons, or ligaments, or blood vessels, or the wall of the arteries, or the cornea of the eye, or the sclera, or the placenta, or dentin, or the stroma of the internal organs in combination with or without a transport molecule with the introduction of these gene-therapeutic substances into human organs and tissues.

Thus, the above examples confirm the implementation of the task, namely, the creation of highly effective means for treating conditions of the human body associated with a decrease in the expression level of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, based on the gene-therapeutic substances with the gene P4HA1, which is a group of gene therapeutic substances, which, taking into account the individual characteristics of the patient, increase the expression level of the P4HA1 gene and / or whether increasing the amount of protein prolyl 4-hydroxylase alpha 1 in the cells of organs and tissues and / or organs and tissues of the body.

In addition, the introduction of genetic structures in contrast to the introduction of the protein directly, reduces the required frequency of their introduction due to the prolonged action, as well as facilitates intracellular delivery.

Improving the efficiency of the correction of the amount of prolyl 4-hydroxylase alpha 1 protein in human organs and tissues is due to the fact that when an insufficient amount of this protein is due to a defect in the P4HA1 gene, it is not the protein that is used, but the genetic construct with the P4HA1 gene coding for this protein.

Industrial Applicability.

All the above examples on the creation and use of the group of gene-therapeutic substances created confirm its industrial applicability.

List of abbreviations

DNA - deoxyribonucleic acid

cDNA - complementary deoxyribonucleic acid

RNA - ribonucleic acid

mRNA - matrix ribonucleic acid

PCR - polymerase chain reaction

ml - milliliter, mkl - microliter

l - liter

cc mm - cubic millimeter

mkg - mkg

mg - milligram

g - gram

μM - micromoles

mm - millimole

rpm - revolutions per minute

nm - nanometer

cm - centimeter

mW - milliwatts

o.e.f. - relative fluorescence unit

CTA is a gene therapeutic substance

Claims (7)

1. An agent for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, based on gene-therapeutic substances with the P4HA1 gene, which is at least one gene-therapeutic substance , selected from the group of gene-therapeutic substances, each of which represents a genetic construct based on a vector plasmid, including the cDNA of the P4HA1 gene, with the coding sequence of the prolyl 4-hydroxylase alpha 1 protein, deletions of the 5- 'and 3'-untranslated regions, namely, obtained on the basis of a portion of the unmodified cDNA of the P4HA1 gene SEQ ID No: 1, or the modified cDNA of the P4HA1 gene, while the modified cDNA of the P4HA1 gene is used as SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level expression of the P4HA1 gene in eukaryotic cells, in particular in cells of human organs and tissues, and capable of increasing the amount of protein prolyl 4-hydroxylase alpha 1, in the cells of organs and tissues and / or human organs and tissues, particularly in hematopoietic cells, or mesenchymal stem cells, or chondroblasts, or myocytes, or myoblasts, or fibroblasts, or osteoblasts, or keratocytes , or epithelial cells, or corneal cells, or endothelial cells, or epithelial cells, in combination with or without a transport molecule, when transfected with these gene-therapeutic substances of human organ cells and tissues and / or organ and human tissues, particularly in connective tissue structures, or skin, or joints, or cartilage, or bone tissue, or muscle tissue, or tendons, or ligaments, or blood vessels, or artery wall, or cornea, or sclera or placenta, or dentin, or stroma of internal organs, in combination with or without a transport molecule, when these gene-therapeutic substances are introduced into human organs and tissues. 2. Means under item 1, characterized in that the genetic construct with a modified cDNA of the P4HA1 gene contains a nucleotide sequence that includes the protein coding region of the cDNA of the P4HA1 gene, which carries modifications that do not affect the structure of the protein prolyl 4-hydroxylase alpha 1, and namely nucleotide substitutions that do not lead to amino acid substitutions or breaks in the amino acid chain. 3. Means under item 1, characterized in that the genetic construct with a modified cDNA of the gene P4HA1 contains a nucleotide sequence that includes the protein coding region of the cDNA of the gene P4HA1, which carries modifications affecting the structure of the protein prolyl 4-hydroxylase alpha 1, namely nucleotide substitutions leading to amino acid substitutions or breakage of the amino acid chain. 4. The agent according to claim 1, characterized in that the genetic construct with the modified cDNA of the P4HA1 gene contains a nucleotide sequence that includes the protein coding region of the cDNA of the P4HA1 gene, which carries modifications that do not affect the structure of the protein prolyl 4-hydroxylase alpha 1, but namely, nucleotide substitutions that do not lead to amino acid substitutions or the breakage of the amino acid chain, in combination with modifications affecting the structure of the protein prolyl 4-hydroxylase alpha 1, namely nucleotide substitutions leading to amino acid residues Amenam or breakage of the amino acid chain. 5. The agent according to claim 1, characterized in that liposomes or dendrimers of the 5th generation and above, or amphiphilic block copolymers, or transetition reagent based on Polyethylenimine (PEI) are used as a transport molecule. 6. A method of obtaining an agent for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, according to claim 1, consisting in obtaining each gene-therapeutic substance from the group of gene-therapeutic substances according to 1, in this case, the cDNA of the P4HA1 gene is obtained, then the cDNA is placed into a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, increasing and isolating the required amount of gene the genetic structure is then combined with a transport molecule to transfect the resulting gene-therapeutic substance of the cells of organs and tissues and / or introduce the resulting gene-therapeutic substance into human organs and tissues, using the cDNA of the P4HA1 gene for the prolyl 4-hydroxylase coding sequence alpha 1, with deletions of 5'- and 3'-untranslated regions, namely, obtained on the basis of a portion of the unmodified cDNA of the P4HA1 gene SEQ ID No: 1, or the modified cDNA of the P4HA1 gene, while in The modified cDNA of the P4NA1 gene is either SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination these genetic constructs. 7. A method of using an agent for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and / or a decrease in the amount of prolyl 4-hydroxylase alpha 1 protein, which consists in transfecting a gene therapeutic substance selected from the group of genetically therapeutic substances of claim 1 cells of organs and tissues of the patient and / or in the introduction into the organs and tissues of the patient autologous cells of the patient transfected with a gene therapeutic substance selected from the group of genetically therapeutic subjects created stations according to claim 1, and / or in the introduction into the patient’s organs and tissues of a gene therapeutic substance or several substances selected / selected from the group of gene-therapeutic substances created according to claim 1, or a combination of the indicated methods.

Images