RU2658428C1 - Agent for treatment of human body states related to p4ha1 gene reduced expression and/or reduced quantity of prolyl 4-hydroxylase alpha 1 protein on basis of gene-therapeutic substances with p4ha1 gene, method of manufacture and operation - Google Patents

Abstract

FIELD: biology.

SUBSTANCE: invention relates to molecular biology, biotechnology, genetic engineering and medicine and is a means for treating conditions of the human body associated with a decrease in the expression of the P4HA1 gene and/or a decrease in the amount of protein spilled 4-hydroxylase alpha 1, based on gene therapy substances with the P4HA1 gene, at least one gene therapeutic substance selected from the group of gene therapeutic substances, each representing a genetic construct based on a vector plasmid comprising the cDNA of the P4HA1 gene, with the coding sequence of the protein spilled 4-hydroxylase alpha 1, with deletions 5'- and 3'-non-translated regions, namely the unmodified cDNA gene obtained from the site P4HA1 SEQ ID No: 1, or a modified cDNA of the P4HA1 gene, wherein the modified cDNA of the P4HA1 gene is SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level of expression of the P4HA1 gene in eukaryotic cells.

EFFECT: invention effectively increases the amount of protein spilled 4-hydroxylase alpha 1 in eukaryotic cells and to obtain a highly effective agent for the treatment of human body conditions associated with a decrease in the level of expression of the P4HA1 gene and/or a decrease in the amount of the prolyl 4-hydroxylase alpha 1 protein.

7 cl, 20 dwg, 18 ex

Description

FIELD OF THE INVENTION

The invention relates to molecular biology, biotechnology, genetic engineering and medicine and can be used to correct the pathological conditions of cells of various organs and tissues, as well as human organs and tissues proper, associated with a decrease in the expression level of the P4NA1 gene and / or a decrease in the amount of protein shed 4- hydroxylases alpha 1, in particular for therapeutic purposes.

Prior level.

Collagen glycoprotein is the most common protein not only in the extracellular matrix, but throughout the human body. It accounts for one third of all body proteins and 70% of all skin proteins. Collagen is the basis of connective tissue, the structural basis of the skin, cartilage, synovial fluid of the joints, bronchi, lung tissue, vascular wall, intervertebral discs, intestinal and stomach walls. In collagen, one third of the amino acid residues are glycine and another third are proline and hydroxyproline. Hydroxyproline, represented in collagen by a very large number of residues, stabilizes the triple helix of collagen with respect to the action of proteases. In this connection, collagen provides structural support to the tissue, gives it hardness and durability.

Collagen is synthesized in fibroblasts in the form of a high molecular weight precursor - procollagen. Collagen polypeptide chains are synthesized on membrane-bound ribosomes and enter the lumen of the endoplasmic reticulum in the form of larger precursors (pro-alpha chains) having additional amino acid residues (propeptides) at the N- and C-ends, as well as a short N-terminal signal peptide, necessary for the entry of the resulting polypeptide into the endoplasmic reticulum. Further, some proline and lysine residues are hydroxylated. The hydroxyl groups of these amino acids form inter-helical hydrogen bonds, which is necessary for the correct three-dimensional folding of newly synthesized procollagen chains.

The formation of hydroxyprolyl and hydroxylisyl is catalyzed by iron-containing enzymes - prolyl hydroxylase and lysyl hydroxylase, which are in the microsomal fraction of many tissues (skin, liver, lungs, heart, skeletal muscle, granulating wound surfaces). These enzymes are peptidyl hydroxylases, since hydroxylation occurs only after the inclusion of proline or lysine in the polypeptide chain.

Prolyl 4-hydroxylase is an oxidoreductase class enzyme that catalyzes hydroxylation at the 4 position of specific proline residues in nascent procollagen chains. The enzyme requires the activity of Fe2 +, ascorbate and α-ketoglutarate for activity, and the reaction is necessary for the thermal stability of the triple helical structure of collagen. The enzyme is a tetramer containing 2α and 2β chains; The β-chain in monomeric form is a protein disulfide isomerase enzyme. Moreover, the α-subunit contains catalytic and peptide-substrate binding domains, but is inactive in the absence of a β-subunit. The enzyme is an oxygenase with a mixed function and functions with the participation of molecular oxygen.

In vitro expression of active recombinant prolyl 4-hydroxylase from its subunits was successfully obtained by co-infection of insect cells Spodoptera frugiperda and Trichoplusia ni (Vuori, K., et al. (1992) Proc Natl Acad Sci USA 89, 7467-7470) with recombinant baculoviruses or cotransfection with expression vectors in mammalian cell lines COS-1 (John, DC and Bulleid, NJ (1996) Biochem J 317 (Pt 3), 659-665) and HEK293 (Wagner, K., et al. (2000) Biochem J352 Pt 3, 907-911), in the yeast Pichia pastoris (Vuorela, A., et al. (1997) Embo J16, 6702-6712) and Saccharomyces cerevisiae (Toman, PD et al. (2000) J Biol Chem 275 , 23303-23309).

The expression systems for producing recombinant collagens are also E. coli cells, transgenic animals and plants. However, almost all of the above expression systems have their drawbacks. For example, the E. coli expression system has no post-translational modification, and the yeast expression system does not have prolyl 4-hydroxylase activity, although the yield of collagen in Pichia pastoris is the highest among these expression systems. The mammalian cell line expression system has a low yield and limits for specific tissue types, and the insect cell expression system has a low prolyl 4-hydroxylase activity. As for transgenic animals (silkworm or mice) or plants (tobacco), in them collagen products were excessively “crosslinked”. In addition, it is difficult to restore or purify recombinant collagens due to cell lysis. Therefore, the creation of an effective expression system for producing collagen in high yield is very important.

The known P4NA1 gene shed 4-hydroxylase of the alpha polypeptide I of Homo sapiens encoding the catalytic α (I) subunit of the main isoenzyme C-P4H (C-P4H-I) (https://cgwb.nci.nih.gov/cgi-bin/ hgGene? hgg_gene = uc001jth.3 & hgg_prot = Q5VSQ6 & hgg_chrom = chr10 & hgg_start = 74766979 & hgg_end = 74856732 & hgg_type = knownGene & db = hg19 & hgsid = 1030298). The P4HA1 gene is located at position 10q22.1 of the chromosome, has a length of more than 69 kB, and consists of 16 exons. The protein of the P4NA1 gene catalyzes the formation of 4-hydroxyproline, which is necessary for the correct three-dimensional folding of newly synthesized procollagen chains.

Mutations of the human P4NA1 biallelic gene were studied in a family with congenital connective tissue disorder, which manifested as early articular hypermobility, articular contractures, muscle weakness and bone dysplasia, as well as high myopia, with confirmation of the clinical improvement in motor function over time in the surviving patient. As in null P4ha1 mice that die prenatally, muscle tissue from generations P1 and P2 showed reduced collagen IV immunoreactivity on the membrane of the basal muscle. Patients were heterozygous for the mutant gene, which led to a decrease, but not the absence of the level of P4NA1 protein and the activity of prolyl 4-hydroxylase C-P4H in dermal fibroblasts compared to control samples. Differential scanning calorimetry showed reduced thermal stability of collagen in dermal fibroblasts obtained from patients, compared with control samples. Mutations affecting the C-P4Hs protein family and, in particular, C-P4H-I, should be considered in patients with congenital connective tissue / myopathy disorders with joint hypermobility, contractures, mild skeletal dysplasia and high myopia (Yaqun Zou, Sandra Donkervoort et al. Molecular Human Genetics, Volume 26, Issue 12, June 15, 2017, pages 2207-2217, https://doi.org/10.1093/hmg/ddx110).

WO 2014170460 (A2) describes a method for producing collagen from sea sponges (Chondrosia reniformis) in Pichia pastoris yeast. In particular, three vector constructions were created:

- cDNA encoding the alpha subunit of prolyl 4-hydroxylase (pPinkHC \ <xo pPinkLC \ vectors),

- with cDNA encoding the beta subunit of prolyl 4-hydroxylase (pPIC6B \ PDI vector),

- with cDNA encoding non-fibrillar collagen protein C. Reniformis (pPICZB \ ColCH).

The application describes a method that involves the joint transformation of a yeast strain with two different vectors containing: the first is the coding sequence for the alpha subunit of the prolyl 4-hydroxylase enzyme, followed by transformation using a vector containing one coding sequence of collagen protein of marine sponge.

The disadvantage of this approach is that the yeast cell expression system, which according to published data does not have significant prolyl-4-hydroxylase activity, was selected for the expression of the genes of prolyl 4-hydroxylase subunits of the sea sponge. This patent application does not consider the possibility of expression in human cells as a gene-therapeutic agent, taking into account the individual characteristics of the patient, in connection with which a group of variations for this agent may be needed.

For the prototype, the authors decided on patent US 7759090 (B2), which describes the expression system for collagen production. In particular, stably transfected insect cell lines containing cDNAs encoding human α prolyl 4-hydroxylase coding for α and β subunits in Trichoplusia ni and Drosophila melanogaster S2 cells are shown. Additionally, the involvement of prolyl 4-hydroxylase in the assembly of three alpha chains with the formation of trimeric type minicollagen XXI, which contains the intact C-terminal non-collagen domain (NC1) and collagen domain (COL1) in the Drosophila system, was characterized. Minicollagen XXI coexpressed with prolyl 4-hydroxylase contained sufficient hydroxyproline to form heat-resistant pepsin-resistant triple helices.

One embodiment of the invention describes a recombinant insect cell comprising a transfected gene encoding prolyl 4-hydroxylase. This gene includes the α-subunit and / or β-subunit of prolyl 4-hydroxylase. The recombinant insect cell further includes a transfected gene encoding the collagen (COL1) domain and the C1-terminal domain (NC1) of type XXI collagen.

Genes encoding the α-subunit and β-subunit of human prolyl 4-hydroxylase were cloned together in the pIZ / V5-His expression vector under the control of the OplE2 promoter derived from the polypeptide virus mnogonad (in the InsectSelect system), and in the Drosophila inducible expression system (DES ®) (Invitrogen) genes encoding the α-subunit and β-subunit of prolyl 4-hydroxylase were cloned separately in the pMT / V5-HisA expression vector under the control of the metallothionein promoter, which is induced by the addition of copper or cadmium ions.

It was shown that P4Hα and P4Hβ subunits are able to assemble into the active tetramer α2β2. The resulting prolyl 4-hydroxylase provides collagen synthesis with stable triple helices. The total activity of prolyl 4-hydroxylase in stably transfected Trichoplusia ni P4H cells increased only 2-fold compared to the endogenous enzyme in the control without cell transfection, and in the Drosophila S2 system, it was 3-4 times higher than in the Trichoplusia ni system. This is due to the higher copy number of recombinant plasmid vectors that were used to transfect the genome of Drosophila S2 cells. A comparison of the expression levels of P4Hα and P4Hβ in the lysates of Trichoplusia ni cells showed that the expression level of the P4Hα protein is approximately 5 times lower than P4Hβ. For P4H expression in the inducible Drosophila expression system, Drosophila S2 cells were co-transfected with pMT / P4Hα, pMT / P4Hβ and pCoHygro in a 10: 10: 1 ratio using Effectene transfection reagent (Qiagen). Collagen domains were introduced into cells by transformation with the pMT / BiP-mC21 vector. Thus, recombinant collagen was obtained using the expression system of three genes in Drosophila melanogaster cells.

The disadvantage of this approach is that for the expression of human prolyl 4-hydroxylase subunit genes, an insect cell expression system has been selected, which according to published data has low prolyl 4-hydroxylase activity. Also, the possibility of expression in human cells as a gene-therapeutic agent is not considered, taking into account the individual characteristics of the patient, in connection with which a group of variations for this agent may be needed.

Disclosure of invention

The objective of the invention is to provide a highly effective means for treating the conditions of the human body associated with a decrease in the expression level of the P4NA1 gene and / or a decrease in the amount of protein shed by 4-hydroxylase alpha 1, based on gene therapeutic substances with the P4NA1 gene, which are a group of gene therapeutic substances using which, taking into account the individual characteristics of the patient, an increase in the level of expression of the P4NA1 gene and / or an increase in the amount of protein shed 4-hydroxylase a fa 1 in cells of organs and tissues and / or organs and tissues

This problem is solved due to the fact that a tool has been created for treating the conditions of the human body associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shed by 4-hydroxylase alpha 1, based on gene-therapeutic substances with the P4NA1 gene, which is at least at least one gene therapeutic substance selected from the group of gene therapeutic substances, each of which represents a genetic construct based on a vector plasmid comprising the cDNA of the P4NA1 gene, encoding the last protein shed 4-hydroxylase alpha 1, with deletions of 5'- and 3'-untranslated regions, namely, obtained on the basis of a portion of unmodified cDNA of the P4NA1 gene SEQ ID No: 1, or modified cDNA of the P4NA1 gene, while as a modified cDNA P4NA1 gene use SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level of expression of the P4NA1 gene in eukaryotic cells, in particular in cells human organs and tissues, and capable of increasing the amount of protein shed by 4-hydroxylase alpha 1, in the cells of organs and tissues and / or organs and tissues of a person, in particular in hematopoietic cells, or mesenchymal stem cells, or chondroblasts, or myocytes, or myoblasts, or fibroblasts, or osteoblasts, or keratocytes, or epithelial cells, or corneal cells, or endothelial cells, or epithelial cells, in combination with or without a transport molecule when transfected with these gene-therapeutic substances mi of cells of human organs and tissues and / or in human organs and tissues, in particular, in connective tissue structures, or skin, or joints, or cartilage, or bone tissue, or muscle tissue, or tendons, or ligaments, or blood vessels or the wall of arteries, or the cornea of the eye, or the sclera, or placenta, or dentin, or the stroma of internal organs in combination with or without a transport molecule when these gene-therapeutic substances are introduced into human organs and tissues. In this case, the genetic construct with the modified cDNA of the P4NA1 gene contains a nucleotide sequence that includes the protein coding region of the cDNA of the P4NA1 gene, which carries modifications that do not affect the protein structure, shed 4-hydroxylase alpha 1, namely: nucleotide substitutions that do not lead to amino acid substitutions or a break in the amino acid chain. Or, a genetic construct with a modified cDNA of the P4NA1 gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the P4NA1 gene that carries modifications that affect the structure of the protein shed by 4-hydroxylase alpha 1, namely: nucleotide substitutions leading to amino acid substitutions or amino acid termination chains. Or, a genetic construct with a modified cDNA of the P4NA1 gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the P4HA1 gene that carries modifications that do not affect the protein structure of shed 4-hydroxylase alpha 1, namely, nucleotide substitutions that do not lead to amino acid substitutions or the termination of the amino acid chain, in combination with modifications affecting the structure of the protein, shed 4-hydroxylase alpha 1, namely: nucleotide substitutions leading to amino acid substitutions or termination of the amino acid enu. As a transport molecule, liposomes or dendrimers of the 5th and higher generations, or amphiphilic block copolymers, or transethection reagent based on Polyethylenimine (PEI) are used.

A method of obtaining a means for treating the conditions of the human body associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shedding 4-hydroxylase alpha 1, is to obtain each gene therapeutic substance from the group of gene therapeutic substances, whereby cDNA of the P4NA1 gene is obtained, then cDNA is placed in a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, and the necessary amount of genetic constructs is increased and secreted cells, then combine the genetic construct with a transport molecule to transfect the obtained gene therapeutic substance of cells of organs and tissues and / or introduce the obtained gene therapeutic substance into human organs and tissues, using cDNA of the P4NA1 gene with the coding sequence of the protein shed 4-hydroxylase alpha 1, with deletions of 5'- and 3'-untranslated regions, namely, obtained on the basis of a plot of unmodified cDNA of the P4NA1 gene SEQ ID No: 1, or a modified cDNA of the P4NA1 gene, while as modifiers P4NA1 gene cDNA is used, either SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination these genetic constructs.

A method of using the agent for treating human body conditions associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shed 4-hydroxylase alpha 1, which consists in transfecting a gene-therapeutic substance selected from the group of created gene-therapeutic substances, cells of organs and tissues of the patient and / or in the introduction into the patient’s organs and tissues of autologous patient cells transfected with a gene-therapeutic substance selected from the group of created gene-therapeutic substances d according to claim 1, and / or in the introduction into the organs and tissues of a patient of a gene-therapeutic substance or several substances selected / selected from the group of created gene-therapeutic substances according to claim 1., or a combination of the indicated methods.

List of figures

In FIG. one

The nucleotide sequence of the unmodified cDNA of the P4NA1 gene is presented, the sequence of which is homologous to that given in the GenBank database under the number NM_000917 P4HA1SEQ ID No: 1.

In FIG. 2

The nucleotide sequence of the modified cDNA of the P4NA1 gene, SEQ ID No: 2, which

contains 2 nucleotide substitutions G> C at positions 730, 790; 3 nucleotide substitutions T> G at positions 511, 649, 1123; 4 nucleotide substitutions A> G at positions 487, 502, 646, 727; 2 nucleotide substitutions T> C at positions 500, 644, which do not lead to changes in the amino acid sequence of the protein shed by 4-hydroxylase alpha 1.

In FIG. 3

The nucleotide sequence of the modified cDNA of the P4NA1 gene, SEQ ID No: 3, which

contains 3 nucleotide substitutions G> C at positions 730,790,1828; 6 nucleotide substitutions T> G at positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G at positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C at positions 500, 644, which do not lead to changes in the amino acid sequence of the protein shed by 4-hydroxylase alpha 1.

In FIG. four

Presents the nucleotide sequence of the modified cDNA of the gene P4NA1, SEQ ID No: 4, which

contains 28 non-synonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 13370T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 G> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, leading to changes in the amino acid sequence of the protein 4-hydroxylase alpha 1.

In FIG. 5

The nucleotide sequence of the modified cDNA of the P4NA1 gene is presented, SEQ ID No: 5, which contains 28 non-synonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 1337 C> T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 C> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, leading to changes in the amino acid sequence of the protein spilled 4-hydroxylase alpha 1, as well as 3 nucleotide substitutions G> C at positions 730, 790, 1828; 6 nucleotide substitutions T> G at positions 511, 649, 1123, 1192, 1249, 1801; 6 nucleotide substitutions A> G at positions 487, 502, 646, 727, 1429, 1816; 2 nucleotide substitutions T> C at positions 500, 644.

In FIG. 6

Presents the nucleotide sequence of the modified cDNA of the gene P4NA1, SEQ ID No: 6, which

contains a deletion from 1490 to 1544 n.p., leading to changes in the amino acid sequence of the protein shed of 4-hydroxylase alpha 1.

In FIG. 7

The nucleotide sequence of the modified cDNA of the P4NA1 gene, SEQ ID No: 7, which

contains 3 nucleotide substitutions G> C at positions 730, 790, 1828; 6 nucleotide substitutions T> G at positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G at positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C at positions 500, 644; a deletion from 1490 to 1544 bp, leading to changes in the amino acid sequence of the protein shed by 4-hydroxylase alpha 1.

In FIG. 8

In order to subsequently correctly determine the gene therapeutic effect after transfection of fibroblasts with a gene therapeutic substance with cDNA of the P4NA1 gene, an analysis of the endogenous expression of the P4NA1 gene was carried out in the culture of primary fibroblasts. The figure shows the graphs of the accumulation of products of polymerase chain reaction (PCR), corresponding to:

1 - cDNA of the P4NA1 gene, fibroblasts with reduced expression of the P4NA1 gene

2 - cDNA of the P4NA1 gene, fibroblasts with normal expression of the P4NA1 gene

3 - cDNA of the B2M gene, fibroblasts with reduced expression of the P4NA1 gene

4 - cDNA of the B2M gene, fibroblasts with normal expression of the P4NA1 gene

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

In FIG. 9

In order to confirm the increase in the expression of the P4NA1 gene in a cell culture of fibroblasts with reduced expression of the P4NA1 gene during transfection of these cells with a gene therapeutic substance with cDNA of the P4NA1 gene, the graphs of accumulation of PCR products are presented corresponding to:

1 - cDNA of the P4NA1 gene in fibroblasts with normal expression of the P4NA1 gene,

2 - cDNA of the P4NA1 gene in fibroblasts with reduced expression of the P4NA1 gene before transfection of the GTS with cDNA of the P4NA1 gene

3 - cDNA of the P4NA1 gene in fibroblasts with reduced expression of the P4NA1 gene after transfection of the GTS with cDNA of the P4NA1 gene

4 - cDNA of the P4NA1 gene in fibroblasts with reduced expression of the P4NA1 gene after transfection with a vector without cDNA of the P4NA1 gene

5-cDNA of the B2M gene in fibroblasts with normal expression of the P4NA1 gene,

6- B2M gene cDNA in fibroblasts with reduced expression of the P4NA1 gene prior to transfection of GTS with cDNA of the P4NA1 gene

7- B2M gene cDNA in fibroblasts with reduced expression of the P4NA1 gene after transfection of GTS with cDNA of the P4NA1 gene

8 - cDNA of the B2M gene in fibroblasts with reduced expression of the P4NA1 gene after transfection with a vector without cDNA of the P4NA1 gene

From the graphs it follows that in the case of transfection with a vector without insertion of the cDNA of the P4NA1 gene, the level of cDNA of the P4NA1 gene in fibroblasts did not change, and in the case of transfection with a vector of cDNA P4NA1, the cDNA level of fibroblasts with reduced expression of the P4NA1 gene increased significantly (to a level higher than the level of cDNA P4NA1 gene in normal fibroblasts).

In FIG. 10

In order to confirm the increase in the amount of protein, shedding of 4-hydroxylase alpha 1 in a cell culture of fibroblasts with normal expression of the P4NA1 gene during transfection of these cells with the gene therapeutic substance containing cDNA of the P4NA1 gene, a graph of the amount of protein shedding of 4-hydroxylase alpha 1 of non-transfected fibroblasts is presented (culture A) transfected with pCDNA 3.1 (+) vector without P4NA1 cDNA (culture B) and transfected with a gene therapeutic substance based on the genetic construct pCDNA 3.1-P4HA1SEQ ID No: 1 (c ultura C). It follows from the graph that upon transfection of fibroblasts with a gene therapeutic substance with cDNA of the P4NA1 gene, an increase in the amount of protein shed by 4-hydroxylase alpha 1 in the cell lysate occurs.

In FIG. eleven

In order to confirm the increase in the amount of protein, shedding of 4-hydroxylase alpha 1 in human skin with the introduction of a fibroblast cell culture transfected with a gene therapeutic substance, an analysis of the change in the amount of protein shedding 4-hydroxylase alpha 1 in the skin of patients is presented. At the same time, three variants of autologous fibroblast culture were injected into patients - non-transfected (A), transfected with pCMV6-XL5 vector (B) and transfected with gene-therapeutic substance based on pCMV6-P4HA1SEQ ID No: 7 (C) - into the skin of the forearm. A quantitative level of protein shedding 4-hydroxylase alpha 1 in intact skin was also analyzed. An increase in the amount of protein shedding 4-hydroxylase alpha 1 in the patient’s skin in the area of the introduction of fibroblasts transfected with the gene therapeutic substance with the cDNA of the P4NA1 gene (C) was shown.

In FIG. 12

In order to confirm the increase in the amount of protein, he shed 4-hydroxylase alpha 1 to a different individual level in cell cultures of fibroblasts of patients upon transfection of these cells with gene-therapeutic substances with modified and unmodified cDNA of the P4NA1 gene, depending on the presence and type of a particular modification of the cDNA gene P4NA1 presents an analysis of changes in the quantitative level of protein shed of 4-hydroxylase alpha 1 in cultures of human skin fibroblasts depending on the presence and type of modifications in cDN R4NA1 gene used to transfect fibroblasts.

Fibroblast cultures of 28 patients were divided into 8 parts each from (A) to (H); the first parts (A) of patient cell cultures were transfected with the gene therapeutic substance pCMV6-P4HA1SEQ ID No: 1, parts (B) were transfected with the gene therapeutic substance pCMV6-P4HA1SEQ ID No: 2, parts (C) were transfected with the gene therapeutic substance pCMV6-P4HA1SEQ ID No: 3, part (D) was transfected with the gene therapeutic substance pCMV6-P4HA1SEQ ID No: 4, part (E) was transfected with the gene therapeutic substance pCMV6-P4HA1SEQ ID No: 5, part (F) was transfected with the gene therapeutic substance pCMV6- P4HA1SEQ ID No: 6, part (G) was transfected with the gene therapeutic substance pCM V6-P4HA1SEQ ID No: 7, part (H) was transfected with a vector plasmid lacking the cDNA of the P4NA1 gene.

Based on the analysis of the quantitative level of the protein, shedding of 4-hydroxylase alpha 1, we selected indicators for each part of the cell culture from each patient, which showed the greatest amount of protein shedding 4-hydroxylase alpha 1 and combined them into seven groups, based on the following criterion:

In group 1, the largest amount of protein shed 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1SEQ ID No: 1,

in group 2, the largest amount of protein shed 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1 SEQ ID No: 2,

in group 3, the largest amount of protein shed 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1 SEQ ID No: 3,

in group 4, the largest amount of protein shed 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1 SEQ ID No: 4,

in group 5, the largest amount of protein shed 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1 SEQ ID No: 5,

in group 6, the largest amount of protein shed 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1 SEQ ID No: 6,

in group 7, the highest amount of protein shedding 4-hydroxylase alpha 1 was observed during transfection of pCMV6-P4HA1 SEQ ID No: 7.

None of the cell cultures showed that the greatest amount of protein shed 4-hydroxylase alpha 1 was present upon transfection with a vector without insertion of the cDNA of the P4NA1 gene.

The figure 12 for each group of cell cultures shows a diagram of indicators of the concentration of protein shedding 4-hydroxylase alpha 1 (averaged within the group, if the group includes more than one cell culture) for all involved in the experiment of gene-therapeutic substances, after transfection of these cell cultures with gene therapeutic substances containing modified and unmodified cDNA of the P4NA1 gene.

From the figure it follows that the achievement of the greatest amount of protein shed 4-hydroxylase alpha 1 in cultures of skin fibroblasts of various patients during their transfection with gene therapeutic substances, is associated with individual characteristics of patients and depends on the presence and type of modifications in the c4DNA of the P4NA1 gene that are part of the gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 1 (A)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 1 (A)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 2 (B)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 2 (B)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 3 (С)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 3 (C)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 4 (D)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 5 (Е)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 5 (E)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 6 (F)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 7 (G)

parts of cell cultures transfected with P4NA1 GTS SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

parts of cell cultures transfected with placebo (H)

In FIG. 13

In order to confirm the increase in the expression of the P4NA1 gene in cell culture of keratocytes and epithelial cells of the cornea of the eye during transfection of these cells with a gene therapeutic substance with cDNA of the P4NA1 gene, the graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the P4NA1 gene, keratocytes before transfection

2 - cDNA of the P4NA1 gene, corneal epithelium prior to transfection

3 - cDNA of the P4NA1 gene, keratocytes after transfection

4 - cDNA of the gene P4NA1, corneal epithelium after transfection

5 - cDNA of the B2M gene, keratocytes before transfection

6 - cDNA of the B2M gene, corneal epithelium prior to transfection

7 - cDNA of the B2M gene, keratocytes after transfection

8 - cDNA of the B2M gene, corneal epithelium after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the P4NA1 gene in the culture of keratocytes and in the culture of the epithelium increased many times.

In FIG. fourteen

In order to confirm the increase in the expression of the P4NA1 gene in the cell culture of chondroblasts during the transfection of these cells with a gene therapeutic substance with cDNA of the P4NA1 gene, the graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the P4NA1 gene, before transfection

2 - cDNA of the gene P4NA1, after transfection

3 - cDNA of the B2M gene, before transfection

4 - cDNA of the B2M gene, after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the P4NA1 gene increased many times.

In FIG. fifteen

In order to confirm the increase in the amount of protein, shedding of 4-hydroxylase alpha 1 in human skin when a therapeutic substance was introduced into the skin, an analysis of changes in the quantitative level of protein shedding of 4-hydroxylase alpha 1 in the skin is presented. At the same time, the patient was injected with a gene therapeutic substance containing the pCMV6-P4HA1 genetic construct SEQ ID No: 4 (B) with a transport molecule and a placebo, which is a combination of the pCMV-XL5 vector plasmid without the P4NA1 gene cDNA with the transport molecule (A), was simultaneously introduced - into the skin of the forearm. An increase in the amount of protein shedding 4-hydroxylase alpha in a skin biopsy of patient 1B was shown, to which a gene therapeutic substance containing a genetic construct with cDNA of the P4NA1 gene was injected, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

In FIG. 16

In order to confirm the increase in the amount of protein, he shed 4-hydroxylase alpha 1

In human cartilage tissue, when a gene therapeutic substance is introduced into the cartilage tissue, an analysis of the change in the quantitative level of the protein shed of alpha 1-hydroxylase alpha 1 in the cartilage tissue is presented. At the same time, the patient was injected with a gene therapeutic substance containing a vector plasmid with cDNA of the P4HA1pCDNA 3.1 gene P4HA1SEQ ID No: 5 (B) with a transport molecule and a placebo pCDNA 3.1 (+) was introduced, which is a combination of a vector plasmid that does not contain the P4NA1 gene cDNA with a transport molecule (A) - into the cartilage tissue.

An increase in the quantitative level of protein shedding 4-hydroxylase alpha in the lysate of the cartilage biopsy sample of patient 1B was shown, which was injected with a gene therapeutic substance containing a genetic construct with cDNA of the P4NA1 gene, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

In FIG. 17

In order to confirm the increase in the amount of protein, shedding of 4-hydroxylase alpha 1 in the muscle tissue of a person with the introduction of the gene therapeutic substance into the muscle tissue, an analysis of the change in the amount of protein shedding of 4-hydroxylase alpha 1 in the muscle tissue is presented. At the same time, the patient was injected with a gene therapeutic substance containing a vector plasmid with cDNA of the P4NA1-pCMV6-Kan / Neo gene P4HA1SEQ ID No: 6 (B) with a transport molecule and a placebo pCMV6-Kan / Neo, which is a combination of a vector plasmid containing no cDNA of the P4NA1 gene with the transport molecule (A) - into the muscle tissue in the area of the forearm. An increase in the amount of protein shedding 4-hydroxylase alpha 1 in a biopsy of the muscle tissue of patient 1B was shown, which was injected with a gene therapeutic substance containing a genetic construct with cDNA of the P4NA1 gene, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

In FIG. eighteen

In order to confirm the increase in the amount of protein, shed 4-hydroxylase alpha 1 to a different individual level with the introduction of gene therapeutic substances with modified and unmodified cDNA of the P4NA1 gene into the skin of the patients, the quantitative level of protein shed 4-hydroxylase alpha 1 in human skin was analyzed depending on the presence and type modifications in the cDNA of the P4NA1 gene.

Each of the 24 randomly selected patients was injected with 7 gene therapeutic substances pCMV6-SEQ ID No: 1, pCMV6-SEQ ID No: 2, pCMV6-SEQ ID No: 3, pCMV6-SEQ ID No : 4, pCMV6-SEQ ID No: 5, pCMV6-SEQ ID No: 6, pCMV6-SEQ ID No: 7, and placebo pCMV6-XL5.

Based on the analysis of the amount of protein, shedding of 4-hydroxylase alpha 1 in biopsy samples, we selected indicators for each biopsy sample from each patient, which showed the highest quantitative levels of protein shedding 4-hydroxylase alpha 1 and combined them into seven groups based on the following criteria:

In group 1, the largest amount of protein shed 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 1,

in group 2, the largest amount of protein shed 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 2,

in group 3, the largest amount of protein shed 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 3,

in group 4, the largest amount of protein shed 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 4,

in group 5, the largest amount of protein shed 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 5,

in group 6, the largest amount of protein shed 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 6,

in group 7, the highest amount of protein shedding 4-hydroxylase alpha 1 was observed with the introduction of pCMV6-P4HA1 SEQ ID No: 7.

None of the biopsy specimens showed that the largest amount of protein shed 4-hydroxylase alpha 1 was present when a placebo was administered.

Figure 18 shows, for each group of biopsy samples, charts of protein concentration indicators of shedding 4-hydroxylase alpha 1 (averaged within the group if more than one biopsy is included in the group) for all genetically therapeutic substances participating in the experiment after administration to patients these gene therapeutic substances containing modified and unmodified cDNA of the P4NA1 gene.

From this example, it follows that the achievement of an increase in the amount of protein shed 4-hydroxylase alpha 1 in biopsy samples of the skin of various patients with the introduction of gene therapeutic substances into the skin is associated with individual characteristics of patients and depends on the presence and type of modifications in the c4DNA of the P4NA1 gene included in gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 1 (А)

biopsy specimens of patients after administration of P4NA1 GTS SEQ ID No: 1 (A)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 2 (B)

biopsy samples of patients after administration of P4NA1 GTS SEQ ID No: 2 (B)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 3 (С)

biopsy specimens of patients after administration of P4NA1 GTS SEQ ID No: 3 (C)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 4 (D)

biopsy specimens of patients after administration of P4NA1 GTS SEQ ID No: 4 (D)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 5 (Е)

biopsy specimens of patients after administration of P4NA1 GTS SEQ ID No: 5 (E)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 6 (F)

biopsy specimens of patients after administration of P4NA1 GTS SEQ ID No: 6 (F)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 7(G)

biopsy samples of patients after administration of P4NA1 GTS SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (Н)

biopsy samples of patients after placebo (N)

In FIG. 19

In order to determine the most effective gene-therapeutic substance for a particular patient, the quantitative level of protein prolyl 4-hydroxylase alpha 1 was analyzed in cell lysates of this patient's fibroblasts transfected with different genetic constructs containing unmodified or modified cDNA of the P4NA1 gene.

According to the analysis of the amount of protein shedding alpha 4-hydroxylase alpha 1 in the patient’s fibroblast culture, a variant of the gene-therapeutic substance was isolated, the transfection of which revealed the highest concentration of protein shedding 4-hydroxylase alpha 1 in the cell culture lysate. In this experiment, the highest concentration of protein shedding alpha 4-hydroxylase alpha 1 in the lysate was observed upon transfection with a gene therapeutic substance based on pCMV6-P4HA1SEQ ID No: 3 containing a modified P4NA1 cDNA, as shown in Figure 19.

Thus, the most effective gene-therapeutic substance has been selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Designations:

1 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 1 (A)

2 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 2 (B)

3 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 3 (C)

4 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 4 (D)

5 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 5 (E)

6 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 6 (F)

7 - cell lysate after transfection of the GTS P4HA1SEQ ID No: 7 (G)

8 - cell lysate after placebo transfection (H)

In FIG. twenty

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of protein shedding 4-hydroxylase alpha 1 in the lysates of this patient’s skin biopsy samples was analyzed after the introduction of gene-therapeutic substances containing unmodified or modified P4NA1 cDNA of the gene.

According to the analysis of the amount of protein shedding 4-hydroxylase alpha 1 in the lysate of biopsy samples of the patient’s skin, a variant of the gene-therapeutic substance was isolated, with the introduction of which the highest concentration of protein shedding 4-hydroxylase alpha 1 in the lysate of the biopsy was revealed. In this experiment, the highest concentration of protein shedding 4-hydroxylase alpha 1 was noted with the introduction of a gene therapeutic substance based on pCMV6 P4HA1SEQ ID No: 4 containing a modified P4HA1 cDNA, as shown in Figure 20.

Thus, the most effective gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

Designations:

1 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 1 (A)

2 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 2 (B)

3 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 3 (C)

4 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 4 (D)

5 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 5 (E)

6 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 6 (F)

7 - biopsy specimen lysate after administration of P4NA1 GTS SEQ ID No: 7 (G)

8 - lysate biopsy specimen after the introduction of placebo (N)

The implementation of the invention.

With a decrease in the expression of genes encoding collagen synthesis proteins, for example, the P4NA1 gene, the quality of the structure of organs and tissues of the body decreases. So mice homozygous for the zero mutation show a high mortality rate during organogenesis during the embryonic period of development, the presence of capillary ruptures, and impaired formation of the basement membrane. http://www.jbc.org/content/282/4/2512.

The advantages of using a genetic construct with the P4NA1 gene to correct the expression of the P4NA1 gene and the amount of protein shed of alpha 1 4-hydroxylase in the cells of human organs and tissues:

1) it is easier to provide a higher and stable level of the target protein in the cells,

2) transportation of the gene-therapeutic substance is provided to a larger spectrum of cells of human organs and tissues, as well as more efficient intracellular transportation of the gene-therapeutic substance.

3) individual characteristics of the patient are taken into account.

Thus, to create a group of gene therapeutic substances according to this invention, the P4NA1 gene was chosen, and not the protein shedding 4-hydroxylase alpha 1 encoded by this gene.

To obtain a group of gene-therapeutic substances carry out the following actions:

1. Obtaining a site of unmodified cDNA of the P4NA1 gene containing the protein-coding region of the P4NA1 gene and deletion of 5'-untranslated regions or deletion of 3'-untranslated regions, cloning it into an intermediate plasmid, cloning it into expression vector plasmids under the control of eukaryotic regulatory elements for expression of the target gene in such a way that the obtained genetic constructs contain the coding nucleotide sequence of the protein cDNA shed 4-hydroxylase alpha 1, which is unmodified cDNA of the P4NA1 gene and which is used for further modifications.

2. The introduction of modifications of the P4NA1 gene into the cDNA sequence of the cDNA gene to create a series of cDNA of the P4NA1 gene, which provides a sufficient level of protein translation to shed 4-hydroxylase alpha 1 to combat pathological manifestations.

3. Cloning of a portion of the unmodified cDNA of the P4NA1 gene and the resulting modified cDNA of the P4NA1 gene into vector plasmids capable of efficiently expressing this cDNA in cells of human organs and tissues.

4. Transformation of each of the obtained genetic constructs of bacterial E. coli cells, analysis of transformed clones for the presence, orientation, and copy number of the cDNA insert and the growth of selected clones to obtain the number of plasmid DNA variants necessary for further work.

5. Isolation of a number of genetic constructs containing modified cDNA of the P4NA1 gene and a portion of the unmodified cDNA of the P4NA1 gene to create a group of gene-therapeutic substances based on them.

6. Creation of a group of gene therapeutic substances, each of which includes a genetic construct with modified cDNA of the P4NA1 gene and a portion of the unmodified cDNA of the P4NA1 gene, or a combination of such a construct with a transport molecule for efficient transfection of various types of cells of organs and tissues and / or introduction into organs and human tissue.

To prove the effectiveness of the created gene-therapeutic substances, leading to an increase in the expression of the P4NA1 gene, the following studies are performed:

A) Cultivation of cultures of various types of cells from biopsies of various human organs and tissues, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells.

B) Isolation of RNA from a cell culture, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, and analysis of P4NA1 gene expression from the genome of these cells.

C) Transfection of a cell culture, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells containing gene-therapeutic substances containing unmodified and / or modified c4DNA of the P4NA1 gene and parallel transfection of a culture of the same cells with a vector plasmid that does not contain cDNA of the gene P4NA1 in various combinations.

D) A comparative analysis of changes in cDNA levels and / or changes in the amount of protein spilled 4-hydroxylase alpha 1 after transfection in various combinations of cells, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, with gene-therapeutic substances containing unmodified and / or modified cDNA of the P4NA1 gene and parallel transfection of the culture of the same cells with a vector plasmid that does not contain the cDNA of the P4NA1 gene. This analysis is carried out, in particular, before the proposed therapy in order to determine the most effective gene-therapeutic substance for the patient.

E) Introduction to patients in organs and tissues of a culture of cells with the cDNA of the P4NA1 gene, for example, the introduction into the human skin of autologous fibroblasts transfected with the gene therapeutic substance with cDNA of the P4NA1 gene and the parallel administration of the cultures to organs and tissues, for example, of the skin, of the cultures the same cells untransfected and transfected with a vector without inserting the cDNA of the P4NA1 gene and / or introducing patients into the organs and tissues of gene-therapeutic substances, for example, the introduction into the human skin of gene-therapeutic substances containing non-modification bathroom and / or modified cDNAs R4NA1 and placebo in various combinations.

F) A comparative analysis of the amount of protein shed by 4-hydroxylase alpha 1 in organs and tissues of a person, in particular in human skin, after administration of cells untransfected and transfected with gene therapeutic substances containing cDNA of the P4NA1 gene and vector plasmids not containing cDNA of the P4NA1 gene and / or gene-therapeutic substances containing unmodified or modified cDNA of the P4NA1 gene, as well as placebo.

G) The introduction into patients of organs and tissues, for example, cartilage, or muscle tissue of gene-therapeutic substances containing unmodified and / or modified cDNA of the P4NA1 gene, as well as placebo.

H) A comparative analysis of the amount of protein shed by 4-hydroxylase alpha 1 in human organs and tissues, in particular in cartilage, or human muscle tissue, after the introduction of gene-therapeutic substances containing unmodified and / or modified P4NA1 cDNA as well as placebo.

I) The introduction into patients of organs and tissues, for example, the introduction into the patient's skin of gene-therapeutic substances containing unmodified and modified cDNA of the P4NA1 gene.

J) A comparative analysis of the amount of protein shed by 4-hydroxylase alpha 1 in the organs and tissues of the patient, in particular in the skin, after the introduction of gene-therapeutic substances containing unmodified and modified cDNA of the P4NA1 gene. This analysis is carried out, in particular, before the proposed therapy in order to select the most effective gene-therapeutic substance for the patient from the group of gene-therapeutic substances.

Example 1

Obtaining and cloning of unmodified cDNA of the P4NA1 gene.

Unmodified cDNA of the P4NA1 gene is a nucleotide sequence that has high homology with the nucleotide sequence of the P4NA1 gene and mRNA shown in the GenBank database under the number NM_000917; nucleotides from 242 to 1846 are translated into the amino acid sequence of the protein shed of 4-hydroxylase alpha 1, corresponding to that given in GenBank under the number NP_000908.2.

Total RNA is obtained from human blood cells using the PAXGeneBlood RNA Kit (Qiagen, Germany) and is used to obtain total cDNA by reverse transcription using RevertAid reverse transcriptase (ThermoScientific, USA) and random 9-nucleotide primers according to the method of the manufacturer of reverse transcriptase. Then, using total cDNA as a template and specific, pre-kinered primers complementary to nucleotides 162-181 5 'GGCGACTGGGGGCTGAAGAG 3' (P4HA1-F1) and 2336-2314 5 'AGGGCAATCACATGGAACCCAGT 3' (P4HA1-RNA PNA sequence m NM_ NM_000917), a portion of the unmodified cDNA of the P4NA1 gene is obtained containing the coding sequence of the protein shed of 4-hydroxylase alpha 1 and partial deletions of the 5'- and 3'-untranslated regions. Polymerase chain reaction (PCR) is carried out using Phusion DNA polymerase (ThermoScientific, USA), giving products with blunt ends, on a Master CyclerGradient amplifier (Eppendorf, USA) in 50 μl. a reaction mixture containing 0.5 μl of total cDNA of the first chain, 0.1 μM of each primer P4NA1 F1 and P4NA1 R1, 250 μM of each deoxynucleotide triphosphate (dATP, dTCP, dTTP and dGTP), 100 mM Tris-HCl (pH 8.85 at 20 ° С), 50 mM ammonium sulfate, 250 mM potassium chloride, 0.01% Tween-20 and 5 units. Pfu DNA polymerase (PhusionThermo Scientific, USA) under the following conditions: initial denaturation at + 98 ° C for 30 s, 35 cycles including denaturation at + 98 ° C for 10 s, annealing of primers at + 64 ° C for 30 s and elongation at + 68 ° C for 4 minutes.

The amplification product was isolated from agarose gel using the QIAquickGelExtractionKit kit (Qiagen, Germany)

The amplified cDNA fragment of 2175 bp in length, carrying the region of the unmodified cDNA of the P4NA1 gene, was cloned in the pUC19 plasmid vector (NEB, USA, cat. No. N3041S). The DNA of the vector plasmid pUC19 (NEB, USA, cat. No. N3041S) is digested with restriction enzyme giving blunt ends, for example, Smal (NEB, USA) and is treated with alkaline phosphatase. The amplified cDNA fragment and the linearized plasmid pUC19 are ligated with 400,000 U / ml phage T4 DNA ligase. (NEB, USA, Cat. No. M0202S) at the rate of 1 μl of the enzyme per 1 μg of DNA. Ligation is carried out in a volume of 20 μl in the presence of 2 mm ATP, 50 mm Tris-HCl, pH 7.6, 10 mm MgCl ₂ , 10 mm DTT for 10 hours at + 16 ° C.

The resulting mixture was transformed with competent E. coli Tor 10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on Petri dishes with L-agar containing 100 μg / ml ampicillin and 40 μl per solution cup 100 mm IPTG and 2% X-gal. Separate colonies are analyzed for the presence of an insert using PCR with primers P4HA1 - F1 and P4HA1 - R1 and confirmed by sequencing according to the Sanger method.

Example 2

Obtaining genetic constructs with a plot of unmodified cDNA of the P4NA1 gene

To express a portion of the unmodified cDNA of the P4NA1 gene in cells of human organs and tissues, the variant cDNA of the P4NA1 gene according to Example 1 is placed in a vector plasmid, the selection of which uses the following selection criteria:

1) the plasmid must necessarily be replicated in E. coli, preferably with high copy number;

2) the plasmid must have a bacterial selection factor, or another selection factor that does not contain antibiotic resistance genes;

3) the plasmid must have the presence of eukaryotic regulatory elements - the obligatory promoter and terminator (polyadenylation signal), for example, an enhancer and intron (e) element (s);

4) the plasmid must have a convenient polylinker for cloning.

5) The plasmid may contain nucleotide sequences with regulatory elements for replication in mammalian cells, for example, such as SV40 ori from the monkey virus SV40 or ori P / EBNA-1 from the human Epstein-Barr virus.

6) The plasmid may also contain additional regulatory elements that enhance the translation of the protein, for example, binding sites with the transcription factor NFkB, which ensures the active transport of plasmid DNA into the cell nucleus for more efficient transcription of the target gene. Examples of such plasmids can be pCMV6-XL5, pCMV6-Kan / Neo (OriGene, USA), VTvaf17 (Cell and Gene Therapy Ltd, UK) or pCDNA 3.1 (+) (ThermoFisher Scientific, USA), or plasmid vectors of viral origin - for example, human adenovirus of the 5th serotype.

When cloning a portion of the unmodified cDNA of the P4NA1 gene in pCDNA 3.1 (+), the coding nucleotide sequence is placed under the control of the human cytomegalovirus CMV promoter, which is effective in eukaryotic cells, and the bovine growth hormone gene polyadenylation signal. This plasmid also has a bacterial selection factor, the ampicillin resistance gene, and a eukaryotic selection factor, the neomycin resistance gene.

When cloning a portion of the unmodified cDNA of the P4NA1 gene into pCMV6-XL5, pCMV6-Kan / Neo, the coding nucleotide sequence is placed under the control of the human cytomegalovirus CMV promoter, effective in eukaryotic cells, and the polyadenylation signal of the human growth hormone gene. This plasmid also has a bacterial selection factor, the ampicillin resistance gene.

When cloning a portion of the unmodified cDNA of the P4NA1 gene in VTvaf17, the coding nucleotide sequence is placed under the control of the promoter of the human elongation factor gene EF1A with its own enhancer, effective in eukaryotic cells and the polyadenylation signal of the human growth factor gene. Also, this plasmid has a selection factor that allows positive selection without the use of antibiotics.

To obtain genetic constructs with a plot of unmodified cDNA of the P4NA1 gene, the vector plasmid pUC19-P4HA1 of Example 1 with a plot of unmodified cDNA of P4NA1 containing the protein coding region of the P4NA1 gene and partial deletions of 5'- and 3'-untranslated regions is used as a template for amplification with the following pairs of primers:

Amplification is carried out under the conditions described in Example 1. Next, the amplification products are reprecipitated with ethanol, the precipitates are washed with 70% ethanol and dissolved in 1x TE buffer, and then subjected to restriction with Kpn I and Eco RV endonucleases.

The restriction products are separated by gel electrophoresis on 1% agarose, stained with ethidium bromide solution and DNA fragments corresponding to the KpnI-P4NA1-EcoRV insert gene, and the linearized plasmid pCMV6-XL5 and pCMV6-Kan / Neo and pCDNA 3.1 (+) are excised isolated from the gel using a QIAquickGelExtractionKit gel isolation kit (Qiagen, Germany) and mixed. The resulting mixture of restriction fragments is ligated using T4 phage DNA ligase. Ligation is carried out for 10-15 minutes at room temperature, and then at 12 ° C for 10 hours. Ligation DNA is used to transform E. coli cells according to standard methods using calcium chloride (T. Maniatis et al. Molecular Cloning . M., Mir, 1984). Transformed cells were selected on agar medium LB with ampicillin (100 μg / ml). Plasmid DNA was isolated from ampicillin-resistant colonies using the QiagenSpinMiniprepKit plasmid isolation kit (Qiagen, Germany), analyzed by restriction enzyme digestion with KpnI and EcoRV, and the genetic construct (s) were selected by DNA sequencing of genetic constructs using the Sanger method.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain the corresponding genes -therapeutic substances.

Thus, expression genetic constructs are obtained based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+), which contain a 1605 bp nucleotide sequence that includes the protein coding region of the P4NA1 gene and does not contain untranslated 5 the 'and 3' regions of the primary-structured gene of FIG. 1 Seq ID No1.

Example 3

Modifications of cDNA of the P4NA1 gene in genetic constructs to obtain gene-therapeutic substances based on them.

Modifications to Seq ID: 2, 3 are carried out in such a way as not to affect the primary structure of the protein shedding 4-hydroxylase alpha 1, namely, nucleotide substitutions are performed that do not lead to amino acid substitutions or termination of the amino acid chain, and, accordingly, do not affect the encoded this amino acid sequence. Modifications to Seq ID: 5, 7 are carried out in such a way that deletions and / or nucleotide substitutions are performed, leading to a combination of variants containing no amino acid substitutions or amino acid chain termination with variants containing amino acid substitutions or amino acid chain termination, and, accordingly, affecting the amino acid sequence encoded by this sequence and affecting the primary protein structure shed 4-hydroxylase alpha 1. Modifications to Seq ID: 4, 6 are carried out in such a way that the primary protein structure is affected lil 4-hydroxylase alpha 1, namely, performed by nucleotide substitutions or deletions of amino acid substitutions leading to amino acid chain or breakage, and correspondingly affecting the encoded amino acid sequence this sequence.

In particular, in order to obtain modified cDNA of the P4NA1 gene in order to increase the transcription and translation efficiency of the protein, shed 4-hydroxylase alpha 1, in cells of human tissues and organs, modifications are made to the section of the unmodified c4NA of the P4NA1 gene using the codon optimization principle by replacing the minor codons with synonymous major in such a way that the substitutions do not lead to changes in the amino acid sequence of the protein or the termination of the amino acid chain during translation, do not worsen the processes of transcription AI and translation.

All modifications are carried out in several stages by PCR mutagenesis using the QuikChP4HA1e II XL kit or QuikChP4HA1e Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) according to the manufacturer's recommendations.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

To the plasmid DNA obtained according to Example 2, in the amount of 10-50 ng add 50-100 ng of primer containing the necessary replacement, insertion or deletion of a length of 19-45 N. p. and PCR was performed in a QuikChP4HA1e Multi reaction buffer (Agilent Technologies, USA) with a mixture of QuikChP4HA1e Multi mix enzymes (Agilent Technologies, USA) under the following conditions: 95 ° C, 1 min; further from 30 to 35 cycles: 95 ° С 1 minute, 55 ° С 1 minute, 65 ° С 2 minutes / 1000 bp After PCR, 1-2 μl of restriction enzyme Dpn I was added to the amplification mixture and incubated for 1-2 hours at 37 ° C. The resulting mixture was transformed with competent E. coli Tor 10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on L-agar plates containing 100 μg / ml ampicillin. Transformed colonies are analyzed for mutation by sequencing plasmid DNA according to the Sanger method.

To obtain the modified cDNA of the P4NA1 gene, SEQ ID No 2, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 with primers complementary regions of unmodified cDNA of the P4NA1 gene, listed in GenBank under the number NM_000917:

P4NA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G at positions 487.502; by replacing T> C at position 500 and replacing T> G at position 511;

P4NA1 626-666 F:

Complementary to nucleotides 626-666, with substitution A> G at position 646; replacing T> C at position 644 and replacing T> G at position 649;

P4NA1 710-748 F:

Complementary to nucleotides 710-748, with substitution A> G at position 727 and substitution G> C at position 730;

P4NA1 774-805 F:

Complementary to nucleotides 774-805, with substitution G> C at position 790;

P4NA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

The nucleotide sequence of the P4NA1 cDNA thus modified SEQ ID No: 2, length 1605 n.p. contains 2 nucleotide substitutions G> C at positions 730,790; 3 nucleotide substitutions T> G at positions 511, 649, 1123; 4 nucleotide substitutions A> G at positions 487, 502, 646, 727; 2 nucleotide substitutions T> C at positions 500, 644; which do not lead to changes in the amino acid sequence of the protein encoded by the sequence of the P4NA1 gene and has a primary structure shown in FIG. 2.

To obtain the modified cDNA of the P4NA1 gene, SEQ ID No. 3, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-P4HA1 Seq ID No. 1, pCMV6-Kan / Neo-P4HA1 Seq ID No. 1 and pCDNA 3.1 (+) - P4HA1 Seq ID No. 1 with primers, complementary regions of unmodified cDNA of the P4NA1 gene, listed in GenBank under the number NM_000917:

1. P4NA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G at positions 487.502; by replacing T> C at position 500 and replacing T> G at position 511;

2. P4NA1 626-666 F:

Complementary to nucleotides 626-666, with substitution A> G at position 646; replacing T> C at position 644 and replacing T> G at position 649;

3. P4NA1 710-748 F:

Complementary to nucleotides 710-748, with substitution A> G at position 727 and substitution G> C at position 730;

4. P4NA1 774-805 F:

Complementary to nucleotides 774-805, with substitution G> C at position 790;

5. P4NA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

6. P4NA1 1177-1210 F:

Complementary to nucleotides 1177-1210, with substitution T> G at position 1192;

7. P4NA1 1240-1267 F:

Complementary to nucleotides 1240-1267, with substitution T> G at position 1249;

8. P4NA1 1316-1357 F:

Complementary to nucleotides 1316-1357, with A> G substitutions at position 1327, 1336;

9. P4NA1 1418-1450 F:

Complementary to nucleotides 1418-1450, with substitution A> G at position 1429;

10. P4NA1 1794-1841 F:

Complementary to nucleotides 1794-1841, with replacement T> G at position 1801; with replacement A> G at position 1816; with the replacement of G> C at position 1828;

The nucleotide sequence of the P4NA1 cDNA thus modified SEQ ID No: 3, length 1605 n.p. contains 3 nucleotide substitutions G> C at positions 730, 790, 1828; 6 nucleotide substitutions T> G at positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G at positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C at positions 500, 644; which do not lead to changes in the amino acid sequence of the protein encoded by the sequence of the P4NA1 gene and has a primary structure shown in FIG. 3

To obtain the modified cDNA of the P4NA1 gene, SEQ ID No 4, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 with the synthesized fragment DNA length 182 n.p .:

The thus modified nucleotide sequence of the P4NA1 cDNA SEQ ID No: 4, length 1605 bp, contains 28 non-synonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 1337C> T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 G> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A, resulting in 10 amino acid substitutions and has a primary structure shown in FIG. four.

To obtain the modified cDNA of the P4NA1 gene, SEQ ID No. 5, sequential PCR mutagenesis is carried out on plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 a DNA fragment of 182 n.p. length

and then with the following primers:

1. P4NA1 476-520 F:

Complementary to nucleotides 476-520, with substitutions A> G at positions 487.502; by replacing T> C at position 500 and replacing T> G at position 511;

2. P4NA1 626-666 F:

Complementary to nucleotides 626-666, with substitution A> G at position 646; replacing T> C at position 644 and replacing T> G at position 649;

3. P4NA1 710-748 F:

Complementary to nucleotides 710-748, with substitution A> G at position 727 and substitution G> C at position 730;

4. P4NA1 774-805 F:

Complementary to nucleotides 774-805, with substitution G> C at position 790;

5. P4NA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

6. P4NA1 1177-1210 F:

Complementary to nucleotides 1177-1210, with substitution T> G at position 1192;

7. P4NA1 1240-1267 F:

Complementary to nucleotides 1240-1267, with substitution T> G at position 1249;

8. P4NA1 1418-1450 F:

Complementary to nucleotides 1418-1450, with substitution A> G at position 1429;

9. P4NA1 1794-1841 F:

Complementary to nucleotides 1794-1841, with replacement T> G at position 1801; with replacement A> G at position 1816; with the replacement of G> C at position 1828;

The nucleotide sequence of the P4NA1 cDNA thus modified SEQ ID No: 5, length 1602 n.p. contains 3 nucleotide substitutions G> C at positions 730, 790, 1828; 6 nucleotide substitutions T> G at positions 511, 649, 1123, 1192, 1249, 1801; 6 nucleotide substitutions A> G at positions 487, 502, 646, 727, 1429, 1816; 2 nucleotide substitutions T> C at positions 500, 644; not leading to changes in the amino acid sequence of the protein, as well as 28 non-synonymous nucleotide substitutions 1324 C> G, 1330 T> C, 1333 A> C, 1334 G> A, 1336 A> T, 13370T, 1338 A> C, 1339 T> A, 1340 G> A, 1345 T> A, 1346 G> A, 1347 A> T, 1348 G> A, 1351 T> A, 1355 A> G, 1357 A> C, 1361 A> G, 1362 C> A, 1363 C> G, 1366 A> G, 1368 C> T, 1372 G> T, 1379 G> A, 1381 A> T, 1382 T> A, 1383 C> G, 1384 T> C, 1387 G> A resulting in 10 amino acid substitutions and has a primary structure shown in FIG. 5.

To obtain the modified cDNA of the P4NA1 gene, SEQ ID No. 6, sequential PCR mutagenesis is carried out on plasmids pCMV6-XL5-P4HA1 Seq ID No. 1, pCMV6-Kan / Neo-P4HA1 Seq ID No. 1 and pCDNA 3.1 (+) - P4HA1 Seq ID No. 1 with the synthesized fragment DNA length 90 n.p .:

The nucleotide sequence of the P4NA1 cDNA thus modified SEQ ID No: 6, length 1551 n.p. contains a deletion from 1490 to 1544 n.a. and has a primary structure shown in FIG. 6.

To obtain the modified cDNA of the P4NA1 gene, SEQ ID No 7, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan / Neo-P4HA1 Seq ID No1 and pCDNA 3.1 (+) - P4HA1 Seq ID No1 a 90 np DNA fragment

and then with primers complementary to regions of unmodified P4NA1 cDNA shown in GenBank under the number NM_000917:

1. P4NA1 476-520 F:

Complementary to nucleotides 476-520, with A> G substitutions at positions 487, 502; by replacing T> C at position 500 and replacing T> G at position 511;

2. P4NA1 626-666 F:

Complementary to nucleotides 626-666, with substitution A> G at position 646; replacing T> C at position 644 and replacing T> G at position 649;

3. P4NA1 710-748 F:

Complementary to nucleotides 710-748, with substitution A> G at position 727 and substitution G> C at position 730;

4. P4NA1 774-805 F:

Complementary to nucleotides 774-805, with substitution G> C at position 790;

5. P4NA1 1009-1142 F:

Complementary to nucleotides 1009-1142, with the replacement of T> G at position 1123;

6. P4NA1 1177-1210 F:

Complementary to nucleotides 1177-1210, with substitution T> G at position 1192;

7. P4NA1 1240-1267 F:

Complementary to nucleotides 1240-1267, with substitution T> G at position 1249;

8. P4NA1 1316-1357 F:

Complementary to nucleotides 1316-1357, with A> G substitutions at position 1327, 1336;

9. P4NA1 1418-1450 F:

Complementary to nucleotides 1418-1450, with substitution A> G at position 1429;

10. P4NA1 1794-1841 F:

Complementary to nucleotides 1794-1841, with replacement T> G at position 1801; with replacement A> G at position 1816; with the replacement of G> C at position 1828;

The nucleotide sequence of the P4NA1 cDNA thus modified SEQ ID No: 7, length 1551 n.p. contains 3 nucleotide substitutions G> C at positions 730,790,1828; 6 nucleotide substitutions T> G at positions 511, 649, 1123, 1192, 1249, 1801; 8 nucleotide substitutions A> G at positions 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 nucleotide substitutions T> C at positions 500, 644; deletion from 1490 to 1544 n.a. and has a primary structure shown in FIG. 7.

Thus, expression vectors based on plasmids pCMV6-XL5, pCMV6-Kan / Neo, and pCDNA 3.1 (+) are obtained in which a portion of the unmodified cDNA of the P4NA1 gene (SEQ ID No: 1) and modified cDNA nucleotide sequences of the P4NA1 gene (SEQ ID No: 2, 3, 4, 5, 6, 7) encoding a protein shed by 4-hydroxylase alpha 1.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain the corresponding genes -therapeutic substances.

The resulting expression vectors are used to create gene-therapeutic substances based on them, which are subsequently used for transfection of eukaryotic cells of organs and tissues and / or introduction into human organs and tissues. As control plasmids, the original vector pCMV6 - XL5, (pCMV6-Kan / Neo) or pCDNA 3.1 (+) without the cDNA insert of the P4NA1 gene is used.

Example 4

Building up the genetic construct in bacterial culture.

To obtain preparative amounts of a vector plasmid containing one of the P4NA1 gene cDNA variants, the constructs of Example 3 transform bacterial E. coli cells (T. Maniatis et al. Molecular Cloning. M., Mir, 1984) and the obtained bacterial clones are grown, containing the construct, in the presence of a bacterial selection factor - ampicillin resistance.

The ligase mixture of Example 3 is used to transform competent E. coli cells of strain XLblue. Preliminary selection of clones containing the P4NA1 gene cDNA insert in the correct orientation and a single copy is carried out by hydrolysis of plasmid DNA with restriction enzymes Kpn I and Eco RV and analysis of restriction products by electrophoresis in 1.2% agarose gel. The selected clones are used for preparative growth of plasmid DNA with the aim of further transfection into fibroblast cultures (epithelial cells of the oral mucosa, or epithelial cells of the cornea of the eye, etc.).

To obtain preparative amounts of the genetic expression constructs of Example 3, 20 ml of an overnight E.coli culture was grown in LB medium with 150 μg / ml ampicillin. 500 ml of LB medium with 100 μg / ml ampicillin were inoculated with this culture; growth was carried out in a shaker-incubator for 16 hours at 37 ° C and 200 rpm. Isolation of plasmid DNA was performed using the EndoFreePlasmidMaxiKit kit (Qiagen, Germany). The yield was 350 μg of DNA.

Example 5

Cultivation of eukaryotic cells, for example, fibroblasts for subsequent transfection with a gene therapeutic substance and analysis of P4NA1 gene expression.

For subsequent transfection with a gene therapeutic substance containing one of the cDNA variants of the P4NA1 gene according to Example 3, primary cultures of human fibroblasts from biopsy samples of the skin of patients are grown.

Using a skin biopsy device, Epitheasy 3.5 (MedaxSRL) takes a biopsy sample of the skin from a zone protected from ultraviolet radiation, for example, behind the auricle or from the side inner surface in the area of the elbow joint, with a volume of at least 10 cubic meters. mm, mass - not less than 11 mg. The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The primary cell culture was grown on Petri dishes at 37 ° C in an atmosphere containing 5% CO ₂ in DMEM medium with 10% fetal calf serum and ampicillin 100 U / ml. Trypsinization and reseeding is performed every 5 days; for trypsinization, the cells were washed with PBS and incubated for 30 minutes at 37 ° C in a solution containing 0.05% trypsin and 1 mM EDTA. To neutralize trypsin, 5 ml of culture medium was added to the cells and the suspension was centrifuged at 600 rpm for 5 minutes. The growth of fibroblast culture after 4-5 passages was carried out in 75 ml culture bottles in a medium containing 10 g / l DMEM, 3.7 g / l Na ₂ CO ₃ , 2.4 g / l HEPES, 10% fetal serum and 100 U / ml ampicillin . The culture medium was changed every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 10 ⁶ cells was selected from the cell culture.

The part of the fibroblast culture intended for RNA isolation followed by transcription analysis of the P4NA1 gene was centrifuged at 1000 rpm for 20 minutes and washed twice in PBS buffer by centrifugation at 600 rpm for 5 minutes. Then the cells were resuspended in 1.5 ml of the stabilizing reagent RNAlater and stored at 4 ° C for 10 days for subsequent RNA isolation.

RNA isolation was performed using the RNeasyMiniKit kit. (Qiagen, Germany). The isolated RNA was analyzed spectrophotometrically, measuring the ratio of optical density at 260 and 280 nm, as well as by capillary electrophoresis on a QIAxcel instrument (Qiagen, Germany) using an RNA Qiality Control cartridge. For further work, we used only those samples for which the total amount of isolated RNA was not less than 50 μg RNA, the ratio of D260: D280 was not less than 1.8, and the ratio of the 28S: 18S bands on capillary electrophoresis was not less than 1: 1.

The synthesis of total cDNA of the first strand was carried out using RevertAid reverse transcriptase (Thermo Scientific, USA), according to the manufacturer's recommendations. 1-2 μg of total RNA was used as a template for the synthesis of the first cDNA strand. 100-200 units were added to the reaction mixture for reverse transcription. reverse transcriptase and 10 pM random 9-nucleotide primer.

Example 6

Analysis of endogenous expression of the P4NA1 gene in a culture of primary fibroblasts.

Analysis of the expression of the P4NA1 gene from the fibroblast genome is carried out in order to subsequently correctly determine the gene therapeutic effect after transfection of these cells with genetic constructs with cDNA of the P4NA1 gene.

For analysis, skin fibroblast cell lines, fibroblasts with low expression of the P4NA1 gene, and fibroblasts with normal expression of the P4NA1 gene are used, from which RNA is isolated according to the standard method (Maniatis T. et al. Molecular Cloning. M., Mir, 1984).

Isolated RNA is analyzed by real-time PCR (SYBR GreenRealTimePCR). For amplification of cDNA (542-642 n.p.) specific for the P4NA1 gene, the direct primer P4NA1 FA1 is used

and reverse primer P4NA1 -RA1

Amplification product length -68 nucleotide. As a reference gene, the beta-2-microglobulin B2M gene is used, the expression level of which in fibroblasts is comparable to that normal for the P4NA1 gene.

PCR amplification is performed using the SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) or another real-time PCR kit in 20 μl amplification mixture containing: 25 μl QuantiTect SYBR Green RT-PCR MasterMix, 2.5 mM magnesium chloride, 0.5 μm of each primer, 5 μl of total RNA. The reaction is carried out on a CFX96 thermocycler (Bio-Rad, USA) under the following conditions: 1 cycle of reverse transcription at 50 ° C for 30 minutes, denaturation 98 ° C for 15 minutes, then 40 cycles including denaturation 94 ° C for 15 s, primer annealing at 59 ° C for 30 s and elongation at 72 ° C for 30 s

As a positive control, the concentration of amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the P4NA1 and B2M genes is used. As a negative control, deionized water is used (PCR accumulation curves of the products of negative and positive controls are not shown in FIG. 8 to simplify visualization). The number of PCR products - cDNA of genes P4NA1 and B2M obtained as a result of amplification, is estimated in real time using the software of the Bio-RadCFXManager 2.1 amplifier.

Based on the analysis of the expression of the P4NA1 gene in different fibroblast cultures (with low expression of the P4NA1 gene and with normal expression of the P4NA1 gene), clones were selected from patients of the same age and the same type of aging, in which the amount of PCR product corresponding to the cDNA of the P4NA1 gene was 10 -20 times lower than that of the B2M gene cDNA. The accumulation curves of specific PCR products are shown in figure 8.

Example 7

Transfection of a fibroblast cell culture with reduced expression of the P4NA1 gene by a gene therapeutic substance in order to confirm an increase in the expression of the P4NA1 gene in the culture of these cells.

To evaluate the effectiveness of the gene therapeutic substance containing the unmodified cDNA of the P4NA1 gene according to Example 2, the primary culture of human fibroblasts with reduced expression of the P4NA1 gene selected in Example 6 is transfected with this gene therapeutic substance.

This fibroblast culture is grown in culture bottles (25 cm ² ) until the cells cover 50-70% of the surface of the bottle. The obtained cells are transfected with the gene therapeutic substance based on pCMV6-P4NA1 SEQ ID No: 1 in the presence of a transport molecule (for example, dendrimer) and the vector pCMV6-XL5 as a control.

A 6-well plate with DMEM medium with 10% fetal calf serum (1.6 ml per well) was seeded with fibroblasts at a rate of 1-4 × 10 ⁵ cells per well. Cells were incubated for 18 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then, 2 μg of plasmid DNA was dissolved in serum-free DMEM with Tris-HCl buffer 20 mM with 1 mM EDTA, pH 7-8 (minimum DNA concentration - 0.1 μg / μl). The final volume of the mixture was 100 μl.

The 6th generation SuperFect Transfection Reagent dendrimer solution (Qiagen, Germany) was used as a transport molecule.

Preparation of the DNA dendrimer complex was carried out according to the manufacturer's method (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some changes: 5 μl (with a concentration of 0.5 μg / μl) was added to 15 μl of the dendrimer (with a concentration of 3 μg / μl) plasmid DNA and mixed thoroughly. Then the DNA mixture with the dendrimer was incubated for 5-10 minutes at a temperature of 15-25 ° C.

Medium was carefully selected from the wells of the cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml PBS buffer. To a solution containing DNA dendrimer complexes, 600 μl of fetal serum DMEM medium was added and the mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then the culture medium was added and incubated for 24-48 hours at 37 ° C and in an atmosphere containing 5% CO ₂ , after which the cDNA level of the P4NA1 gene and the control cDNA of the B2M gene were estimated using real-time amplification as described in Example 6. Results analysis are shown in figure 9.

From the graphs it follows that in the case of transfection with a vector without inserting a cDNA of the P4NA1 gene, the level of cDNA of the P4NA1 gene in fibroblasts did not change, and in the case of transfection with a vector of cDNA of P4NA1 gene, the level of fibroblast cDNA with reduced expression of the P4NA1 gene increased significantly (to a level higher than P4NA1 gene cDNA in normal fibroblasts).

It was shown that in cells transfected with the gene therapeutic substance based on pCMV6-P4NA1 SEQ ID No: 1, the expression of the target P4NA1 gene is enhanced.

Example 8

Transfection of a fibroblast cell culture with normal expression of the P4NA1 gene by a gene therapeutic substance with cDNA of the P4NA1 gene to confirm the increase in the amount of protein shed by alpha 1 4-hydroxylase in the culture of these cells.

To assess the change in the amount of protein, shed 4-hydroxylase alpha 1, we used a human skin fibroblast culture according to Example 5, the 6th generation SuperFect Transfection Reagent dendrimers (Qiagen, Germany) as a transport molecule, and an aqueous solution of dendrimers without plasmid DNA as a control (A), the vector plasmid pCDNA 3.1 (+), which does not contain the cDNA of the P4NA1 gene (B), as transfected agents, the gene therapeutic substance based on the vector plasmid pCDNA 3.1 (+), which contains the cDNA of the P4NA1 gene - pCDNA 3.1 P4NA1 EQ ID No: 1 (C), Preparation of DNA Dendry Complex measures and transfection of fibroblasts was performed according to Example 7.

After transfection, 0.1 ml of 1N HCl was poured into 0.5 ml of culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2N NaOH / 0.5M HEPES (pH 7-7.6) and mixed thoroughly.

The supernatant was taken and used to quantify the target protein. Quantification of the P4NA1 gene cDNA product was performed by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), according to the manufacturer’s methodology https://www.mvbiosource.com/imaqes/tds/protocol manuals / 000000-799999 /MBS763203.pdf

The optical density was measured at a wavelength of 450 nm using a ChemWell automatic biochemical and enzyme immunoassay analyzer (Awareness TechNology Inc., USA) and is proportional to the protein concentration in the sample. The numerical value of the concentration is determined using a calibration curve constructed using calibrators with a known protein concentration of the P4NA1 gene, which is part of the kit. The difference between the optical density (OD) values of the calibrators supplied in triplicate did not exceed 10%.

Statistical processing of the results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). Thus, it was shown that transfection of fibroblasts with the obtained gene-therapeutic substance carrying the cDNA of the P4NA1 gene leads to an increase in the amount of protein shed of 4-hydroxylase alpha 1 in fibroblast cells. The results are shown in figure 10.

Example 9

The introduction into the human skin of a cell culture of fibroblasts transfected with a gene therapeutic substance with cDNA of the P4NA1 gene in order to confirm the increase after this amount of protein shed 4-hydroxylase alpha 1 in a biopsy of human skin.

In order to analyze the changes in the amount of protein shedding alpha-4-hydroxylase alpha 1 in human tissues, three variants of autologous fibroblast culture were introduced into the skin of the forearm: untransfected (A), transfected with a vector without an insert, for example, pCMV6-XL5 (B) and transfected with gene therapy a substance based on pCMV6-P4NA1 SEQ ID No: 7 (C) in combination with transport molecules - TRANSFAST TM Transfection Reagent liposomes (PROMEGA, USA),

The suspension of liposomes was prepared according to the manufacturer's method (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) with some changes: 0.4 ml of Nuclease-Free sterile water was added to 0.4 mg of liposome powder. The suspension was mixed well by shaking. The resulting intermediate product of the suspension of liposomes was kept for 18 hours at a temperature of -20 ° C, then thawed at room temperature, resuspended by shaking or on a table mixer type "VORTEX".

To prepare the DNA liposome complex, 400 μl of plasmid DNA solution (with a concentration of 150 μg / ml) was added to 400 μl of liposome solution (with a concentration of 1 mg / ml) and mixed thoroughly. Then the mixture of DNA with liposomes was incubated for 5-10 minutes at a temperature of 15-25 ° C and was further used as a gene-therapeutic substance.

For subsequent transfection of cells with a gene therapeutic substance, primary cultures of human fibroblasts were grown from biopsy samples of the skin of patients according to Example 5.

For transfection, the medium was carefully selected from the wells of a cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml of PBS buffer. To a solution containing DNA liposime complexes, 600 μl of fetal serum DMEM medium was added and this mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then, the culture medium was added and incubated for 24-48 hours at 37 ° C in an atmosphere containing 5% CO ₂ .

Part of the cell culture was centrifuged at 700 rpm, the cells were washed twice with physiological saline, resuspended in physiological saline at the rate of 1 million cells in 200 μl and used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. Foci of introducing fibroblast cultures were located at a distance of 3-5 cm from each other.

Determination of the amount of shedding protein 4-hydroxylase alpha 1 was carried out in lysates of biopsy samples of the skin of the patient was performed by enzyme-linked immunosorbent assay (ELISA) using a set of P4NA1 elisa kit (MyBioSource, USA.), As described in Example 8.

Biopsy samples were taken 3 days after the introduction of a suspension of fibroblasts. A biopsy was performed from the injection sites of the fibroblast suspension, as well as from the intact skin, using an Epitheasy 3.5 skin biopsy device (MedaxSRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The volume of the biopsy sample is not less than 10 cubic meters. mm, mass - not less than 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

As can be seen from figure 11, in the skin of the patient in the area of administration of fibroblasts transfected with the gene therapeutic substance based on pCMV6-P4NA1 SEQ ID No: 7, there was an increase in the amount of protein shed by 4-hydroxylase alpha 1, which may indicate increased expression of the P4NA1 gene. Whereas with the introduction of control cultures of fibroblasts (untransfected and transfected with a vector without insertion of the P4NA1 pCMV6-XL5 cDNA gene) the amount of 4-hydroxylase alpha 1 shed did not change in the skin.

Thus, the effectiveness of the gene therapeutic substance was shown when a cell culture of fibroblasts transfected with the obtained gene therapeutic substance carrying the modified cDNA of the P4NA1 gene was introduced into the human skin, which leads to an increase in the expression level of the P4NA1 gene, namely, an increase in the amount of protein shed 4- hydroxylase alpha 1 in the skin at the injection site.

Example 10

Transfection of fibroblast cultures from biopsies of a group of different patients with gene-therapeutic substances containing modified cDNA of the P4NA1 gene and a portion of the unmodified cDNA of the P4NA1 gene.

In order to confirm the individual nature of the increase in the expression of the P4NA1 gene to a different level during the transfection of cell cultures of fibroblasts of patients with gene-therapeutic substances with modified cDNA of the P4NA1 gene and a portion of unmodified cDNA of the P4NA1 gene, the quantitative level of protein shed 4-hydroxylase alpha 1 in transfected fibroblast lysates was analyzed, gene-therapeutic substances according to example 3, containing modified cDNA of the gene P4NA1 and a plot of unmodified cDN To the P4NA1 gene in the group of patients, depending on the presence and type of modifications in the cDNA of the P4NA1 gene.

The sequence of the unmodified cDNA region of the P4NA1 gene is shown in Figure 1, SEQ ID No: 1., the sequences of the modified cDNA of the P4NA1 gene are shown in Figures 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Fibroblast cultures were grown from the same skin biopsy samples taken from the inner lateral surface zone in the elbow joint region of 28 patients, randomly selected in Example 5, aliquots were selected and the level of protein shedding 4-hydroxylase alpha 1 was evaluated in cell lysates. A cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 MMNaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm, the protein concentration in the supernatant was determined by the Bradford method ([Bradford M.M. (1976) Anal. Biochem. 72: 248-254.]).

Then, each of the 18 fibroblast cultures was divided into 8 parts. One part, designated (A), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 1 vector containing unmodified cDNA of the P4NA1 gene (SEQ ID No: 1.) according to Example 2 in combination with a transport molecule - dendrimer as in example 7.

The second part, designated (B), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 2 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 2.) according to Example 3 in combination with a transport molecule - dendrimer as in example 7.

The 3rd part, designated (C), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 3 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 3.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 4th part, designated (D), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 4 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 4.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 5th part, designated (E), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 5 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 5.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 6th part, labeled (F), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 6 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 6.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 7th part, labeled (G), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 7 vector containing a variant of the modified cDNA of the P4NA1 gene (SEQ ID No: 7.) according to Example 3 in combination with a transport molecule dendrimer according to example 7.

The 8th part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 that did not contain the cDNA of the P4NA1 gene according to Example 3 in combination with the transport molecule dendrimer of Example 7.

Quantitative determination of the cDNA product of the P4NA1 gene was performed by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), as described in Example 8.

Based on the results of determining the quantitative level of the protein, 4-hydroxylase alpha 1 sheds selected indicators regarding each part of the cell culture from each patient, which showed the highest quantitative levels of the protein and combined them into seven groups based on the following criterion:

In group 1, the largest amount of protein shed 4-hydroxylase alpha 1, was observed during transfection of unmodified cDNA of the P4NA1 gene SEQ ID No: 1. This group included 7 out of 28 cultures.

In group 2, the largest amount of protein shed 4-hydroxylase alpha 1, was observed during transfection of the modified cDNA of the P4NA1 gene SEQ ID No: 2. This group included 3 cultures of 28.

In group 3, the largest amount of protein shed 4-hydroxylase alpha 1, was observed during transfection of the modified cDNA of the P4NA1 gene SEQ ID No: 3. This group included 6 out of 28 cultures.

In group 4, the largest amount of protein shed 4-hydroxylase alpha 1, was observed upon transfection of the modified cDNA of the P4NA1 gene SEQ ID No: 4. This group included 4 out of 28 cultures.

In group 5, the largest amount of protein shed 4-hydroxylase alpha 1, was observed during transfection of the modified cDNA of the P4NA1 gene SEQ ID No: 5. This group included 3 cultures of 28.

In group 6, the largest amount of protein shed 4-hydroxylase alpha 1, was observed during transfection of the modified cDNA of the P4NA1 gene SEQ ID No: 6. This group included 3 out of 28 cultures.

In group 7, the largest amount of protein shed 4-hydroxylase alpha 1, was observed during transfection of the modified cDNA of the P4NA1 gene SEQ ID No: 7. This group included 2 out of 28 cultures.

None of the cell cultures transfected with a gene therapeutic substance with a vector plasmid lacking the P4NA1 gene cDNA showed the highest quantitative level of protein shedding 4-hydroxylase alpha 1, in contrast to cell cultures transfected with gene therapeutic substances with genetic constructs, containing cDNA of the P4NA1 gene.

The figure 12 for each group of cell cultures shows a diagram of indicators of the amount of protein shed of 4-hydroxylase alpha 1, (averaged within the group, if the group includes more than one cell culture) for all involved in the experiment of gene-therapeutic substances, after transfection of these cell cultures with gene-therapeutic substances containing modified and a portion of the unmodified cDNA of the P4NA1 gene.

From this example it follows that the achievement of the greatest amount of protein shed 4-hydroxylase alpha 1 in cultures of skin fibroblasts of various patients during their transfection with gene therapeutic substances, is associated with individual characteristics of patients and depends on the presence and type of modifications in the c4NA of the P4NA1 gene that are part of the gene -therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples for the most effective therapeutic effect, created by the gene-therapeutic substances within the group of gene-therapeutic substances, is necessary. therapeutic substances.

Example 11

Transfection of the cell culture of keratocytes and epithelial cells of the eye with a gene-therapeutic substance without a transport molecule in order to confirm the increase in the expression of the P4NA1 gene in these cell cultures.

In order to determine the effectiveness of the gene therapeutic substance containing P4NA1 cDNA in various cell types, keratocytes and epithelial cells of the human cornea were transfected without using transport molecules.

Biopsy material from the limb region in the form of a circle with a diameter of 1-1.5 mm was placed in a Petri dish in a balanced Hanks saline solution, dispase (20 μl 25 u / ml) and gentamicin were added and incubated for 24 hours at +4. Then the epithelial layer was separated from the stroma and both tissues were cut into pieces of 1-2 mm3.

A suspension of epithelial cells was obtained by incubating pieces of tissue in a solution of Trypsin-EDTA for 15 minutes at + 37 ° C. Trypsinization was stopped by the addition of a soybean trypsin inhibitor in PBS. Cell suspensions were washed by centrifugation at 700 rpm and resuspended in serum-free DMEM with gentamicin. Cells were grown in 25 cm ² vials with 5 ml of medium at 37 ° C and in an atmosphere containing 5% CO ₂ . After 24 hours, non-adherent cells were removed and 5 ml of fresh medium was added. Reseeding was performed every 7 days in a ratio of 1: 2 - 1: 3.

A keratocyte suspension was obtained by incubation in RPMI-1640 medium with collagenase 300 u / ml for 2 hours. Then the cells were washed and resuspended in DMEM medium with 20% calf serum and antibiotic-antimycotic. Cells were grown in 25 cm ² vials with 1 ml of medium at + 37 ° C and in an atmosphere containing 5% CO ₂ . Reseeding was performed every 7 days in a ratio of 1: 4.

Since the efficiency of keratocyte transfection is low, we used the gene therapeutic substance based on the plasmid pCMV6-Kan / Neo P4NA1 SEQ ID No: 2, containing an additional selection factor, the neor gene, which confers antibiotic resistance to geneticin.

The gene therapeutic substance was added to the cells and the cells were incubated for 1 hour at 37 ° C. After incubation, serum-free DMEM medium was added to the epithelial cells and DMEM medium containing 10% fetal calf serum to keratocytes was continued and incubated for 24 hours. After a 24-hour incubation, the cells were seeded in a new DMEM medium containing 400 μg / mL of the selection factor antibiotic G418 (Geneticin). Surviving cells were cultured for 2 weeks in 25 cm3 vials with 5 ml of G418 medium. A total of 24 samples of cultures of epithelial cells and 24 samples of cultures of keratocytes were grown.

An aliquot of 500 μl of suspension was taken from each culture every 24 hours to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with a similar concentration and combined. The analysis of the level of specific cDNA of the P4NA1 gene was carried out using real-time amplification according to the procedure and with the primers of Example 6 using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-RadUSA) and Bio-RadCFXManager 2.1 software. The greatest increase in the expression (transcription) of the P4NA1 gene was observed on day 3 for epithelial cells and on day 5 - for keratocytes.

The figure 13 shows the curves of accumulation of a specific amplification product corresponding to the cDNA of the P4NA1 gene in keratocytes and epithelial cells of the cornea.

It was shown that in keratocytes and epithelial cells of the human cornea transfected with the gene therapeutic substance based on pCMV6-Kan / Neo P4NA1 SEQ ID No: 2, without a transport molecule, the expression of the target P4NA1 gene is enhanced.

Example 12

Transfection of the cell culture of chondroblasts with a gene therapeutic substance in order to confirm the increase in the expression of the P4NA1 gene in these cell cultures.

Human chondroblasts were transfected using amphiphilic block copolymers as a transport molecule in order to determine the effectiveness of the gene therapeutic substance containing the cDNA of the P4NA1 gene in various cell types, as well as to assess the effect of the transport molecule on the success of transfection with this substance.

Cartilage biopsy samples weighing 50-150 mg were crushed into fragments up to 10 mm3 and incubated in a buffer solution with collagenase II, hyaluronidase and trypsin for 48 hours at + 37 ° C. Cells were washed with serum-free DMEM medium, resuspended in the same medium with gentamicin and grown at + 37 ° C and in an atmosphere containing 5% CO ₂ in 75 cm ² vials with 15 ml of medium. Growth was carried out in a serum-free medium, since in a monolayer culture, chondrocytes change their shape and biochemical properties. Reseeding was performed every 4 days in a ratio of 1: 3, the cells were removed from the surface of the vial with trypsin-EDTA solution with 0.02% Versen solution.

Amphiphilic block copolymers were used to transfect cells with a gene-therapeutic substance containing the cDNA of the P4NA1 gene. The methodology was applied according to (IntJPharm, 2012, 427, 80-87) or in (Macromol. Biosci. 2011, 11, 652-661), with some changes. The block copolymer was synthesized from a mixture of linear polyethyleneimine (PEI) (Polyscience Inc., USA) and bifunctional polyethylene glycol (PEG) N-hydroxysuccinimidyl-75-N- (3-maleimidopropionyl) -amido-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - tetracosoxapenta-heptacontanoate (MAL-dPEG ™ -NHS ester, Quanta BioDesign, Ltd., USA) in borate buffer. A polyplex was prepared 1 hour before the introduction into the cells, mixing the block copolymer solution with DNA of the genetic construct pCMV6-Kan / Neo P4HA1SEQ ID No: 3 with modified cDNA P4HA1SEQ ID No: 3. The transfection mixture was added to the cell suspension in 1 ml of culture medium DMEM with 10% fetal serum and ampicillin.

Since a construct containing a selection factor (resistance to geneticin) was used for transfection, the cells after transfection were grown in 25 cm3 vials with 5 ml of medium with geneticin for 12 days, changing the medium every 4 days. An aliquot of 500 μl of suspension was taken from each culture every 24 hours to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with a similar concentration and combined. The analysis of the level of specific P4NA1 cDNA was performed using real-time amplification according to the method and with the primers of Example 6 using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-Rad, USA) and Bio-RadCFXManager 2.1 software . The greatest increase in P4NA1 transcription was observed on day 5. Figure 14 shows the accumulation curves of a specific amplification product corresponding to the cDNA of the P4NA1 gene.

It was shown that in chondroblasts transfected with a gene therapeutic substance based on pCMV6-Kan / Neo P4HA1SEQ ID No: 3, using amphiphilic block copolymers as a transport molecule, the expression of the target P4NA1 gene is enhanced.

Example 13

The introduction into the human skin of a gene-therapeutic substance with cDNA of the P4NA1 gene in order to confirm the increase in the amount of protein shed 4-hydroxylase alpha 1 in human skin.

For the purpose of analyzing the increase in the quantitative level of the protein, shedding of 4-hydroxylase alpha 1, patients were injected with a gene therapeutic substance containing a genetic construct with cDNA of the P4NA1 gene (B) with a transport molecule and a placebo was introduced, which was a combination of a vector plasmid that did not contain cDNA of the P4NA1 gene with a transport molecule (A) - into the skin of the forearm.

As a transport molecule, TRANS FAST TM Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the genetic construct pCMV6 P4NA1 SEQ ID No: 4, which contains the modified cDNA of the P4NA1 gene (SEQ ID No: 4) and plasmid pCMV6-XL5 used as a placebo - which does not contain the cDNA of the P4NA1 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 3-5 cm from each other.

The amount of protein shedding 4-hydroxylase alpha 1 was evaluated in lysates of biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. The biopsy was performed from skin areas in the area of the introduction of the gene-therapeutic substance and placebo, as well as from intact skin, using the Epitheasy 3.5 biopsy device (Medax SRL) below, as described in Example 9.

It was shown that in the patient’s skin in the area of the introduction of the gene therapeutic substance with the cDNA of the P4NA1 gene, there was an increase in the amount of protein shedding 4-hydroxylase alpha 1, while with the introduction of placebo, the amount of protein shedding 4-hydroxylase alpha 1 in the skin did not change. The result indicates an increase in the expression of the P4NA1 gene when using the gene therapeutic substance with cDNA of the P4NA1 gene and, accordingly, the effectiveness of the gene therapeutic substance with cDNA of the P4NA1 gene. The results are shown in figure 15.

Example 14

The introduction of a gene-therapeutic substance with cDNA of the P4NA1 gene into human cartilage tissue in order to confirm an increase in the amount of protein shed 4-hydroxylase alpha 1 in human cartilage tissue.

In order to analyze the changes in the amount of protein shedding of 4-hydroxylase alpha 1, the patients were given a gene therapeutic substance containing a genetic construct with cDNA of the P4NA1 gene (B) with a transport molecule and a placebo was introduced, which was a combination of a vector plasmid that did not contain cDNA of the P4NA1 gene with a transport molecule (A) - in the cartilaginous tissue of the auricles from the back.

The genetic construct of pCDNA 3.1 P4NA1 SEQ ID No: 5, which contains the modified cDNA of the P4NA1 gene (SEQ ID No: 5), and the plasmid pCDNA 3.1, used as a placebo, which does not contain cDNA of the P4NA1 gene, each of which was dissolved in sterile water of degree Nuclease-Free Cleanup. Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France-USA) was used as a transport system. To obtain gene therapeutic substances, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

The calculation of the amount of reagent was carried out according to the formula proposed by the manufacturer:

V (μl) = (pDNA (μg) × 3 × N / P) / 150

where N / P is the ratio between the number of nitrogenous residues in jetPEI and the number of phosphate groups of nucleic acids. In this experiment, the ratio N / P = 6 was used, i.e., for 20 μg pDNA - 2.4 μl jetPEI.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 1-2 mm into the cartilaginous tissue of the auricles from the back side. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.2 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 2-3 cm from each other.

The amount of protein shedding 4-hydroxylase alpha 1 was evaluated in lysates of the patient’s cartilage biopsy samples by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. A biopsy was performed from cartilage tissue sites in the area of the introduction of the gene-therapeutic substance, as well as from intact areas and in the placebo area, by the method of percutaneous puncture biopsy using a disposable manual biopsy needle, then according to Example 9.

It was shown that in the patient’s cartilage tissue in the area of the introduction of the gene therapeutic substance with cDNA of the P4NA1 gene, there was an increase in the amount of protein shedding 4-hydroxylase alpha 1, while with placebo, the amount of protein shed 4-hydroxylase alpha 1 in the cartilage did not change. The result indicates an increase in the expression of the P4NA1 gene when using the gene therapeutic substance with cDNA of the P4NA1 gene and, accordingly, the effectiveness of the gene therapeutic substance with cDNA of the P4NA1 gene. The results are shown in figure 16.

Example 15

Introduction into the muscle tissue of a human gene of a therapeutic substance with cDNA of the P4NA1 gene in order to confirm an increase in the amount of protein shed 4-hydroxylase alpha 1 in human muscle tissue.

In order to analyze the change in the amount of protein shedding of 4-hydroxylase alpha 1, patients were injected with a gene therapeutic substance containing a vector plasmid with cDNA of the P4NA1 gene (B) with a transport molecule and a placebo was introduced, which was a combination of a vector plasmid without cDNA of the P4NA1 gene with a transport molecule (A) - into muscle tissue in the area of the forearm.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used according to Example 9. Next, the pCMV6-Kan / Neo P4NA1 genetic construct SEQ ID No: 6, which contains the modified c4NA of the P4NA1 gene (SEQ ID No: 6), and plasmid pCMV6-Kan / Neo, used as a placebo, which does not contain the cDNA of the P4NA1 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade.

To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 15-20 mm. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.5 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 5-7 cm from each other

The amount of protein shedding 4-hydroxylase alpha 1 was measured in lysates of biopsies of muscle tissue of a patient by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. A biopsy was performed from muscle tissue in the area of the introduction of the gene-therapeutic substance, as well as from intact areas of the muscle and in the placebo, using the MAGNUM automatic biopsy device (company BARD, USA), hereinafter in Example 9.

It was shown that in the patient’s muscle tissue in the area of the introduction of the gene therapeutic substance with the cDNA of the P4NA1 gene, there was an increase in the amount of protein shedding 4-hydroxylase alpha 1, while with placebo, the amount of protein shed 4-hydroxylase alpha 1 in the muscle tissue did not change. The result indicates an increase in the expression of the P4NA1 gene when using the gene therapeutic substance with cDNA of the P4NA1 gene and, accordingly, the effectiveness of the gene therapeutic substance with cDNA of the P4NA1 gene. The results are shown in figure 17

Example 16

The introduction of a group of different patients of gene-therapeutic substances containing modified cDNA of the P4NA1 gene and a portion of the unmodified cDNA of the P4NA1 gene.

In order to confirm the individual character of the increase in the expression level of the target P4NA1 gene to a different level when the gene therapeutic substances with modified and unmodified cDNA of the P4NA1 gene were introduced into the skin of the patients, the level of protein shed of 4-hydroxylase alpha 1 in the lysate of biopsy samples of the group of patients was analyzed, depending on the presence and the type of modifications in the cDNA of the P4NA1 gene.

The sequence of the unmodified cDNA region of the P4NA1 gene is shown in Figure 1, SEQ P4NA1 ID No: 1, the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ P4NA1 ID No: 2, SEQ P4NA1 ID No: 3, SEQ P4HA1 ID No: 4 , SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

Moreover, the genetic constructs, one of which contains a portion of the unmodified cDNA of the P4NA1 gene (SEQ ID No: 1), the second genetic construct contains the portion of the modified cDNA of the P4NA1 gene (SEQ ID No: 2), and the third genetic construct contains the modified cDNA of the P4NA1 gene (SEQ ID No: 3), the fourth genetic construct contains a modified cDNA of the P4NA1 gene (SEQ ID No: 4), the fifth genetic construct contains a modified cDNA of the P4NA1 gene (SEQ ID No: 5), the sixth genetic construct contains a modified cDNA of the P4NA1 gene (SEQ ID No: 6), ce maya genetic construct comprises a cDNA R4NA1 modified gene (SEQ ID No: 7), eighth genetic construct (placebo) is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. To obtain gene therapeutic substances, DNA complexes were prepared in combination with transport molecules - liposomes according to example 9.

The resulting seven variants of gene therapeutic substances and a placebo were used for administration to the skin of patients. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Each of the 24 patients, who were randomly selected, was injected with 7 gene-therapeutic substances and a placebo into the skin of the forearm.

Biopsy samples were taken 72 hours after the introduction of gene-therapeutic substances. The biopsy was performed from the sites of the introduction of gene-therapeutic substances, placebo, as well as from intact skin, using the device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The volume of each biopsy sample is at least 10 cubic meters. mm, mass - not less than 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

A - biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 1, containing unmodified cDNA of the P4NA1 gene (SEQ ID No: 1.) according to Example 2 in combination with transport molecules - liposomes according to Example 9.

B - a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 2, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 2.) according to Example 3 in combination with transport α-liposome molecules according to Example 9.

C is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 3, containing a modified cDNA of the P4NA1 gene (SEQ ID No: 3.) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

D is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 4, containing a modified cDNA of the P4NA1 gene (SEQ ID No: 4.) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

E is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 5, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 5) according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

F - biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 6, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 6) according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

G is a biopsy obtained after the introduction of a gene therapeutic substance based on pCMV6-SEQ ID No: 7, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 7.) according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

H is a biopsy obtained after the introduction of the vector plasmid pCMV6-XL5 that does not contain the cDNA of the P4NA1 gene according to example 3 in combination with transport molecules - liposomes according to example 9.

The amount of protein shedding alpha-4-hydroxylase alpha 1 was determined in nine skin biopsies from each patient (A to H and in the intact skin biopsy) 72 hours after the introduction of gene therapeutic substances by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA ELISA kit Kit (MyBioSource, USA), as described in Example 8.

Based on the results of the quantitative analysis of the protein, it shed 4-hydroxylase alpha 1, we selected indicators for each biopsy from each patient that showed the highest levels of protein shed 4-hydroxylase alpha 1 and combined them into seven groups, based on the following criterion:

In group 1, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of unmodified cDNA of the P4NA1 gene SEQ ID No: 1. This group included 3 biopsy samples from 24.

In group 2, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of the modified cDNA of the P4NA1 gene SEQ ID No: 2. This group included 3 biopsy samples from 24.

In group 3, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of a modified cDNA of the P4NA1 gene SEQ ID No: 3. This group included 4 biopsy samples from 24

In group 4, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of modified DNA gene P4NA1 SEQ ID No: 4. This group included 4 biopsy samples from 24.

In group 5, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of a modified cDNA of the P4NA1 gene SEQ ID No: 5. This group included 3 biopsy samples from 24

In group 6, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of the modified cDNA of the P4NA1 gene SEQ ID No: 6. This group included 4 biopsies from 24.

In group 7, the largest amount of protein shed 4-hydroxylase alpha 1, was observed with the introduction of the modified cDNA of the P4NA1 gene SEQ ID No: 7. This group included 3 biopsy samples from 24.

In none of the biopsy specimens into which the placebo gene therapeutic substances were introduced - a vector plasmid that does not contain the cDNA of the P4NA1 gene - did the largest amount of protein shed 4-hydroxylase alpha 1, unlike the biopsy specimens into which the gene therapy was introduced substances with genetic constructs containing cDNA of the P4NA1 gene.

The figure 18 for each group of biopsy samples shows diagrams of indicators of protein concentrations (averaged within the group, if the group includes more than one biopsy) in relation to all involved in the experiment of gene-therapeutic substances, after the introduction of patients with these gene-therapeutic substances, containing modified and unmodified region of the cDNA of the P4NA1 gene.

From this example it follows that the achievement of the highest level of protein shed 4-hydroxylase alpha 1 in biopsies of the skin of various patients with the introduction of gene-therapeutic substances into the skin, is associated with the individual characteristics of the patients and depends on the presence and type of modifications of the P4NA1 gene in the cDNA included in gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples for the most effective therapeutic effect, created by the gene-therapeutic substances within the group of gene-therapeutic substances, is necessary. therapeutic substances.

Example 17

Transfection of a patient’s fibroblast cell line with various therapeutic genes containing modified P4NA1 cDNA and a portion of unmodified cDNA of the P4NA1 gene to personalize the choice of the most effective gene-therapeutic substance from the group of gene-therapeutic substances for this patient for subsequent transfection of the patient’s cells with this substance as part of a therapeutic procedure.

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of protein prolyl 4-hydroxylase alpha 1 was analyzed in the patient’s cell lysates of the fibroblasts of this patient transfected with different gene therapeutic substances containing a portion of unmodified cDNA of the P4NA1 gene and / or modified cDNA of the P4NA1 gene .

The sequence of the unmodified cDNA region of the P4NA1 gene is shown in Figure 1, SEQ P4NA1 ID No: 1, the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ P4NA1 ID No: 2, SEQ P4NA1 ID No: 3, SEQ P4HA1 ID No: 4 , SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

Fibroblast cultures from the patient’s biopsy were grown according to Example 5, aliquots were taken and cell lysis was performed: the cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethyl sulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm.

Then the patient’s fibroblast culture was divided into 8 parts. The first part, designated (A), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 1 vector containing a portion of the unmodified cDNA of the P4NA1 gene (SEQ ID No: 1.) according to Example 2 in combination with transport molecules - liposomes of example 9.

The second part, designated (B), was transfected according to Example 7 with a gene therapeutic substance based on the vector pCMV6-SEQ ID No: 2, containing the modified cDNA region of the P4NA1 gene (SEQ ID No: 2.) according to Example 3 in combination with transport molecules - liposomes of example 9.

The third part, labeled (C), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 3 vector containing the modified P4NA1 gene cDNA (SEQ ID No: 3.) according to Example 3 in combination with liposome transport molecules as in example 9.

The fourth part, designated (D), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 4 vector containing the modified P4NA1 gene cDNA (SEQ ID No: 4.) according to Example 3 in combination with liposome transport molecules as in example 9.

The fifth part, designated (E), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6 SEQ ID No: 5 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 5.) according to Example 3 in combination with liposome transport molecules as in example 9.

The sixth part, labeled (F), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 6 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 6.) according to Example 3 in combination with liposome transport molecules as in example 9.

The seventh part, designated (G), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 7 vector containing the modified cDNA of the P4NA1 gene (SEQ ID No: 7.) according to Example 3 in combination with liposome transport molecules as in example 9.

The eighth part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 that did not contain the cDNA of the P4NA1 gene according to Example 3 in combination with the liposome transport molecules of Example 9.

Determination of the amount of protein spilled 4-hydroxylase alpha 1 in the patient’s cell fibroblast lysates was performed 72 hours after transfection by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), as described in Example 8.

According to the results of determining the amount of protein, he shed 4-hydroxylase alpha 1, a variant of the gene therapeutic substance was isolated in the patient’s fibroblast culture, during the transfection of which the greatest amount of protein shed 4-hydroxylase alpha 1 was observed in the cell culture lysate, which ultimately indicates the highest expression of the P4NA1 gene . In this experiment, the largest amount of protein shed 4-hydroxylase alpha 1 in the lysate was observed during transfection with the gene therapeutic substance based on pCMV6 P4NA1 SEQ ID No: 3 containing unmodified cDNA of the P4NA1 gene, as shown in Figure 19.

Thus, the most effective gene-therapeutic substance has been selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Example 18

The introduction into the patient’s skin of various gene-therapeutic substances containing modified P4NA1 cDNA and a portion of the unmodified P4NA1 cDNA to select from the group of gene-therapeutic substances the most effective gene-therapeutic substance for this patient for subsequent administration of this substance to the patient as part of a therapeutic procedure .

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of protein shed of 4-hydroxylase alpha 1 was analyzed in lysates of biopsy samples of the skin of this patient, after the introduction of gene-therapeutic substances containing modified P4NA1 cDNA and / or a site of unmodified cDNA of the P4NA1 gene.

The sequence of the unmodified cDNA region of the P4NA1 gene is shown in Figure 1, SEQ P4NA1 ID No: 1, the sequences of the modified cDNA of the P4HA1 gene are shown in Figures 2-7 (SEQ P4NA1 ID No: 2, SEQ P4NA1 ID No: 3, SEQ P4HA1 ID No: 4 , SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

The patient was administered 7 gene therapeutic substances and a placebo into the skin of the forearm.

The first gene therapeutic substance (A) based on pCMV6-SEQ ID No: 1, containing a portion of the unmodified cDNA of the P4NA1 gene (SEQ ID No: 1.) according to Example 2 in combination with the transport molecule dendrimer of Example 7.

The second gene therapeutic substance (B) based on pCMV6-SEQ ID No: 2, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 2.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The third gene therapeutic substance (C) based on pCMV6-SEQ ID No: 3, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 3.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The fourth gene therapeutic substance (D) based on pCMV6-SEQ ID No: 4, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 4.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The fifth gene therapeutic substance (E) based on pCMV6-SEQ ID No: 5, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 5.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The sixth gene therapeutic substance (F) based on pCMV6-SEQ ID No: 6, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 6.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The seventh gene therapeutic substance (G) based on pCMV6-SEQ ID No: 7, containing the modified cDNA of the P4NA1 gene (SEQ ID No: 7.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The eighth vector plasmid pCMV6-XL5 that does not contain the cDNA of the P4NA1 gene of Example 3 in combination with the transport molecule dendrimer of Example 7.

Moreover, the genetic constructs, one of which contains a portion of the unmodified cDNA of the P4NA1 gene (SEQ ID No: 1), the second genetic construct contains the modified cDNA of the P4HA1 gene (SEQ ID No: 2), the third genetic construct contains the modified cDNA of the P4NA1 gene (SEQ ID No: 1) : 3), the fourth genetic construct contains a modified cDNA of the P4NA1 gene (SEQ ID No: 4), the fifth genetic construct contains a modified cDNA of the P4NA1 gene (SEQ ID No: 5), the sixth genetic construct contains a modified cDNA of the P4NA1 gene (SEQ ID No: 6 ), seventh ge eticheskaya construct contains the modified cDNA R4NA1 gene (SEQ ID No: 7), eighth plasmid (placebo) is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. To obtain gene therapeutic substances, DNA-dendrimer complexes were prepared according to Example 7.

The resulting seven variants of gene-therapeutic substances and placebo were used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Biopsy samples were taken 72 hours after the introduction of gene-therapeutic substances. The biopsy was performed from the sites of the introduction of gene-therapeutic substances, placebo, as well as from intact skin using the device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was at least 10 cubic meters. mm, mass - not less than 11 mg.

The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

The determination of the amount of shedding 4-hydroxylase alpha 1 protein was carried out in nine biopsy samples of the patient’s skin 72 hours after the introduction of gene therapeutic substances by enzyme-linked immunosorbent assay (ELISA) using the Human P4NA1 ELISA Kit (MyBioSource, USA), as described in Example 8 .

According to the results of determining the amount of protein, shed 4-hydroxylase alpha 1, a variant of the gene therapeutic substance was isolated in the lysate of biopsy samples of the patient’s skin, with the introduction of which the greatest amount of protein shed 4-hydroxylase alpha 1 in the cell culture lysate was observed, which ultimately indicates the greatest expression of the gene P4NA1. In this experiment, the largest amount of the target protein shed 4-hydroxylase alpha 1 in the skin biopsy lysate was observed with the introduction of the gene therapeutic substance based on pCMV6 P4NA1 SEQ ID No: 4, containing the modified cDNA of the P4NA1 gene, as shown in figure 20

Thus, the most effective gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

An agent has been developed for treating the conditions of the human body associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein spilled 4-hydroxylase alpha 1, consisting of one or more gene-therapeutic substances from the group of gene-therapeutic substances for the correction of pathological conditions of cells of organs and tissues and / or human organs and tissues resulting from insufficient expression of the P4NA1 gene, method for its preparation and use.

The invented tool for treating human body conditions associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shed 4-hydroxylase alpha 1, consisting of one or more gene therapeutic substances from the group of gene therapeutic substances using one of the modified cDNA of the P4NA1 gene or a portion of the unmodified cDNA of the P4NA1 gene allows in practice the use of the gene-therapeutic substances included in the group to raise 4-hydroxyl to the required protein level Laz 1 alpha, in various cells of organs and tissues and / or organs and human tissues by increasing gene expression R4NA1.

As a result of preliminary studies of the biopsy of the patient, or cells grown from these biopsies, it is determined which variant of the gene therapeutic substance from the created group of gene therapeutic substances must be selected for this patient in order to increase the amount of protein shed by 4-hydroxylase alpha 1, in the cells of these organs and tissues and / or organs and tissues to the necessary level in relation to a particular patient. In cases where the use of a gene-therapeutic substance with a portion of unmodified cDNA of the P4NA1 gene does not lead to the desired change in the amount of protein shed by 4-hydroxylase alpha 1 in cells of organs and tissues and / or organs and tissues, it is necessary to use a substance based on modified cDNA P4NA1 gene, leading to more efficient expression of the P4NA1 gene.

When using the claimed gene therapeutic substance, there is no embedding of exogenous genetic material in the genome of the cell.

The group of gene therapeutic substances provides a high level of expression of the P4NA1 gene by increasing the amount of protein shed by 4-hydroxylase alpha 1 in the cells of organs and tissues and / or organs and tissues of a person, in particular, hematopoietic cells, or mesenchymal stem cells, or chondroblasts, or myocytes, or myoblasts, or fibroblasts, or osteoblasts, or keratocytes, or epithelial cells, or corneal cells, or endothelial cells, or epithelial cells, in combination with or without a transport molecule transfections with these gene therapeutic substances of cells of human organs and tissues and / or in human organs and tissues, in particular in connective tissue structures, or skin, or joints, or cartilage, or bone, or muscle, or tendons, or ligaments, or blood vessels, or the wall of arteries, or the cornea of the eye, or the sclera, or placenta, or dentin, or stroma of internal organs in combination with or without a transport molecule when these gene therapeutic substances are introduced into human organs and tissues.

Thus, the above examples confirm the fulfillment of the task, namely, the creation of a highly effective agent for treating the conditions of the human body associated with a decrease in the level of expression of the P4NA1 gene and / or a decrease in the amount of protein shed by 4-hydroxylase alpha 1, based on gene therapeutic substances with the gene P4NA1, which is a group of gene therapeutic substances, the use of which, taking into account the individual characteristics of the patient, increases the level of expression of the P4NA1 gene and / and whether an increase in the amount of protein shed 4-hydroxylase alpha 1 in the cells of organs and tissues and / or organs and tissues of the body.

In addition, with the introduction of genetic constructs, in contrast to the introduction of the protein itself, the required frequency of their introduction is reduced due to the prolonged action, and intracellular delivery is also facilitated.

An increase in the efficiency of correction of the amount of protein was shed by 4-hydroxylase alpha 1, in cells of human organs and tissues due to the fact that with an insufficient amount of this protein due to a defect in the P4NA1 gene, not a protein is used, but a genetic construct with cDNA of the P4NA1 gene encoding this protein.

Industrial applicability.

All the above examples on the creation and use of the created group of gene therapeutic substances confirm its industrial applicability.

List of abbreviations

DNA - deoxyribonucleic acid

cDNA - complementary deoxyribonucleic acid

RNA - ribonucleic acid

mRNA - template ribonucleic acid

PCR - polymerase chain reaction

ml - milliliter, μl - microliter

l - liter

cube mm - cubic millimeter

mcg - micrograms

mg - milligram

g - gram

μM - micromol

mm - millimole

rpm - revolutions per minute

nm - nanometer

cm - centimeter

MW - milliwatts

o.e.f. - relative unit of fluorescence

GTS - a gene-therapeutic substance

Claims (7)

1. An agent for treating human body conditions associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shed 4-hydroxylase alpha 1, based on gene therapeutic substances with the P4HA1 gene, which is at least one gene therapeutic substance selected from the group of gene therapeutic substances, each of which represents a genetic construct based on a vector plasmid comprising the cDNA of the P4NA1 gene, with the coding sequence of the protein, shed 4-hydroxylase alpha 1, deletions of 5- 'and 3'-untranslated regions, namely, obtained on the basis of a plot of unmodified cDNA of the P4NA1 gene of SEQ ID No: 1, or a modified cDNA of the P4HA1 gene, while SEQ ID No: 2, or SEQ is used as a modified cDNA of the P4NA1 gene ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level expression of the P4NA1 gene in eukaryotic cells, in particular in cells of human organs and tissues, and capable of increasing the amount of protein shed 4-hydroxylase alpha 1 in the cells of organs and tissues and / or human organs and tissues, in particular in hematopoietic cells, or mesenchymal stem cells, or chondroblasts, or myocytes, or myoblasts, or fibroblasts, or osteoblasts, or keratocytes or epithelial cells, or corneal cells, or endothelial cells, or epithelial cells, in combination with or without a transport molecule when these gene-therapeutic substances are transfected with cells of human and / or human organs and / or organ and human tissues, in particular in connective tissue structures, or skin, or joints, or cartilage, or bone, or muscle, or tendons, or ligaments, or blood vessels, or the wall of arteries, or the cornea of the eye, or sclera or a placenta, or dentin, or stroma of internal organs, in combination with or without a transport molecule when these gene-therapeutic substances are introduced into human organs and tissues. 2. The tool according to p. 1, characterized in that the genetic construct with a modified cDNA of the P4NA1 gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the P4HA1 gene, which carries modifications that do not affect the protein structure, shed 4-hydroxylase alpha 1, and namely, nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain. 3. The tool according to p. 1, characterized in that the genetic construct with a modified cDNA of the P4NA1 gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the P4HA1 gene, which carries modifications that affect the structure of the protein shed by 4-hydroxylase alpha 1, namely nucleotide substitutions leading to amino acid substitutions or termination of the amino acid chain. 4. The tool according to p. 1, characterized in that the genetic construct with a modified cDNA of the P4NA1 gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the P4HA1 gene, which carries modifications that do not affect the protein structure, shed 4-hydroxylase alpha 1, and namely, nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, in combination with modifications affecting the protein structure, shed 4-hydroxylase alpha 1, namely nucleotide substitutions leading to amino acid amenas or an amino acid chain termination. 5. The tool according to p. 1, characterized in that as a transport molecule using liposomes or dendrimers of the 5th and higher generations, or amphiphilic block copolymers, or transfection reagent based on Polyethylenimine (PEI). 6. A method of obtaining a means for treating conditions of the human body associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shedding 4-hydroxylase alpha 1, according to claim 1, which consists in obtaining each gene therapeutic substance from the group of gene therapeutic substances according to p. 1, in this case, cDNA of the P4NA1 gene is obtained, then cDNA is placed in a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, the necessary amount of gene is increased and secreted of the genetic construct, then the genetic construct is combined with a transport molecule to transfect the obtained gene therapeutic substance of cells of organs and tissues and / or introduce the obtained gene therapeutic substance into human organs and tissues, using cDNA of the P4NA1 gene with the coding sequence of the protein shed 4-hydroxylase alpha 1, with deletions of 5'- and 3'-untranslated regions, namely, obtained on the basis of a plot of unmodified cDNA of the P4NA1 gene SEQ ID No: 1, or a modified cDNA of the P4NA1 gene, while in As a modified cDNA of the P4NA1 gene, either SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination these genetic constructs. 7. A method of using an agent for treating conditions of the human body associated with a decrease in the expression of the P4NA1 gene and / or a decrease in the amount of protein shed 4-hydroxylase alpha 1, which consists in transfecting a gene-therapeutic substance selected from the group of created gene-therapeutic substances according to claim 1 cells of organs and tissues of a patient and / or in the introduction into the organs and tissues of a patient of autologous cells of a patient transfected with a gene therapeutic substance selected from the group of created gene therapeutic su substances according to claim 1, and / or in the introduction into the organs and tissues of a patient of a gene-therapeutic substance or several substances selected / selected from the group of created gene-therapeutic substances according to claim 1, or a combination of the indicated methods.

Images