WO2014170460A2 - Method for the production of collagen proteins derived from marine sponges and an organism able to produce said proteins - Google Patents

Method for the production of collagen proteins derived from marine sponges and an organism able to produce said proteins Download PDF

Info

Publication number
WO2014170460A2
WO2014170460A2 PCT/EP2014/057966 EP2014057966W WO2014170460A2 WO 2014170460 A2 WO2014170460 A2 WO 2014170460A2 EP 2014057966 W EP2014057966 W EP 2014057966W WO 2014170460 A2 WO2014170460 A2 WO 2014170460A2
Authority
WO
WIPO (PCT)
Prior art keywords
coding
seq
sponge
collagen
nucleotide sequence
Prior art date
Application number
PCT/EP2014/057966
Other languages
French (fr)
Other versions
WO2014170460A3 (en
Inventor
Marina POZZOLINI
Umberto Benatti
Francesca MUSSINO
Sonia Scarfi'
Valentina BERILLI
Annalisa Salis
Gianluca Damonte
Marco Giovine
Original Assignee
Universita' Degli Studi Di Genova
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universita' Degli Studi Di Genova filed Critical Universita' Degli Studi Di Genova
Publication of WO2014170460A2 publication Critical patent/WO2014170460A2/en
Publication of WO2014170460A3 publication Critical patent/WO2014170460A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces

Definitions

  • the present invention relates to a method for the production of collagen proteins derived from marine sponges and to an organism able to produce said proteins .
  • Collagen is an extracellular matrix protein present in all animals, from the simplest ones to humans , which have acquired a relevant commercial interest in the last two decades.
  • collagen originates as pre-pro- collagen, a product that, with respect to the collagen, has two pro-peptides , one at the N-terminus and C-terminus, which have a globular structure.
  • the pre-pro-collagen chain is subjected to the removal of the signal peptide, specific proline and lysine residues become hydroxylated to hydroxyproline and hydroxylysine .
  • Three of such chains wrap themselves to form a triple helix structure stabilised by hydrogen bonds between hydroxylated aminoacids , generating the procollagen .
  • the following steps provide the helix glycosilation, extracellular secretion and the action of some pro-collagen peptidases that remove pro- peptides at N-terminus and at C-terminus, converting the pro-collagen into tropocollagen .
  • Tropocollagen is therefore the structural unit of collagen and it is a protein formed by three polypeptide chains with a anticlock-wise arrangement that associate with each other to form a clock-wise triple helix.
  • the three chains in the tropocollagen are held together by hydrogen bonds, bonds that are possible by the presence of glycine and by post-translational modifications of lysine and proline.
  • procollagen in the maturation process of the collagen, therefore are the hydroxylation of prolines (one of the aminoacid characterizing this type of proteins) and glycosilation (addition of sugars) : these modifications are performed by specific enzymes present in the collagen-producing cell .
  • the prolyl-4-hydroxylase (P4H) is a key enzyme necessary for obtaining collagen from pro-collagen and, in mammalians, it is a tetramer with subunits ⁇ 2 ⁇ 2.
  • Alpha subunits contain the catalytic sites involved in proline residue hydroxylation.
  • Beta subunits are identical to protein disulfide isomerase (PDI) and in this specific case they perform a structural function to maintain the alpha subunit as functional .
  • PDI protein disulfide isomerase
  • marine collagen proteins derived from sponges means proteins with collagen structures produced from porifers , that is collagen precursors (pro-collagen) , collagen, polypeptides containing collagen sequences, fragments thereof or the like, usually different in their sequence and structure from collagens of more evolved animals (for example mussels or mammalians) .
  • collagen from marine sponges is currently obtained only by extraction from the source organism, that is from sponges, with remarkable purification problems due to the frequent co-presence of other toxic components and with a strong environmental impact since the sponge subjected to the extraction process currently does not derive from farming sponge but from the natural environment.
  • collagens and collagen polypeptides of sponge origin display specific peculiarities compared both to those of mammalians and to those of other organisms even marine ones (such as the mytilus one described in EP1787995) , particularly the sponge collagen C. reniformis is particularly useful in cosmetic and pharmaceutical applications (for example for making protective capsules for oral drug administration) .
  • the co-presence in the origin animal of considerable amounts of toxic compounds makes it difficult, long and expensive the method for extracting this specific collagen protein mixture having a high industrial interest from the origin biomass .
  • the present invention aims at:
  • the object of the present invention is a method for the production of recombinant collagen proteins derived from marine sponges , which method provides the transformation of a selected host organism with expression vectors allowing:
  • genetic information coding for the primary structure of the protein or proteins to be added.
  • Said method can provide also to add at least one coding sequence for a signal peptide allowing the extracellular secretion of the host organism of said collagen protein or proteins and/or at least one sequence coding for a tag peptide allowing the affinity purification.
  • the production method therefore provides the introduction and the expression in a host organism of at least one nucleotide sequence coding for one polypeptide chain of collagen protein of marine sponge and at least one nucleotide sequence coding for an enzyme or for at least one of its subunits, also derived from the marine sponge, which enzyme is involved in the post-translational modifications, such as hydroxylation , of the maturation process of marine sponge collagen.
  • the method provides the expression of at least one gene involved in the marine sponge collagen protein production process in a host organism by using the recombinant technology.
  • said host organism consists of yeast eukaryotic cells transformed with expression vectors: the transformation with recombinant expression vectors containing the nucleotide sequences of at least one enzyme involved in the prolyl-hydroxylase activity of marine sponge allows to obtain strains able to express such functional polypeptide in the endoplasmic reticulum of the cell of the host organism.
  • This starting cell can be further transformed with one or more specific genes coding for marine sponge collagen proteins .
  • the method of the present invention allows to obtain high amounts of marine sponge collagen proteins in a host organism that, without the transformation process, would not be able to produce said molecules or their precursors .
  • the host organism is a yeast (eukaryotic, unicellular) , that, with respect to bacteria (although they are easier to use) , allows the exploitation of a pre-existent enzymatic glycosilation machinery, however it being necessary to introduce the enzymes involved in the hydroxylation process to ensure the yeast to produce correctly structured marine sponge collagen proteins.
  • yeast eukaryotic, unicellular
  • Object of the present invention is also an eukaryotic system for the recombinant expression of marine sponge collagen proteins wherein the cells express, as rtiR A and proteins, one or more genes coding for the collagen and one or more enzymes necessary for the post-translational modifications of said collagens .
  • yeast strain has been transformed with the genes of both alpha and beta subunits of marine sponge prolyl-4-hydroxylase enzyme .
  • the sponge is of the C. reniformis species .
  • the yeast strain has also been transformed with one specific gene coding for the nonfibrillar C. reniformis sponge pro-collagen, that is the ColCH gene (SEQ ID NO: 5) .
  • the transformed host organism used to produce recombinant collagen proteins according to the present invention is a Pichia pastoris yeast strain.
  • P. pastoris strains of the PichiaPinkTM Expression System kit have been used, but it is possible to use any yeast strains having similar characteristics in which the recombinant approach can be applied.
  • the P. pastoris strain of the PichiaPinkTM Expression System kit is defective for the gene related to adenine biosynthesis .
  • the strain is neither toxic nor dangerous for humans and for the environment.
  • Said Pinchia pastoris yeast strain transformed as described above identified with the reference name "Pichia pastoris ColCH4" has been stored in the Industrial Yeasts Collection DBVPG located in Borgo 20 Giugno 74 06121 Perugia, Italy, on April 5th, 2013, with reference 34P as requested by the Budapest Treaty .
  • the yeast strain has been transformed through recombinant technology with a gene coding for a marine sponge collagen protein analogue to vertebrate type IV collagen, thus, the method, and the organism object of this invention, is also able to produce collagens with complex structure analogues to type IV collagens of higher organisms .
  • Transformed yeast cells are then cultured in order to allow recombinant protein expression and the extraction/purification of the recombinant bioproduct (marine sponge collagen protein) .
  • Object of the present invention is also a method of recombinant transformation of a yeast strain for at least one nucleotide sequence coding for at least a marine sponge collagen protein and at least one nucleotide sequence coding for an enzymatic protein or at least one subunit thereof involved in the modifications to said chain in the marine sponge collagen maturation process, to be expressed in the cells of said strain.
  • the method, object of the present invention allows to transform the Pichia pastoris strain with vectors comprising specific DNA sequences .
  • the method therefore allows to introduce in the genome of the Pichia pastoris at least three different nucleotide sequences coding each one for a protein involved in the marine collagen maturation.
  • said method comprises the following steps:
  • Said yeast transformation method for the production of C. reniformis recombinant marine sponge proteins is possible thanks to the identification of the marine sponge prolyl-4 -hydroxylase enzyme, isolated from the animal .
  • the method contemplates the co-transformation of the yeast strain with two different vectors one containing the coding sequence for the alpha subunit and the other containing the coding sequence of the beta subunit of the prolyl-4-hydroxylase enzyme, followed by the transformation with the expression vector containing at least one coding sequence for at least a marine sponge collagen protein.
  • a step selecting the yeast strains showing an elevated prolyl-4-hydroxylase activity is provided.
  • Object of the present invention is also at least one expression vector for the transformation of a host organism through recombinant technology.
  • Said vectors contain the coding sequences for the marine collagen polypeptide structure and/or for genes of the enzymes involved in the transformation process of said polypeptide chains.
  • said vectors to comprise also at least one sequence coding for a signal peptide for the extracellular secretion of the host organism of said marine sponge collagen protein and/or at least a sequence coding for a tag peptide allowing the affinity purification of said marine sponge collagen protein.
  • the expression vectors have been produced which contain sequences coding for optimal signal peptides upstream the regions coding the proteins of interest.
  • expression vectors which contain:
  • the cloning site is preceded by the coding region for the S. cerevisiae Alpha Mating Factor (AM) .
  • AM Alpha Mating Factor
  • the enzymes responsible for the polypeptide chain hydroxylation during the sponge collagen biosynthetic process and their gene sequences have been characterized and with them a yeast has been transformed, particularly the C. reniformis prolyl-4-hydroxylase enzyme (alpha and beta subunits) has been characterized.
  • Said enzyme belongs to the type II prolyl- hydroxylase family .
  • polypeptides of alpha and beta subunits of marine sponge C. reniformis prolyl-4-hydroxylase enzyme and the correspondent aminoacid sequences are unknown in the prior art.
  • the object of the invention are the nucleotide and aminoacid sequences coding for the alpha and beta subunits of the prolyl-4-hydroxylase enzyme (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively)
  • the genes (SEQ ID NO: 1 and SEQ ID NO : 3) coding for the enzyme with the prolyl-4-hydroxylase activity during the process of C. reniformis marine collagen production have been isolated from the organism and identified through the technical process (PCR) further described below.
  • An object of the present invention are also the nucleotide and aminoacid sequences coding for nonfibrillar collagens and for a C. reniformis sponge fibrillar collagen:
  • SEQ ID NO: 7 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein
  • SEQ ID NO: 8 aminoacid sequence of the C. reniformis nonfibrillar collagen protein 2) SEQ ID NO: 9 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
  • SEQ ID NO: 11 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein
  • SEQ ID NO: 13 nucleotide sequence of the gene coding for the C. reniformis fibrillar collagen protein
  • An object of the present invention are the yeast strains which express the nucleotide sequences coding for the alpha and beta subunits of the prolyl-4- hydroxylase enzyme of the sponge C. reniformis, which enzyme, having a prolyl-hydroxylase activity, is involved in the modifications to the primary polypeptide chain of the marine sponge collagen proteins and at least the nucleotide sequence coding for at least one of said C. reniformis sponge proteins .
  • yeast strains can express at least one of the following necleotide sequences: SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13.
  • the method and the organism transformed by the vectors object of the present invention allow therefore the large-scale production of sponge- derived extracellular matrix proteins , which proteins , in particular collagen and its derivatives , can be used in the biomedic, pharmaceutical and cosmetic fields .
  • the marine sponge collagen proteins are a biomaterial that can be used as an alternative to, or in combination with, mammalian collagen.
  • Fig. 1 is the co-transformation strategy of the yeast strain, defective for the gene related to the synthesis of adenine, with the three vectors containing 1) the gene coding for the alpha subunit of P4H and the gene Ade+, 2) the gene for the synthesis of the PDI with the marker for the resistance to blasticidin and 3) the gene coding for the nonfibrillar collagen with the marker for resistance to zeocin, respectively.
  • the co- transformed strains are easily selected in plates free from adenine and with blasticidin and zeocin antibiotic ;
  • Fig. 2 schematically is the three expression vectors and the relative selection marker
  • Fig. 3a and 3b are the map of pPinkLC and pPinkHC vectors .
  • Fig. 4 is the map of ⁇ xpPIC6 vector
  • Fig. 5 is the map of pPICZA vector
  • Fig. 6 is the activity of recombinant P4H in the different P. pastoris strains analysed by the quantification of 1 C0 2 produced from the decarboxylation of 2-oxo- [l- 14 C] glutarate; the ⁇ strain incubated for 30 minutes in ice in the presence of a specific inhibitor of P4H, cumalic acid, was used as control;
  • Fig. 7 is a comparison of the activity of recombinant P4H in the two P. pastoris High copy and Low copy strains analysed by the quantification of 1 C0 2 produced from the decarboxylation of 2-oxo- [l- 14 C] glutarate; the ⁇ strain incubated for 30 minutes in ice in the presence of a specific inhibitor of P4H, cumalic acid, was used as control; Fig.
  • Fig. 9 is the relative quantitative analysis of the gene copy number firmly inserted in the genome of various transformed yeast strains.
  • Fig. 10 is the relative mRNA expression of the three genes inserted in the P. pastoris strains, namely P4H, PDI and ColCH evaluated by quantitative PCR. The expression levels of the messengers were analysed at 24 hours after induction in the yeasts.
  • TO represents the control sample composed of the ColCH4 strain extracted immediately after induction;
  • Fig. 11 is the SDS-Page analysis followed by Coomassie staining of the lysate (a) and of the concentrated and water-dialyzed culture medium (b) of the P. pastoris strains induced with methanol.
  • Fig. 12 is the mass spectrometric MS 2 identification of the triptic peptide GAVGPGGKPGPR (m/z 525,5 with double charge) derived from the recombinant pro-collagen.
  • Fig. 13a and 13b are the mass spectrometric identification MS of all triptic peptides derived from recombinant pro-collagen displaying one or more hydroxylated prolines ;
  • Fig. 14 is an example of the identification by fragmentation MS spectrum of a triptic double proline-hydroxylated peptide P [oxi] GPPGP [oxi] AGRDGR (m/z 583,3, double charge) .
  • the method for the production of recombinant collagen proteins from the marine sponge C. reniformis, and in particular of hydroxylated pro-collagen is based on the use of an host organism represented by a genetically modified yeast strain.
  • the strategy for the production of said organism able to produce recombinant marine sponge proteins is based on the co-transformation of yeast strains with three different expression vectors containing respectively :
  • the yeast strain used is the Pichia pastoris strain.
  • the method preferably contemplates the transformation of the strain with the vectors containing the coding sequences for the enzyme involved in the post-translational modification of the collagen protein followed by a further transformation of said strain (containing the genes coding for the alpha and beta subunits of prolyl-4- hydroxylase enzyme) with one or more genes coding for marine sponge collagen proteins .
  • the strain transformed with a specific expression vector contains a gene coding for the C. reniformis sponge ColCH pro- collagen.
  • the nucleotide sequence of the gene (ColCH) coding for the nonfibrillar procollagen, as well as the aminoacid sequence of the nonfibrillar procollagen protein is accessible on GenBank database with the ID number DQ874470.
  • the ColCH gene coding for the nonfibrillar procollagen protein has the nucleotide sequence reported in SEQ ID NO: 5.
  • the ColCH protein has the aminoacid sequence reported in SEQ ID NO: 6.
  • Said Pinchia pastoris yeast strain transformed as described above identified with the reference name "Pichia pastoris ColCH4" has been stored in the Industrial Yeasts Collection DBVPG located in Borgo 20 Giugno 74 06121 Perugia, Italy, on April 5th, 2013, with reference 34P as requested by the Budapest Treaty .
  • Object of the present invention are the coding sequence for the alpha subunit of the prolyl-4- hydroxylase (P4H) enzyme and the coding sequence for the beta subunit of said enzyme (Protein Disulfide Isomerase, PDI) still unknown in the prior art. Said sequences have been isolated, identified, inserted in plasmid vectors and cloned in E. coli strains.
  • the gene coding for the alpha subunit of the prolyl-4-hydroxylase (P4H) enzymatic protein has the nucleotide sequence reported in SEQ ID NO : 1.
  • the alpha subunit of the prolyl-4-hydroxylase protein has the aminoacid sequence reported in SEQ ID NO: 2.
  • the gene coding for the protein disulfide isomerase (PDI) (beta subunit of the prolyl-4- hydroxylase enzyme) has the nucleotide sequence reported in SEQ ID NO: 3.
  • the protein disulfide isomerase has the aminoacid sequence reported in SEQ ID NO : 4.
  • An object of the present invention are also the nucleotide and aminoacid sequences coding for C. reniformis nonfibrillar collagens :
  • SEQ ID NO: 7 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein
  • SEQ ID NO: 9 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein
  • SEQ ID NO: 11 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein
  • the transformation host organism with expression vector comprising at least one of said sequences: cDNA SEQ ID NO: 7, cDNA SEQ ID NO: 9, cDNA SEQ ID NO: 11, cDNA SEQ ID NO: 13.
  • the commercial kit PichiaPinkTM Expression System (Life technologies) , has been used where the strains named Pichia PinkTM are defective of the gene related to adenine synthesis (ade2) ; the vectors of the kit (pPinkHC or pPinkLC) contain the ADE2 gene, allowing the transformed strain to grow in a medium lacking adenine .
  • This commercial strain is designed for the expression of a single recombinant polypeptide.
  • the present invention provides a modification of the yeast transformation method and it allows the integration of three different coding sequences, inserted in three different vectors, and their co- expression in the same system.
  • kit vectors containing the ADE2 gene have been used to host the coding sequence of the alpha subunit of the prolyl-4- hydroxylase enzyme (P4H) .
  • the expression vector used for the insertion of the coding sequence of beta subunit contains the resistance marker for blasticidin.
  • a vector pPICZ which contains genes that give the resistance for the zeocin antibiotic.
  • the strains containing the three integrated coding sequences have been easily selected in plates with media lacking adenine and in the presence of both antibiotics .
  • the coding sequences of the alpha subunit of prolyl-4- hydroxylase enzyme (P4H) and of collagen (ColCH) were inserted in the expression vectors equipped with their own signal peptides , while in the coding sequence of the beta subunit of the enzyme (PDI) the signal peptide was replaced with the S.
  • AM Alpha Mating factor
  • the SignalP 3.9 server analysis revealed the possible presence of a signal peptide in position 1-28 with a cleavage site between Gly 27 and Glu 28.
  • the presence of a Pfam P4Ha_N domain (alpha subunit of P4H, N- terminal region) between aa 32 and aa 163 indicates that the protein is a member of prolyl-4-hydroxylase superfamily.
  • P4Hc domain is present (homologue to alpha subunit of prolyl-4-hydroxylase)
  • another domain can be identified, namely the 20G-Fell_Oxy (residues 412-517) belonging to members of the (20G) - dependent iron-dioxygenase 2-oxoglutatarate superfamily.
  • Another C-terminal domain in the alpha subunit of P4H, involved in the catalytic activity, is also recognized as a region belonging to the iron- dioxygenase 2-oxoglutatarate superfamily.
  • the putative translational product of P4Hac has an estimated molecular weight of 61.9 kDa and an isoelectric point of 6.31.
  • the Signal P 3.9 server analysis reveals the presence of a signal peptide in position 1-16 with a cut site between the Gly 16 and Ala 17.
  • BLAST and SMART sequence analyses show the presence of four different TRX domains (thioredoxin-like coil) : 1) PDIa, TRX redox active domain at the N- terminal between aa 30 and 127; 2) PDIb, TRX-like redox inactive domain between aa 135 and 230; 3) PDIb' , TRX-like redox inactive domain between aa 242 and 345; 4) PDIa_PDIa'C with an active TRX region at the C-terminal in position 366-466.
  • Both the TRX active redox domains (PDIa and PDIa_PDIa'C) host a -Cys-Gly-His-Cys motif, representing two catalytic sites acting independently in the PDI .
  • the putative translational product of the PDI gene has an estimated molecular weight of 58.8 kDa and an isoelctric point of 4.34.
  • the cDNA coding for the alpha subunit of C. reniformis prolyl-4-hydroxylase going from the yeast consensus sequence for the beginning of translation to the stop codon, and flanked by an EcoRI site in 5' and a Kpnl site in 3' , was PCR-amplified and ligated into the pPinkHC (high copy) or pPinkLC (low copy) vectors in correspondence to the MCS cloning region (Fig. 3b and a) (Life Technologies TM) . Vectors were previously linearised with the two EcoRI and Kpnl enzymes. This strategy allowed to obtain pPinkHC ⁇ x and pPinkLC ⁇ a. Specifically, in order to include the yeast translation consensus sequence (Kozak sequence, gaaacg) at the beginning of the translation site a two step PCR reaction was performed.
  • a first PCR was performed using as primer sense FwalfaRO and as antisense RewalfaT:
  • the thermal profile was as following: 2 min initial denaturation at 94 °C followed by 20 cycles at 95°C for 30 s, 60°C for 30 s and 68°C for 1.5 min, at the end of the cycles a final step of 7 min at 68 °C was performed.
  • a 1:100 fold dilution of the first PCR product was used for a nested-PCR with Fwalfal as primer sense and Rewalfal as antisense primer.
  • the thermal profile was as follows: 2 min initial denaturation at 94°C followed by 28 cycles at 95° C for 30 s, 62°C for 30 s and 68° C for 1.5 min, at the end of the cycles a final step of 7 min at 68°C was performed.
  • the purified amplified product and the pPinkLC or pPinkHC vectors were then digested with EcoRI and Kpnl and finally ligated with the following reagent concentration :
  • Recombinant pPinkLC ⁇ a and pPinkHC ⁇ x vectors were extracted from 200 ml of transformed E. coli suspensions through the Nucleobond Xtra midi commercial kit (Macherey-Nagel) . Vectors were then linearised with Spel (also known as Bcul) restriction enzyme.
  • the cDNA of the beta subunit of C. reniformis prolyl-4-hydroxylase (PDI) going from the first amino acid codon (Alal7) , after the signal peptide cleavage site, to the stop codon and flanked by
  • Pmll restriction site in the 5' -end and Notl in the 3' -end was synthesized by PCR using FwPDIr as sense and RewPDIr as antisense primers :
  • the cDNA was finally ligated into the MCS of the ⁇ xpPIC6B vector (Life TechnologiesTM) (Fig. 4) , previously linearised with Pmll and Notl , obtaining the recombinant construct ⁇ xpPIC6B ⁇ PDI .
  • the amplification reaction was performed in the following conditions :
  • the thermal profile was as follows : 2 min initial denaturation at 94 °C, followed by 32 cycles at 95° C for 30 s, 58°C for 30 s and 68° C for 2 min, at the end of the cycles a final step of 7 min at 68 °C was performed.
  • the cDNA and vector were then ligated in the following conditions :
  • Recombinant ⁇ xpPIC6B ⁇ PDI vector was extracted from 200 ml of transformed E. coli suspension through the Nucleobond Xtra midi commercial kit (Macherey-Nagel) and linearised with the Sacl restriction enzyme in the following conditions :
  • the following thermal profile was used: 2 min of initial denaturation at 94 °C, 15 cycles at 94° C for 30 s, 63.7°C for 30 s and 68° C for 2.5 min, at the end of the cycles a final step of 7 min at 68 °C was performed.
  • 1 ⁇ of the PCR product was again amplified using FwColRl as sense primer and RewColR as antisense primer.
  • the thermal profile was: 2 min of initial denaturation at 94 °C, 28 cycles at 95° C for 30 s, 62 °C for 30 s and 68° C for 2.5 min, at the end of the cycles a final step of 10 min at 68 °C was performed.
  • the purified PCR product and the pPICZA vector were then digested with Pmll followed by NotI .
  • reaction was performed at 16°C for 18 hours.
  • 1 ⁇ of the recombinant product obtained with the ligation was cloned in E. coli TOP 10 One Shot chemically competent cells (Life technologiesTM, USA) by standard procedure with the difference in the antibiotic used, in this case zeocin at 100 g/ml, and an LB culture medium with half concentration of NaCl.
  • Recombinant pPICZA ⁇ ColCH vector was extracted from 200 ml of transformed E. coli suspension through the Nucleobond Xtra midi commercial kit (Macherey-Nagel) and linearised with Pmel restriction enzyme.
  • the four competent strains were then co- transformed as described in the PichiaPinkTM Expression System kit (Life TechnologiesTM) , with 5 ]ig of linearised pPinkHC/a or pPinkLC/a and with 5 ]ig of linearised ⁇ xpPIC6B/PDI .
  • ⁇ xpPIC6B/PDI vector selection marker is an antibiotic resistance
  • the universal primers in fact, have been designed to match the flanking regions of the cloning site that is identical in the two vectors : thus , the two genes integrated in the yeast genome would compete for the same couple of primers .
  • the sense primers are different for P4H and PDI even if complementary to the vector, because the vector used for PDI also contains the coding region of S. cerevisiae Alpha Mating Factor (AM) and this is the region where the sense primer has been designed to match, to confirm the integration of the construct ⁇ xpPIC6BPD ⁇ PDI into the yeast genome.
  • AM Alpha Mating Factor
  • the primer sequences used to confirm by PCR the integration of the recombinant constructs in the yeast genome are as follows:
  • FwOxi 5' -GACTGGTTCCAATTGACAAGC-3' SEQ ID NO: 24
  • RewP4H 5' -CCAAAGCCACAGCAGACATA-3' SEQ ID NO: 25
  • FwAM 5' -CTATTGCCAGCATTGCTGC-3' SEQ ID NO: 26
  • RewPDI 5' TCACAATGTCCTCTGCTTGC-3' SEQ ID NO: 27
  • Yeast cells were grown in liquid culture.
  • Recombinant protein expression was obtained in yeast cell suspensions grown in a buffered 1% glycerol complex medium (BMGY, pH 6.0) followed by culture in a buffered minimal methanol medium (BMMY, pH 6.0), for 60 hours at 30°C for the induction of expression.
  • BMGY buffered 1% glycerol complex medium
  • BMMY buffered minimal methanol medium
  • yeast cells were harvested by sedimentation at 1.500 x g for ten min, at room temperature, washed once with BMMY and suspended in ice-cold lysis buffer containing 0.1 M NaCl, 0.1 M glycine, 0.05% Triton X- 100, 10 uM dithiothreitol (DTT) , 1:100 diluted yeast protease inhibitor cocktail (P8465 Sigma-Aldrich Corp., St. Louis, MO, USA), 10 itiM Tris buffer, pH 7.8.
  • the lysate was then centrifuged at 15,000 ⁇ g for 15 min at 4°C to obtain the cytosolic and microsomal fraction.
  • the yeast protein extract was introduced in a chamber of a sealed glass vessel especially designed for radioactive CO 2 capture and quantification, while in another chamber of the vessel, connected to the first through a channel allowing air exchange between the two , 0.2 ml of 2 M NaOH were introduced to capture radioactive 1 C0 2 released by yeast lysate.
  • the solution was then additioned with 0.5 Ci of 2- oxo-[l-14C] glutarate (final specific activity: 10 mCi/mmol) , the vessel was tightly sealed and incubated at 37 °C for 2 hours in the presence of the Kivirikko reaction mixture containing 50 itiM FeS0 4 , 50mM Tris-HCl pH 7.8, 0.1 itiM DTT, 2 itiM ascorbic acid, 30 itiM (Pro-Pro-Gly) io peptide, 2 mg/ml bovine serum albumin (BSA) and 600 U catalase.
  • Kivirikko reaction mixture containing 50 itiM FeS0 4 , 50mM Tris-HCl pH 7.8, 0.1 itiM DTT, 2 itiM ascorbic acid, 30 itiM (Pro-Pro-Gly) io peptide, 2 mg/ml bovine serum albumin (BSA) and 600 U catalase.
  • reaction mixture was then incubated at 37 °C for 30 minutes .
  • strain 2 was identified as the best performing, as shown in Fig. 6.
  • the competent strain was transformed using 10 ]ig of linearized pPICZA/ColCH recombinant expression vector. Since pPICZA/ColCH vector selection marker is an antibiotic resistance, after thermal shock cells were incubated for two hours at 30 °C in the presence of YPD, to allow the expression of the resistance gene. Then cells were plated on PAD/agar selective plates without adenine and additioned with blasticidin 0.3 mg ⁇ ml and zeocin 0.1 mg/ml.
  • FwCs 5'- AATTCACGTGGAAACGATGGAG-3' (SEQ ID NO: 28) and RewCs : 5'- TCCTTTCGCACCTAATCCTG-3' (SEQ ID NO: 29) .
  • the first oligonucleotide matches the fusion region between the vector and the insert, while the second recognizes a region inside the vector .
  • the genomic DNA was extracted from the various strains following the instructions reported at page 70 of the instruction manual of PichiaPinkTM Expression System kit, 20 times diluted and amplified in a final volume of 20 ⁇ , in the following conditions :
  • the thermal profile was as follows : 3 minutes at 95°C, and 45 cycles of 15 s at 95°C, 30 s at 60°C, fluorescence quantification; melting curve from 58 °C to 95°C, fluorescence reading every 0.5°C. Each reaction was performed in triplicate .
  • ⁇ -actin gene was used for sample normalization. Gene copy quantity was expressed as amount relative to the sample with the lowest gene quantity.
  • ColCH strains culture and induction of expression of recombinant collagen
  • Yeast cells derived from positive colony number 4 (ColCH4 strain) were cultured in liquid medium.
  • Induction of the recombinant polypeptide expression was performed in the yeast cell suspension grown in a buffered 1% glycerol complex medium (BMGY, pH 6.0) followed by culture in a buffered minimal methanol medium (BMMY, pH 6.0), for the induction of expression.
  • BMGY buffered 1% glycerol complex medium
  • BMMY buffered minimal methanol medium
  • qPCR quantitative real-time PCR
  • Total yeast RNA was extracted from 5xl0 7 cells before the methanol induction of gene expression and 24 hours after, using RNeasy mini kit (Qiagen) .
  • the yeast cells were mechanically lysed with 600 ⁇ of nitric acid-washed glass beads (0.45-0.55 mm diameter) .
  • Lysate was then centrifuged at 10,000 x g for 2 minutes at 4°C.
  • RNA extraction was performed on the supernatant following the manufacturer's protocol, comprising the DNAse I digestion phase (27 Kunits) .
  • Yeast cDNA was synthesized using Iscript cDNA synthesis kit according to the manufacturer' s instruction in a final volume of 20 ⁇ , with 1 ]ig of purified total yeast RNA, the proper reaction buffer, 2.5 uM random examers , 0.5 inM dNTP mix, 5 inM DTT, 40 U ribonuclease inhibitor RNAseOUT (Life TechnologiesTM) and 15 U of Super ScriptlllTM (Life TechnologiesTM) .
  • the reaction was performed at 25°C for 10 minutes and then at 50°C for 50 minutes.
  • To remove cDNA complementary RNA 2 U of E. coli RNase H (Life TechnologiesTM) were added and the mixture incubated for 20 min at 37 °C.
  • Quantitative PCR was performed using a 1:5 dilution of synthetized cDNA and performed as already reported in the section relative to ⁇ 21 ⁇ strain transformation with pPICZa/ColCH vector.
  • C. reniformis transcriptome analysis was performed on the corresponding cDNA through 454 pyrosequencing technique. After the assembling of 665,421 reads, 19,678 transcripts were obtained belonging to 13,900 isogroups .
  • bioinformatics analyses using both the MIRA and NEWBLER software, a series of C. reniformis new collagen sequences were identified. Specifically, the nucleotide sequences shown in SEQ ID NO: 7, 9, 11, 13, and corresponding to the aminoacid sequences shown in SEQ ID NO: 8, 10, 12, 14 were identified as peculiar sponge collagens homologous to the C. reniformis ColCH gene (SEQ ID NO: 5) .
  • the nucleotide sequences shown in SEQ ID NO: 7, 9, 11 belong to the marine sponge nonfibrillar short chain collagen family while the nucleotide sequence shown in SEQ ID NO: 13 belongs to the marine sponge fibrillar collagen family.
  • Cells were lysed by vigorously shacking using a tissue lyser (Qiagen) at 30 Hz for 8 minutes with acid-washed glass beads (0.5 mm diameter) added according to a ratio of 1:1 (beads volume: yeast cell lysate volume). The lysate was centrifuged at 10,000 x g for 30 min at 4°C, and the supernatant was recovered.
  • tissue lyser Qiagen
  • acid-washed glass beads 0.5 mm diameter
  • the culture medium was centrifuged for 20 minutes, at 20,000 x g, at 4°C, ten-fold concentrated using Amicon concentrating tubes (Millipore) with 50 kDa molecular cut off and dialyzed against distilled water, in order to change solvent from culture medium to distilled water.
  • Amicon concentrating tubes Micropore
  • the band corresponding to the theoretical expected molecular weight of collagen was excised from the acrylamide gel and was digested as described in Shervenko et al (Shervenko et al . Analytical Chemistry 1996, 68, 850-858) . After digestion, triptic peptides obtained from the gel extraction, were dried using a centrifugal evaporator (Speed Vac) .
  • Reversed-phase separation of digested samples was carried out on an Agilent 1100 series system (HPLC system) , consisting of a capillary chromatograph equipped with a diode array detector (Agilent, Palo Alto, CA, USA) using an Agilent Zorbax RP Ci8 column (150x1 mm ID; particle size, 5 um) at a micro flow rate of 40 ⁇ /min.
  • HPLC system high-LC system
  • the gradient applied was as follows: from start to 5 minutes the eluent B (0.051% v/v FOA in acetonitrile) was maintained at 10%; then the eluent B was linearly brought up to 95% in 65 minutes ; and maintained at those A and B percentages for further 10 minutes.
  • the eluent from HPLC separation was directly introduced in a mass spectrometer equipped with an electrospray source with orthogonal geometry and an ion trap analyzer (Agilent 1100 series LC/MSD ion trap XCT instrument) .
  • an ion trap analyzer Alent 1100 series LC/MSD ion trap XCT instrument
  • MS and MS/MS spectra allowed to perform database search (Mascot-Matrixscience) . All the MS and MS/MS analyses were performed ion positive ion mode and confirmed through manual de- novo sequence .
  • spots of interest were cut from the gel and destained, reducted, alkylated and digested with trypsin as described by Shervenko et al. (Shervenko et al . Analytical Chemistry 1996, 68, 850-858) .
  • Nano-HPLC MS and MS/MS experiments were performed on a Q-TOF mass spectrometer TripleTOF® 5600+ (AB Sciex, Concord, Ontario Canada) controlled by the Analyst QS 1.6 software (AB Sciex) .
  • the mass spectrometer was coupled to a splitless Ultra 2D Plus HPLC system with a cHiPLC Nanoflex (Eksigent, Dublin, CA) , managed by the above mentioned software.
  • the dried peptide pellets were suspended immediately before analysis in 10pL of HPLC eluent A (95% v/v water, 5%v/v acetonitrile , 0.1%v/v formic acid).
  • the peptides were subsequently eluted from the pre-column over the analytical column (Eksigent C18 PepMaplOO, 150 mmx75um, , 3um beads, 120 A) at a flow rate of 350 nl/min.
  • Analytical separation was established by maintaining 2% eluent B (acetonitrile , 0.1%v/v formic acid) for 5 min. In the following 2 min, 10% eluent B was attained and a linear gradient to 40% eluent B occurred in 60 min. Following the peptide elution, gradient was increased to 90% B and maintained for 10 min.
  • the analytical column was connected with a 15um inner diameter Silica Tip (Pico Tip) nanospray emitter (New Objective, Woburn, MA) .
  • a spray voltage of 2.2 kV was applied to the emitter.
  • the MS was operated with a RP of 30,000 FWH M for TOF-MS scans.
  • survey scans were acquired in 250 ms and as many as 8, 20, or 50 product ion scans were collected if exceeding a threshold of 125 counts per second (counts/s) and with a +2 to +5 charge-state .
  • a sweeping collision energy setting of 35 ⁇ 15 eV was applied to all precursor ions for collision-induced dissociation.
  • Dynamic exclusion was set for 1 ⁇ 2 of peak width ( ⁇ 8 s) , and then the precursor was refreshed off of the exclusion list.
  • Mass spectra were acquired from 100 to 1200m/z.
  • Protein Pilot Software v. 4.5 (AB SCIEX, Foster City, CA) was used to create peak lists from MS and MS/MS raw data.
  • the database employed was C. Reniformis SwissProt database with the trypsin sequence and common keratin contaminants included, and this allowed the opportunity to employ the target-decoy database search strategy.
  • all modifications listed in UniMod are searched simultaneously (http://www.unimod.org/) and the tolerances used were ⁇ 0.09 Da for peptides and ⁇ 0.05 Da for MS/MS fragments, respectively.
  • the false discovery rate (FDR) analysis was also done using the integrated tools in ProteinPilot .
  • the method for production of recombinant collagen proteins derived from marine sponge and a yeast able to produce said proteins allows to obtain a biomaterial with high purity, and to facilitate and make cheaper the production of collagen compaunds best characterized and homogeneous than the collagen extracts obtained from sponges using traditional methods .
  • P. pastoris transformed strain avoids the risk of toxic contaminants , commonly present in natural matrices , for human health and the environment.
  • the P. pastoris microorganism identified by reference Pichia pastoris ColCH4 , modified and selected as above reported, has been stored at the Industrial Yeasts Collection DBVPG, Borgo 20 Giugno 74 06121 Perugia, Italy the 5th of April 2013 with assigned number of 34P, as requested by the Budapest Treaty .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A method for the production of recombinant marine sponge collagen proteins, which method comprises introduction and expression of at least one nucleotide sequence coding for a primary polypeptide chain of marine sponge collagen proteins, and at least one nucleotide sequence coding for an enzymatic protein or at least one subunit thereof involved in the posttranslational modifications, such as hydroxylation, of said collagen proteins, in a host organism.

Description

U IVERSITA' DEGLI STUDI DI GENOVA
Method for the production of collagen proteins derived from marine sponges and an organism able to produce said proteins .
The present invention relates to a method for the production of collagen proteins derived from marine sponges and to an organism able to produce said proteins .
Collagen is an extracellular matrix protein present in all animals, from the simplest ones to humans , which have acquired a relevant commercial interest in the last two decades.
The patent application US 2010/0260823, for example, describes pharmaceutical preparations containing marine collagen processed and derived from sponges, preferably from Chondrosia reniformis.
In the natural world its biosynthetic process, performed by specialized cells , develops through different passages beginning with the transcription of the gene or genes encoding for the primary structure and following with the intervention of enzymes that modify it till it takes the active, mature structure.
Specifically, collagen originates as pre-pro- collagen, a product that, with respect to the collagen, has two pro-peptides , one at the N-terminus and C-terminus, which have a globular structure.
The pre-pro-collagen chain is subjected to the removal of the signal peptide, specific proline and lysine residues become hydroxylated to hydroxyproline and hydroxylysine . Three of such chains wrap themselves to form a triple helix structure stabilised by hydrogen bonds between hydroxylated aminoacids , generating the procollagen .
The following steps provide the helix glycosilation, extracellular secretion and the action of some pro-collagen peptidases that remove pro- peptides at N-terminus and at C-terminus, converting the pro-collagen into tropocollagen .
Tropocollagen is therefore the structural unit of collagen and it is a protein formed by three polypeptide chains with a anticlock-wise arrangement that associate with each other to form a clock-wise triple helix.
The three chains in the tropocollagen are held together by hydrogen bonds, bonds that are possible by the presence of glycine and by post-translational modifications of lysine and proline.
The main modifications in procollagen, in the maturation process of the collagen, therefore are the hydroxylation of prolines (one of the aminoacid characterizing this type of proteins) and glycosilation (addition of sugars) : these modifications are performed by specific enzymes present in the collagen-producing cell .
The prolyl-4-hydroxylase (P4H) is a key enzyme necessary for obtaining collagen from pro-collagen and, in mammalians, it is a tetramer with subunits α2β2.
Alpha subunits contain the catalytic sites involved in proline residue hydroxylation.
Beta subunits are identical to protein disulfide isomerase (PDI) and in this specific case they perform a structural function to maintain the alpha subunit as functional .
In the last years the industrial interest towards alternative sources for collagens and gelatines, different from the traditional ones, bovine or porcine, is increased, both for biosafety problems derived from the use of bioproducts of mammalian origin and for the well acquired awareness of the applicative potential of these biomaterials . This last aspect, in particular, has prompted the research on the evaluation of employ potentialities also of new molecular types of this family of proteins (extracted from a multitude of organisms) in addition to the already known ones .
In this context, the use of recombinant systems for the production in host organisms, such as yeasts and bacteria, of some types of human collagen and mussel collagen (mussel byssus) are known.
However, the expression of heterologous genes coding for collagen in recombinant systems is difficult, due to the fact that in order to obtain the formation of the collagen fibrils , it is necessary to provide a complex system managing the necessary post-translational modifications. In the known systems this complex molecular machinery is based on the transformation of the used organisms with enzymes of human origin.
The term "marine collagen proteins derived from sponges" means proteins with collagen structures produced from porifers , that is collagen precursors (pro-collagen) , collagen, polypeptides containing collagen sequences, fragments thereof or the like, usually different in their sequence and structure from collagens of more evolved animals (for example mussels or mammalians) .
Particularly, collagen from marine sponges is currently obtained only by extraction from the source organism, that is from sponges, with remarkable purification problems due to the frequent co-presence of other toxic components and with a strong environmental impact since the sponge subjected to the extraction process currently does not derive from farming sponge but from the natural environment.
The patent application US 2003/0032601 describes a method for collagen extraction from marine sponges .
It is known that collagens and collagen polypeptides of sponge origin display specific peculiarities compared both to those of mammalians and to those of other organisms even marine ones (such as the mytilus one described in EP1787995) , particularly the sponge collagen C. reniformis is particularly useful in cosmetic and pharmaceutical applications (for example for making protective capsules for oral drug administration) . In this specific case, the co-presence in the origin animal of considerable amounts of toxic compounds makes it difficult, long and expensive the method for extracting this specific collagen protein mixture having a high industrial interest from the origin biomass .
The present invention aims at:
producing collagen proteins derived from marine sponges, in a quick and low-cost manner;
obtaining large amounts of said collagen proteins derived from marine sponges avoiding a negative environmental impact (on the contrary this occurs for the traditional production methods that provide sponges to be collected from the environment) ,
- overcoming extraction problems set forth in the prior art and therefore allowing a substantially pure compound free from other components , also toxic ones , usually present in the source organism and easily contaminating the final product to be provided.
Therefore the object of the present invention is a method for the production of recombinant collagen proteins derived from marine sponges , which method provides the transformation of a selected host organism with expression vectors allowing:
- genetic information coding for at least one enzyme involved in the primary structure modification of the protein to be added to allow it to be properly organized or employed,
genetic information coding for the primary structure of the protein or proteins to be added.
Said method can provide also to add at least one coding sequence for a signal peptide allowing the extracellular secretion of the host organism of said collagen protein or proteins and/or at least one sequence coding for a tag peptide allowing the affinity purification.
The production method therefore provides the introduction and the expression in a host organism of at least one nucleotide sequence coding for one polypeptide chain of collagen protein of marine sponge and at least one nucleotide sequence coding for an enzyme or for at least one of its subunits, also derived from the marine sponge, which enzyme is involved in the post-translational modifications, such as hydroxylation , of the maturation process of marine sponge collagen.
Therefore, the method provides the expression of at least one gene involved in the marine sponge collagen protein production process in a host organism by using the recombinant technology. According to the method of the present invention said host organism consists of yeast eukaryotic cells transformed with expression vectors: the transformation with recombinant expression vectors containing the nucleotide sequences of at least one enzyme involved in the prolyl-hydroxylase activity of marine sponge allows to obtain strains able to express such functional polypeptide in the endoplasmic reticulum of the cell of the host organism.
This starting cell can be further transformed with one or more specific genes coding for marine sponge collagen proteins .
Advantageously, to obtain adequate yields of recombinant collagen proteins it is necessary to select cells with multiple collagen gene copies integrated in their genome .
Thus , the method of the present invention allows to obtain high amounts of marine sponge collagen proteins in a host organism that, without the transformation process, would not be able to produce said molecules or their precursors .
Advantageously, according to the present invention the host organism is a yeast (eukaryotic, unicellular) , that, with respect to bacteria (although they are easier to use) , allows the exploitation of a pre-existent enzymatic glycosilation machinery, however it being necessary to introduce the enzymes involved in the hydroxylation process to ensure the yeast to produce correctly structured marine sponge collagen proteins.
Object of the present invention is also an eukaryotic system for the recombinant expression of marine sponge collagen proteins wherein the cells express, as rtiR A and proteins, one or more genes coding for the collagen and one or more enzymes necessary for the post-translational modifications of said collagens .
According to the invention the yeast strain has been transformed with the genes of both alpha and beta subunits of marine sponge prolyl-4-hydroxylase enzyme .
In particular, the sponge is of the C. reniformis species .
The yeast strain has also been transformed with one specific gene coding for the nonfibrillar C. reniformis sponge pro-collagen, that is the ColCH gene (SEQ ID NO: 5) .
The transformed host organism used to produce recombinant collagen proteins according to the present invention is a Pichia pastoris yeast strain.
Specifically, as described below, P. pastoris strains of the PichiaPink™ Expression System kit have been used, but it is possible to use any yeast strains having similar characteristics in which the recombinant approach can be applied.
The P. pastoris strain of the PichiaPink™ Expression System kit is defective for the gene related to adenine biosynthesis .
The characteristics of the kit and of the strain are shown in its operative manual (Pichia Expression Kit Catalog no. K1710-01, Manual part no. 25-0043) .
The strain is neither toxic nor dangerous for humans and for the environment.
Said Pinchia pastoris yeast strain, transformed as described above identified with the reference name "Pichia pastoris ColCH4" has been stored in the Industrial Yeasts Collection DBVPG located in Borgo 20 Giugno 74 06121 Perugia, Italy, on April 5th, 2013, with reference 34P as requested by the Budapest Treaty .
According to the present invention, it is possible to provide the transformation of a yeast strain with other specific sequences coding for nonfibrillar and/or fibrillar sponge collagen proteins, particularly C. reniformis sponge, not known in the prior art, such as described in details below.
Advantageously, the yeast strain has been transformed through recombinant technology with a gene coding for a marine sponge collagen protein analogue to vertebrate type IV collagen, thus, the method, and the organism object of this invention, is also able to produce collagens with complex structure analogues to type IV collagens of higher organisms .
Transformed yeast cells are then cultured in order to allow recombinant protein expression and the extraction/purification of the recombinant bioproduct (marine sponge collagen protein) .
Object of the present invention is also a method of recombinant transformation of a yeast strain for at least one nucleotide sequence coding for at least a marine sponge collagen protein and at least one nucleotide sequence coding for an enzymatic protein or at least one subunit thereof involved in the modifications to said chain in the marine sponge collagen maturation process, to be expressed in the cells of said strain.
The method, object of the present invention, allows to transform the Pichia pastoris strain with vectors comprising specific DNA sequences . According to an embodiment of the present invention it is possible to transform the Pichia pastoris strain with three different vectors each one comprising a specific DNA sequence.
Obviously it is possible to use two different vectors each one comprising a specific DNA sequence.
The method therefore allows to introduce in the genome of the Pichia pastoris at least three different nucleotide sequences coding each one for a protein involved in the marine collagen maturation.
According to the invention, said method comprises the following steps:
identification of the nucleotide sequences coding for alpha and beta chains of the C. reniformis enzyme involved in the post-translational modifications of marine sponge collagen,
- preparation and use of at least one expression vector for the introduction of said sequences into the cells ,
- selection of the transformed organisms containing the integrated sequences in their genome .
According to the present invention new nucleotide sequences coding for C. reniformis marine sponge fibrillar and nonfibrillar collagen proteins have also been identified.
Said yeast transformation method for the production of C. reniformis recombinant marine sponge proteins is possible thanks to the identification of the marine sponge prolyl-4 -hydroxylase enzyme, isolated from the animal .
The method contemplates the co-transformation of the yeast strain with two different vectors one containing the coding sequence for the alpha subunit and the other containing the coding sequence of the beta subunit of the prolyl-4-hydroxylase enzyme, followed by the transformation with the expression vector containing at least one coding sequence for at least a marine sponge collagen protein.
Obviously, it is possible to use one single vector containing the coding sequences for both the subunits .
Preferably, between said two steps there is provided a step selecting the yeast strains showing an elevated prolyl-4-hydroxylase activity.
Object of the present invention is also at least one expression vector for the transformation of a host organism through recombinant technology.
Said vectors contain the coding sequences for the marine collagen polypeptide structure and/or for genes of the enzymes involved in the transformation process of said polypeptide chains.
According to a further embodiment of the present invention it is possible to provide said vectors to comprise also at least one sequence coding for a signal peptide for the extracellular secretion of the host organism of said marine sponge collagen protein and/or at least a sequence coding for a tag peptide allowing the affinity purification of said marine sponge collagen protein.
According to the invention the expression vectors have been produced which contain sequences coding for optimal signal peptides upstream the regions coding the proteins of interest.
Preferably, according to the invention, expression vectors have been produced which contain:
- the cDNA (SEQ ID NO: 1) coding for the alpha subunit of the prolyl-4-hydroxylase (pPinkHC\<x o pPinkLC\a vectors) , - the cDNA (SEQ ID NO: 3) coding for the beta subunit of the prolyl-4-hydroxylase (pPIC6B\PDI vector)
- the cDNA (SEQ ID NO: 5) coding for the C. reniformis nonfibrillar collagen protein
(pPICZB\ColCH) .
According to the present invention as an alternative to or in combination with the cDNA (SEQ ID NO: 5) coding for the C. reniformis nonfibrillar collagen protein (ColCH) it is possible to provide an expression vector comprising at least one of the following sequences :
- cDNA (SEQ ID NO: 7) coding for the C. reniformis nonfibrillar collagen protein,
- cDNA (SEQ ID NO: 9) coding for the C. reniformis nonfibrillar collagen protein
- cDNA (SEQ ID NO: 11) coding for the C. reniformis nonfibrillar collagen protein,
- cDNA (SEQ ID NO: 13 coding for the C. reniformis fibrillar collagen protein.
Particularly, in one embodiment of the present invention, in the expression vector containing the coding DNA sequence of the beta subunit of the prolyl-4-hydroxylase enzyme, the cloning site is preceded by the coding region for the S. cerevisiae Alpha Mating Factor (AM) .
It is possible to provide the use of other secretion factors in addition to the one mentioned above .
According to the present invention the enzymes responsible for the polypeptide chain hydroxylation during the sponge collagen biosynthetic process and their gene sequences have been characterized and with them a yeast has been transformed, particularly the C. reniformis prolyl-4-hydroxylase enzyme (alpha and beta subunits) has been characterized.
Said enzyme belongs to the type II prolyl- hydroxylase family .
The polypeptides of alpha and beta subunits of marine sponge C. reniformis prolyl-4-hydroxylase enzyme and the correspondent aminoacid sequences are unknown in the prior art.
According to the present invention also three nonfibrillar collagen proteins and one C. reniformis marine sponge fibrillar collagen protein have been characterized.
Particularly, the object of the invention are the nucleotide and aminoacid sequences coding for the alpha and beta subunits of the prolyl-4-hydroxylase enzyme (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively)
The genes (SEQ ID NO: 1 and SEQ ID NO : 3) coding for the enzyme with the prolyl-4-hydroxylase activity during the process of C. reniformis marine collagen production have been isolated from the organism and identified through the technical process (PCR) further described below.
An object of the present invention are also the nucleotide and aminoacid sequences coding for nonfibrillar collagens and for a C. reniformis sponge fibrillar collagen:
1) SEQ ID NO: 7 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
SEQ ID NO: 8 aminoacid sequence of the C. reniformis nonfibrillar collagen protein, 2) SEQ ID NO: 9 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
SEQ ID NO: 10 aminoacid sequence of the C. reniformis nonfibrillar collagen protein,
3) SEQ ID NO: 11 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
SEQ ID NO: 12 aminoacid sequence of the C. reniformis nonfibrillar collagen protein,
4) SEQ ID NO: 13 nucleotide sequence of the gene coding for the C. reniformis fibrillar collagen protein,
SEQ ID NO: 14 aminoacid sequence of the C. reniformis fibrillar collagen protein.
An object of the present invention are the yeast strains which express the nucleotide sequences coding for the alpha and beta subunits of the prolyl-4- hydroxylase enzyme of the sponge C. reniformis, which enzyme, having a prolyl-hydroxylase activity, is involved in the modifications to the primary polypeptide chain of the marine sponge collagen proteins and at least the nucleotide sequence coding for at least one of said C. reniformis sponge proteins .
In particular said yeast strains can express at least one of the following necleotide sequences: SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13.
The method and the organism transformed by the vectors object of the present invention allow therefore the large-scale production of sponge- derived extracellular matrix proteins , which proteins , in particular collagen and its derivatives , can be used in the biomedic, pharmaceutical and cosmetic fields .
The marine sponge collagen proteins are a biomaterial that can be used as an alternative to, or in combination with, mammalian collagen.
The recombinant method of production has numerous advantages :
- it allows a large-scale production avoiding an environmental damage since it does not use living animals (it is well known that sponges are animals very difficult to breed, thus the traditional methods for the production of collagen use animals not deriving from farming process with a considerable environmental impact) ,
- it avoids the problem of co-existence of secondary metabolites from natural bioproducts (standard traditional methods, based on sponge collagen extraction do not separate with a sufficient efficacy the secondary metabolites and this drawback can confer to the extracts a potent toxicity. This complicates the extraction process leading to expensive and long purification processes for the extracted material) ,
it allows to obtain a clean extracted biomaterial (that is without toxic contaminants and unrelated to collagen and its derivatives) , which is homogeneous and well characterized,
- it avoids the risk of toxic contaminants or allergens (commonly present in natural matrices and/or in bovine or porcine collagen) , thanks to the production of marine collagen in the yeast.
These and other characteristics and advantages of the present invention will be more clear from the following description of some embodiments shown in the annexed drawings , wherein :
Fig. 1 is the co-transformation strategy of the yeast strain, defective for the gene related to the synthesis of adenine, with the three vectors containing 1) the gene coding for the alpha subunit of P4H and the gene Ade+, 2) the gene for the synthesis of the PDI with the marker for the resistance to blasticidin and 3) the gene coding for the nonfibrillar collagen with the marker for resistance to zeocin, respectively. The co- transformed strains are easily selected in plates free from adenine and with blasticidin and zeocin antibiotic ;
Fig. 2 schematically is the three expression vectors and the relative selection marker;
Fig. 3a and 3b are the map of pPinkLC and pPinkHC vectors .
Fig. 4 is the map of <xpPIC6 vector;
Fig. 5 is the map of pPICZA vector;
Fig. 6 is the activity of recombinant P4H in the different P. pastoris strains analysed by the quantification of 1C02 produced from the decarboxylation of 2-oxo- [l-14 C] glutarate; the αβΙΗ strain incubated for 30 minutes in ice in the presence of a specific inhibitor of P4H, cumalic acid, was used as control;
Fig. 7 is a comparison of the activity of recombinant P4H in the two P. pastoris High copy and Low copy strains analysed by the quantification of 1C02 produced from the decarboxylation of 2-oxo- [l-14 C] glutarate; the αβΙΗ strain incubated for 30 minutes in ice in the presence of a specific inhibitor of P4H, cumalic acid, was used as control; Fig. 8 is a time course evaluation of recombinant P4H expression in the αβ21ι strain, ; the expression of P4H is analysed by the quantification of the enzymatic activity (1C02 produced from the decarboxylation of 2-oxo- [l-14 C] glutarate) ; the <x|31L strain incubated for 30 minutes in ice in the presence of a specific inhibitor of P4H, cumalic acid, was used as control;
Fig. 9 is the relative quantitative analysis of the gene copy number firmly inserted in the genome of various transformed yeast strains;
Fig. 10 is the relative mRNA expression of the three genes inserted in the P. pastoris strains, namely P4H, PDI and ColCH evaluated by quantitative PCR. The expression levels of the messengers were analysed at 24 hours after induction in the yeasts. TO represents the control sample composed of the ColCH4 strain extracted immediately after induction;
Fig. 11 is the SDS-Page analysis followed by Coomassie staining of the lysate (a) and of the concentrated and water-dialyzed culture medium (b) of the P. pastoris strains induced with methanol.
a) 50 g of proteins derived from total lysate of the <χβ2Ιι strain (A) and from ColCH4 strain (B) after 60 hour induction with methanol;
b) 30 g of proteins derived from the concentrated and dialyzed culture medium of the ColCH4 strain, un-induced (C) or induced for 60 hours with methanol (D) ; 15 ]ig of proteins derived from the dialyzed and concentrated culture medium from strain <χβ2Ιι (F) and ColCH4 (E) methanol-induced for 60 hours ;
Fig. 12 is the mass spectrometric MS2 identification of the triptic peptide GAVGPGGKPGPR (m/z 525,5 with double charge) derived from the recombinant pro-collagen.
Fig. 13a and 13b are the mass spectrometric identification MS of all triptic peptides derived from recombinant pro-collagen displaying one or more hydroxylated prolines ;
Fig. 14 is an example of the identification by fragmentation MS spectrum of a triptic double proline-hydroxylated peptide P [oxi] GPPGP [oxi] AGRDGR (m/z 583,3, double charge) .
According to the present invention the method for the production of recombinant collagen proteins from the marine sponge C. reniformis, and in particular of hydroxylated pro-collagen, is based on the use of an host organism represented by a genetically modified yeast strain.
The strategy for the production of said organism able to produce recombinant marine sponge proteins is based on the co-transformation of yeast strains with three different expression vectors containing respectively :
- the coding sequence of the alpha subunit of prolyl-4-hydroxylase (P4H) enzyme,
- the coding sequence of the beta subunit of the prolyl-4-hydroxylase enzyme (Protein disulfide
Isomerase, PDI) ,
the coding sequence of a nonfibrillar collagen .
The yeast strain used is the Pichia pastoris strain.
The method preferably contemplates the transformation of the strain with the vectors containing the coding sequences for the enzyme involved in the post-translational modification of the collagen protein followed by a further transformation of said strain (containing the genes coding for the alpha and beta subunits of prolyl-4- hydroxylase enzyme) with one or more genes coding for marine sponge collagen proteins .
According to the invention, the strain transformed with a specific expression vector, further described in the following, contains a gene coding for the C. reniformis sponge ColCH pro- collagen.
The nucleotide sequence of the gene (ColCH) coding for the nonfibrillar procollagen, as well as the aminoacid sequence of the nonfibrillar procollagen protein is accessible on GenBank database with the ID number DQ874470.
The ColCH gene coding for the nonfibrillar procollagen protein has the nucleotide sequence reported in SEQ ID NO: 5.
The ColCH protein has the aminoacid sequence reported in SEQ ID NO: 6.
Said Pinchia pastoris yeast strain, transformed as described above identified with the reference name "Pichia pastoris ColCH4" has been stored in the Industrial Yeasts Collection DBVPG located in Borgo 20 Giugno 74 06121 Perugia, Italy, on April 5th, 2013, with reference 34P as requested by the Budapest Treaty .
Object of the present invention are the coding sequence for the alpha subunit of the prolyl-4- hydroxylase (P4H) enzyme and the coding sequence for the beta subunit of said enzyme (Protein Disulfide Isomerase, PDI) still unknown in the prior art. Said sequences have been isolated, identified, inserted in plasmid vectors and cloned in E. coli strains. The gene coding for the alpha subunit of the prolyl-4-hydroxylase (P4H) enzymatic protein has the nucleotide sequence reported in SEQ ID NO : 1.
The alpha subunit of the prolyl-4-hydroxylase protein has the aminoacid sequence reported in SEQ ID NO: 2.
The gene coding for the protein disulfide isomerase (PDI) (beta subunit of the prolyl-4- hydroxylase enzyme) has the nucleotide sequence reported in SEQ ID NO: 3.
The protein disulfide isomerase (PDI) has the aminoacid sequence reported in SEQ ID NO : 4.
An object of the present invention are also the nucleotide and aminoacid sequences coding for C. reniformis nonfibrillar collagens :
1) SEQ ID NO: 7 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
SEQ ID NO: 8 aminoacid sequence of the C. reniformis nonfibrillar collagen protein,
2) SEQ ID NO: 9 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
SEQ ID NO: 10 aminoacid sequence of the C. reniformis nonfibrillar collagen protein,
3) SEQ ID NO: 11 nucleotide sequence of the gene coding for the C. reniformis nonfibrillar collagen protein,
SEQ ID NO: 12 aminoacid sequence of the C. reniformis nonfibrillar collagen protein,
and for a C. reniformis sponge fibrillar collagen : 4) SEQ ID NO: 13 nucleotide sequence of the gene coding for the C. reniformis fibrillar collagen protein,
SEQ ID NO: 14 aminoacid sequence of the C. reniformis fibrillar collagen protein.
According to an embodiment of the present invention as an alternative to or in combination with the cDNA (SEQ ID NO: 5) coding for the C. reniformis non fibrillar collagen protein ColCH it is possible the transformation host organism with expression vector comprising at least one of said sequences: cDNA SEQ ID NO: 7, cDNA SEQ ID NO: 9, cDNA SEQ ID NO: 11, cDNA SEQ ID NO: 13.
As shown in figure 1 for the production of the P. pastoris strains able to express and therefore produce recombinant proteins , the commercial kit PichiaPink™ Expression System (Life technologies) , has been used where the strains named Pichia Pink™ are defective of the gene related to adenine synthesis (ade2) ; the vectors of the kit (pPinkHC or pPinkLC) contain the ADE2 gene, allowing the transformed strain to grow in a medium lacking adenine .
This commercial strain is designed for the expression of a single recombinant polypeptide.
The present invention provides a modification of the yeast transformation method and it allows the integration of three different coding sequences, inserted in three different vectors, and their co- expression in the same system.
The kit vectors (pPinkHC or pPinkLC) containing the ADE2 gene have been used to host the coding sequence of the alpha subunit of the prolyl-4- hydroxylase enzyme (P4H) . The expression vector used for the insertion of the coding sequence of beta subunit (Protein disulfide isomerase, PDI) contains the resistance marker for blasticidin.
For the coding sequence of C. reniformis procollagen a vector pPICZ has been used which contains genes that give the resistance for the zeocin antibiotic.
Figure imgf000022_0001
After the transformation, the strains containing the three integrated coding sequences have been easily selected in plates with media lacking adenine and in the presence of both antibiotics .
Since the recombinant prolyl-4-hydroxylase enzyme has to perform its enzymatic activity inside the yeast cell, thus the presence of both alpha and beta subunits of the enzyme is necessary, the coding sequences of the alpha subunit of prolyl-4- hydroxylase enzyme (P4H) and of collagen (ColCH) were inserted in the expression vectors equipped with their own signal peptides , while in the coding sequence of the beta subunit of the enzyme (PDI) the signal peptide was replaced with the S. cerevisiae Alpha Mating factor (AM) signal peptide using a version of the pPIC6 vector, wherein the MCS region (the multiple cloning site) is preceded by the coding sequence of this specific signal peptide (<x|3PIC) .
Identification and cloning of C. reniformis prolyl-4-hydroxylase alpha and beta subunit coding sequences
The complete coding sequences of C. reniformis alpha and beta subunits of prolyl-4-hydroxylase enzyme (P4H and PDI) were identified using a PCR approach.
In both cases the most conserved regions of P4H and PDI coding regions were identified in A. queenslandica sponge; then, a set of sense primers were designed within the most conserved regions, while as antisense primer an oligonucleotide (5'- GTACTAGTCGACGCGTGGCC-3' ) able to match specifically at the 3' -end of the cDNA sequences, retro- transcribed with an oligo-dT-adapter, was synthesized (5' -GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTT -3' ) .
To complete the 5' end region, the GeneRacer™
Kit (Life technologies) was used, according to the manufacturer' s protocol .
Once the entire cDNA nucleotide sequence was completed, a last high fidelity amplification reaction was performed, using a couple of primers both recognizing two cDNA external regions , thereafter 1 μΐ of PCR product was ligated in the pCR®II plasmid and cloned in E. coli strains.
The C. reniformis p4H and PDI cDNA sequences, currently unknown at the state of the art, were analysed through the "National Centre for Biotechnology Information" BLAST algorithm
(http : //blast . ncbi . nlm. nih . gov/Blast . cgi) . The deduced amino acid sequences were analysed using SignalP 3.9 server
(http://www.cbs.dtu.dk/services/SignalP/) to identify the presence of signal peptides .
For what concern the aminoacid sequence of P4H, the SignalP 3.9 server analysis revealed the possible presence of a signal peptide in position 1-28 with a cleavage site between Gly 27 and Glu 28. The presence of a Pfam P4Ha_N domain (alpha subunit of P4H, N- terminal region) between aa 32 and aa 163 indicates that the protein is a member of prolyl-4-hydroxylase superfamily. Between the residues 332 and 517 a P4Hc domain is present (homologue to alpha subunit of prolyl-4-hydroxylase) , inside said domain another domain can be identified, namely the 20G-Fell_Oxy (residues 412-517) belonging to members of the (20G) - dependent iron-dioxygenase 2-oxoglutatarate superfamily. Another C-terminal domain in the alpha subunit of P4H, involved in the catalytic activity, is also recognized as a region belonging to the iron- dioxygenase 2-oxoglutatarate superfamily. Furthermore, in correspondence to the aminoacid sequence 157-160, in position 157 (Asp) a possible N-glycosilation site is identified, while no O- glycosilation sites are recognizable inside the sequence. Finally, between residues 302 and 304 the His-His-Lys catalytic triad forming the covalent bond between the carboxylic group and the C5 of 2- oxoglutarate is present.
The putative translational product of P4Hac has an estimated molecular weight of 61.9 kDa and an isoelectric point of 6.31.
For what concern the aminoacid sequence deduced from the PDI gene, the Signal P 3.9 server analysis reveals the presence of a signal peptide in position 1-16 with a cut site between the Gly 16 and Ala 17. BLAST and SMART sequence analyses show the presence of four different TRX domains (thioredoxin-like coil) : 1) PDIa, TRX redox active domain at the N- terminal between aa 30 and 127; 2) PDIb, TRX-like redox inactive domain between aa 135 and 230; 3) PDIb' , TRX-like redox inactive domain between aa 242 and 345; 4) PDIa_PDIa'C with an active TRX region at the C-terminal in position 366-466. Neither N- nor O- glycosilation sites can be identified inside the sequence. Both the two TRX active redox domains (PDIa and PDIa_PDIa'C) host a -Cys-Gly-His-Cys motif, representing two catalytic sites acting independently in the PDI .
The putative translational product of the PDI gene has an estimated molecular weight of 58.8 kDa and an isoelctric point of 4.34.
Expression vector preparation Preparation of the expression vectors comprising the coding sequence of the alpha subunit of prolyl-4-
Figure imgf000025_0001
The cDNA coding for the alpha subunit of C. reniformis prolyl-4-hydroxylase , going from the yeast consensus sequence for the beginning of translation to the stop codon, and flanked by an EcoRI site in 5' and a Kpnl site in 3' , was PCR-amplified and ligated into the pPinkHC (high copy) or pPinkLC (low copy) vectors in correspondence to the MCS cloning region (Fig. 3b and a) (Life Technologies ™) . Vectors were previously linearised with the two EcoRI and Kpnl enzymes. This strategy allowed to obtain pPinkHC\<x and pPinkLC\a. Specifically, in order to include the yeast translation consensus sequence (Kozak sequence, gaaacg) at the beginning of the translation site a two step PCR reaction was performed.
With this technique also the correct restriction sites for the directional cloning in the expression vector were inserted.
A first PCR was performed using as primer sense FwalfaRO and as antisense RewalfaT:
• name: FwalfaRO
sequence : 5 '-gaaacgatgcagttggtattagggatgagt-3' position : 1-24
SEQ ID NO: 15.
• name: RewalfaT
sequence : 5 ' -cgcaaagtggtatgacaatga-3 '
position: 1642-1663
SEQ ID NO: 16
• name: FwalfaRl
sequence : 5 ' -aattGAATTCgaaacgatgcagttggtatt-3 ' position: 1 - 14
SEQ ID NO: 17
• name: RewalfaRl
sequence : 5' -aattGGTACCcgcaaagtggtatgacaatg-3 ' position: 1642-1662
SEQ ID NO: 18
(double underline used to identify the Kozac sequence, capital letters are for the restriction sites , single underscore indicates initial and final codons in the ORF) .
The amplification was performed as reported in the following table :
Figure imgf000026_0001
10x High Fidelity PCR Buffer 2.5 lx
0.2
10 itiM dNTP mix 0.5
mM
50mM MgS0 1 2 mM
0.2
10 uM FwalfaRO 0.5
uM
0.2
10 uM RewalfaT 0.5
uM pCR®II /P4H (40 ng/μΐ)
1.6 plasmid prepared as in sect. 1
ng/μΐ 6.5.1.
Platinum® Tag High Fidelity 1.0
0.1
(Life Technologies™) units sterile H20 18.9 -
Total Volume 25 -
The thermal profile was as following: 2 min initial denaturation at 94 °C followed by 20 cycles at 95°C for 30 s, 60°C for 30 s and 68°C for 1.5 min, at the end of the cycles a final step of 7 min at 68 °C was performed.
A 1:100 fold dilution of the first PCR product was used for a nested-PCR with Fwalfal as primer sense and Rewalfal as antisense primer. The thermal profile was as follows: 2 min initial denaturation at 94°C followed by 28 cycles at 95° C for 30 s, 62°C for 30 s and 68° C for 1.5 min, at the end of the cycles a final step of 7 min at 68°C was performed.
Eight identical amplification reactions were pooled and purified through the commercial kit High Pure PCR Product Purification Kit (Roche) following the manufacturer's instructions.
The purified amplified product and the pPinkLC or pPinkHC vectors were then digested with EcoRI and Kpnl and finally ligated with the following reagent concentration :
Figure imgf000028_0002
The reaction was performed at 16°C for 18 hours. 1 μΐ of the recombinant product obtained was cloned in E. coli TOP 10 One Shot chemically competent cells (Life technologies ™) . Positive colonies were identified by PCR. Recombinant pPinkLC\a and pPinkHC\<x vectors were extracted from 200 ml of transformed E. coli suspensions through the Nucleobond Xtra midi commercial kit (Macherey-Nagel) . Vectors were then linearised with Spel (also known as Bcul) restriction enzyme.
Preparation of the expression vector containing the prolyl-4-hydroxylase enzyme beta subunit (Protein
Figure imgf000028_0001
The cDNA of the beta subunit of C. reniformis prolyl-4-hydroxylase (PDI) , going from the first amino acid codon (Alal7) , after the signal peptide cleavage site, to the stop codon and flanked by
Pmll restriction site in the 5' -end and Notl in the 3' -end, was synthesized by PCR using FwPDIr as sense and RewPDIr as antisense primers :
• name: FwPDIr sequence: 5' -aattCACGTGgcagacgatatccctgaaga-3' position: 49 - 69
SEQ ID NO: 19
name: RewPDIr
sequence : aattGCGGCCGCctaaagttcaatcttttt-3' position: 1579-1597
SEQ ID NO: 20
(restriction sites are evidenced in capital letters while the STOP codon is underlined)
The cDNA was finally ligated into the MCS of the <xpPIC6B vector (Life TechnologiesTM) (Fig. 4) , previously linearised with Pmll and Notl , obtaining the recombinant construct <xpPIC6B\PDI .
The amplification reaction was performed in the following conditions :
Figure imgf000029_0001
The thermal profile was as follows : 2 min initial denaturation at 94 °C, followed by 32 cycles at 95° C for 30 s, 58°C for 30 s and 68° C for 2 min, at the end of the cycles a final step of 7 min at 68 °C was performed.
Eight identical amplification reactions were pooled and purified through the commercial kit High Pure PCR Product Purification Kit (Roche) following the manufacturer's instructions.
The purified PCR product and the <xpPIC6B vector, were then digested with Pmll for two hours at 37 °C.
At the end of the reaction the second Notl digestion was performed.
The cDNA and vector were then ligated in the following conditions :
Figure imgf000030_0001
The reaction was performed at 16°C for 18 hours. 1 μΐ of the recombinant product obtained with the ligation was cloned in E. coli TOP 10 One Shot chemically competent cells (Life technologies, USA) by standard procedure with the difference in the antibiotic used, in this case blasticidin at 100 μg/ml, and an LB culture medium with half concentration of NaCl . Positive colonies were identified by PCR. Recombinant <xpPIC6B\PDI vector was extracted from 200 ml of transformed E. coli suspension through the Nucleobond Xtra midi commercial kit (Macherey-Nagel) and linearised with the Sacl restriction enzyme in the following conditions :
Figure imgf000031_0001
Preparation of the expression vector containing the C. reniformis nonfibrillar procollagen coding sequence: pPICZA\ColCH The C. reniformis nonfibrillar procollagen cDNA
(GenBank n° DQ874470 shown in SEQ ID NO: 5) going from the translation consensus sequence to the stop codon flanked by 5' -end Pmll and 3' -end Notl restriction sites, respectively, was amplified through PCR and ligated into the MCS region of the pPICZA vector (Life Technologies™) (Fig. 5) , previously linearised with Pmll and Notl, obtaining the recombinant construct pPICZA\ColCH .
Also in this case, to introduce the yeast translation consensus sequence just before the first methionine (kozac sequence, gaaacg) a two step PCR was performed.
A first amplification was performed with FwColRO as sense primer and RewColRT as antisense:
· name: FwColRO sequence : 3 '-GAAACGatggagaagaccagttctaaagtg-5' position: 1 - 24
SEQ ID NO: 21
name : FwColR
sequence: 3' -AATTCACGTGGAAACGatggagaagaccag-5' position: 1 - 14
SEQ ID NO: 22
name : RewColR
sequence: 5' -AATT GCGGCCGC ttactttgtgcacactgc-3' position: 2215-2292
SEQ ID NO: 23
(the kozac sequence is underlined and evidenced in capital letters, the restriction sites are double underlined and in capital letters too, the initial and final codons of the ORF are simply underlined) .
The reaction was performed in the following conditions :
Figure imgf000032_0001
sterile H20 18.9 -
Total Volume 25 -
The following thermal profile was used: 2 min of initial denaturation at 94 °C, 15 cycles at 94° C for 30 s, 63.7°C for 30 s and 68° C for 2.5 min, at the end of the cycles a final step of 7 min at 68 °C was performed.
1 μΐ of the PCR product was again amplified using FwColRl as sense primer and RewColR as antisense primer. The thermal profile was: 2 min of initial denaturation at 94 °C, 28 cycles at 95° C for 30 s, 62 °C for 30 s and 68° C for 2.5 min, at the end of the cycles a final step of 10 min at 68 °C was performed.
Eight identical amplification reactions were pooled and purified through the commercial kit High Pure PCR Product Purification Kit (Roche) following the manufacturer's instructions.
The purified PCR product and the pPICZA vector, were then digested with Pmll followed by NotI .
At the end of the reaction insert and vector were ligated in the following conditions :
Figure imgf000033_0001
The reaction was performed at 16°C for 18 hours. 1 μΐ of the recombinant product obtained with the ligation was cloned in E. coli TOP 10 One Shot chemically competent cells (Life technologiesTM, USA) by standard procedure with the difference in the antibiotic used, in this case zeocin at 100 g/ml, and an LB culture medium with half concentration of NaCl.
Positive colonies were identified by PCR. Recombinant pPICZA\ColCH vector was extracted from 200 ml of transformed E. coli suspension through the Nucleobond Xtra midi commercial kit (Macherey-Nagel) and linearised with Pmel restriction enzyme.
Transformation and selection of P. pastoris strains with prolyl-hydroxylase activity
Four different P. pastoris strains provided in the PichiaPink™ Expression System kit (Life Technologies™) with the genotypes indicated below, were made chemically competent using the EasyCompTM kit (Life Technologies™) , following the manufacturer's instruction.
Figure imgf000034_0001
The four competent strains were then co- transformed as described in the PichiaPink™ Expression System kit (Life Technologies™) , with 5 ]ig of linearised pPinkHC/a or pPinkLC/a and with 5 ]ig of linearised <xpPIC6B/PDI . In this case, since <xpPIC6B/PDI vector selection marker is an antibiotic resistance, after the thermal shock cells were incubated for two hours at 30 °C in the presence of YPD, to allow the expression of the resistance gene.
Then cells were plated on PAD/agar selective plates without adenine and additioned with blasticidin 0.3 mg\ml . Overall, eight recombinant yeast strains expressing the alpha subunit of prolyl- 4-hydroxylase and the protein disulfide isomerase (PDI) with the Alpha Mating factor of S. cerevisiae, were obtained and are reported below. A negative control was also prepared using a Pichia pinkl strain transfected with 5 ]ig of pPinkHC and of <xpPIC6B empty vectors .
Figure imgf000035_0001
pPinkLCa
Pichia pinK adenine/ αβ3Ι, /apPIC6B P4H/amPDI
3 blasticidin
PDI
pPinkLCa
Pichia pinK adenine/
<χβ4Ι< /apPIC6B P4H/amPDI
4 blasticidin
PDI
nega Pichia pinK pPinkHC/ adenine/ nothing
tive 1 apPIC6BI blasticidin a C. reniformis prolyl-4-hydroxylase alpha subunit b C. reniformis prolyl-4-hydroxylase beta subunit (PDI) which signal peptide has been replaced with the S. cerevisiae Alpha Mating (AM) .
The insertion of the expression constructs into the P. pastoris genome was confirmed at least on five colonies of each recombinant strain, through traditional PCR and following the procedure reported in the PichiaPink™ Expression System kit manual (page 70) (Life Technologies™) .
Instead of the universal primers provided in the kit, a specific set of primers was used for this specific analysis .
The universal primers, in fact, have been designed to match the flanking regions of the cloning site that is identical in the two vectors : thus , the two genes integrated in the yeast genome would compete for the same couple of primers .
To overcome this problem two set of oligonucleotides were used in which the sense primer would match in a region of the vector while the antisense in a region of the insert, being this way gene-specific .
Also the sense primers are different for P4H and PDI even if complementary to the vector, because the vector used for PDI also contains the coding region of S. cerevisiae Alpha Mating Factor (AM) and this is the region where the sense primer has been designed to match, to confirm the integration of the construct <xpPIC6BPD\PDI into the yeast genome.
The primer sequences used to confirm by PCR the integration of the recombinant constructs in the yeast genome are as follows:
FwOxi: 5' -GACTGGTTCCAATTGACAAGC-3' SEQ ID NO: 24 RewP4H: 5' -CCAAAGCCACAGCAGACATA-3' SEQ ID NO: 25 FwAM: 5' -CTATTGCCAGCATTGCTGC-3' SEQ ID NO: 26
RewPDI: 5' TCACAATGTCCTCTGCTTGC-3' SEQ ID NO: 27
P. pastoris strain culture and recombinant expression induction
Yeast cells were grown in liquid culture.
Recombinant protein expression was obtained in yeast cell suspensions grown in a buffered 1% glycerol complex medium (BMGY, pH 6.0) followed by culture in a buffered minimal methanol medium (BMMY, pH 6.0), for 60 hours at 30°C for the induction of expression.
During recombinant protein expression, performed at 28°C and 250 rpm shacking, 0.5% methanol and 80 g/ml ascorbic acid were added every twelve hours.
Analysis of the recombinant proteins produced The production of recombinant proteins was evaluated by P4H enzymatic activity analysis in yeast cell lysates .
Initially the activity was tested in the αβΗΙ, <χβΗ2, <χβΗ3 and <χβΗ4.
After 60 hour induction in BMMY medium, yeast cells were harvested by sedimentation at 1.500 x g for ten min, at room temperature, washed once with BMMY and suspended in ice-cold lysis buffer containing 0.1 M NaCl, 0.1 M glycine, 0.05% Triton X- 100, 10 uM dithiothreitol (DTT) , 1:100 diluted yeast protease inhibitor cocktail (P8465 Sigma-Aldrich Corp., St. Louis, MO, USA), 10 itiM Tris buffer, pH 7.8.
Cells were then lysed with a Potter homogenizer following cell disruption under an optic microscope (Olympus CKX41) .
The lysate was then centrifuged at 15,000 χ g for 15 min at 4°C to obtain the cytosolic and microsomal fraction.
The supernatant was collected and conserved in ice until the enzymatic activity assay of P4H was performed as described in the method by Kivirikko and Myllila, based on the hydroxylation-coupled decarboxylation of 2-oxo- [1-1C] glutarate on the cell lysate with some modifications .
The yeast protein extract was introduced in a chamber of a sealed glass vessel especially designed for radioactive CO2 capture and quantification, while in another chamber of the vessel, connected to the first through a channel allowing air exchange between the two , 0.2 ml of 2 M NaOH were introduced to capture radioactive 1C02 released by yeast lysate. The solution was then additioned with 0.5 Ci of 2- oxo-[l-14C] glutarate (final specific activity: 10 mCi/mmol) , the vessel was tightly sealed and incubated at 37 °C for 2 hours in the presence of the Kivirikko reaction mixture containing 50 itiM FeS04, 50mM Tris-HCl pH 7.8, 0.1 itiM DTT, 2 itiM ascorbic acid, 30 itiM (Pro-Pro-Gly) io peptide, 2 mg/ml bovine serum albumin (BSA) and 600 U catalase.
In order to quantify the background due to mitochondrial alpha-ketoglutarate dehydrogenase contamination, an enzyme with similar enzymatic activity catalyzing the decarboxylation of 2-oxo- [1- 1 C] glutarate with the formation of 1C02, a control sample was carried out in presence of cumalic acid, a specific inhibitor of the P4H enzyme. Each reaction mixture containing 120 ]ig total protein, was pre- incubated for 30 minutes in ice in presence or absence of 8 inM cumalic acid before performing the enzymatic assay.
The reaction mixture was then incubated at 37 °C for 30 minutes .
At the end of the incubation the NaOH solution containing the captured 1 C02 was withdrawn and used for scintillation counting in a Beckman Beta-Counter Liquid Scintillator.
Through this experiment strain 2 was identified as the best performing, as shown in Fig. 6.
Once evidenced which strain possessed the highest enzymatic activity, a comparison between the high copy and the low copy pPink vector transformed strains was made (as shown in Fig. 7) . Finally a time-course of induction time was performed measuring the prolyl-4-hydroxylase activity in yeast cell lysate at different times of protein expression induction (as shown in Fig. 8) .
Αβ2Ιι strain transformation with vector pPICZa/ColCH
The previously identified αβ21ι P. pastoris strain was made chemically competent using Pichia EasyComp TM Kit (Life technologies™) following the kit instructions.
Subsequently, the competent strain was transformed using 10 ]ig of linearized pPICZA/ColCH recombinant expression vector. Since pPICZA/ColCH vector selection marker is an antibiotic resistance, after thermal shock cells were incubated for two hours at 30 °C in the presence of YPD, to allow the expression of the resistance gene. Then cells were plated on PAD/agar selective plates without adenine and additioned with blasticidin 0.3 mg\ml and zeocin 0.1 mg/ml.
The successful insertion of the expression cassette in the yeast genome was verified by PCR screening of eight random colonies as described on PichiaPink Expression System manual (Life TechnologiesTM) , using the following oligonucleotides :
FwCs: 5'- AATTCACGTGGAAACGATGGAG-3' (SEQ ID NO: 28) and RewCs : 5'- TCCTTTCGCACCTAATCCTG-3' (SEQ ID NO: 29) .
In this case the first oligonucleotide matches the fusion region between the vector and the insert, while the second recognizes a region inside the vector .
Furthermore, in order to select the potentially most efficient strain, the relative amount of copies of all inserted genes was quantified by qPCR (Fig. 9) ·
The genomic DNA was extracted from the various strains following the instructions reported at page 70 of the instruction manual of PichiaPinkTM Expression System kit, 20 times diluted and amplified in a final volume of 20 μΐ, in the following conditions :
Figure imgf000040_0001
nuclease-free sterile
5.2 - H20
10 uM of sense and
0.8 800 nM antisense primers
2X master mix iQ
10 1 x
SIBReGreen (Bio-Rad)
cDNA or negative control 4 -
Total Volume 20
The thermal profile was as follows : 3 minutes at 95°C, and 45 cycles of 15 s at 95°C, 30 s at 60°C, fluorescence quantification; melting curve from 58 °C to 95°C, fluorescence reading every 0.5°C. Each reaction was performed in triplicate .
The qPCR experiments were performed on a Chromo 4 instrument (MJ Research; UK) , coupled to the DNA Engine Opticon ® 3 Real-Time Detection System Software (version 3.03).
To analyze results the Gene Expression Analysis of the iCycler iQ Real Time Detection System (Bio- Rad) was used.
β-actin gene was used for sample normalization. Gene copy quantity was expressed as amount relative to the sample with the lowest gene quantity.
ColCH strains culture and induction of expression of recombinant collagen
Yeast cells derived from positive colony number 4 (ColCH4 strain) were cultured in liquid medium.
Induction of the recombinant polypeptide expression was performed in the yeast cell suspension grown in a buffered 1% glycerol complex medium (BMGY, pH 6.0) followed by culture in a buffered minimal methanol medium (BMMY, pH 6.0), for the induction of expression.
During recombinant protein expression, performed at 28°C and 250 rpm shacking, 0.5% methanol and 80 g/ml ascorbic acid were added every twelve hours.
qPCR transcripts quantification
The mRNA levels of the three genes inserted in the ColCH4 strain and induced with methanol were assayed by quantitative real-time PCR (qPCR) .
Total yeast RNA was extracted from 5xl07 cells before the methanol induction of gene expression and 24 hours after, using RNeasy mini kit (Qiagen) .
The yeast cells were mechanically lysed with 600 μΐ of nitric acid-washed glass beads (0.45-0.55 mm diameter) .
Cells were thoroughly shacked in a TissueLyser® (Qiagen) for 5 minutes at 30 Hz frequency, the proportion between beads and lysate volume being 1:1.
Lysate was then centrifuged at 10,000 x g for 2 minutes at 4°C.
Total RNA extraction was performed on the supernatant following the manufacturer's protocol, comprising the DNAse I digestion phase (27 Kunits) .
Yeast cDNA was synthesized using Iscript cDNA synthesis kit according to the manufacturer' s instruction in a final volume of 20 μΐ, with 1 ]ig of purified total yeast RNA, the proper reaction buffer, 2.5 uM random examers , 0.5 inM dNTP mix, 5 inM DTT, 40 U ribonuclease inhibitor RNAseOUT (Life Technologies™) and 15 U of Super ScriptlllTM (Life Technologies™) .
The reaction was performed at 25°C for 10 minutes and then at 50°C for 50 minutes. To remove cDNA complementary RNA 2 U of E. coli RNase H (Life Technologies™) were added and the mixture incubated for 20 min at 37 °C.
Quantitative PCR was performed using a 1:5 dilution of synthetized cDNA and performed as already reported in the section relative to αβ21ι strain transformation with pPICZa/ColCH vector.
Analysis of P4H, PDI and collagen mRNAs at 24 hour methanol-induction in ColCH4 strain indicates that all the three genes are 100,000 times more expressed than at time 0 induction (figure 10) .
Identification of other C. reniformis marine sponge collagen sequences
C. reniformis transcriptome analysis was performed on the corresponding cDNA through 454 pyrosequencing technique. After the assembling of 665,421 reads, 19,678 transcripts were obtained belonging to 13,900 isogroups . Through bioinformatics analyses, using both the MIRA and NEWBLER software, a series of C. reniformis new collagen sequences were identified. Specifically, the nucleotide sequences shown in SEQ ID NO: 7, 9, 11, 13, and corresponding to the aminoacid sequences shown in SEQ ID NO: 8, 10, 12, 14 were identified as peculiar sponge collagens homologous to the C. reniformis ColCH gene (SEQ ID NO: 5) . In particular, the nucleotide sequences shown in SEQ ID NO: 7, 9, 11 belong to the marine sponge nonfibrillar short chain collagen family while the nucleotide sequence shown in SEQ ID NO: 13 belongs to the marine sponge fibrillar collagen family.
Analysis of recombinant collagen production in ColCH4 strain Cells and culture media derived from the strain ColCH4 after 60 hours of induction in BMMY media were harvested.
Cells were centrifuged for 10 min at 1500 x g, at room temperature, washed once in BMMY medium and suspended in 5% glycerol, 1 inM EDTA, 50 inM sodium phosphate buffer pH 7.4 and 1:100 diluted yeast protease inhibitor cocktail (P8465 Sigma-Aldrich Corp., St. Louis, MO, USA).
Cells were lysed by vigorously shacking using a tissue lyser (Qiagen) at 30 Hz for 8 minutes with acid-washed glass beads (0.5 mm diameter) added according to a ratio of 1:1 (beads volume: yeast cell lysate volume). The lysate was centrifuged at 10,000 x g for 30 min at 4°C, and the supernatant was recovered.
The culture medium was centrifuged for 20 minutes, at 20,000 x g, at 4°C, ten-fold concentrated using Amicon concentrating tubes (Millipore) with 50 kDa molecular cut off and dialyzed against distilled water, in order to change solvent from culture medium to distilled water.
Cell lysate, as well as concentrated and dialyzed culture media, were analyzed by SDS-Page Sodium Dodecyl Sulphate - PolyAcrylamide Gel Electrophoresis . The presence of proteins on the gels was revealed with standard Coomassie Blue staining (Figure 11) .
The band corresponding to the theoretical expected molecular weight of collagen was excised from the acrylamide gel and was digested as described in Shervenko et al (Shervenko et al . Analytical Chemistry 1996, 68, 850-858) . After digestion, triptic peptides obtained from the gel extraction, were dried using a centrifugal evaporator (Speed Vac) .
The dried pellets were suspended in eluent A containing 0.1% v/v formic acid (FOA) in H20.
Reversed-phase separation of digested samples was carried out on an Agilent 1100 series system (HPLC system) , consisting of a capillary chromatograph equipped with a diode array detector (Agilent, Palo Alto, CA, USA) using an Agilent Zorbax RP Ci8 column (150x1 mm ID; particle size, 5 um) at a micro flow rate of 40 μΐ/min.
The gradient applied was as follows: from start to 5 minutes the eluent B (0.051% v/v FOA in acetonitrile) was maintained at 10%; then the eluent B was linearly brought up to 95% in 65 minutes ; and maintained at those A and B percentages for further 10 minutes.
Through direct coupling, the eluent from HPLC separation was directly introduced in a mass spectrometer equipped with an electrospray source with orthogonal geometry and an ion trap analyzer (Agilent 1100 series LC/MSD ion trap XCT instrument) . With this technique the peptides eluted during chromatographic separation were directly analysed allowing the determination of single m/z correspondent values (MS spectra) .
In case of particularly intense signals fragmentation spectra were also obtained (MS/MS) , mainly referred to double charged ions (MS2 spectra) .
The collection of MS and MS/MS spectra allowed to perform database search (Mascot-Matrixscience) . All the MS and MS/MS analyses were performed ion positive ion mode and confirmed through manual de- novo sequence .
As an explicative example the MS2 fragmentation spectrum of the double charged peptide with m/z 525.5, whose GAVGPGGKPGPR sequence corresponds to the expected nucleotide sequence for marine sponge procollagen ggtgctgttggaccaggtggtaaaccaggaccacgg, is reported in Fig. 12.
Recombinant collagen hydroxylation identification by nano-LC/Q-TOF MS and MS/MS analysis To confirm the specific enzymatic activity of P4H recombinant yeast strain on the recombinant procollagen polypeptide introduced in said strain, a further and more sophisticated MS analysis was performed to identify prolyl-hydroxylated procollagen specific peptides in the triple transformed yeast strain (<x|32L) .
For MS analysis, spots of interest were cut from the gel and destained, reducted, alkylated and digested with trypsin as described by Shervenko et al. (Shervenko et al . Analytical Chemistry 1996, 68, 850-858) .
Nano-HPLC MS and MS/MS experiments were performed on a Q-TOF mass spectrometer TripleTOF® 5600+ (AB Sciex, Concord, Ontario Canada) controlled by the Analyst QS 1.6 software (AB Sciex) . The mass spectrometer was coupled to a splitless Ultra 2D Plus HPLC system with a cHiPLC Nanoflex (Eksigent, Dublin, CA) , managed by the above mentioned software. The dried peptide pellets were suspended immediately before analysis in 10pL of HPLC eluent A (95% v/v water, 5%v/v acetonitrile , 0.1%v/v formic acid). 5 μΐ of each sample were loaded onto the pre-column (Eksigent C18, 200 um i.d.x 0.5 mm, 3 um beads, 120A) and washed with solvent A for 10 min using a flow rate of 2 μΐ/min.
The peptides were subsequently eluted from the pre-column over the analytical column (Eksigent C18 PepMaplOO, 150 mmx75um, , 3um beads, 120 A) at a flow rate of 350 nl/min. Analytical separation was established by maintaining 2% eluent B (acetonitrile , 0.1%v/v formic acid) for 5 min. In the following 2 min, 10% eluent B was attained and a linear gradient to 40% eluent B occurred in 60 min. Following the peptide elution, gradient was increased to 90% B and maintained for 10 min.
The analytical column was connected with a 15um inner diameter Silica Tip (Pico Tip) nanospray emitter (New Objective, Woburn, MA) . A spray voltage of 2.2 kV was applied to the emitter. The MS was operated with a RP of 30,000FWHM for TOF-MS scans. For IDA, survey scans were acquired in 250 ms and as many as 8, 20, or 50 product ion scans were collected if exceeding a threshold of 125 counts per second (counts/s) and with a +2 to +5 charge-state . A sweeping collision energy setting of 35 ± 15 eV was applied to all precursor ions for collision-induced dissociation. Dynamic exclusion was set for ½ of peak width (~8 s) , and then the precursor was refreshed off of the exclusion list. Mass spectra were acquired from 100 to 1200m/z.
MS Data analysis
Protein Pilot Software v. 4.5 (AB SCIEX, Foster City, CA) was used to create peak lists from MS and MS/MS raw data. The database employed was C. Reniformis SwissProt database with the trypsin sequence and common keratin contaminants included, and this allowed the opportunity to employ the target-decoy database search strategy. In the software algorithm, all modifications listed in UniMod are searched simultaneously (http://www.unimod.org/) and the tolerances used were ±0.09 Da for peptides and ±0.05 Da for MS/MS fragments, respectively. The false discovery rate (FDR) analysis was also done using the integrated tools in ProteinPilot .
This last MS technique analysis allowed to finally confirm the 33.6% aminoacid sequence with a confidence higher than 95%, the 16.5% with a confidence between 50 and 95% and the remaining 46.9% of the aminoacid sequence with a confidence below 50% of recombinant procollagen polypeptide produced by the triple transformed yeast strain through the relative identification of its specific peptides in the yeast lysate. Furthermore, and more important, the LC/Q-TOF technique allowed the punctual identification of a number of μ-hydroxylated recombinant procollagen specific peptides shown in Fig. 13a and 13b. This result unequivocally indicates the ability of the transformed yeast strain (<χβ2Ιι) to perform prolyl-hydroxylation on collagen polypeptides introduced by recombinant approach.
Finally, as an explicative example the MS fragmentation spectrum of the double charged recombinant procollagen peptide with m/z 583.3, whose P [oxi] GPPGP [oxi] AGRDGR sequence presents two hydroxylated prolines is reported in Fig. 14.
The method for production of recombinant collagen proteins derived from marine sponge and a yeast able to produce said proteins allows to obtain a biomaterial with high purity, and to facilitate and make cheaper the production of collagen compaunds best characterized and homogeneous than the collagen extracts obtained from sponges using traditional methods .
Furthermore, the use of a P. pastoris transformed strain avoids the risk of toxic contaminants , commonly present in natural matrices , for human health and the environment.
Biological material deposit
The P. pastoris microorganism, identified by reference Pichia pastoris ColCH4 , modified and selected as above reported, has been stored at the Industrial Yeasts Collection DBVPG, Borgo 20 Giugno 74 06121 Perugia, Italy the 5th of April 2013 with assigned number of 34P, as requested by the Budapest Treaty .
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule Ubis)
The indications made below relate to the deposited microorganism or other biological material referred to in the description on nase 7 . line 31
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet
Name of depositary institution
Collezione dei Lieviti Industriali DBVPG (Industrial Yeasts Collection DBVPG)
Address of depositary institution (including postal code and country)
Borgo 20 Giugno 74
06121 Perugia
Italy
Date of deposit Accession Number
05/04/13 34P
ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet identification reference given by the depositor: Pichia pastoris ColCH4
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature qf the indications e.g.. "Accession Number of Deposit")
For receiving Office use onlv For International Bureau use onlv
I I This sheet was received with the international application This sheet was received the International Bureau on:
Authorized officer Authorized officer
Form PCT/RO/134 (July 1998; reprint January 2004) 1 /1
PCT
Print Out (Original in Electronic Form)
(This sheet is not part of and does not count as a sheet of the international application)
Figure imgf000051_0001
Indications are Made All designations
FOR RECEIVING OFFICE USE ONLY
0-4 This form was received with the
international application: yes
(yes or no)
0-4-1 Authorized officer
Van Kerckhoven, Use
FOR INTERNATIONAL BUREAU USE ONLY
0-5 This form was received by the
international Bureau on:
0-5-1 Authorized officer

Claims

1. A method for the production of recombinant marine sponge collagen proteins , characterized in that it comprises introduction and expression of at least one nucleotide sequence coding for a polypeptide chain of marine sponge collagen protein, so called pro-collagen, and at least one nucleotide sequence coding for an enzymatic protein or at least one subunit thereof involved in the post- translational modifications, such as hydroxylation, of said chain during the maturation process of marine collagen, in a host organism.
2. A method as claimed in claim 1 , characterized in that said host organism consists of eukaryotic yeast cells and the introduction of nucleotide sequences in its genome occurs using at least one expression vector comprising a nucleotide sequence coding for at least one enzyme, or at least one subunit thereof, which is involved in the hydroxylation of the polypeptide chain of said marine sponge collagen protein.
3. A method as claimed in claim 2 , characterized in that the nucleotide sequence shown in SEQ ID NO: 1 coding for the alpha subunit of prolyl-4-hydroxylase (P4H) enzyme from marine sponge, and the nucleotide sequence shown in SEQ ID NO: 3 coding for the beta subunit of prolyl-4-hydroxylase enzyme from marine sponge (PDI) are introduced and expressed in the recombinant host organism.
4. A method as claimed in claim 1 or 2 , characterized in that at least one nucleotide sequence coding for at least one collagen protein of C.reniformis is introduced and expressed, using at least one expression vector, in the recombinant host
-50- organism.
5. A method as claimed in one or more of the preceding claims, characterized in that said host organism consists of eukaryotic yeast cells transformed, using expression vectors, with the nucleotide sequences coding for the alpha and beta subunits of the prolyl-4-hydroxylase enzyme from the sponge C. reniformis and at least the nucleotide sequence coding for at least one C. reniformis collagen protein.
6. A method as claimed in one or more of the preceding claims , characterized in that said vectors comprise at least one coding sequence for a signal peptide for the extracellular secretion of the host organism of said at least one marine sponge collagen protein and/or at least one coding sequence for a tag peptide allowing affinity purification of said marine sponge collagen protein.
7. A method as claimed in one or more of the preceding claims characterized in that said host organism consists of eukaryotic Pichia pastoris yeast cells .
8. A method as claimed in one or more of the preceding claims , characterized in that the expression vector comprises at least the nucleotide sequence shown in SEQ ID NO: 5 coding for the C. reniformis sponge nonfibrillar collagen protein.
9. A method as claimed in one or more of the preceding claims , characterized in that the expression vector comprises at lest the nucleotide sequence shown in SEQ ID NO: 7 coding for the C. reniformis sponge nonfibrillar collagen protein.
10. A method as claimed in one or more of the preceding claims , characterized in that the
- 51 - expression vector comprises at least the nucleotide sequence shown in SEQ ID NO: 9 coding for the C. reniformis sponge nonfibrillar pro-collagen.
11. A method as claimed in one or more of the preceding claims , characterized in that the expression vector comprises at least the nucleotide sequence shown in SEQ ID NO: 11 coding for the C. reniformis sponge nonfibrillar collagen protein.
12. A method as claimed in one or more of the preceding claims , characterized in that the expression vector comprises at least the nucleotide sequence shown in SEQ ID NO: 13 coding for the C. reniformis sponge fibrillar collagen protein.
13. A method as claimed in one or more of the preceding claims 1 to 8 characterized in that said host organism consists of eukaryotic cells of the Pichia pastoris yeast strain deposited with no. 34P on 05.04.2013 at the Industrial Yeasts Collection DBVPF as "Pichia pastoris ColCH4".
14. A method as claimed in one or more of the preceding claims , characterized in that the expression of recombinant proteins occurs in suspensions of yeast cells that were first cultured in minimal medium with 1% glycerol and then transferred into minimal medium (BMMY, pH 6,0) with methanol, to initiate expression induction, with methanol and ascorbic acid being added, during the expression, under stirring at a temperature from 20 to 30°C.
15. A method as claimed in one or more of the preceding claims , characterized in that it comprises the step of selecting the eukaryotic yeast cells, transformed by at least one expression vector, having multiple integrated copies of nucleotide sequences
-52- coding for marine sponge collagen proteins .
16. A method as claimed in one or more of the preceding claims , characterized in that it comprises the steps of isolating said recombinant marine sponge collagen protein/s from the transformed host cell, by preparation of a cell lysate and a concentrated and dialyzed culture medium.
17. A method of recombinant transformation of a yeast strain for at least one nucleotide sequence coding for at least a marine sponge collagen protein and at least one nucleotide sequence coding for an enzymatic protein or at least one subunit thereof involved in the modifications to said chain in the marine sponge collagen formation process, to be expressed in the cells of said strain, characterized in that said method comprises the steps of:
- identifying the nucleotide sequences coding the alpha and beta subunits of the enzyme having a prolyl-hydroxylase activity, involved in the modifications to said chain
- preparing and using at least one expression vector for introducing said sequences into the cells ,
- selecting the transformed organisms containing said integrated sequences in their genome.
18. A transformation method as claimed in claim
17, characterized in that it comprises a co- transformation step that uses a first expression vector comprising the nucleotide sequence coding for the alpha subunit of prolyl-4-hydroxylase (P4H) enzyme, and a second expression vector comprising the nucleotide sequence coding for the beta subunit of prolyl-4-hydroxylase (PDI) enzyme from the sponge C. reniformis.
19. A transformation method as claimed in claim
- 53 - 18, characterized in that said first vector contains the nucleotide sequence shown in SEQ ID NO:l and said second vector contains the nucleotide sequence shown in SEQ ID NO: 3.
20. A transformation method as claimed in claim 17, 18 or 19, characterized in that it comprises a transformation step that uses an expression vector comprising at lest a nucleotide sequence coding for at least one C. reniformis sponge collagen protein.
21. A transformation method as claimed in one or more of the preceding claims 17 to 20, characterized in that the co-transformation step using the vectors with the sequences for the alpha and beta subunits of the prolyl-4-hydroxylase enzyme precedes the transformation step using the vector with the nucleotide sequence coding for at least one sponge collagen protein, a step of selecting the yeast strains with high prolyl-hydroxylase activity being interposed between said two steps.
22. A transformation method as claimed in one or more of the preceding claims from 17 to 21, characterized in that it involves the transformation of a Pichia pastoris yeast strain.
23. A transformation method as claimed in one or more of the preceding claims 17 to 22, characterized in that the expression vector comprising the sequence for the beta subunit of the prolyl-4-hydroxylase enzyme (PDI) has its cloning site preceded by the region coding for the Alpha Mating Factor (AM) of S. cerevisiae .
24. A transformation method as claimed in one or more of the preceding claims 17 to 23, characterized in that a single expression vector is provided, which comprises the nucleotide sequence coding for the
-54- alpha subunit of prolyl 4-hydroxylase (P4H) enzyme, and the nucleotide sequence coding for the beta subunit of prolyl-4-hydroxylase (PDI) enzyme from the sponge C. reniformis.
25. A transformation method as claimed in one or more of the preceding claims 17 to 24, characterized in that said vectors comprise at least one coding sequence for a signal peptide for the extracellular secretion of the host organism of said at least one marine sponge collagen protein and/or at least one coding sequence for a tag peptide allowing affinity purification of said marine sponge collagen protein.
26. An expression vector for transforming a host organism for recombinant production of marine sponge collagen proteins , characterized in that it comprises the nucleic acid sequence of SEQ ID NO: 1, coding for the alpha subunit of the prolyl-4-hydroxylase enzyme (P4H) of the sponge C. reniformis, which enzyme, having a prolyl-hydroxylase activity, is involved in the post-translational modifications of the polypeptide chain of the marine sponge collagen protein called as pro-collagen, in the collagen maturation process.
27. An expression vector for transforming a host organism for recombinant production of marine sponge collagen proteins , characterized in that it comprises the nucleic acid sequence of SEQ ID NO: 3, coding for the beta subunit of the prolyl-4-hydroxylase enzyme (PDI) of the sponge C. reniformis, which enzyme, in the post-translational modifications of the polypeptide chain of the marine sponge collagen protein called as pro-collagen, in said collagen maturation process.
28. An expression vector as claimed in claims 26
- 55 - and 27, characterized in that it comprises both nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 3.
29. An expression vector as claimed in claim 27, characterized in that the cloning site is preceded by the region coding for the Alpha Mating Factor (AM) of S. cerevisiae.
30. An expression vector for transforming a host organism for recombinant production of marine sponge collagen proteins , characterized in that it comprises the nucleic acid sequence of SEQ ID NO: 5 and/or the nucleic acid sequence of SEQ ID NO: 7 and/or SEQ ID NO: 9 and/or SEQ ID NO: 11 each one coding for a C. reniformis sponge nonfibrillar collagen protein and/or the nucleic acid sequence of SEQ ID NO: 13 coding for a C. reniformis sponge fibrillar collagen protein .
31. An expression vector as claimed in one or more of the preceding claims 26 to 30, characterized in that said vectors comprise at least one coding sequence for a signal peptide for the extracellular secretion of the host organism of said at least one marine sponge collagen protein and/or at least one coding sequence for a tag peptide allowing affinity purification of said marine sponge collagen protein.
32. A recombinant yeast strain for producing marine sponge collagen proteins , characterized in that it expresses therein at least one nucleotide sequence coding for a primary polypeptide chain of a marine sponge collagen protein, and at least one nucleotide sequence coding for an enzymatic protein or at least one subunit thereof involved in the modifications to said chain in the marine collagen maturation process.
- 56 -
33. A yeast strain as claimed in claim 32, characterized in that it belongs to the species Pichia pastoris.
34. A yeast strain as claimed in claim 32 or 33, characterized in that said strain expresses the nucleotide sequences coding for the alpha and beta subunits of the prolyl-4-hydroxylase enzyme of the sponge C. reniformis, which enzyme, having a prolyl- hydroxylase activity, is involved in the modifications to the primary polypeptide chain of the marine sponge collagen proteins and at least the nucleotide sequence coding for at least one of said C. reniformis sponge proteins.
35. A Pichia pastoris yeast strain, characterized in that it is the strain deposited with no. 34P, on 05.04.2013, at the Industrial Yeast Collection DBVPG as Pichia pastoris ColCH4".
36. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 1 and coding for the alpha subunit of the prolyl-4-hydroxylase enzyme (P4H) involved in the hydroxylation of the polypeptide chain of marine sponge collagen protein.
37. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 3 and coding for the beta subunit of the prolyl-4-hydroxylase enzyme (PDI) involved in the hydroxylation of the polypeptide chain of marine sponge collagen protein.
38. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 7 and coding for a C. reniformis sponge nonfibrillar collagen protein .
39. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 9 and coding for a C. reniformis sponge nonfibrillar collagen
-57- protein .
40. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 11 and coding for a C. reniformis sponge nonfibrillar collagen protein .
41. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 13 and coding for a C. reniformis sponge fibrillar collagen protein .
42. A prolyl-4-hydroxylase enzyme involved in the hydroxylation of the polypeptide chain of the marine sponge collagen protein whose alpha and beta subunits have an amino acid sequence as shown in SEQ ID NO: 2 and SEQ ID NO: 4 respectively, said alpha subunit being characterized by a molecular weight of 61,9 kDa and an isoelectric point of 6,31, and said beta subunit being characterized by a molecular weight of 58,8 kDa and an isoelectric point of 4,34.
- 58 -
PCT/EP2014/057966 2013-04-18 2014-04-17 Method for the production of collagen proteins derived from marine sponges and an organism able to produce said proteins WO2014170460A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ITGE2013A000040 2013-04-18
IT000040A ITGE20130040A1 (en) 2013-04-18 2013-04-18 METHOD FOR THE PRODUCTION OF RECOMBINANT MARINE COLLAGEN AND ORGANISM ABLE TO PRODUCE THE SEA COLLAGEN

Publications (2)

Publication Number Publication Date
WO2014170460A2 true WO2014170460A2 (en) 2014-10-23
WO2014170460A3 WO2014170460A3 (en) 2014-12-31

Family

ID=48628770

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/057966 WO2014170460A2 (en) 2013-04-18 2014-04-17 Method for the production of collagen proteins derived from marine sponges and an organism able to produce said proteins

Country Status (2)

Country Link
IT (1) ITGE20130040A1 (en)
WO (1) WO2014170460A2 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018014453A1 (en) * 2016-07-22 2018-01-25 江苏江山聚源生物技术有限公司 Fermentation technique to improve production level of recombinant human collagen
RU2658428C1 (en) * 2017-10-03 2018-06-21 Общество с ограниченной ответственностью "Медсервис" Agent for treatment of human body states related to p4ha1 gene reduced expression and/or reduced quantity of prolyl 4-hydroxylase alpha 1 protein on basis of gene-therapeutic substances with p4ha1 gene, method of manufacture and operation
US20190002893A1 (en) * 2017-06-29 2019-01-03 Modern Meadow, Inc. Yeast strains and methods for producing collagen
CN111334512A (en) * 2019-12-06 2020-06-26 肽源（广州）生物科技有限公司 Recombinant human-like collagen containing hydroxyproline and hydroxylysine and production method thereof
CN116333096A (en) * 2023-03-12 2023-06-27 广东瀚润生物科技有限公司 Application of recombinant human three-type collagen, injection and medical cosmetic product
WO2023221787A1 (en) * 2022-05-19 2023-11-23 华北制药集团新药研究开发有限责任公司 Pichia pastoris engineering strain for recombinant type i collagen, construction method therefor and use thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030032601A1 (en) * 2000-03-03 2003-02-13 Jorg Kreuter Method for isolating sponge collagen and producing nanoparticulate collagen, and the use thereof
EP1787995A1 (en) * 2005-11-17 2007-05-23 Technische Universität München Recombinant mussel byssus protein

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030032601A1 (en) * 2000-03-03 2003-02-13 Jorg Kreuter Method for isolating sponge collagen and producing nanoparticulate collagen, and the use thereof
EP1787995A1 (en) * 2005-11-17 2007-05-23 Technische Universität München Recombinant mussel byssus protein

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] 6 August 2008 (2008-08-06), "Chondrosia reniformis nonfibrillar collagen mRNA, complete cds.", XP002715173, retrieved from EBI accession no. EM_STD:DQ874470 Database accession no. DQ874470 *
MARINA POZZOLINI ET AL: "Molecular Characterization of a Nonfibrillar Collagen from the Marine SpongeNardo 1847 and Positive Effects of Soluble Silicates on Its Expression", MARINE BIOTECHNOLOGY, SPRINGER-VERLAG, NE, vol. 14, no. 3, 10 November 2011 (2011-11-10), pages 281-293, XP035039502, ISSN: 1436-2236, DOI: 10.1007/S10126-011-9415-2 *
SWATSCHEK D ET AL: "Marine sponge collagen: isolation, characterization and effects on the skin parameters surface-pH, moisture and sebum", EUROPEAN JOURNAL OF PHARMACEUTICS AND BIOPHARMACEUTICS, ELSEVIER SCIENCE PUBLISHERS B.V., AMSTERDAM, NL, vol. 53, no. 1, 1 January 2002 (2002-01-01), pages 107-113, XP004331337, ISSN: 0939-6411, DOI: 10.1016/S0939-6411(01)00192-8 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018014453A1 (en) * 2016-07-22 2018-01-25 江苏江山聚源生物技术有限公司 Fermentation technique to improve production level of recombinant human collagen
US11136373B2 (en) 2016-07-22 2021-10-05 Jiangsu Jland Biotech Co., Ltd. Fermentation process for increasing production level of recombinant human collagen
US20190002893A1 (en) * 2017-06-29 2019-01-03 Modern Meadow, Inc. Yeast strains and methods for producing collagen
US11312968B2 (en) * 2017-06-29 2022-04-26 Modern Meadow, Inc. Yeast strains and methods for producing collagen
RU2658428C1 (en) * 2017-10-03 2018-06-21 Общество с ограниченной ответственностью "Медсервис" Agent for treatment of human body states related to p4ha1 gene reduced expression and/or reduced quantity of prolyl 4-hydroxylase alpha 1 protein on basis of gene-therapeutic substances with p4ha1 gene, method of manufacture and operation
RU2658428C9 (en) * 2017-10-03 2018-10-03 Общество с ограниченной ответственностью "Медсервис" Agent for treatment of human body states related to p4ha1 gene reduced expression and/or reduced quantity of prolyl 4-hydroxylase alpha 1 protein on basis of gene-therapeutic substances with p4ha1 gene, method of manufacture and operation
CN111334512A (en) * 2019-12-06 2020-06-26 肽源（广州）生物科技有限公司 Recombinant human-like collagen containing hydroxyproline and hydroxylysine and production method thereof
CN111334512B (en) * 2019-12-06 2023-10-13 肽源（广州）生物科技有限公司 Recombinant human-like collagen containing hydroxyproline and hydroxylysine and production method thereof
WO2023221787A1 (en) * 2022-05-19 2023-11-23 华北制药集团新药研究开发有限责任公司 Pichia pastoris engineering strain for recombinant type i collagen, construction method therefor and use thereof
CN116333096A (en) * 2023-03-12 2023-06-27 广东瀚润生物科技有限公司 Application of recombinant human three-type collagen, injection and medical cosmetic product
CN116333096B (en) * 2023-03-12 2023-10-24 百世美生物技术(浙江)有限公司 Application of recombinant human three-type collagen, injection and medical cosmetic product

Also Published As

Publication number Publication date
WO2014170460A3 (en) 2014-12-31
ITGE20130040A1 (en) 2014-10-19

Similar Documents

Publication Publication Date Title
WO2014170460A2 (en) Method for the production of collagen proteins derived from marine sponges and an organism able to produce said proteins
US20060166319A1 (en) Charging tRNA with pyrrolysine
WO2018094110A2 (en) Systems and methods for identifying and expressing gene clusters
Zhou et al. Soybean transcription factor Gm MYBZ2 represses catharanthine biosynthesis in hairy roots of Catharanthus roseus
KR102350425B1 (en) Methods of using o-methyltransferase for biosynthetic production of pterostilbene
CN111088254B (en) Endogenous carried exogenous gene efficient controllable expression system
CN113621593A (en) Polyketide synthases EnPKS1 and EnPKS2 from coca, genes and uses thereof
WO2009139365A1 (en) Process for production of cis-4-hydroxy-l-proline
CN114032222B (en) Sugar chain extension glycosyltransferase mutant and coding gene thereof, genetic engineering bacteria and application of sugar chain extension glycosyltransferase mutant and coding gene
CN115873836A (en) Nerolidol synthetase and application thereof
CN109486849B (en) CPR and CYP9A12 double-gene co-expression recombinant vector and preparation method and application thereof
DE60215881T2 (en) Method for expanding the chemical composition of proteins produced in vivo using mutant aminoacyl-tRNA synthetases without correction function
CN111471659A (en) Polypeptide with catalytic activity of removing epoxy group, and coding nucleic acid and application thereof
US10472688B2 (en) Compositions and methods for producing podophyllotoxin derivatives
US20230407287A1 (en) Method for preparing multisubunit scf e3 ligase with fusion protein through in vitro reconstitution, and use of multisubunit scf e3 ligase
KR101781259B1 (en) A method for production of gypenoside LXXV using ginsenoside glycosidase
CN114606212B (en) Coumarin synthase from clematis terniflora, gene, vector and application thereof
EP4119507A1 (en) Use of flavonoid glycoside substance and glycosyltransferase gene therefor in regulating resistance of plant to weeds
WO2024120148A1 (en) Novel diterpene synthase and use thereof
JP6804467B2 (en) Recombinant nucleoside-specific ribonuclease and its production and usage
CN118165968A (en) Novel diterpene synthetase and application thereof
CN114717248A (en) Curculigo orchiol synthase gene CoORS1 and application thereof in preparing orchiol
CN117737023A (en) Ergothioneine synthetase derived from Pleurotus ostreatus, and encoding gene and application thereof
CN117512027A (en) ScEgt1 gene derived from schizophyllum commune and application of coded protein thereof in synthesis of ergothioneine
Karbalaei-Heidari et al. Genomically integrated orthogonal translation in Escherichia coli, a new synthetic auxotrophic chassis with altered genetic code, genetic firewall, and enhanced protein expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14718965

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 14718965

Country of ref document: EP

Kind code of ref document: A2