RU2662944C1 - Agent for treating human body conditions associated with a decrease in the level of expression of the prok 1 gene and/or a decrease in the amount of prokineticin 1 protein on the basis of gene-therapeutic substances with prok 1 gene, method for obtaining and using - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, specifically to therapeutic genetic engineering agents, and can be used to correct the pathological human conditions associated with a decrease in the expression of the PROK 1 gene and/or a decrease in the amount of prokineticin 1 protein. Agent comprises a gene therapeutic substance selected from the group of vector plasmids comprising the cDNA of the PROK 1 gene with the prokineticin 1 protein coding sequence with deletions of 5' and 3'-non-translated regions, obtained on from the site of the native unmodified cDNA of the PROK 1 gene or the modified cDNA of the PROK 1 gene.EFFECT: invention provides a high level of expression of the PROK 1 gene in eukaryotic cells, thereby increasing the amount of prokineticin 1 protein in human cells and/or tissues, in particular in fibroblasts, in endotheliocytes of testicles, adrenals, ovaries and placenta, in vagina, cervix, appendages of uterus, brain regions, cerebellum and pituitary gland.5 cl, 20 dwg, 18 ex

Description

FIELD OF THE INVENTION

The invention relates to molecular biology, biotechnology, gene and medicine, and can be used to correct the pathological conditions of cells of various organs and tissues, as well as human organs and tissues proper, associated with a decrease in the level of expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein, in particular for therapeutic purposes.

Prior level

Angiogenesis is divided into two stages: vasculogenesis and actually angiogenesis. At the same time, vasculogenesis is the process of the formation of blood vessels de novo from mesodermal progenitor cells, while angiogenesis is the development of new vessels from the vessels that formed during vasculogenesis. Angiogenesis begins with the secretion of a soluble angiogenic factor acting on a nearby blood vessel and leading to changes in the capillary wall in the form of degradation of the basement membrane, mitotic division of endotheliocytes, their subsequent migration to the stroma and proteolytic degradation of the extracellular matrix. The next stage is the organization of vascular endotheliocytes into a tubular structure and the initialization of blood flow in a newly formed area.

Angiogenesis is not characteristic of intact tissues of an adult's body under physiological conditions and is activated by pathological tissue growth in tumors, an acute or chronic inflammatory process, and diabetic retinopathy. The endometrium and ovarian tissue are a unique exception to this rule, since the processes of cyclic angiogenesis in them occur monthly.

The process of angiogenesis plays an important role in the development and normal growth of tissues, wound healing, the reproductive cycle in women (development of the placenta and corpus luteum, ovulation), and is involved in the pathogenesis of various diseases. The main mediators of angiogenesis are: fibroblast growth factor, platelet growth factor, vascular endothelial growth factor (VEGF), transforming growth factor beta. The inducing effect of other factors is known: placental growth factor, interleukin-8, hepatocyte growth factor, colony-stimulating granulocyte growth factor. The action of angiogenesis inducers is directed to endothelial cells, as well as to vascular smooth muscle cells and fibroblasts. The regulation of neovascularization is a dynamic process of the subtle interaction of inhibitors and activators of angiogenesis.

A growth factor secreted by endocrine gland cells called prokineticin 1 (PROK 1). In its structure, it is close to the VEGF family and therefore was originally called the vascular endothelial growth factor isolated from endocrine glands (EG-VEGF). This molecule caused proliferation, migration, and the formation of membrane breaks in the endothelial cells of capillaries derived from endocrine glands. Moreover, prokineticin 1 had practically no effect on other types of tested endothelial and non-endothelial cells. Like VEGF, prokineticin 1 has a HIF-1 binding site, and its expression is induced by hypoxia. Both factors led to extensive angiogenesis and cyst formation during their delivery to the ovary. However, unlike VEGF, prokineticin 1 was able to stimulate angiogenesis in the cornea or skeletal muscle. Prokineticin 1 (EG-VEGF) is an example of a class of highly specialized mitogens that act to regulate tissue-specific proliferation and differentiation of vascular endothelium.

Protein Bv8, which is designated as prokineticin 2 (PROK 2) and is a closely related secreted protein with EG-VEGF (PROK 1). Bv8 has been shown to induce proliferation, survival, and migration of adrenal cortical endothelial cells (LeCouter, J. et al, Proc Natl Acad Sci USA 100, 2685-2690 (2003)). If PROK 1 (EG-VEGF) is expressed primarily in the endocrine glands and genitals, then PROK 2 (Bv8) is associated mainly with the nervous system.

The prokineticin signaling system is represented by two ligand / receptor pairs - the PROK1 / PROKR1 pair, whose scope is limited to the gastrointestinal tract (here the products of these genes are involved in triggering the action of motilin, a polypeptide hormone that regulates the motility of the stomach and intestines).

Expression of PROK1 was detected in the cells of the testes, adrenal glands, ovaries and placenta, and its effects are limited to endotheliocytes of these organs. Expression is also found in the vagina, cervix, uterine appendages, brain, cerebellum, pituitary gland, cerebral cortex, spinal cord, prostate gland, heart, mammary glands, spleen, skeletal muscle tissue, bladder, gall bladder, leg skin, suprapubic skin, cornea, mucous membrane of the cervical canal, subcutaneous fat, visceral adipose tissue (http://www.proteinatlas.org/ENSG00000143125-PROK1/tissue).

Patent RU 2559542 describes a coding nucleic acid; expression vector based on it to obtain antibodies to Bv8 (PROK 2); a host cell for expressing a vector-based antibody; and a method for producing an antibody using a cell. Disclosed is a pharmaceutical composition using an antibody in an effective amount, as well as the use of an antibody to treat a tumor, cancer, or cell proliferation disorder. The use of antibodies is proposed to reduce or inhibit angiogenesis in a subject, as well as to inhibit proliferation of endothelial cells. The use of the invention provides new antibodies with an affinity for human Bv8 or macaque (K _D ) less than 10 ^-11 M, as measured by the BIACORE 3000 method, which can be used in the treatment of various cancers.

WO2004081229 describes an invention that provides methods for using the Bv8 polypeptides (PROK 2) and EG-VEGF (PROK 1) and the corresponding nucleic acids to facilitate the blood formation process. In addition, it contains modulator screening methods for Bv8 and EG-VEGF activity. In addition, the application provides methods of treatment using Bv8 and EG-VEGF polypeptides or their antagonists.

For the prototype, the authors made a decision on the application WO 2003/020892, which describes methods of using the Bv8 polypeptide (PROK 2) to induce proliferation of endothelial cells and increase the survival of endothelial cells. Also contains screening methods for modulators for Bv8 activity. In addition, the application provides methods of treatment using the Bv8 polypeptide. In one embodiment of the invention, the method comprises contacting the cell with Bv8 in an amount effective to induce cell proliferation. The method may further include contacting the cells with VEGF. In another embodiment of the present invention, the method comprises introducing a nucleic acid encoding Bv8 into cells in an amount effective to induce cell proliferation.

The disadvantage of this approach is the high cost of obtaining pure protein, its more frequent administration during therapy (which increases the cost of therapy and increases the risk of side effects) and the complexity of the intracellular delivery of the drug, as well as the fact that when creating a gene-therapeutic agent in this invention are not taken into account patient characteristics, in connection with which a group of variations for this agent may be needed.

Disclosure of invention

The objective of the invention is to provide a highly effective tool for the treatment of human body conditions associated with a decrease in the level of expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein, based on gene therapeutic substances with the PROK 1 gene.

This problem is solved due to the fact that a tool has been created for treating the conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein, based on gene-therapeutic substances with the PROK 1 gene, which is at least one gene therapeutic substance selected from the group of gene therapeutic substances, each of which represents a genetic construct based on a vector plasmid comprising the cDNA of the PROK 1 gene with the coding sequence without prokineticin 1, with deletions of 5 'and 3'-untranslated regions, namely, obtained on the basis of a portion of native unmodified cDNA of the PROK 1 gene SEQ ID No: 1, or modified cDNA of the PROK 1 gene, while as a modified cDNA of the PROK 1 gene using SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each which also contains regulatory elements that provide a high level of expression of the PROK 1 gene in eukaryotic cells, in particular in cells of human organs and tissues, and capable of increasing the amount of prokineticin 1 protein in the cells of organs and tissues and / or human organs and tissues, in particular in fibroblasts, in the endothelial cells of the testes, adrenal glands, ovaries and placenta, in the vagina, cervix, uterine appendages, brain regions, cerebellum, pituitary gland , cerebral cortex, spinal cord, prostate, heart, mammary glands, spleen, skeletal muscle tissue, bladder, gall bladder, foot skin, suprapubic skin, cornea, mucous membrane of the cervical canal, subcutaneous fat, visceral adipose tissue in combination with or without a transport molecule when these gene-therapeutic substances are introduced into human organs and tissues. Moreover, each genetic construct with a modified cDNA of the PROK 1 gene contains a nucleotide sequence that includes the protein coding region of the cDNA of the PROK 1 gene, which carries modifications that do not affect the structure of the prokineticin 1 protein, namely, nucleotide substitutions that do not lead to amino acid substitutions or breakage of the amino acid chain, or a combination of the above modifications and that do not affect the amino acid sequence encoded by this sequence.

Liposomes, or dendrimers of the 5th and higher generations, or amphiphilic block copolymers are used as a transport molecule.

A method of obtaining a means for treating the conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein is to obtain each gene therapeutic substance from the group of created gene therapeutic substances, whereby the cDNA of the PROK 1 gene is obtained, then placed cDNA into a vector plasmid capable of providing a high level of expression of this cDNA in cells of various organs and tissues of a person increases and secrete the required amount of genetic construct , then the genetic construct is combined with a transport molecule to transfect the obtained gene therapeutic substance of cells of organs and tissues and / or introduce the obtained gene therapeutic substance into human organs and tissues, using cDNA of the PROK 1 gene with the prokineticin 1 protein coding sequence, with deletions 5 'and 3'-untranslated regions, namely, obtained on the basis of a portion of the native unmodified cDNA of the PROK 1 SEQ ID No: 1 gene or modified cDNA of the PROK 1 gene, while as a modified cDN To the PROK 1 gene, either SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination these genetic constructs.

A method of using an agent for treating conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein is to transfect a gene therapeutic substance selected from the group of created gene therapeutic substances of cells of the patient’s organs and tissues and / or introducing into the patient’s organs and tissues autologous cells of the patient transfected with a gene-therapeutic substance selected from the group of created gene-therapeutic substances, and / or and into the organs and tissues of the patient of a gene-therapeutic substance or several substances selected / selected from the group of created gene-therapeutic substances, or a combination of the indicated methods.

Description of figures

In FIG. 1 shows the nucleotide sequence of unmodified cDNA of the PROK 1 gene with a length of 318 bp SEQ ID No: 1, which has a high homology with that given in the GenBank database under the number NM_032414. and encodes a prokineticin 1 protein (GenBank NP_115790.1).

In FIG. Figure 2 shows the nucleotide sequence of the modified cDNA of the PROK 1 gene, SEQ ID No: 2, which contains 1 nucleotide substitution G → C at position 66 and 1 nucleotide substitution A → G at position 69, which do not lead to changes in the amino acid sequence of prokineticin protein 1.

In FIG. 3 shows the nucleotide sequence of the modified cDNA of the PROK 1 gene, SEQ ID No: 3, which

contains 1 nucleotide substitution G → C at position 66, two nucleotide substitutions A → G at position 69, 90, which do not lead to changes in the amino acid sequence of prokineticin protein 1.

In FIG. 4 shows the nucleotide sequence of the modified cDNA of the PROK 1 gene, SEQ ID No: 4, which

contains 1 nucleotide substitution G → C at position 66, 3 nucleotide substitutions A → G at positions 69, 90, 93, which do not lead to changes in the amino acid sequence of prokineticin protein 1.

In FIG. 5 shows the nucleotide sequence of the modified cDNA of the PROK 1 gene, SEQ ID NO: 5, which

contains 1 nucleotide substitution G → C at position 66, 4 nucleotide substitutions A → G at positions 69, 90, 93, 186, which do not lead to changes in the amino acid sequence of the prokineticin protein 1.

In FIG. 6 shows the nucleotide sequence of the modified cDNA of the PROK 1 gene, SEQ ID NO: 6, which

contains 2 nucleotide substitutions G → C at positions 66, 207; 4 nucleotide substitutions A → G at positions 69, 90, 93, 186, which do not lead to changes in the amino acid sequence of prokineticin protein 1.

In FIG. 7 shows the nucleotide sequence of the modified cDNA of the PROK 1 gene, SEQ ID No: 7, which

contains 3 nucleotide substitutions G → C at positions 66, 207, 321; 4 nucleotide substitutions A → G at positions 69, 90, 93, 186, which do not lead to changes in the amino acid sequence of prokineticin protein 1.

FIG. 8. In order to subsequently correctly determine the gene therapeutic effect after transfection of fibroblasts with the gene therapeutic substance with the cDNA of the PROK 1 gene, an analysis of the endogenous expression of the PROK 1 gene was carried out in a primary fibroblast culture. The figure shows the graphs of the accumulation of products of polymerase chain reaction (PCR), corresponding to:

1 - cDNA of the PROK 1 gene, fibroblasts with reduced expression of the PROK 1 gene,

2 - cDNA of the PROK 1 gene, fibroblasts with normal expression of the PROK 1 gene,

3 - cDNA of the B2M gene, fibroblasts with reduced expression of the PROK 1 gene,

4 - cDNA of the B2M gene, fibroblasts with normal expression of the PROK 1 gene.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

FIG. 9. In order to confirm the increase in the expression of the PROK 1 gene in cell culture of fibroblasts with reduced expression of the PROK 1 gene during transfection of these cells with the gene therapeutic substance with the cDNA of the PROK 1 gene with the genetic construct pCMV6-PROK 1 SEQ ID No: 1, plots of PCR-accumulation are presented products matching:

1 - cDNA of the PROK 1 gene in fibroblasts with normal expression of the PROK 1 gene,

2 - cDNA of the PROK 1 gene in fibroblasts with reduced expression of the PROK 1 gene before transfection of the GTS with cDNA of the PROK 1 gene,

3 - cDNA of the PROK 1 gene in fibroblasts with reduced expression of the PROK 1 gene after transfection of GTS with cDNA of the PROK 1 gene,

4 - cDNA of the PROK 1 gene in fibroblasts with reduced expression of the PROK 1 gene after transfection with a vector without cDNA of the PROK 1 gene,

5 - cDNA of the B2M gene in fibroblasts with normal expression of the PROK 1 gene,

6 - cDNA of the B2M gene in fibroblasts with reduced expression of the PROK 1 gene prior to transfection of GTS with cDNA of the PROK 1 gene,

7 - cDNA of the B2M gene in fibroblasts with reduced expression of the PROK 1 gene after transfection of GTS with cDNA of the PROK 1 gene,

8 - cDNA of the B2M gene in fibroblasts with reduced expression of the PROK 1 gene after transfection with a vector without cDNA of the PROK 1 gene.

From the graphs it follows that in the case of transfection with a vector without inserting the cDNA of the PROK 1 gene, the cDNA level of the PROK 1 gene in fibroblasts did not change, and in the case of transfection with a vector with cDNA of the PROK 1 gene, the level of fibroblast cDNA with reduced expression of the PROK 1 gene increased significantly (to the level higher than the cDNA level of the PROK 1 gene in normal fibroblasts).

FIG. 10. In order to confirm the increase in the amount of prokineticin 1 protein, in a cell culture of fibroblasts with normal expression of the PROK 1 gene during transfection of these cells with the gene therapeutic substance containing the cDNA of the PROK 1 gene, a graph of the change in the amount of prokineticin 1 protein, untransfected fibroblasts (culture A), transfected vector pCDNA 3.1 (+) not containing cDNA of the PROK 1 gene (culture B) and transfected with a gene therapeutic substance with the genetic construct pCDNA 3.1-PROK 1SEQ ID No: 1 (culture C). From the graph it follows that during the transfection of fibroblasts with a gene therapeutic substance with cDNA of the PROK 1 gene, an increase in the amount of prokineticin 1 protein occurs in the cell lysate.

FIG. 11. In order to confirm the increase in the amount of prokineticin 1 protein in human skin with the introduction of a fibroblast cell culture transfected with a gene-therapeutic substance into the skin, an analysis of the change in the amount of prokineticin 1 protein in the skin of patients is presented. At the same time, three variants of autologous fibroblast culture were injected into the patients - non-transfected (A), transfected with the pCMV6-XL5 vector (B) and transfected with the gene therapeutic substance with the genetic construct pCMV6-PROK 1 SEQ ID No: 7 (C) - into the lower leg skin. The quantitative level of prokineticin 1 protein in intact skin was also analyzed. An increase in the amount of prokineticin 1 protein was shown in the patient’s skin in the area of the introduction of fibroblasts transfected with the gene therapeutic substance of the cDNA of the PROK 1 gene (C).

FIG. 12. In order to confirm the increase in the amount of prokineticin 1 protein to various individual levels in cell cultures of fibroblasts of patients upon transfection of these cells with gene-therapeutic substances with a portion of native unmodified cDNA of the PROK 1 gene and modified cDNA of the PROK 1 gene, an analysis of the change in the quantitative level of prokineticin 1 protein is presented. , in human skin fibroblast cultures, depending on the presence and type of modifications in the cDNA of the PROK 1 gene used for transfection of fibroblasts.

Fibroblast cultures of 24 patients were divided into 8 parts each from (A) to (H); the first parts (A) of the patient’s cell cultures were transfected with the gene therapeutic substance pCMV6-PROK 1 SEQ ID No: 1, parts (B) were transfected with the gene therapeutic substance pCMV6-PROK 1 SEQ ID No: 2, parts (C) were transfected with the gene therapeutic with the substance pCMV6-PROK 1 SEQ ID No: 3, part (D) was transfected with the gene-therapeutic substance pCMV6-PROK 1 SEQ ID No: 4, part (E) was transfected with the gene-therapeutic substance pCMV6-PROK 1 SEQ ID No: 5, part (F) was transfected with the gene therapeutic substance pCMV6-PROK 1 SEQ ID No: 6, part (G) was transfected with the gene therapeutic substance pCMV6-PROK 1 SEQ ID No: 7, part (H) were transfected with the vector plasmid not containing the cDNA gene PROK 1.

Based on the results of the analysis of the quantitative level of prokineticin 1 protein, indicators were selected for each part of the cell culture from each patient that showed the maximum amount of prokineticin 1 protein and combined them into seven groups based on the following criteria:

In group 1, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 1,

in group 2, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 2,

in group 3, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 3,

in group 4, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 4,

in group 5, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 5,

in group 6, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 6,

in group 7, the maximum amount of prokineticin 1 protein was observed during transfection of pCMV6-PROK 1 SEQ ID No: 7.

None of the cell cultures showed that the maximum amount of prokineticin 1 protein was present upon transfection with a vector without insertion of the cDNA of the PROK 1 gene.

The figure 12 for each group of cell cultures shows a diagram of indicators of the concentration of prokineticin 1 protein, (averaged within the group, if the group includes more than one cell culture) for all involved in the experiment of gene-therapeutic substances, after transfection of these cell cultures of gene therapeutic substances containing modified and native cDNA of the PROK 1 gene.

It follows from the figure that the achievement of the maximum amount of prokineticin 1 protein in the skin fibroblast cultures of various patients during their transfection with gene therapeutic substances is associated with individual characteristics of the patients and depends on the presence and type of modifications in the cDNA of the PROK 1 gene included in gene therapeutic substances .

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:1 (A)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 1 (A)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:2 (В)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 2 (B)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:3 (С)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 3 (C)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:4 (D)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:5 (E)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 5 (E)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:6 (F)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС PROK 1 SEQ ID No:7 (G)

parts of cell cultures transfected with GTS PROK 1 SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

parts of cell cultures transfected with placebo (H)

FIG. 13. In order to confirm the increase in the expression of the PROK 1 gene in cell culture of the uterine endometrial epithelium upon transfection of these cells with a gene therapeutic substance with cDNA of the PROK 1 gene in the pCMV6-Kan / Neo PROK 1 SEQ ID No: 2 genetic construct, plots of accumulation of PCR products are shown corresponding to:

1 - cDNA of the PROK 1 gene, endometrial epithelium before transfection

2 - cDNA of the PROK 1 gene, endometrial epithelium after transfection

3 - cDNA of the B2M gene, endometrial epithelium before transfection

4 - cDNA of the B2M gene, endometrial epithelium after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the PROK 1 gene in the culture of the uterine endometrial epithelium increased many times.

FIG. 14. In order to confirm the increase in the expression of the PROK 1 gene in a cell culture of human corneal epithelial cells upon transfection of these cells with a gene therapeutic substance with cDNA of the PROK 1 gene, the graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the PROK 1 gene, before transfection

2 - cDNA of the PROK 1 gene, after transfection

3 - cDNA of the B2M gene, before transfection

4 - cDNA of the B2M gene, after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the PROK 1 gene increased many times.

FIG. 15. In order to confirm the increase in the amount of prokineticin 1 protein in human skin when a gene of therapeutic substance is introduced into the skin, an analysis of the change in the quantitative level of prokineticin 1 protein in the skin is presented. At the same time, the patient was injected with a gene-therapeutic substance containing a vector plasmid with the cDNA of the PROK 1 pCMV6-PROK 1 SEQ ID No: 4 (B) gene and a placebo, which is a combination of the vector plasmid pCMV-XL5 without the cDNA of the PROK 1 gene with transport molecule (A) - into the skin in the lower leg. An increase in the amount of prokineticin 1 protein was shown in the skin biopsy of patient 1B, to whom a gene therapeutic substance containing a genetic construct with cDNA of the PROK 1 gene was injected, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

FIG. 16. In order to confirm the increase in the amount of prokineticin 1 protein in human cartilage with the introduction of a gene-therapeutic substance into the cartilage, an analysis of the change in the quantitative level of prokineticin 1 protein of cartilage is presented. In this case, the patient was injected with a gene therapeutic substance containing a vector plasmid with the cDNA of the PROK 1 pCDNA 3.1 gene PROK 1 SEQ ID No: 5 (B) and a placebo pCDNA 3.1 (+) was introduced in parallel, which is a combination of the vector plasmid without the cDNA of the PROK 1 gene with the transport molecule (A) - into the cartilage tissue.

An increase in the quantitative level of prokineticin 1 protein was shown in the lysate of the cartilage biopsy of patient 1B, which was injected with a gene therapeutic substance containing a genetic construct with cDNA of the PROK 1 gene, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

FIG. 17. In order to confirm the increase in the amount of prokineticin 1 protein in human muscle tissue when a gene therapeutic substance is introduced into muscle tissue, an analysis of the change in the amount of prokineticin 1 protein in muscle tissue is presented. At the same time, the patient was injected with a gene therapeutic substance containing a vector plasmid with cDNA of the PROK 1 gene - pCMV6-Kan / Neo PROK 1 SEQ ID No: 6 (B) and a placebo pCMV6-Kan / Neo, which is a combination of a vector plasmid containing no cDNA of the PROK 1 gene with a transport molecule (A) - into muscle tissue in the forearm zone. An increase in the amount of prokineticin 1 protein was shown in a biopsy of muscle tissue of patient 1B, to which a gene therapeutic substance containing a genetic construct with cDNA of the PROK 1 gene was injected, which indicates the effectiveness of the gene therapeutic substance. Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

FIG. 18. In order to confirm the increase in the amount of prokineticin 1 protein to a different individual level when the gene therapeutic substances with modified PROK 1 gene cDNA and a portion of the native unmodified PROK 1 gene cDNA were introduced into the skin of the patients, the quantitative level of prokineticin 1 protein in human skin was analyzed depending on the presence and type of modifications in the cDNA of the PROK 1 gene.

To each of the 23 patients who were randomly selected, 7 gene-therapeutic substances pCMV6-SEQ ID No: 1, pCMV6-SEQ ID No: 2, pCMV6-SEQ ID No: 3, pCMV6-SEQ were injected into the lower leg skin ID No: 4, pCMV6-SEQ ID No: 5, pCMV6-SEQ ID No: 6, pCMV6-SEQ ID No: 7, and placebo pCMV6-XL5.

Based on the results of the analysis of the amount of prokineticin 1 protein, the biopsy samples selected indicators for each biopsy from each patient, which showed the maximum quantitative levels of prokineticin 1 protein, and combined them into seven groups based on the following criterion:

In group 1, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PROK 1 SEQ ID No: 1,

in group 2, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PROK 1 SEQ ID No: 2,

in group 3, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PROK 1 SEQ ID No: 3,

in group 4, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PPOK 1 SEQ ID No: 4,

in group 5, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PROK 1 SEQ ID No: 5,

in group 6, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PROK 1 SEQ ID No: 6,

in group 7, the maximum amount of prokineticin 1 protein was observed with the introduction of pCMV6-PROK 7 SEQ ID No: 7.

None of the biopsy specimens showed that the maximum amount of prokineticin 1 protein was present when a placebo was administered.

The figure 18 for each group of biopsy samples shows charts of indicators of the concentration of prokineticin 1 protein, (averaged within the group, if the group includes more than one biopsy) in relation to all involved in the experiment of gene-therapeutic substances, after the introduction of these genetic therapeutic substances containing modified cDNA of the PROK 1 gene and a portion of the native unmodified cDNA of the PROK 1 gene.

From this example, it follows that the achievement of the maximum amount of prokineticin 1 protein in biopsies of the skin of various patients when they introduce gene-therapeutic substances into the skin is associated with individual characteristics of patients and depends on the presence and type of modifications in the cDNA of the PROK 1 gene included in the gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary. Designations:

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:1 (A)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 1 (A)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:2 (В)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 2 (B)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:3 (С)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 3 (C)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:4 (D)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 4 (D)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:5 (E)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 5 (E)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:6 (F)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 6 (F)

биоптаты пациентов после введения ГТС PROK 1 SEQ ID No:7 (G)

biopsy specimens of patients after the administration of GTS PROK 1 SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (Н)

biopsy samples of patients after placebo (N)

FIG. 19. In order to determine the most effective gene-therapeutic substance for a particular patient, the quantitative level of prokineticin 1 protein was analyzed in the cell lysates of this patient’s fibroblasts transfected with different genetic constructs containing a portion of the native unmodified cDNA of the PROK 1 gene or modified cDNA of the PROK 1 gene.

According to the results of the analysis of the amount of prokineticin 1 protein, a variant of the gene therapeutic substance was isolated in the patient’s fibroblast culture, the transfection of which revealed the maximum concentration of prokineticin 1 protein in the cell culture lysate. In this experiment, the maximum concentration of prokineticin 1 protein in the lysate is observed upon transfection with a gene therapeutic substance based on pCMV6 PROK 1 SEQ ID No: 1 containing a portion of the native unmodified cDNA of the PROK 1 gene, as shown in Figure 19.

Thus, the most effective gene-therapeutic substance has been selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Designations:

1 - cell lysate after transfection of GTS PROK 1 SEQ ID No: 1 (A)

2 - cell lysate after transfection of GTS PROK 1 SEQ ID No: 2 (B)

3 - cell lysate after transfection of GTS PROK 1 SEQ ID No: 3 (C)

4 - cell lysate after transfection of the GTS PROK 1 SEQ ID No: 4 (D)

5 - cell lysate after transfection of GTS PROK 1 SEQ ID No: 5 (E)

6 - cell lysate after transfection of the GTS PROK 1 SEQ ID No: 6 (F)

7 - cell lysate after transfection of GTS PROK 1 SEQ ID No: 7 (G)

8 - cell lysate after placebo transfection (H)

FIG. 20. In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of prokineticin 1 protein was analyzed in lysates of biopsy samples of the skin of this patient, after the introduction of gene-therapeutic substances containing a portion of native unmodified cDNA of the PROK 1 gene or sections of modified PROK gene cDNA one.

According to the analysis of the amount of prokineticin 1 protein, a variant of the gene-therapeutic substance was isolated in the lysate of biopsy samples of the patient’s skin, the introduction of which reveals the maximum concentration of prokineticin 1 protein in the biopsy sample lysate. In this experiment, the maximum concentration of prokineticin 1 protein was noted with the introduction of a gene therapeutic substance based on pCMV6 PROK 1 SEQ ID No: 7 containing a modified gene cDNA, as shown in Figure 20.

Thus, the most effective gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

Designations:

1 - lysate of the biopsy specimen after administration of the GTS PROK 1 SEQ ID No: 1 (A)

2 - biopsy specimen lysate after administration of GTS PROK 1 SEQ ID No: 2 (B)

3 - biopsy specimen lysate after administration of GTS PROK 1 SEQ ID No: 3 (C)

4 - biopsy specimen lysate after administration of GTS PROK 1 SEQ ID No: 4 (D)

5 - biopsy specimen lysate after administration of GTS PROK 1 SEQ ID No: 5 (E)

6 - biopsy specimen lysate after administration of GTS PROK 1 SEQ ID No: 6 (F)

7 - biopsy specimen lysate after administration of GTS PROK 1 SEQ ID No: 7 (G)

8 - biopsy specimen lysate after placebo (H). Implementation of the invention.

With a decrease in the expression of genes encoding proteins, for example, the PROK 1 gene, a decrease in the amount of protein in the body occurs, which leads to pathological conditions.

The advantages of using the genetic construct with the PROK1 gene to correct the quantitative level of prokineticin 1 protein in cells of human organs and tissues, compared with the use of human prokineticin 1 protein and nucleic acid encoding human prokineticin 1 protein, the solution according to WO 2003/020892 (prototype) is as follows :

1) it is easier to provide a higher and stable level of protein in the cells,

2) a complex and expensive procedure for refolding and purification of a protein preparation is not required,

3) transportation of the gene-therapeutic substance is provided to a larger spectrum of cells of human organs and tissues, as well as more efficient intracellular transportation of the gene-therapeutic substance.

4) individual characteristics of patients are taken into account.

Thus, to create a group of gene therapeutic substances according to this invention, the PROK 1 gene was selected, and not the human prokineticin 1 protein encoded by this gene.

To obtain a group of gene-therapeutic substances carry out the following actions:

1. Obtaining a portion of the native cDNA of the PROK 1 gene containing the protein coding region of the PROK 1 gene, cloning it into an intermediate plasmid, cloning it into expression vector plasmids under the control of eukaryotic regulatory elements for expression of the target gene in such a way that the resulting genetic constructs contain a nucleotide coding the cDNA sequence of the prokineticin 1 protein, which is a portion of the native unmodified cDNA of the PROK 1 gene and which is used for further modifications.

2. Introduction of modifications of the PROK 1 gene cDNA into the cDNA sequence to create a number of PROK 1 cDNAs that provide a sufficient level of prokineticin 1 protein translation to combat pathological manifestations.

3. Cloning of a portion of the native unmodified cDNA of the PROK 1 gene and the modified cDNA of the PROK 1 gene obtained on its basis into vector plasmids capable of efficient expression of this cDNA in cells of human organs and tissues.

4. Transformation of each of the obtained genetic constructs of bacterial E. coli cells, analysis of transformed clones for the presence, orientation, and copy number of the cDNA insert and the growth of selected clones to obtain the number of plasmid DNA variants necessary for further work.

5. Isolation of a number of genetic constructs containing modified cDNA of the PROK 1 gene and a portion of the native unmodified cDNA of the PROK 1 gene to create a group of gene-therapeutic substances based on them.

6. Creation of a group of gene therapeutic substances (GTS), each of which includes a genetic construct with modified cDNA of the PROK 1 gene and a portion of the native unmodified cDNA of the PROK 1 gene, or a combination of this construct with a transport molecule for efficient transfection of various types of cells of organs and tissues and / or administration to human organs and tissues.

To prove the effectiveness of the created gene-therapeutic substances leading to an increase in the expression of the PROK 1 gene, the following studies are carried out:

A) Cultivation of cultures of various types of cells from biopsies of various human organs and tissues, for example, human skin fibroblasts, or uterine endometrial epithelial cells, or eye epithelial cells.

B) Isolation of RNA from a cell culture, for example, human skin fibroblasts, or uterine endometrial epithelial cells, or eye epithelial cells, and analysis of the expression of the PROK 1 gene from the genome of these cells.

C) Transfection of a cell culture, for example, human skin fibroblasts, or uterine endometrial epithelial cells, or eye epithelial cells with gene therapeutic substances containing a portion of native unmodified cDNA of the PROK 1 gene and / or modified cDNA of the PROK 1 gene and parallel transfection of the culture of the same vector cells a plasmid that does not contain the cDNA of the PROK 1 gene in various combinations.

D) Comparative analysis of changes in the mRNA level of the PROK 1 gene and / or changes in the amount of prokineticin 1 protein after transfection in various combinations of cells, for example, human skin fibroblasts, or uterine endometrial epithelial cells or eye epithelial cells with genetic therapeutic substances containing a portion of native unmodified cDNA the PROK 1 gene and / or modified cDNA of the PROK 1 gene and parallel transfection of the culture of the same cells with a vector plasmid not containing the cDNA of the PROK 1 gene. This analysis is carried out, in particular, before appended therapy to determine the most effective for the patient genetically therapeutic substance.

E) Introduction to patients in the organs and tissues of a cell culture transfected with a gene therapeutic substance with a cDNA of the PROK 1 gene, for example, the introduction into the human skin of autologous fibroblasts transfected with a gene therapeutic substance with a cDNA of the PROK 1 gene and parallel administration to patients in organs and tissues , for example, in the skin, cultures of the same cells untransfected and transfected with a vector without inserting the cDNA of the PROK 1 gene and / or introducing into the organs and tissues of genetically therapeutic substances, for example, introducing genot therapeutically substances containing portion native unmodified PROK cDNA gene 1 and / or modified cDNAs PROK 1 and placebo in various combination.

F) A comparative analysis of the amount of prokineticin 1 protein in human organs and tissues, in particular in human skin, after the administration of cells of non-transfected and transfected gene-therapeutic substances containing the cDNA of the PROK 1 gene and vector plasmids not containing the cDNA of the PROK 1 gene and / or gene -therapeutic substances containing a portion of the native unmodified cDNA of the PROK 1 gene or modified cDNA of the PROK 1 gene, as well as a placebo.

G) Introduction to patients in organs and tissues, for example, in cartilage or muscle tissue, of gene-therapeutic substances containing a portion of native unmodified cDNA of the PROK 1 gene and / or modified cDNA of the PROK 1 gene, as well as a placebo.

H) A comparative analysis of the amount of prokineticin 1 protein in human organs and tissues, in particular in human cartilage or muscle tissue, after the introduction of gene therapeutic substances containing a portion of native unmodified cDNA of the PROK 1 gene and / or sections of modified cDNA of the PROK 1 gene, and also a placebo.

I) The introduction into patients of organs and tissues, for example, the introduction into the patient's skin of gene-therapeutic substances containing a portion of native unmodified cDNA of the PROK 1 gene and sections of modified cDNA of the PROK 1 gene.

J) A comparative analysis of the amount of prokineticin 1 protein, in the patient’s organs and tissues, in particular in the skin, after the introduction of gene therapeutic substances containing a portion of the native unmodified cDNA of the PROK 1 gene and regions of modified cDNA of the PROK 1 gene. This analysis is carried out, in particular before the proposed therapy in order to select the most effective gene-therapeutic substance for the patient from the group of gene-therapeutic substances.

Example 1

Obtaining and cloning of native unmodified PROK 1 cDNA gene.

Unmodified cDNA of the PROK 1 gene is a nucleotide sequence that has high homology with the nucleotide sequence of the PROK 1 gene and mRNA shown in the GenBank database under the number NM_032414; nucleotides 52 to 369 are translated into the amino acid sequence of prokineticin 1 protein corresponding to that given in GenBank under the number NP_115790.1.

Total RNA is obtained from human blood cells using the PAXGeneBlood RNA Kit (Qiagen, Germany) and is used to obtain total cDNA by reverse transcription using RevertAid reverse transcriptase (ThermoScientific, USA) and random 9-nucleotide primers according to the method of the manufacturer of reverse transcriptase. Then, using total cDNA as a template and specific pre-primed primers complementary to nucleotides 17-39 5 'AAGCAGGCAGTGTTTTGCCTTCA 3' (PROK1-F1) and 817-797 5 'CACGTGAAGGGCCTGAGGGTC 3' (PROK1-M1 R1) ), a portion of the native unmodified cDNA of the PROK 1 gene is obtained, containing the coding sequence of the prokineticin 1 protein, and partial deletions of the 5 ′ and 3 ′ untranslated regions. The polymerase chain reaction (PCR) is carried out using Phusion DNA polymerase (ThermoScientific, USA), giving products with blunt ends, on a Master CyclerGradient thermocycler (Eppendorf, USA) in 50 μl of a reaction mixture containing 0.5 μl of total cDNA of the first chain, 0.1 μM of each primer PROK1F1 and PROK1R1, 250 μM of each deoxynucleotide triphosphate (dATP, dTTP, dTTP and dGTP), 100 mM Tris-HCl (pH 8.85 at 20 ° C), 50 mM ammonium sulfate, 250 mM potassium chloride , 0.01% Tween-20 and 5 units. Pfu DNA polymerase (PhusionThermo Scientific, USA) under the following conditions: initial denaturation at + 98 ° C for 30 s, 35 cycles including denaturation at + 98 ° C for 10 s, annealing of primers at + 64 ° C for 30 s and elongation at + 68 ° C for 2 minutes.

The amplification product was isolated from agarose gel using the QIAquickGelExtractionKit kit (Qiagen, Germany)

The amplified cDNA fragment of 801 bp in length, carrying the portion of the native unmodified cDNA of the PROK 1 gene, was cloned in pUC19 plasmid vector (NEB, USA, cat. No. N3041S). The DNA of the vector plasmid pUC19 (NEB, USA, cat. No. N3041S) is digested with restriction enzyme giving blunt ends, for example, Smal (NEB, USA) and is treated with alkaline phosphatase. The amplified cDNA fragment and the linearized plasmid pUC19 are ligated using T4 phage DNA ligase 400000 units / ml (NEB, USA, cat. M0202S) at the rate of 1 μl of the enzyme per 1 μg of DNA. Ligation is carried out in a volume of 20 μl in the presence of 2 mm ATP, 50 mm Tris-HCl, pH 7.6, 10 mm MgCl ₂ , 10 mm DTT for 10 hours at + 16 °.

The resulting mixture is transformed with competent E. coli Top10 cells (http://molbiol.ru/protocol/03_04.html), which are seeded on Petri dishes with L-agar containing 100 μg / ml ampicillin and 40 μl per cup of 100 mM solutions IPTG and 2% X-gal. Separate colonies are analyzed for the presence of an insert using PCR with primers PROK 1 - F1 and PROK 1 - R1 and confirmed by sequencing according to the Sanger method.

Example 2

Obtaining genetic constructs with a plot of unmodified cDNA of the PROK 1 gene

To express a portion of the unmodified cDNA of the PROK 1 gene in cells of human organs and tissues, a variant of the cDNA of the PROK 1 gene according to Example 1 is placed in a vector plasmid, the choice of which uses the following selection criteria:

1) the plasmid must necessarily be replicated in E. coli, preferably with high copy number;

2) the plasmid must contain a bacterial selection factor or another selection factor that does not contain antibiotic resistance genes;

3) the plasmid must have the presence of eukaryotic regulatory elements - the obligatory promoter and terminator (polyadenylation signal), for example, an enhancer and intron (e) element (s);

4) the plasmid must have a convenient polylinker for cloning. An example of such a plasmid can be pCMV6-XL5, pCMV6-Kan / Neo (OriGene, USA) or pCDNA 3.1 (+) (ThermoFisher Scientific, USA), or plasmid vectors of viral origin - for example, human adenovirus of the 5th serotype.

5) The plasmid may contain nucleotide sequences with regulatory elements for replication in mammalian cells, for example, such as SV40 ori from the monkey virus SV40 or ori P / EBNA-1 from the human Epstein-Barr virus.

6) The plasmid may also contain additional regulatory elements that enhance the translation of the protein, for example, binding sites with the transcription factor NFkB, which ensures the active transport of plasmid DNA into the cell nucleus for more efficient transcription of the target gene.

When cloning a portion of the unmodified cDNA of the PROK 1 gene into pCDNA 3.1 (+), the coding nucleotide sequence is placed under the control of the human CMV promoter CMV, which is effective in eukaryotic cells, and the bovine growth hormone gene polyadenylation signal. This plasmid also has a bacterial selection factor, the ampicillin resistance gene, and a eukaryotic selection factor, the neomycin resistance gene.

When cloning a portion of the unmodified cDNA of the PROK 1 gene into pCMV6-XL5, pCMV6-Kan / Neo, the coding nucleotide sequence is placed under the control of the human cytomegalovirus CMV promoter, which is effective in eukaryotic cells, and the polyadenylation signal of the human growth hormone gene. This plasmid also has a bacterial selection factor, the ampicillin resistance gene.

The vector plasmid pUC19-PROK 1 with a portion of the native unmodified cDNA sequence of the PROK 1 gene is used as a template for amplification with the following primer pairs:

for orientation Hind III - PROK 1-Eco RI

PROK1 F2 GGAAGCTTGCCACCATGAGAGGTGCCACG

PROK1 R2 AAGAATTCCTAAAAATTGATGTTCTTCAA

Orientation Eco RI - PROK 1-Hind III

PROK1 F3 GGGAATTCGCCACCATGAGAGGTGCCACG

PROK1 R3 GGAAGCTTCTAAAAATTGATGTTCTTCAA

Amplification is carried out under the conditions described in Example 1. Next, the amplification products are reprecipitated with ethanol, the precipitates are washed with 70% ethanol and dissolved in 1 × TE buffer, and then subjected to restriction with EcoRI and HindIII endonucleases.

The restriction products are separated by 1% agarose gel electrophoresis, stained with ethidium bromide solution and DNA fragments corresponding to the HindIII-5'NTR-cDNA insert gene PROK 1 -3'NTR-EcoRI or EcoRI-5'NTR-cDNA PROK 1 -3'NTR-HindIII and the linearized plasmid pCMV6-XL5 and pCMV6-Kan / Neo and pCDNA 3.1 (+), excised, isolated from the gel using the QIAquickGelExtractionKit gel isolation kit from Example 1 and mixed. The resulting mixture of restriction fragments is ligated using T4 phage DNA ligase. Ligation is carried out for 10-15 minutes at room temperature, and then at 12 ° C for 10 hours. Ligation DNA is used to transform E. coli cells according to the standard method using calcium chloride. Transformed cells were selected on agar medium LB with ampicillin (100 μg / ml). Plasmid DNA was isolated from ampicillin-resistant colonies using the QiagenSpinMiniprepKit plasmid isolation kit, digested with restriction enzymes EcoRI and HindIII, and the genetic construct was selected by DNA sequencing of genetic constructs using the Sanger method.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain the corresponding genes -therapeutic substances.

Thus, expression genetic constructs are obtained based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+), which contain a 318 bp nucleotide sequence. with the primary structure shown in FIG. 1 Seq ID Nol

Example 3

Modifications of the cDNA of the PROK 1 gene in genetic constructs to obtain gene-therapeutic substances based on them.

Modifications are carried out in such a way as not to affect the primary structure of the prokineticin 1 protein, namely, nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, and, accordingly, do not affect the amino acid sequence encoded by this sequence.

In particular, to obtain modified cDNAs of the PROK 1 gene in order to increase the transcription and translation efficiency of the prokineticin 1 protein in human tissue and organ cells, modifications are made to the codon native sequence section of the PROK 1 gene using the codon optimization principle by replacing the minor codons with synonymous major ones so that the substitutions do not lead to changes in the amino acid sequence of the protein or the termination of the amino acid chain during translation, do not worsen the processes of transcription and translation.

All modifications are carried out in several stages by PCR mutagenesis using the QuikChPROK 1 e II XL kit or QuikChPROK 1 e Multi Site-Directed Mutagenesis Kit (Agilent Technology, USA) according to the manufacturer's recommendations (http://www.agilent.com/cs/library/usermanuals / Public / 200513).

To the plasmid DNA obtained in Example 2, 50-100 ng of primer containing the necessary replacement, insertion or deletion of 19-45 bp was added in the amount of 10-50 ng and PCR was carried out in QuikChPROK 1 e Multi reaction buffer (AgilentTechnologies) , USA) with a mixture of QuikChPROK 1 e Multi mix enzymes (Agilent Technologies, USA) under the following conditions: 95 ° С, 1 min; further from 30 to 35 cycles: 95 ° С 1 minute, 55 ° С 1 minute, 65 ° С 2 minutes / 1000 bp After PCR, 1-2 μl of restriction enzyme Dpn I was added to the amplification mixture and incubated for 1-2 hours at 37 ° C. The resulting mixture was transformed with competent E. coli Tor10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on L-agar plates containing 100 μg / ml ampicillin. Transformed colonies are analyzed for mutation by sequencing plasmid DNA according to the Sanger method.

To obtain the modified cDNA of the PROK 1 SEQ ID No. 2 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-PROK 1Seq ID No1, pCMV6-Kan / Neo-PROK 1Seq ID No1 and pCDNA 3.1 (+) - PROK 1Seq ID No1 with primers complementary to the native cDNA region of the PROK 1 gene shown in GenBank under the number NM_032414:

1. PROK 54-81 F:

5 'GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Complementary to nucleotides 54-81, with the replacement of G → C at position 66 and the replacement of A → G at position 69

The nucleotide sequence of the PROK 1 SEQ ID No: 2 cDNA thus modified contains 1 nucleotide substitution G → C at position 66 and 1 nucleotide substitution A → G at position 69, which does not lead to changes in the amino acid sequence of the protein encoded by the PROK 1 gene sequence and has the primary structure shown in FIG. 2.

To obtain a modified cDNA of the PROK 1 SEQ ID No. 3 gene, sequential PCR mutagenesis is performed on plasmids PCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan / Neo-PROK 1 SEQ ID No1 and pCDNA 3.1 (+) - PROK 1 SEQ ID No1 with primers complementary to the native cDNA region of the PROK 1 gene shown in GenBank under the number NM_032414:

1. PROK 54-81 F:

5 'GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Complementary to nucleotides 54-81, with the replacement of G → C at position 66 and the replacement of A → G at position 69

2. PROK 1 79-109 F:

5 'ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Complementary to nucleotides 79-109, with the replacement of A → G at position 90;

The nucleotide sequence of the PROK 1 SEQ ID No: 3 cDNA thus modified contains 1 nucleotide substitution G → C at position 66, two nucleotide substitutions A → G at position 69, 90; not leading to changes in the amino acid sequence of the prokineticin 1 protein, and has the primary structure shown in FIG. 3.

To obtain the modified cDNA of the PROK 1 SEQ ID No. 4 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan / Neo-PROK 1 SEQ ID No1 and pCDNA 3.1 (+) - PROK 1 SEQ ID No1 with primers complementary to the native cDNA region of the PROK 1 gene shown in GenBank under the number NM_032414:

1. PROK 54-81 F:

5 'GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Complementary to nucleotides 54-81, with the replacement of G → C at position 66 and the replacement of A → G at position 69

2. PROK 1 79-109 F:

5 'ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Complementary to nucleotides 79-109, with the replacement of A → G at position 90;

3. PROK 1 79-106 F:

5 'ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Complementary to nucleotides 79-106, with A → G substitutions at positions 90 and 93;

The nucleotide sequence of the PROK 1 SEQ ID No: 4 cDNA modified in this way contains 1 nucleotide substitution G → C at position 66, 3 nucleotide substitutions A → G at positions 69, 90, 93; not leading to changes in the amino acid sequence of the prokineticin 1 protein, and has the primary structure shown in FIG. four.

To obtain a modified cDNA of the PROK 1 SEQ ID No. 5 gene, sequential PCR mutagenesis is carried out on plasmids pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan / Neo-PROK 1 SEQ ID No1 and pCDNA 3.1 (+) - PROK 1 SEQ ID No1 with primers complementary to the native cDNA region of the PROK 1 gene shown in GenBank under the number NM_032414:

1. PROK 54-81 F:

5 'GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Complementary to nucleotides 54-81, with the replacement of G → C at position 66 and the replacement of A → G at position 69

2. PROK 1 79-109 F:

5 'ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Complementary to nucleotides 79-109, with the replacement of A → G at position 90;

3. PROK 1 79-106 F:

5 'ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Complementary to nucleotides 79-106, with A → G substitutions at positions 90 and 93;

4. PROK 1 172-196 F:

5 'AGCCTGTGGCTTCGGGGGCCTGCGGA 3',

Complementary to nucleotides 172-196, with the replacement of A → G at position 186;

The nucleotide sequence of the PROK 1 SEQ ID No: 5 cDNA modified in this way contains 1 nucleotide substitution G → C at position 66, 4 nucleotide substitutions A → G at positions 69, 90, 93, 186; not leading to changes in the amino acid sequence of the prokineticin 1 protein, and has the primary structure shown in FIG. 5.

To obtain the modified cDNA of the PROK 1 SEQ ID No. 6 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan / Neo-PROK 1 SEQ ID No1 and pCDNA 3.1 (+) - PROK 1 SEQ ID No1 with primers complementary to the native cDNA region of the PROK 1 gene shown in GenBank under the number NM_032414:

1. PROK 54-81 F:

5 'GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Complementary to nucleotides 54-81, with the replacement of G → C at position 66 and the replacement of A → G at position 69

2. PROK 1 79-109 F:

5 'ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Complementary to nucleotides 79-109, with the replacement of A → G at position 90;

3. PROK 1 79-106 F:

5 'ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Complementary to nucleotides 79-106, with A → G substitutions at positions 90 and 93;

4. PROK 1 172-196 F:

5 'AGCCTGTGGCTTCGGGGGCCTGCGGA 3',

Complementary to nucleotides 172-196, with the replacement of A → G at position 186;

5. PROK 1 194-221 F:

5 'GGATGTGCACCCCCCTGGGGCCGGGAAGG 3',

Complementary to nucleotides 194-221, with the replacement of G → C at position 207;

The nucleotide sequence of the PROK 1 SEQ ID No: 6 cDNA thus modified contains 2 nucleotide substitutions G → C at positions 66, 207; 4 nucleotide substitutions A → G at positions 69, 90, 93, 186; not leading to changes in the amino acid sequence of the prokineticin 1 protein, and has the primary structure shown in FIG. 6.

To obtain the modified cDNA of the PROK 1 SEQ ID No. 7 gene, sequential PCR mutagenesis is carried out on plasmids pCMV6-XL5-PROK 1 SEQ ID No1, pCMV6-Kan / Neo-PROK 1 SEQ ID No1 and pCDNA 3.1 (+) - PROK 1 SEQ ID No1 with primers complementary to the native cDNA region of the PROK 1 gene shown in GenBank under the number NM_032414:

1. PROK 54-81 F:

5 'GAGAGGTGCCACCCGGGTCTCAATCATG 3',

Complementary to nucleotides 54-81, with the replacement of G → C at position 66 and the replacement of A → G at position 69

2. PROK 1 79-109 F:

5 'ATGCTCCTCCTGGTAACTGTGTCTGACTGTG 3',

Complementary to nucleotides 79-109, with the replacement of A → G at position 90;

3. PROK 1 79-106 F:

5 'ATGCTCCTCCTGGTGACTGTGTCTGACT 3'

Complementary to nucleotides 79-106, with A → G substitutions at positions 90 and 93;

4. PROK 1 172-196 F:

5 'AGCCTGTGGCTTCGGGGGCCTGCGGA 3',

Complementary to nucleotides 172-196, with the replacement of A → G at position 186;

5. PROK 1 194-221 F:

5 'GGATGTGCACCCCCCTGGGGCCGGGAAGG 3',

Complementary to nucleotides 194-221, with the replacement of G → C at position 207;

6. PROK 1 308-336 F:

5 'GCTCCAGGTTCCCCGACGGCAGGTACCGC 3',

Complementary to nucleotides 308-336, with substitution G → C at position 321;

The nucleotide sequence of the PROK 1 SEQ ID No: 7 cDNA modified in this way contains 3 nucleotide substitutions G → C at positions 66, 207, 321; 4 nucleotide substitutions A → G at positions 69, 90, 93, 186; not leading to changes in the amino acid sequence of the prokineticin 1 protein, and has the primary structure shown in FIG. 7.

Thus, expression vectors based on plasmids pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are obtained in which a portion of the native unmodified cDNA of the PROK 1 gene (SEQ ID No: 1) and modified nucleotide sequences of the PROK 1 gene cDNA are cloned (SEQ ID No: 2, 3, 4, 5, 6, 7) encoding prokineticin 1 protein.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain the corresponding genes -therapeutic substances.

The resulting expression vectors are used to obtain gene-therapeutic substances based on them, which are subsequently used for transfection of eukaryotic cells of organs and tissues and / or introduction into human organs and tissues. As control plasmids, the original vector pCMV6-XL5, (pCMV6-Kan / Neo) or pCDNA 3.1 (+) without the cDNA insert of the PROK 1 gene is used.

Example 4

Building up the genetic construct in bacterial culture.

To obtain preparative amounts of a vector plasmid containing one of the cDNA variants of the PROK 1 gene, the E. coli bacterial cells were transformed using the constructs of Example 3 (T. Maniatis et al. Molecular Cloning. M., Mir, 1984) and the obtained bacterial clones were grown containing the construct in the presence of a bacterial selection factor - resistance to ampicillin.

The ligase mixture of Example 3 is used to transform competent E. coli cells of strain XLblue. The preliminary selection of clones containing the cDNA insert of the PROK 1 gene in the correct orientation and a single copy is carried out by hydrolysis of plasmid DNA with restriction enzymes EcoRI and HindIII and analysis of restriction products by electrophoresis in 1.2% agarose gel. Selected clones are used for preparative growth of plasmid DNA for the purpose of further transfection into fibroblast cultures (eye epithelial cells, or uterine endometrial epithelial cells, etc.).

To obtain preparative amounts of the genetic expression constructs of Example 3, 20 ml of an overnight E.coli culture was grown in LB medium with 150 μg / ml ampicillin. 500 ml of LB medium with 100 μg / ml ampicillin were inoculated with this culture; growth was carried out in a shaker-incubator for 16 hours at 37 ° C and 200 rpm. Isolation of plasmid DNA was performed using the EndoFreePlasmidMaxiKit kit (Qiagen, Germany). The yield was 350 μg of DNA.

Example 5

Cultivation of eukaryotic cells, for example, fibroblasts for subsequent transfection with a gene therapeutic substance and analysis of the expression of the PROK 1 gene.

For subsequent transfection with a gene-therapeutic substance containing one of the cDNA variants of the PROK 1 gene according to Example 3, primary cultures of human fibroblasts from biopsy samples of the skin of patients are grown.

Using a skin biopsy device Epitheasy 3.5 (MedaxSRL), a skin biopsy sample is taken from a zone protected from ultraviolet radiation, for example, behind the auricle or from the side inner surface in the lower leg, about 3 mm in size, weighing up to 20 mg. The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The primary cell culture was grown on Petri dishes at 37 ° C in an atmosphere containing 5% CO ₂ in DMEM medium with 10% fetal calf serum and ampicillin 100 U / ml. Trypsinization and reseeding is performed every 5 days; for trypsinization, the cells were washed with PBS and incubated for 30 minutes at 37 ° C in a solution containing 0.05% trypsin and 1 mM EDTA. To neutralize trypsin, 5 ml of culture medium was added to the cells and the suspension was centrifuged at 600 rpm for 5 minutes. The growth of fibroblast culture after 4-5 passages was carried out in 75 ml culture bottles in a medium containing 10 g / l DMEM, 3.7 g / l Na ₂ CO ₃ , 2.4 g / l HEPES, 10% fetal serum and 100 U / ml ampicillin . The culture medium was changed every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 10 ⁶ cells was selected from the cell culture.

A portion of the fibroblast culture for RNA isolation followed by transcription analysis of the PROK 1 gene was centrifuged at 1000 rpm for 20 minutes and washed twice in PBS buffer by centrifugation at 600 rpm for 5 minutes. Then the cells were resuspended in 1.5 ml of the stabilizing reagent RNAlater and stored at 4 ° C for 10 days for subsequent RNA isolation.

RNA isolation was performed using the RNeasyMiniKit kit. (Qiagen, Germany). The isolated RNA was analyzed spectrophotometrically, measuring the ratio of optical density at 260 and 280 nm, as well as by capillary electrophoresis on a QIAxcel instrument (Qiagen, Germany) using an RNA Qiality Control cartridge. For further work, we used only those samples for which the total amount of isolated RNA was not less than 50 μg RNA, the ratio of D260: D280 was not less than 1.8, and the ratio of the 28S: 18S bands on capillary electrophoresis was not less than 1: 1.

The synthesis of total cDNA of the first strand was carried out using RevertAid reverse transcriptase (Thermo Scientific, USA), according to the manufacturer's recommendations. 1-2 μg of total RNA was used as a template for the synthesis of the first cDNA strand. 100-200 units were added to the reaction mixture for reverse transcription. reverse transcriptase and 10 pM random 9-nucleotide primer.

Example 6

Analysis of endogenous expression of the PROK 1 gene in a culture of primary fibroblasts.

Analysis of the expression of the PROK 1 gene from the fibroblast genome is carried out in order to subsequently correctly determine the gene therapeutic effect after transfection of these cells with genetic constructs with the cDNA of the PROK 1 gene.

For analysis, skin fibroblast cell lines, fibroblasts with low expression of the PROK 1 gene and fibroblasts with normal expression of the PROK 1 gene are used, from which RNA is isolated by standard methods (Maniatis T. et al. Molecular Cloning. M., Mir, 1984).

Isolated RNA is analyzed by real-time PCR (SYBR GreenRealTimePCR). For amplification of cDNA (251-332 n.p.) specific for the PROK 1 gene, a direct primer is used

PROK 1FA1 5 'CCACGCGAGTCTCAATCA 3'

and reverse primer

PROK 1-RA1 5 'ACTGGACATCCCGCTCAC 3'

The length of the amplification product is 84 nucleotides. As a reference gene, the beta-2-microglobulin B2M gene is used, the expression level of which in fibroblasts is comparable to that normal for the PROK 1 gene.

PCR amplification is performed using the SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) or another real-time PCR kit in 20 μl amplification mixture containing: 25 μl QuantiTect SYBR Green RT-PCR MasterMix, 2.5 mM magnesium chloride, 0.5 μm of each primer, 5 μl of total RNA. The reaction is carried out on a CFX96 thermocycler (Bio-Rad, USA) under the following conditions: 1 reverse transcription cycle at 50 ° C for 30 minutes, denaturation 98 ° C for 15 minutes, then 40 cycles including denaturation 94 ° C for 15 s, annealing primers 62 ° C for 30 s and elongation 72 ° C for 30 s

As a positive control, the concentration of amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the PROK 1 and B2M genes is used. As a negative control, deionized water is used (PCR accumulation curves of the products of negative and positive controls are not shown in FIG. 8 to simplify visualization). The number of PCR products - cDNA of the PROK 1 and B2M genes obtained as a result of amplification, is estimated in real time using the Bio-RadCFXManager 2.1 amplifier software.

Based on the analysis of the expression of the PROK 1 gene in different fibroblast cultures (with low expression of the PROK 1 gene and with normal expression of the PROK 1 gene), clones were selected from patients of the same age and type of aging, in which the amount of PCR product corresponding to the cDNA of the PROK 1 gene , was 10-20 times lower than that of the B2M gene cDNA. The accumulation curves of specific PCR products are shown in figure 8.

Example 7

Transfection of a fibroblast cell culture with reduced expression of the PROK 1 gene by a gene therapeutic substance in order to confirm an increase in the expression of the PROK 1 gene in the culture of these cells.

To evaluate the effectiveness of the gene therapeutic substance containing the unmodified cDNA of the PROK 1 gene according to Example 2, the primary culture of human fibroblasts with reduced expression of the PROK 1 gene selected in Example 6 is transfected with this gene therapeutic substance.

This fibroblast culture is grown in culture bottles (25 cm ² ) until the cells cover 50-70% of the surface of the bottle. The resulting cells are transfected with the gene therapeutic substance based on pCMV6-PROK 1 SEQ ID No: 1 in the presence of a transport molecule (e.g., dendrimer) and pCMV6-XL5 vector as a control.

A 6-well plate with DMEM medium with 10% fetal calf serum (1.6 ml per well) was seeded with fibroblasts at a rate of 1-4 × 10 ⁵ cells per well. Cells were incubated for 18 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then, 2 μg of plasmid DNA was dissolved in serum-free DMEM with Tris-HCl buffer 20 mM with 1 mM EDTA, pH 7-8 (minimum DNA concentration - 0.1 μg / μl). The final volume of the mixture was 100 μl.

The 6th generation SuperFect Transfection Reagent dendrimer solution (Qiagen, Germany) was used as a transport molecule.

Preparation of the DNA dendrimer complex was carried out according to the manufacturer's method (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some changes: 5 μl (with a concentration of 0.5 μg / μl) was added to 15 μl of the dendrimer (with a concentration of 3 μg / μl) plasmid DNA and mixed thoroughly. Then the DNA mixture with the dendrimer was incubated for 5-10 minutes at a temperature of 15-25 ° C.

Medium was carefully selected from the wells of the cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml PBS buffer. To a solution containing DNA dendrimer complexes, 600 μl of fetal serum DMEM medium was added and the mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Culture medium was then added and incubated 24-48 hours at 37 ° C and in an atmosphere containing 5% CO _2, after which the cDNA was evaluated the level of gene 1, and the control PROK V2M cDNA gene by amplification in real time as described in Example 6. The results of the analysis are shown in figure 9.

From the graphs it follows that in the case of transfection with a vector without inserting the cDNA of the PROK 1 gene, the cDNA level of the PROK 1 gene in fibroblasts did not change, and in the case of transfection with a vector with cDNA of the PROK 1 gene, the level of fibroblast cDNA with reduced expression of the PROK 1 gene increased significantly (to the level higher than the cDNA level of the PROK 1 gene in normal fibroblasts).

It was shown that in cells transfected with a gene-therapeutic substance based on pCMV6-PROK 1 SEQ ID No: 1, an increase in the expression of the target PROK 1 gene is observed.

Example 8

Transfection of a fibroblast cell culture with normal expression of the PROK 1 gene by a gene therapeutic substance with cDNA of the PROK 1 gene in order to confirm the increase in the amount of prokineticin 1 protein in the culture of these cells.

To assess the change in the amount of prokineticin 1 protein, we used a human skin fibroblast culture according to Example 5, the 6th generation SuperFect Transfection Reagent dendrimers (Qiagen, Germany) as a transport molecule, and an aqueous solution of dendrimers without plasmid DNA as a control (A), the vector plasmid pCDNA 3.1 (+), which does not contain the cDNA of the PROK 1 (B) gene, as transfected agents, the gene therapeutic substance based on the vector plasmid pCDNA 3.1 (+), containing the cDNA of the PROK 1-pCDNA 3.1 gene PROK 1 SEQ ID No : 1 (C), Preparation of the DNA-dendrimer complex and transfection fibroblast performed as in Example 7.

After transfection, 0.1 ml of 1N HCl was poured into 0.5 ml of culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2N NaOH / 0.5M HEPES (pH 7-7.6) and mixed thoroughly.

This mixture was used to quantify the target protein. The quantitative determination of the cDNA product of the PROK 1 gene was performed by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA) with a sensitivity of 16-2,000 pg / ml according to the manufacturer's procedure http: //img.creative- diagnostics.com/pdf/DEIA096%20Human%20PROK1%20ELISA%20Kit.pdf.

The method of detecting results is colorimetric. The optical density of the samples was measured at a wavelength of 450 nm using a ChemWell automatic biochemical and enzyme immunoassay analyzer (Awareness TechNology Inc., USA) and is proportional to the concentration of PROK 1 protein in the sample. The numerical value of the concentration is determined using a calibration curve constructed using calibrators with a known protein concentration PROK 1, which is part of the kit. The difference between the optical density (OD) values of the calibrators supplied in triplicate did not exceed 10%.

Statistical processing of the results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/).

Thus, it was shown that the transfection of fibroblasts with the obtained gene therapeutic substance carrying the cDNA of the PROK 1 gene leads to an increase in the amount of prokineticin 1 protein in fibroblast cells. The results are shown in figure 10.

Example 9

The introduction into the human skin of a cell culture of fibroblasts transfected with a gene therapeutic substance with cDNA of the PROK 1 gene in order to confirm the increase after this amount of prokineticin 1 protein in a biopsy of human skin.

In order to analyze changes in the amount of prokineticin 1 protein, three variants of autologous fibroblast culture were introduced into the skin of the leg in human tissues - untransfected (A), transfected with a vector without an insert, for example, pCMV6-XL5 (B) and transfected with a gene-therapeutic substance based on pCMV6 - PROK 1 SEQ ID No: 7 (C) in combination with transport molecules - liposomes TRANSFAST TM Transfection Reagent (PROMEGA, USA),

The suspension of liposomes was prepared according to the manufacturer's method (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) with some changes: 0.4 ml of Nuclease-Free sterile water was added to 0.4 mg of liposome powder. The suspension was mixed well by shaking. The resulting intermediate product of the suspension of liposomes was kept for 18 hours at a temperature of -20 ° C, then thawed at room temperature, resuspended by shaking or on a table mixer type "VORTEX".

To prepare the DNA liposome complex, 400 μl of plasmid DNA solution (with a concentration of 150 μg / ml) was added to 400 μl of liposome solution (with a concentration of 1 mg / ml) and mixed thoroughly. Then the mixture of DNA with liposomes was incubated for 5-10 minutes at a temperature of 15-25 ° C and was further used as a gene-therapeutic substance.

For subsequent transfection of cells with a gene therapeutic substance, primary cultures of human fibroblasts were grown from biopsy samples of the skin of patients according to Example 5.

For transfection, the medium was carefully selected from the wells of a cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml of PBS buffer. To a solution containing DNA liposime complexes, 600 μl of fetal serum DMEM medium was added and this mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then, the culture medium was added and incubated for 24-48 hours at 37 ° C in an atmosphere containing 5% CO ₂ .

Part of the cell culture was centrifuged at 700 rpm, the cells were washed twice with physiological saline, resuspended in physiological saline at the rate of 1 million cells in 200 μl and used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. Foci of introducing fibroblast cultures were located at a distance of 3-5 cm from each other.

The determination of the amount of prokineticin 1 protein was evaluated in lysates of biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of a suspension of fibroblasts. A biopsy was performed from the injection sites of the fibroblast suspension, as well as from the intact skin, using an Epitheasy 3.5 skin biopsy device (MedaxSRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 3 mm, and the mass was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

As can be seen from figure 11, in the skin of the patient in the area of administration of fibroblasts transfected with the gene therapeutic substance based on pCMV6-PROK 1 SEQ ID No: 7, there was an increase in the amount of prokineticin 1 protein, which may indicate an increase in the expression of the PROK 1 gene. Then, as with the introduction of control cultures of fibroblasts (untransfected and transfected with a vector without inserting the cDNA of the PROK 1pCMV6-XL5 gene), the amount of prokineticin 1 protein in the skin did not change.

Thus, the efficacy of a gene therapeutic substance was shown when a cell culture of fibroblasts transfected with the obtained gene therapeutic substance carrying a modified cDNA of the PROK 1 gene was introduced into human skin, which leads to an increase in the amount of prokineticin 1 protein in the skin in the injection zone.

Example 10

Transfection of fibroblast cultures from biopsies of a group of different patients with gene-therapeutic substances containing modified PROK 1 gene cDNA and a portion of native unmodified PROK 1 gene cDNA.

In order to confirm the individual nature of the increase in the amount of prokineticin 1 protein to a different level during transfection of cell cultures of fibroblasts of patients with gene therapeutic substances with modified cDNA of the PROK 1 gene and a portion of the native cDNA of the PROK 1 gene, a quantitative level of prokineticin 1 protein was analyzed in fibroblast cell lysates transfected different gene therapeutic substances according to example 3, containing modified cDNA of the PROK 1 gene and a portion of the native unmodified cDNA gene and PROK 1 in the patient group, depending on the presence and type of modifications in the cDNA of the PROK 1 gene.

The sequence of the site of the native unmodified cDNA of the PROK 1 gene is shown in Figure 1, SEQ ID No: 1, the sequences of the modified cDNA of the PROK 1 gene are shown in Figures 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Fibroblast cultures were grown from the same skin biopsy samples taken from the inner lateral surface in the lower leg area of 24 patients randomly selected as in Example 5, aliquots were selected and the level of prokineticin 1 protein in cell lysates was evaluated. A cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonyl fluoride . The lysate was centrifuged for 5 minutes at 14,000 rpm, the protein concentration in the supernatant was determined by the Bradford method ([Bradford M. M. (1976) Anal. Biochem. 72: 248-254]).

Then, each of the 24 cultures of fibroblasts was divided into 8 parts. One part, designated (A), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 1 vector containing unmodified cDNA of the PROK 1 gene (SEQ ID No: 1) according to Example 2 in combination with a transport molecule - dendrimer as in example 7.

The second part, designated (B), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 2 vector containing the modified PROK 1 gene cDNA (SEQ ID No: 2) according to Example 3 in combination with a dendrimer transport molecule as in example 7.

The 3rd part, labeled (C), was transfected according to Example 7 with a gene therapeutic substance based on pCMV6-SEQ ID No: 3 vector containing the modified cDNA of the PROK 1 gene (SEQ ID No: 3) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 4th part, designated (D), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 4 vector containing the modified cDNA of the PROK 1 gene (SEQ ID No: 4) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 5th part, designated (E), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 5 vector containing the modified cDNA of the PROK 1 gene (SEQ ID No: 5) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 6th part, designated (F), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID NO: 6 vector containing the modified cDNA of the PROK 1 gene (SEQ ID NO: 6) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 7th part, labeled (G), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 7 vector containing the modified variant cDNA of the PROK 1 gene (SEQ ID No: 7) according to Example 3 in combination with a transport molecule dendrimer according to example 7.

The 8th part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 that did not contain the PROK 1 gene cDNA according to Example 3 in combination with the transport molecule dendrimer of Example 7.

The determination of the amount of prokineticin 1 protein was evaluated in lysates of biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

Based on the results of determining the amount of prokineticin 1 protein, indicators were selected for each part of the cell culture from each patient, which showed the maximum levels of prokineticin 1 protein and combined them into seven groups based on the following criteria:

In group 1, the maximum amount of prokineticin 1 protein was observed during transfection of unmodified cDNA of the PROK 1 gene SEQ ID No: 1. This group included 4 out of 24 cultures.

In group 2, the maximum amount of prokineticin 1 protein was observed during transfection of the modified cDNA of the PROK 1 gene SEQ ID No: 2. This group included 2 out of 24 cultures.

In group 3, the maximum amount of prokineticin 1 protein was observed during transfection of the modified cDNA of the PROK 1 gene SEQ ID No: 3. This group included 3 out of 24 cultures.

In group 4, the maximum amount of prokineticin 1 protein was observed during transfection of the modified cDNA of the PROK 1 gene SEQ ID No: 4. This group included 5 out of 24 cultures.

In group 5, the maximum amount of prokineticin 1 protein was observed during transfection of the modified cDNA of the PROK 1 gene SEQ ID No: 5. This group included 2 out of 24 cultures.

In group 6, the maximum amount of prokineticin 1 protein was observed during transfection of the modified cDNA of the PROK 1 gene SEQ ID No: 6. This group includes 4 out of 24 cultures.

In group 7, the maximum amount of prokineticin 1 protein was observed during transfection of the modified cDNA of the PROK 1 gene SEQ ID No: 7. This group included 4 out of 24 cultures.

None of the cell cultures transfected with a gene therapeutic substance with a vector plasmid lacking the PROK 1 gene cDNA showed the maximum amount of prokineticin 1 protein, unlike cell cultures transfected with gene therapeutic substances with genetic constructs containing the gene cDNA PROK 1.

The figure 12 for each group of cell cultures shows a diagram of indicators of protein concentrations of prokineticin 1, (averaged within the group, if the group includes more than one cell culture) for all involved in the experiment of gene-therapeutic substances, after transfection of these cell cultures of gene-therapeutic substances containing modified and a portion of the native cDNA of the PROK 1 gene.

From this example, it follows that the achievement of the maximum amount of prokineticin 1 protein in the skin fibroblast cultures of various patients during their transfection with gene therapeutic substances is associated with individual characteristics of the patients and depends on the presence and type of modifications in the cDNA of the PROK 1 gene included in gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples for the maximum effectiveness of the therapeutic effect created by the gene-therapeutic substances within the group of gene-therapeutic substances is necessary. therapeutic substances.

Example 11

Introduction into the primary cell culture of the uterine endometrial epithelium of a gene-therapeutic substance with the cDNA of the PROK 1 gene in order to confirm an increase in the amount of prokineticin 1 protein.

A cell culture of human uterine endometrial epithelium was obtained by taking aspiration biopsy material. Transfection of this cell culture was carried out with a gene therapeutic substance based on the plasmid pCMV6-Kan / Neo PROK 1 SEQ ID No: 2, using PAMAM dendrimers (Weihai CY Dendrimer Technology) as a transport molecule. Plasmid pCMV6-Kan / Neo without cDNA of the PROK 1 gene was used as a control.

Before transfection, a mixture of plasmid DNA was prepared on the basis that 0.1 μl of a plasmid DNA solution (1 μg / ml) and 0.3 μl of a RAMAM dendrimer solution (1 μg / ml) with 25 μl were added to 4 μl of buffer solution Hanks. The resulting mixture was carefully picketed and incubated at room temperature for 15 minutes.

Immediately before the experiment, the primary cell culture of the human uterine endometrial epithelium was washed with DMEM. Then the cell culture was incubated for 1 h with the prepared transfection mixture at plus 37 ° C and 5% CO ₂ . As a control, 4 μl of Hanks buffer solution was added. After incubation, the cell culture was washed with DMEM, and then complete growth medium was added. Cell culture was observed under a Zeiss Axio Observer A1 microscope for 24 hours.

The cell culture of the human uterine endometrial epithelium was harvested 24, 48, 72, and 96 hours after transfection. The growth medium was selected, washed 2 times with Hanks buffer solution, 1 time with EDTA solution, then the cell culture was incubated in trypsin-EDTA solution at 37 ° C in the presence of 5% CO ₂ for 4 minutes. The trypsinization reaction was inhibited by the addition of growth medium. To get rid of the growth medium, the cell suspension was washed 2 times with Hanks buffer solution, followed by centrifugation.

The resulting precipitate was resuspended in the preservative RNAlater (Qiagen, Germany).

RNA was isolated using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer's procedure. To eliminate DNA during the RNA isolation procedure, the RNAse-Free DNAse Set (Qiagen, Germany) was used.

The concentration of isolated RNA was measured spectrophotometrically using NanoDrop 2000 (ThermoFisher Scientific Inc.). The optical density of the RNA solution was measured in the range of 220-320 nm. For work, we used samples for which the total amount of isolated RNA was not less than 10 ng / μl of RNA, the ratio A ₂₆₀ / A ₂₈₀ - not less than 1.8.

The quality of the isolated RNA was checked by capillary electrophoresis on a QIAxcel instrument (Qiagen, Germany) using an RNA Quality Control Kit cartridge using the BioGel Software program (Qiagen, Germany). The isolated RNA was stored at -80 ° C and was used for the synthesis of the first cDNA strand by RT-PCR.

The synthesis of total cDNA of the first strand was carried out using RevertAid reverse transcriptase (Thermo Scientific, USA) according to the manufacturer's procedure. In a 20 μl reaction mixture consisting of deionized water, 5X Reaction Buffer (250 mM Tris-HCl (pH 8.3 at 25 ° С), 250 mM KCl, 20 mM MgCl2, 50 mM DTT), dNTP (25 mM) was added 200 Units of reverse transcriptase and 5 pmol of a random 9-nucleotide primer, 120 ng of total RNA was used as a template. Reverse transcription was carried out under the following conditions: 1 pre-incubation cycle at 25 ° C for 10 minutes, 1 incubation cycle of 52 ° C for 30 minutes, 1 incubation cycle of 85 ° C for 5 minutes.

Total cDNA was used for real-time PCR, which was performed on a CFX96 thermocycler (Bio-Rad, USA) using the iTaq Universal SYBR Green Supermix reaction mixture (Bio-Rad, USA), which contains the intercalating dye SYBR Green I. The reaction was carried out in a volume of 20 μl according to the manufacturer's instructions using highly specific QuantiTect Primer Assay primers (Qiagen, Germany) to the PROK 1 gene and to the B2M reference gene. As the matrix used: each sample after the stage of synthesis of total cDNA. The amplification results were evaluated in real time using the software Bio-Rad CFX Manager 2.1 (Bio-Rad USA) and qBase plus (Biogazelle, Belgium). PCR was carried out under the following conditions: initial denaturation at + 95 ° C for 30 s, 45 cycles, including denaturation at + 95 ° C for 5 s, annealing of primers and elongation at + 60 ° C for 30 s.

Identification of the obtained PCR products was carried out by capillary electrophoresis in a QX DNA High Resolution cartridge (Qiagen, Germany) using a QIAxcel capillary electrophoresis device (Qiagen, Germany). A QX Alignment Marker of 15-3000 bp was used as a leveling marker, and a QX DNA Size Marker of 50-800 bp was used as a length marker. After comparing the obtained data with the theoretically calculated length of both genes, taking into account the error of the instrument (± 10 bp), it was proved that the detected product corresponds to the PROK 1 gene and the reference B2M gene. In samples with negative control, the product is not detected.

It was shown that, in a cell culture of the human uterine endometrium epithelium transfected with a gene therapeutic substance with PROK 1 cDNA, there was an increase in the amount of prokineticin 1 protein, which confirms the increased expression of the PROK 1 gene when using a gene therapeutic substance with PROK 1 cDNA. Results reflected in figure 13.

Example 12

Transfection of a cell culture of the corneal epithelium of the eye with a gene therapeutic substance in order to confirm an increase in the expression of the PROK 1 gene in this cell culture.

In order to determine the effectiveness of the gene therapeutic substance containing the cDNA of the PROK 1 gene in various cell types, as well as to assess the effect of the transport molecule on the success of transfection with this substance, the corneal epithelium of the human eye was transfected using amphiphilic block copolymers as the transport molecule.

Biopsy material from the limb region in the form of a circle with a diameter of 1-1.5 mm was placed in a Petri dish in a balanced Hanks saline solution, dispase (20 μl 25 units / ml) and gentamicin were added and incubated for 24 hours at +4. Then the epithelial layer was separated from the stroma and both tissues were cut into pieces of 1-2 mm ³ .

A suspension of epithelial cells was obtained by incubating pieces of tissue in a solution of Trypsin-EDTA for 15 minutes at + 37 ° C. Trypsinization was stopped by the addition of a soybean trypsin inhibitor in PBS. Cell suspensions were washed by centrifugation at 700 rpm and resuspended in serum-free DMEM with gentamicin. Cells were grown in 25 cm ² vials with 5 ml of medium at 37 ° C and in an atmosphere containing 5% CO2. After 24 hours, non-adherent cells were removed and 5 ml of fresh medium was added. Reseeding was performed every 7 days in a ratio of 1: 2-1: 3.

Amphiphilic block copolymers were used to transfect cells with a gene therapeutic substance containing the cDNA of the PROK 1 gene. The methodology was applied according to (IntJPharm, 2012, 427, 80-87) or in (Macromol. Biosci.2011, 11, 652-661), with some changes. The block copolymer was synthesized from a mixture of linear polyethyleneimine (PEI) (Polyscience Inc., USA) and bifunctional polyethylene glycol (PEG) N-hydroxysuccinimidyl-75-N (3-maleimidopropionyl) -amido-4, 7, 10, 13, 16, 19 , 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - tetracosoxapenta-heptacontanoate (MAL-dPEG ™ -NHS ester, Quanta BioDesign, Ltd., USA) in borate buffer. A polyplex was prepared 1 hour before the introduction into the cells by mixing the solution of the block copolymer with DNA of the genetic construct pCMV6-Kan / Neo PROK 1 SEQ ID No: 3 with the modified cDNA of the PROK 1 SEQ ID No: 3 gene. The transfection mixture was added to the cell suspension in 1 ml of DMEM culture medium with 10% fetal serum and ampicillin.

Since a construct containing a selection factor (resistance to geneticin) was used for transfection, the cells after transfection were grown in 25 cm ³ bottles with 5 ml of medium with geneticin for 12 days, changing the medium every 4 days. An aliquot of 500 μl of suspension was taken from each culture every 24 hours to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with a similar concentration and combined. The analysis of the level of the specific cDNA of the PROK 1 gene was carried out using real-time amplification according to the method and with the primers of Example 6 using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-Rad, USA) and Bio-software RadCFXManager 2.1. The maximum increase in transcription PROK 1 was observed on day 4. Figure 14 shows the accumulation curves of a specific amplification product corresponding to the cDNA of the PROK 1 gene.

It was shown that in corneal epithelial cells of the eye transfected with a gene therapeutic substance based on pCMV6-Kan / Neo PROK 1 SEQ ID No: 3, using amphiphilic block copolymers as a transport molecule, the expression of the target PROK 1 gene is enhanced.

Example 13

The introduction into the human skin of a gene-therapeutic substance with a cDNA of the PROK 1 gene in order to confirm the increase in the amount of prokineticin 1 protein in human skin.

In order to analyze the changes in the amount of prokineticin 1 protein, the patients were injected with a gene therapeutic substance containing a genetic construct with the cDNA of the PROK 1 gene (B) and a placebo, which is a combination of a vector plasmid without the cDNA of the PROK 1 gene with the transport molecule (A) - into the skin of the lower leg.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the genetic construct pCMV6 PROK 1 SEQ ID No: 4, which contains a modified cDNA of the PROK 1 gene (SEQ ID No: 4) and plasmid pCMV6- XL5, used as a placebo - which does not contain the cDNA of the PROK 1 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 3-5 cm from each other.

The amount of prokineticin 1 protein was evaluated in lysates of biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. The biopsy was performed from skin areas in the area of the introduction of the gene-therapeutic substance and placebo, as well as from intact skin, using the Epitheasy 3.5 biopsy device (Medax SRL) below, as described in Example 9.

It was shown that in the patient’s skin in the area of the introduction of the gene therapeutic substance with the cDNA of the PROK 1 gene, there was an increase in the amount of prokineticin 1 protein, while with placebo, the amount of prokineticin 1 protein in the skin did not change, which indicates increased expression of the PROK 1 gene when using the gene therapeutic substance with cDNA of the PROK gene 1. The results are shown in figure 15.

Example 14

The introduction into the human cartilage of a gene-therapeutic substance with the cDNA of the PROK 1 gene in order to confirm the increase in the amount of prokineticin 1 protein in human cartilage.

In order to analyze the changes in the amount of prokineticin 1 protein, patients were injected with a gene therapeutic substance containing a genetic construct with the cDNA of the PROK 1 gene (B) and a placebo, which is a combination of a vector plasmid without the cDNA of the PROK 1 gene with the transport molecule (A), was administered cartilaginous tissue of the auricles on the back side.

Liposome powder TRANSFAST ™ Transfection Reagent (PROMEGA, USA) according to Example 9 was used as a transport molecule. Next, the genetic construct pCDNA 3.1 PROK 1 SEQ ID No: 5, which contains a modified cDNA of the PROK 1 gene (SEQ ID No: 5), and a plasmid pCDNA 3.1 (+), used as a placebo, which does not contain the cDNA of the PROK 1 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunneling method with a 30G needle to a depth of 1 - 2 mm in the cartilaginous tissue of the auricles from the back side. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 2-4 cm from each other.

The amount of prokineticin 1 protein was evaluated in lysates of the patient’s cartilage biopsy samples by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. The biopsy was performed from cartilage tissue sites in the area of the introduction of the gene-therapeutic substance, as well as from the intact areas and in the placebo area, using the Epitheasy 3.5 biopsy device (Medax SRL), further according to Example 9.

It was shown that in the patient’s cartilage tissue in the area of the introduction of the gene therapeutic substance with the cDNA of the PROK 1 gene, there was an increase in the amount of prokineticin 1 protein, while when the placebo was administered, the amount of prokineticin 1 protein in the cartilage did not change, which confirms the increased expression of the PROK 1 gene when using a gene therapeutic substance with cDNA of the PROK gene 1. The results are shown in figure 16.

Example 15

The introduction into the muscle tissue of a human gene of a therapeutic substance with a cDNA of the PROK 1 gene in order to confirm the increase in the amount of prokineticin 1 protein in human muscle tissue.

To analyze the change in the amount of prokineticin 1 protein, patients were injected with a gene therapeutic substance containing a vector plasmid with the cDNA of the PROK 1 gene (B) and a placebo, which is a combination of a vector plasmid without the cDNA of the PROK 1 gene with the transport molecule (A), was administered muscle tissue in the area of the forearm.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the pCMV6-Kan / Neo PROK 1 SEQ ID No: 6 genetic construct, which contains the modified PROK 1 gene cDNA (SEQ ID No: 6) and the plasmid pCMV6-Kan / Neo, used as a placebo, which does not contain the cDNA of the PROK 1 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade.

To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 15-20 mm. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.5 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 5-7 cm from each other

The amount of prokineticin 1 protein was evaluated in lysates of biopsies of muscle tissue of a patient by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. A biopsy was performed from muscle tissue in the area of the introduction of the gene-therapeutic substance, as well as from intact areas of the muscle and in the placebo, using the MAGNUM automatic biopsy device (company BARD, USA), hereinafter in Example 9.

It was shown that in the patient’s muscle tissue in the area of the introduction of the gene therapeutic substance with the cDNA of the PROK 1 gene, there was an increase in the amount of prokineticin 1 protein, while with placebo, the amount of prokineticin 1 protein in the muscle tissue did not change, which confirms the increased expression of the PROK 1 gene when using a gene therapeutic substance with cDNA of the PROK gene 1. The results are shown in figure 17.

Example 16

The introduction to a group of different patients of gene-therapeutic substances containing modified cDNA of the PROK 1 gene and a portion of the native unmodified cDNA of the PROK 1 gene.

In order to confirm the individual character of the increase in the amount of prokineticin 1 protein to a different level when the gene therapeutic substances with modified and unmodified cDNA of the PROK 1 gene are introduced into the skin of the patients, the quantitative level of prokineticin 1 protein in the lysate of biopsy samples of the skin group of patients was analyzed depending on the presence and type of modifications cDNA of the PROK 1 gene.

The sequence of the portion of the native unmodified cDNA of the PROK 1 gene is shown in Figure 1, PROK 1 SEQ ID No: 1, the sequences of the modified cDNA of the PROK 1 gene are shown in Figures 2-7 (PROK 1 SEQ ID No: 2, PROK 1 SEQ ID No: 3, PROK 1 SEQ ID No: 4, PROK 1 SEQ ID No: 5, PROK 1 SEQ ID No: 6, PROK 1 SEQ ID No: 7).

Moreover, genetic constructs, one of which contains a portion of the native unmodified cDNA of the PROK 1 gene (SEQ ID No: 1), the second genetic construct contains a portion of the modified cDNA of the PROK 1 gene (SEQ ID No: 2), the third genetic construct contains a modified cDNA of the PROK gene 1 (SEQ ID No: 3), the fourth genetic construct contains a modified cDNA of the PROK 1 gene (SEQ ID No: 4), the fifth genetic construct contains a modified cDNA of the PROK 1 gene (SEQ ID No: 5), the sixth genetic construct contains a modified cDNA of the gene PROK 1 (SEQ ID No: 6), gray The eighth genetic construct contains a modified cDNA of the PROK 1 gene (SEQ ID No: 7), the eighth genetic construct (placebo), is the pCMV6 XL5 vector, dissolved in sterile water of the Nuclease-Free purification grade. To obtain gene therapeutic substances, DNA complexes were prepared in combination with transport molecules - liposomes according to example 9.

The resulting seven variants of gene therapeutic substances and a placebo were used for administration to the skin of patients. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Each of the 23 patients who were randomly selected was injected with 7 gene-therapeutic substances and a placebo into the skin of the lower leg.

Biopsy samples were taken 72 hours after the introduction of gene-therapeutic substances. The biopsy was performed from the sites of the introduction of gene-therapeutic substances, placebo, as well as from intact skin, using the device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 3 mm, and the weight was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

A - biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 1, containing unmodified cDNA of the PROK 1 gene (SEQ ID No: 1) according to Example 2 in combination with transport molecules - liposomes according to Example 9.

B - a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 2, containing a modified cDNA of the PROK 1 gene (SEQ ID No: 2) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

C is a biopsy obtained after the introduction of a gene therapeutic substance based on pCMV6-SEQ ID No: 3, containing the modified cDNA of the PROK 1 gene (SEQ ID No: 3) according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

D is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 4, containing a modified cDNA of the PROK 1 gene (SEQ ID No: 4) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

E is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 5, containing a modified cDNA of the PROK 1 gene (SEQ ID No: 5) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

F - biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 6, containing a modified cDNA of the PROK 1 gene (SEQ ID No: 6) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

G is a biopsy obtained after the introduction of a gene therapeutic substance based on pCMV6-SEQ ID No: 7, containing a modified cDNA of the PROK 1 gene (SEQ ID No: 7) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

H is the biopsy obtained after the introduction of the vector plasmid pCMV6-XL5 that does not contain the cDNA of the PROK 1 gene according to Example 3 in combination with the transport molecules - liposomes of Example 9.

The amount of prokineticin 1 protein was evaluated in nine skin biopsies from each patient (A to H and intact skin biopsy) 72 hours after the administration of gene therapeutic substances by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

Based on the results of the analysis of the quantitative level of prokineticin 1 protein, indicators were selected for each biopsy from each patient, which showed the maximum levels of prokineticin 1 protein and combined them into seven groups based on the following criteria:

In group 1, the maximum amount of prokineticin 1 protein was observed with the introduction of unmodified cDNA of the PROK 1 gene SEQ ID No: 1. This group included 3 biopsies out of 23.

In group 2, the maximum amount of prokineticin 1 protein was observed with the introduction of the modified cDNA of the PROK 1 gene SEQ ID No: 2. This group included 3 biopsies out of 23.

In group 3, the maximum amount of prokineticin 1 protein was observed with the introduction of the modified cDNA of the PROK 1 gene SEQ ID No: 3. This group included 3 biopsies out of 23.

In group 4, the maximum amount of prokineticin 1 protein was observed with the introduction of the modified cDNA of the PROK 1 gene SEQ ID No: 4. This group included 4 biopsies out of 23.

In group 5, the maximum amount of prokineticin 1 protein was observed with the introduction of the modified cDNA of the PROK 1 gene SEQ ID No: 5. This group included 3 biopsies out of 23.

In group 6, the maximum amount of prokineticin 1 protein was observed with the introduction of the modified cDNA of the PROK 1 gene SEQ ID No: 6. This group included 5 biopsies out of 23.

In group 7, the maximum amount of prokineticin 1 protein was observed with the introduction of the modified cDNA of the PROK 1 gene SEQ ID No: 7. This group included 2 biopsies out of 23.

None of the biopsy specimens into which the placebo gene therapeutic substances were introduced - a vector plasmid containing the cDNA of the PROK 1 gene, showed the maximum amount of prokineticin 1 protein, unlike the biopsy specimens into which the gene therapeutic substances with genetic constructs containing cDNA of the PROK 1 gene.

The figure 18 for each group of biopsy samples shows diagrams of indicators of protein concentration (averaged within the group, if more than one biopsy is included in the group) for all genetically therapeutic substances participating in the experiment, after the patients have been given these gene therapeutic substances, containing modified and a portion of the native cDNA of the PROK 1 gene.

From this example, it follows that the achievement of the maximum amount of prokineticin 1 protein in biopsies of the skin of various patients when they introduce gene-therapeutic substances into the skin is associated with individual characteristics of patients and depends on the presence and type of modifications in the cDNA of the PROK 1 gene included in the gene therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples for the maximum effectiveness of the therapeutic effect created by the gene-therapeutic substances within the group of gene-therapeutic substances is necessary. therapeutic substances.

Example 17

Transfection of a patient’s fibroblast cell line with different therapeutic genes containing modified PROK 1 cDNA and a portion of native unmodified PROK 1 cDNA to personalize the most effective gene therapeutic substance from the group of gene therapeutic substances for this patient for subsequent transfection with this substance patient cells as part of a therapeutic procedure.

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of prokineticin 1 protein was analyzed in the patient’s cell fibroblast lysates transfected with different gene-therapeutic substances containing a portion of the native unmodified cDNA of the PROK 1 gene and / or modified PROK 1 gene cDNA.

The sequence of the portion of the native unmodified cDNA of the PROK 1 gene is shown in Figure 1, PROK 1 SEQ ID No: 1, the sequences of the modified cDNA of the PROK 1 gene are shown in Figures 2-7 (PROK 1 SEQ ID No: 2, PROK 1 SEQ ID No: 3, PROK 1 SEQ ID No: 4, PROK 1 SEQ ID No: 5, PROK 1 SEQ ID No: 6, PROK 1 SEQ ID No: 7).

Fibroblast cultures from the patient’s biopsy were grown according to Example 5, aliquots were taken and cell lysis was performed: the cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethyl sulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm.

Then the patient’s fibroblast culture was divided into 8 parts. The first part, designated (A), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 1 vector containing a portion of the native unmodified cDNA of the PROK 1 gene (SEQ ID No: 1) according to Example 2 in combination with transport molecules - liposomes according to example 9.

The second part, designated (B), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 2 vector containing a portion of the modified PROK 1 gene cDNA (SEQ ID No: 2) according to Example 3 in combination with transport molecules - liposomes of example 9.

The third part, designated (C), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 3 vector containing the modified PROK 1 gene cDNA (SEQ ID No: 3) according to Example 3 in combination with liposome transport molecules as in example 9.

The fourth part, labeled (D), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 4 vector containing the modified cDNA of the PROK 1 gene (SEQ ID No: 4) according to Example 3 in combination with liposome transport molecules as in example 9.

The fifth part, designated (E), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 5 vector containing the modified PROK 1 gene cDNA (SEQ ID No: 5) according to Example 3 in combination with liposome transport molecules as in example 9.

The sixth part, designated (F), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID NO: 6 vector containing the modified cDNA of the PROK 1 gene (SEQ ID NO: 6) according to Example 3 in combination with liposome transport molecules as in example 9.

The seventh part, designated (G), was transfected according to Example 7 with a gene therapeutic substance based on the vector pCMV6-SEQ ID No: 7 containing the modified cDNA of the PROK 1 gene (SEQ ID No: 7) according to Example 3 in combination with liposome transport molecules as in example 9.

The eighth part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 that did not contain the PROK 1 gene cDNA according to Example 3 in combination with the transport liposome molecules of Example 9.

The amount of prokineticin 1 protein in the patient’s fibroblast cell lysates was determined 72 hours after transfection by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

According to the results of determining the amount of prokineticin 1 protein, a variant of the gene therapeutic substance was isolated in the patient’s fibroblast culture, during transfection of which the maximum amount of prokineticin 1 protein is observed, in the cell culture lysate and, accordingly, the maximum expression of the PROK 1 gene is observed. In this experiment, the maximum amount of prokineticin 1 protein , in the lysate, it was noted during transfection with a gene therapeutic substance based on pCMV6 PROK 1 SEQ ID No: 5 containing unmodified cDNA of the PROK 1 gene, which is shown in ph Ur 19.

Thus, the most effective gene-therapeutic substance has been selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Example 18

The introduction into the patient’s skin of various gene-therapeutic substances containing modified PROK 1 gene cDNA and a portion of the native unmodified PROK 1 gene cDNA to select from the group of gene therapeutic substances the most effective gene-therapeutic substance for this patient for subsequent administration of this substance to the patient in as part of a therapeutic procedure.

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of prokineticin 1 protein was analyzed in the lysates of biopsy samples of the skin of this patient, after introducing into the skin gene-therapeutic substances containing modified cDNA of the PROK 1 gene and / or a portion of the native cDNA of the PROK gene one.

The sequence of the portion of the native unmodified cDNA of the PROK 1 gene is shown in Figure 1, PROK 1 SEQ ID No: 1, the sequences of the modified cDNA of the PROK 1 gene are shown in Figures 2-7 (PROK 1 SEQ ID No: 2, PROK 1 SEQ ID No: 3, PROK 1 SEQ ID No: 4, PROK 1 SEQ ID No: 5, PROK 1 SEQ ID No: 6, PROK 1 SEQ ID No: 7).

The patient was administered 7 gene-therapeutic substances and a placebo into the skin of the lower leg.

The first gene therapeutic substance (A) based on pCMV6-SEQ ID No: 1, containing a portion of the native unmodified cDNA of the PROK 1 gene (SEQ ID No: 1) according to Example 2 in combination with the transport molecule dendrimer according to Example 7.

The second gene therapeutic substance (B) based on pCMV6-SEQ ID No: 2, containing the modified cDNA of the PROK 1 gene (SEQ ID No: 2) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The third gene therapeutic substance (C) based on pCMV6-SEQ ID No: 3, containing the modified cDNA of the PROK 1 gene (SEQ ID No: 3) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The fourth gene therapeutic substance (D) based on pCMV6-SEQ ID No: 4, containing the modified PROK 1 gene cDNA (SEQ ID No: 4) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The fifth gene therapeutic substance (E) based on pCMV6-SEQ ID No: 5, containing the modified PROK 1 gene cDNA (SEQ ID No: 5) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The sixth gene therapeutic substance (F) based on pCMV6-SEQ ID No: 6, containing the modified cDNA of the PROK 1 gene (SEQ ID No: 6) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The seventh gene therapeutic substance (G) based on pCMV6-SEQ ID No: 7, containing the modified cDNA of the PROK 1 gene (SEQ ID No: 7) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The eighth vector plasmid pCMV6-XL5 not containing the cDNA of the PROK 1 gene of Example 3 in combination with the transport molecule dendrimer of Example 7.

Moreover, the genetic constructs, one of which contains a portion of the native unmodified cDNA of the PROK 1 gene (SEQ ID No: 1), the second genetic construct contains the modified cDNA of the PROK 1 gene (SEQ ID No: 2), and the third genetic construct contains the modified cDNA of the PROK 1 gene (SEQ ID No: 3), the fourth genetic construct contains a modified cDNA of the PROK 1 gene (SEQ ID No: 4), the fifth genetic construct contains a modified cDNA of the PROK 1 gene (SEQ ID No: 5), the sixth genetic construct contains a modified cDNA of the PROK gene 1 (SEQ ID No: 6), seventh gene The genetic construct contains a modified cDNA of the PROK 1 gene (SEQ ID No: 7), the eighth plasmid (placebo), is a vector pCMV6 XL5, dissolved in sterile water of the Nuclease-Free purification level. To obtain gene therapeutic substances, DNA-dendrimer complexes were prepared according to Example 7.

The resulting seven variants of gene-therapeutic substances and placebo were used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Biopsy samples were taken 72 hours after the introduction of gene-therapeutic substances. The biopsy was performed from the sites of the introduction of gene-therapeutic substances, placebo, as well as from intact skin using the device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 3 mm, and the weight was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

The determination of the amount of prokineticin 1 protein was determined in nine biopsy samples of the patient’s skin 72 hours after the introduction of gene therapeutic substances by enzyme-linked immunosorbent assay (ELISA) using the Human Prokineticin 1 kit, PROK1 ELISA Kit (CD creative diagnostics, USA), as described in Example 8.

According to the results of determining the amount of prokineticin 1 protein, a variant of the gene therapeutic substance was isolated in the lysate of biopsy samples of the patient’s skin; when introduced into the skin, the maximum amount of prokineticin 1 protein was observed in the lysate of the skin biopsy and, accordingly, the maximum expression of the PROK 1 gene was observed. In this experiment, the maximum amount the target protein in the skin biopsy lysate was noted with the introduction of a gene therapeutic substance based on pCMV6 PROK 1 SEQ ID No: 6 containing a modified cDNA of the PROK 1 gene, as shown in FIG. 20 e.

Thus, the most effective gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

An agent has been developed for treating conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein, consisting of one or more gene therapeutic substances from the group of gene therapeutic substances for correcting pathological conditions of cells of organs and tissues and / or human organs and tissues resulting from insufficient expression of the PROK 1 gene, method for its preparation and use.

An invented tool for treating conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein, consisting of one or more gene therapeutic substances from the group of gene therapeutic substances using one of the modified cDNA of the PROK 1 gene or region native unmodified cDNA of the PROK 1 gene allows in practice to use the genetically therapeutic substances included in the group to increase the amount of prokinetic protein to the required level by 1, in various cells of organs and tissues and / or organs and tissues of a person by increasing the expression of the PROK 1 gene.

As a result of preliminary studies of the biopsy of the patient, or cells grown from these biopsies, determine which version of the gene therapeutic substance from the created group of gene therapeutic substances must be selected for this patient in order to increase the amount of prokineticin 1 protein in the cells of these organs and tissues and / or organs and tissues to the required level for a particular patient. In cases where the use of a gene-therapeutic substance with a portion of native unmodified cDNA of the PROK 1 gene does not lead to the desired change in the amount of prokineticin 1 protein in the cells of organs and tissues and / or organs and tissues, it is necessary to use a substance based on the modified cDNA of the PROK gene 1 leading to more efficient expression of the PROK 1 gene.

When using the claimed gene therapeutic substance, there is no embedding of exogenous genetic material in the genome of the cell.

The group of gene-therapeutic substances provides a high level of expression of the PROK 1 gene by increasing the amount of prokineticin 1 protein in the cells of organs and tissues and / or organs and tissues of a person, in particular fibroblasts, in the endotheliocytes of the testes, adrenal glands, ovaries and placenta, in the vagina, neck , uterine appendages, parts of the brain, cerebellum, pituitary gland, cerebral cortex, spinal cord, prostate gland, heart, mammary glands, spleen, skeletal muscle tissue, bladder, gall bladder, foot skin, suprapubic skin, the osseum, the mucous membrane of the cervical canal, subcutaneous fatty tissue, visceral fatty tissue, in combination with or without a transport molecule during transfection of these organs with therapeutic substances of human organs and tissues and / or in human organs and tissues, in particular, fibroblasts, endothelial cells of the testes, adrenal glands, ovaries and placenta, in the vagina, cervix, appendages of the uterus, parts of the brain, cerebellum, pituitary gland, cerebral cortex, spinal cord, prostate gland, heart, mammary glands, spleen e, skeletal muscle tissue, bladder, gall bladder, leg skin, suprapubic skin, cornea, cervical canal mucosa, subcutaneous fat, visceral adipose tissue in combination with or without a transport molecule with the introduction of these gene therapeutic substances into organs and human tissue.

Thus, the above examples confirm the fulfillment of the task, namely, the creation of a highly effective agent for treating the conditions of the human body associated with a decrease in the level of expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein, based on gene therapeutic substances with the PROK 1 gene, representing a group of gene therapeutic substances, when used, taking into account the individual characteristics of the patient, there is an increase in the level of expression of the PROK 1 gene and / or an increase in count amounts of prokineticin 1 protein in the cells of organs and tissues and / or organs and tissues of the body.

In addition, with the introduction of genetic constructs, in contrast to the introduction of the protein itself, the required frequency of their introduction is reduced due to the prolonged action, and intracellular delivery is also facilitated.

An increase in the efficiency of correction of the quantitative level of prokineticin 1 protein in human organs and tissues is achieved due to the fact that with an insufficient amount of this protein due to a defect in the PROK 1 gene, not a protein is used, but a genetic construct with cDNA of the PROK 1 gene encoding this protein.

Industrial applicability

All the above examples on the creation and use of the created group of gene therapeutic substances confirm its industrial applicability.

List of abbreviations

DNA - deoxyribonucleic acid

cDNA - complementary deoxyribonucleic acid

RNA - ribonucleic acid

mRNA - template ribonucleic acid

PCR - polymerase chain reaction

ml - milliliter, μl - microliter

l - liter

mcg - micrograms

mg - milligram

g - gram

μM - micromol

mm - millimole

rpm - revolutions per minute

nm - nanometer

cm - centimeter

MW - milliwatts

o.e.f. - relative unit of fluorescence

GTS - a gene-therapeutic substance

Claims (5)

1. An agent for treating conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein based on gene therapeutic substances with the PROK 1 gene, representing at least one gene therapeutic substance selected from the group of gene therapeutic substances, each of which represents a genetic construct based on a vector plasmid comprising the cDNA of the PROK 1 gene, with the coding sequence of the prokineticin 1 protein, with 5 ′ and 3 ′ non-translating deletions regions, namely, obtained on the basis of a portion of the native unmodified cDNA of the PROK 1 gene of SEQ ID No: 1 or modified cDNA of the PROK 1 gene, while SEQ ID No: 2, or SEQ ID No: 3, is used as the modified cDNA of the PROK 1 gene, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that provide a high level of expression of the PROK 1 gene in eukaryotic cells, in cells of human organs and tissues, where cells of human organs and tissues are selected from fibroblasts , endothelial cells of the testes, adrenal glands, ovaries and placenta, vagina, neck, appendages of the uterus, brain, cerebellum, pituitary gland, cerebral cortex, spinal cord, prostate gland, heart, mammary glands, spleen, skeletal muscle tissue, bladder, gall bladder, skin of the foot, suprapubic skin, cornea, mucous membrane of the cervical canal, subcutaneous fat, visceral adipose tissue in combination with or without a transport molecule when this agent is introduced into human organs and tissues. 2. The tool according to p. 1, characterized in that each genetic construct with a modified cDNA of the PROK 1 gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the PROK 1 gene, which carries modifications that do not affect the structure of the prokineticin 1 protein, namely : nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, or a combination of the above modifications, and do not affect the amino acid sequence encoded by this sequence. 3. The tool according to p. 1, characterized in that as the transport molecule using liposomes, or dendrimers of the 5th and higher generations, or amphiphilic block copolymers. 4. A method of obtaining a means for treating conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin 1 protein according to claim 1, which consists in obtaining each gene therapeutic substance from the group of gene therapeutic substances, the gene cDNA being obtained PROK 1, then cDNA is placed in a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, the required amount of gene-therapeutic sub is increased and secreted stations, then combine the gene-therapeutic substance with a transport molecule to transfect the obtained organ and tissue cells and / or introduce the obtained agent into human organs and tissues, using the cDNA of the PROK 1 gene with the coding sequence of the prokineticin 1 protein, with 5 ′ deletions and 3'-untranslated regions, obtained on the basis of a portion of native unmodified cDNA of the PROK 1 gene SEQ ID No: 1 or modified cDNA of the PROK 1 gene, while either SEQ ID No: 2 or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these gene therapeutic substances is used. 5. The method of using the agent for treating conditions of the human body associated with a decrease in the expression of the PROK 1 gene and / or a decrease in the amount of prokineticin protein, which consists in transfecting with the agent according to claim 1 on the basis of a gene-therapeutic substance or substances selected or selected from the group created by gene -therapeutic substances, cells of organs and tissues of a patient and / or in the introduction into the organs and tissues of a patient of autologous cells of a patient transfected with the created agent for treatment based on gene therapy substance or substances selected or selected from the group of created gene-therapeutic substances, and / or in the introduction into the organs and tissues of a patient of a medicament for treatment based on gene-therapeutic substance or substances selected or selected from the group of created gene-therapeutic substances, or a combination of the indicated methods.

Images