RU2651757C2 - Line of biologically active gene-therapeutic substances based on sod2 gene for correction of pathological conditions of cells of organs and tissues and human organs and tissues related to oxidative stress, method of obtaining and using - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: group of inventions refers to medicine and concerns a means for correcting the pathological conditions of cells of organs and tissues and/or organs and tissues of human based on the SOD2 gene associated with oxidative stress, where the cells of organs and tissues are selected from cells of fibroblasts, keratocytes and epithelial cells of the eye, chondroblasts; organs and tissues are selected from the skin, the mucous membrane of the human mouth or the human muscle tissue, which is a collection of biologically active gene therapy substances, each of which is a gene therapeutic substance selected from the group of gene therapeutic substances, each being a genetic construct based on a vector plasmid comprising the cDNA of the SOD2 gene, with the coding sequence of the superoxide dismutase-1 protein, with deletions of 5' and 3' non-translated regions, namely the SOD2 gene derived from the site of the native unmodified cDNA, SEQ ID No: 1, or a modified cDNA of the SOD2 gene, with the modified cDNA of the SOD2 gene using SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that ensure transcription of this sequence in eukaryotic cells, human organs and tissues, in combination with or without a transport molecule. Group of inventions also relates to a method for producing said agent; a method of using said agent for correcting the pathological conditions of cells of organs and tissues and/or human organs and tissues based on the SOD2 gene associated with a quantitative reduction in the SOD2 protein.

EFFECT: group of inventions provides a high and stable level of the target protein in the cells.

5 cl, 18 ex, 20 dwg

Description

FIELD OF THE INVENTION

The invention relates to molecular biology, biotechnology, genetic engineering and medicine and can be used to enhance the protection of cells of various organs and tissues, as well as the organs and tissues of a person from oxidative stress, in particular for therapeutic purposes.

Prior level.

Oxidative stress is an imbalance between the processes of formation of active oxygen species (free radicals) and the processes of their neutralization. It leads to damage to cells, tissues and organs of a living organism, in particular, to premature aging of the skin, since of all the systems of a living organism, it is the skin that is most exposed to active oxygen species.

In addition, the respiratory system (exposure to a large amount of oxygen), the brain (high metabolic activity and low levels of endogenous antioxidants), the eyes (constant UV irradiation), the circulatory system (fluctuations in oxygen and nitric oxide levels) and the reproductive system are most prone to oxidative stress. (high metabolic activity of sperm).

Active oxygen species can be endogenous, i.e. products of various metabolic processes in the body. For example, the most common oxidizing agent in the body - hydroxide anion (OH-) - is formed during many aerobic processes. Also, active forms of oxygen can be of exogenous origin. They are formed under the influence of ultraviolet, ionizing and electromagnetic radiation, and also as a result of interaction with oxidizing agents from the environment, for example, with ozone.

Another common active form of oxygen is superoxide anion (O ₂ .-). Unlike the hydroxyl radical, superoxide anion is less active, but has a longer lifetime. In addition, he himself can be a source of the formation of hydroxide anions. Under normal conditions, the superoxide anion, like other free radicals, is quickly neutralized by natural antioxidants - intracellular, membrane and extracellular. Intracellular antioxidants include superoxide dismutase, peroxidase and catalase proteins.

Superoxide dismutases - superoxide dismutase-1 (cytoplasmic, or Cu-Zn-containing) and superoxide dismutase-2 (mitochondrial, or Mn-containing) - catalyze the conversion of superoxide anion to oxygen and hydrogen peroxide, which is then utilized by glutathione peroxidases and catalase.

Therefore, with a reduced activity of superoxide dismutase or with an increased rate of formation of reactive oxygen species, the probability and intensity of oxidative damage to cells and tissues increase.

There are several approaches to enhance the neutralization of the action of reactive oxygen species and reduce the influence of oxidative stress.

The use of organic substances of natural origin with antioxidant activity is known. This principle underlies the production of cosmetics.

So, a composition was proposed for internal use for the correction of hormonal aging of the skin, containing a hormone-like substance of plant origin diosgenin from the root of dioscorea, one or more antioxidants selected from vitamin C, vitamin E, coenzyme Q10, as well as hyaluronic acid (RU 2527344). It was shown that the above composition effectively corrects the hormonal aging of the skin, increases the density and turgor of the skin by stimulating the production of collagen-elastin fibers and providing antioxidant protection. The disadvantage of this approach is that these substances have a short-term effect and require constant use, can cause side effects, for example, an allergic reaction, the use of antioxidant preparations complements the body's antioxidant systems, but does not completely compensate for their insufficient work.

It is also known to use, as drugs, the actual proteins - antioxidants.

So in the patent US 6045809 to neutralize the toxic effects of reactive oxygen species, it was proposed to use the composition of the enzyme - the antioxidant superoxide dismutase and at least one of the lipids (for example, ceramides) or proteins (for example, prolamins). New pharmaceutical compositions are intended for oral administration. The disadvantage of this approach is that with this method of administration, the desired therapeutic effect may not be achieved, and also, with an insufficient degree of purification, adverse reactions are possible.

In the patent US 8916373 it was proposed to use recombinant modified variants of superoxide dismutase-1, in which due to the created mutations in the nucleotide sequence, changes in the amino acid structure of the protein occurred (the degree of identity of the modified variants of the protein and the native protein is at least 80%). Recombinant plasmids transfected cultures of human kidney embryonic cells (HEK cells, HEK293FT line) or mouse embryonic fibroblasts (3T3s, NIH 3T3 lines), in which the presence of modified proteins was determined by immunoblotting, after which their enzymatic activity was determined. It was found that the activity of some variants increased by more than 3 times compared with the wild-type protein. The disadvantage of this approach is that the introduction of modifications into the amino acid sequence of a natural protein can lead to the formation of structures that are antigenic determinants.

For the prototype, the authors decided on patent US 8926965, which proposes the use of recombinant superoxide dismutase-2 protein to reduce oxidative stress in cells, tissues and organs.

Manganese-dependent superoxide dismutase-2, localized in mitochondria, is an important enzyme that controls the level of free radicals in the cell. Since mitochondria is seriously susceptible to oxidative stress, the functional features of superoxide dismutase-2 are relevant for use, as they can compensate or exacerbate oxidative stress (Green D.R., Reed J.C., 1998). Numerous studies confirm that mitochondrial superoxide dismutase-2 plays an important role in protecting cells from oxidative stress. In the patent US 8926965 it was proposed to use a recombinant modified variant of superoxide dismutase-2, in which due to the created mutations in the nucleotide sequence, changes in the amino acid structure of the protein of at least K53 and K89 occurred (the degree of identity of the modified version of the protein and the native protein is at least 95%). The nucleotide sequence encoding the modified protein was introduced into the host cell (mammalian cell, for example, humans, primates, rodents, etc., an insect cell, yeast cell, prokaryotic cells, for example bacterial) using a recombinant expression vector that provided protein translation . It was shown that the enzymatic activity of modified superoxide dismutase-2 is more than 10 times higher than that of unmodified protein. It was also stated that the modified peptide can be used to reduce oxidative stress and / or oxidative damage to the cell, both the drug itself and in composition with other active and auxiliary components.

The disadvantage of this approach is the high cost of obtaining pure recombinant protein, its more frequent administration during therapy (which increases the cost of therapy and increases the risk of side effects) and the complexity of intracellular drug delivery. In addition, modifications to the amino acid sequence of a natural protein can lead to the formation of structures that are antigenic determinants. Also, when creating a therapeutic agent for the prototype, the individual characteristics of the patient are not taken into account.

Disclosure of invention

The objective of the invention is to create a line of highly effective biologically active gene therapeutic substances that can prevent the decrease of the antioxidant activity of the superoxide dismutase-2 protein in the cells of organs and tissues and / or organs and tissues of a person by increasing the expression of the SOD2 gene in the cells of organs and tissues and / or organs and human tissues, and / or by increasing the activity of the superoxide dismutase-2 protein, responsible for maintaining the redox balance in the cells of organs and tissues and / or organs and tissues of the organism, taking into account the individual patient.

This problem is solved due to the fact that a line of biologically active gene therapeutic substances has been created for the correction of pathological conditions of cells of organs and tissues and / or human organs and tissues associated with oxidative stress, each of which is a genetic construct based on a vector plasmid containing native cDNA of the SOD2 gene SEQ ID No: 1 or one of the modified cDNA of the SOD2 gene, and also containing regulatory elements that ensure transcription of this sequence in eukaryotic cells and, in particular, in cells of human organs and tissues and capable of providing a high level of SOD2 gene expression and increasing the activity of superoxide dismutase-2 protein in cells of organs and tissues and / or human organs and tissues, in particular in hematopoietic cells, or hepatocytes, or mesenchymal stem cells, or chondroblasts, or pancreatic cells (for example, in pancreatic islet cells), or skin myocytes or fibroblasts, or keratocytes, or corneal epithelial cells, or in neurons, ganglia, Schwann cells, astrocytes, oligodendrocytes, microglia, or in spermatozoa, or in nephrons, or endothelial cells, or epithelial cells in combination with or without a transport molecule during transfection with these biologically active gene therapeutic substances of human and / or human cells and / or organs and human tissues, in particular in the skin, joints, liver, adrenal glands, kidneys, brain and spinal cord, lungs, heart, vessels, gastrointestinal tract, prostate, pancreas, eye, cornea, mucous membrane e, cartilage tissue, muscle tissue in conjunction with the transport molecule with or without the introduction of these biologically active substances gene therapy in human organs and tissues. At the same time, the genetic construct with cDNA of the SOD2 gene contains a nucleotide sequence that includes the protein coding region of the cODA of the SOD2 gene, which carries modifications that do not affect the structure of the superoxide dismutase-2 protein, namely: deletions of 5 'untranslated regions or deletions of 3'-untranslated regions, or nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, or a combination of the above modifications and, accordingly, do not affect the amino acid encoded by this sequence th sequence. As a modified cDNA of the SOD2 gene, SEQ ID No: 2 is used. Or, as a modified cDNA of the SOD2 gene, use SEQ ID No: 3. Or, as a modified cDNA of the SOD2 gene, use SEQ ID No: 4. Or, as a modified cDNA of the SOD2 gene, use SEQ ID No: 5. Or, as a modified cDNA of the SOD2 gene, use SEQ ID No: 6. Or, as a modified cDNA of the SOD2 gene, use SEQ ID No: 7. Moreover, liposomes, or dendrimers of the 5th and higher generations, or amphiphilic block copolymers are used as a transport molecule.

A method of obtaining a biologically active gene-therapeutic substance for the correction of pathological conditions of cells of organs and tissues and / or human organs and tissues associated with oxidative stress from the created line consists in the production of SOD2 gene cDNA, then cDNA is inserted into a vector plasmid capable of providing high level of expression of this cDNA in cells of various organs and tissues of a person, they increase and secrete the necessary amount of genetic construct, then combine the genetic construct with tra an export molecule for transfection of the obtained biologically active gene therapeutic substance of cells of organs and tissues and / or the introduction of the obtained biologically active gene therapeutic substance into human organs and tissues.

Or a method for producing each biologically active gene-therapeutic substance for correcting pathological conditions of cells of various organs and human tissues associated with oxidative stress from the created line, which consists in the fact that SOD2 gene cDNA is obtained, modify it according to 3, or 4, or 5 or 6 or 7 or 8, then the modified cDNA is placed in a vector construct capable of providing a high level of expression of this cDNA in cells of various organs and tissues of the person, the necessary amount of the genetic construct is increased and secreted, then the genetic construct is combined with a transport molecule for transfecting the obtained biologically active gene therapeutic substance of cells of organs and tissues and / or introducing the obtained biologically active gene therapeutic substance into the organs, etc. kani man.

The method of using each of the biologically active gene-therapeutic substances created and presented in the lineup to correct the pathological conditions of cells of organs and tissues and / or organs and tissues of a person associated with oxidative stress is to transfect the created biologically active gene-therapeutic substance, and selected from line taking into account the individual characteristics of each individual patient based on a preliminary experiment to determine the most effective option for the patient and from the established and represented in the line of biologically active substances, gene therapy, cells, organs and tissues.

Or a method of using each of the biologically active gene-therapeutic substances created and presented in the lineup to correct the pathological conditions of cells of organs and tissues and / or human organs and tissues associated with oxidative stress, which consists in administering one of the created biologically active gene-therapeutic substances, selected from the line for this patient on the basis of a preliminary experiment to determine the most effective option for the patient from those created and presented in the line of biologically active gene-therapeutic substances, into the organs and tissues of this patient, and / or in the introduction of autologous cells of a patient transfected with one of the created biologically active gene-therapeutic substances selected for this patient on the basis of a preliminary experiment to determine the most effective for the patient, a variant of the created and presented in the line of biologically active gene-therapeutic substances into the organs and tissues of this patient.

The implementation of the invention

List of figures

In FIG. one

The nucleotide sequence of the unmodified cDNA of the SOD2 gene is presented, the sequence of which is identical to that given in the GenBank database under the number NM_000636.2 - SOD2 SEQ ID NO: 1.

In FIG. 2

Presents the nucleotide sequence of the modified cDNA of the SOD2 gene, SEQ ID NO: 2, which

contains 3 nucleotide substitutions G → C at positions 199, 286 and 322, which do not lead to changes in the amino acid sequence of superoxide dismutase-2 protein.

In FIG. 3

Presents the nucleotide sequence of the modified cDNA of the SOD2 gene, SEQ ID NO: 3, which

contains 4 nucleotide substitutions G → C at positions 199, 286, 322 and 370 and the substitution A → C at position 400, which does not lead to changes in the amino acid sequence of superoxide dismutase-2 protein.

In FIG. four

Presents the nucleotide sequence of the modified cDNA of the SOD2 gene, SEQ ID NO: 4, which

contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 C → A substitution at position 521 and T → A substitution at position 523, which do not lead to changes in the amino acid sequence of the superoxide dismutase-2 protein.

In FIG. 5

Presents the nucleotide sequence of the modified cDNA of the SOD2 gene, SEQ ID NO: 5, which contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 substitution C → A at position 521, substitution T → A at positions 523, substitution T → C at positions 629 and 2, substitutions A → G at positions 631 and 775, which do not lead to changes in the amino acid sequence of the superoxide dismutase-2 protein.

In FIG. 6

Presents the nucleotide sequence of the modified cDNA of the SOD2 gene, SEQ ID NO: 6, which

contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 substitution C → A at position 521, substitution T → A at positions 523, substitution T → C at positions 629 and 4 substitutions A → G at positions 631, 757, 775 and 793 not leading to changes in the amino acid sequence of the protein superoxide dismutase-2.

In FIG. 7

Presents the nucleotide sequence of the modified cDNA of the SOD2 gene, SEQ ID NO: 7, which

does not contain untranslated 5 'and 3' regions of the gene and contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 substitution C → A at position 521, substitution T → A at positions 523, substitution T → C at positions 629 and 4 substitutions A → G at positions 631, 757, 775 and 793 not leading to changes in the amino acid sequence of the protein superoxide dismutase-2.

In FIG. 8

In order to subsequently correctly determine the gene therapeutic effect after transfection of fibroblasts of a biologically active gene therapeutic substance with cDNA of the SOD2 gene, an analysis of the endogenous expression of the SOD2 gene in a primary fibroblast culture was performed. The figure shows the graphs of the accumulation of products of polymerase chain reaction (PCR), corresponding to:

1 - cODNA of the SOD2 gene, fibroblasts with reduced expression of the SOD2 gene

2 - cDNA of the SOD2 gene, fibroblasts with normal expression of the SOD2 gene

3 - cDNA of the B2M gene, fibroblasts with reduced expression of the SOD2 gene

4 - cDNA of the B2M gene, fibroblasts with normal expression of the SOD2 gene

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

In FIG. 9

In order to confirm the increase in the expression of the SOD2 gene in a cell culture of fibroblasts with reduced expression of the SOD2 gene during transfection of these cells with a biologically active gene therapeutic substance with cDNA of the SOD2 gene, graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the SOD2 gene in fibroblasts with normal expression of the SOD2 gene,

2 - cDNA of the SOD2 gene in fibroblasts with reduced expression of the SOD2 gene before transfection of BAGTS with cDNA of the SOD2 gene

3 - cDNA of the SOD2 gene in fibroblasts with reduced expression of the SOD2 gene after transfection of BAGTS with cDNA of the SOD2 gene

4 - SOD2 gene cDNA in fibroblasts with reduced SOD2 gene expression after transfection with a vector without SOD2 gene cDNA

5 - cDNA of the B2M gene in fibroblasts with normal expression of the SOD2 gene,

6 - cDNA of the B2M gene in fibroblasts with reduced expression of the SOD2 gene prior to transfection of BAGTS with cDNA of the SOD2 gene

7 - cDNA of the B2M gene in fibroblasts with reduced expression of the SOD2 gene after transfection of BAGTS with cDNA of the SOD2 gene

8 - cDNA of the B2M gene in fibroblasts with reduced expression of the SOD2 gene after transfection with a vector without cDNA of the SOD2 gene

From the graphs it follows that in the case of transfection with a vector without inserting the SOD2 cDNA gene, the level of SOD2 cDNA in fibroblasts did not change, and in the case of transfection with a SOD2 cDNA vector, the level of fibroblast cDNA with reduced SOD2 gene expression increased significantly (to a level higher than the cDNA level SOD2 gene in normal fibroblasts).

In FIG. 10

In order to confirm the increase in the activity of superoxide dismutase-2 protein in a cell culture of fibroblasts with normal expression of the SOD2 gene during transfection of these cells with a biologically active gene therapeutic substance containing SOD2 cDNA, a graph of the activity of superoxide dismutase-2 protein depending on the dilution of non-transfected fibroblast cell lysate is presented (culture A ) transfected with pCDNA 3.1 (+) vector not containing SOD2 cDNA (culture B) and transfected with biologically active gene therapy substance based on the genetic construct pCDNA 3.1-SOD2 SEQ ID No1 (culture C). It follows from the graph that upon transfection of fibroblasts with a biologically active gene therapeutic substance with cDNA of the SOD2 gene, the activity of superoxide dismutase-2 protein in the cell lysate increases.

Designations:

культура А

culture A

культура В

culture B

культура С

culture C

In FIG. eleven

In order to confirm the increase in the activity of superoxide dismutase-2 in human skin when a cell culture of fibroblasts transfected with a biologically active gene-therapeutic substance is introduced into the skin, an analysis of the change in the activity of superoxide dismutase-2 in the skin of patients is presented. At the same time, three variants of autologous fibroblast culture were injected into patients - non-transfected (A), transfected with pCMV6-XL5 vector (B) and transfected with a biologically active gene-therapeutic substance based on pCMV6-SOD2 SEQ ID No: 7 (C) - into the skin of the forearm. The activity of superoxide dismutase-2 in intact skin was also analyzed. An increase in the activity of superoxide dismutase-2 in the patient’s skin in the area of the introduction of fibroblasts transfected with the biologically active gene-therapeutic substance of the SOD2 gene cDNA was shown. (C)

Designations:

культура А

culture A

культура В

culture B

культура С

culture C

контрольная биопсия

control biopsy

In FIG. 12

In order to confirm the increase in the activity of superoxide dismutase-2 to various individual levels in cell cultures of patient’s fibroblasts during transfection of these cells with biologically active gene therapeutic substances with modified and native SOD2 cDNA depending on the presence and type of a particular modification of the SOD2 cDNA in them, analysis of changes in the activity of superoxide dismutase-2 protein in cultures of human skin fibroblasts depending on the presence and type of modifications in the cODNA of the SOD2 gene used for transfection of fibroblasts.

Fibroblast cultures of 20 patients were divided into 8 parts each from (A) to (H); part (A) of the patient’s cell cultures was transfected with the biologically active gene therapeutic substance pCMV6-SOD2 SEQ ID No: 1, part (B) was transfected with the biologically active gene therapeutic substance pCMV6-SOD2 SEQ ID No: 2, part (C) was transfected with the biologically active gene-therapeutic substance pCMV6-SOD2 SEQ ID No: 3, part (D) was transfected with the biologically active gene-therapeutic substance pCMV6-SOD2 SEQ ID No: 4, part (E) was transfected with the biologically active gene substance pCMV6-SOD2 SEQ ID No: 3 : 5, part (F) transfected biologist cally active therapeutic substance genetically pCMV6-SOD2 SEQ ID No: 6, part (G) were transfected with the biologically active therapeutic substance genetically pCMV6-SOD2 SEQ ID No: 7, part (H) were transfected with the vector plasmid containing no cDNA SOD2 gene.

Based on the analysis of the level of activity of superoxide dismutase-2 protein, we selected indicators for each part of the cell culture from each patient, which showed the maximum levels of activity of superoxide dismutase-2 and combined them into seven groups, based on the following criterion:

In group 1, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 1.

In group 2, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 2

In group 3, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 3.

In group 4, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 4.

In group 5, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 5.

In group 6, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 6.

In group 7, the maximum activity of superoxide dismutase-2 protein was observed during transfection

pCMV6-SOD2 SEQ ID No: 7.

None of the cell cultures was observed that the maximum activity of superoxide dismutase-2 is present upon transfection with a vector without insertion of the cODNA of the SOD2 gene.

Figure 12 shows, for each group of cell cultures, charts of indicators of the inhibition of the color reaction (averaged within the group, if more than one cell culture is included in the group) for all active gene therapeutic substances participating in the experiment, after transfection of these cell cultures active gene-therapeutic substances containing modified and native cDNA of the SOD2 gene

It follows from the figure that the achievement of the maximum activity of superoxide dismutase-2 in the skin fibroblast cultures of various patients upon their transfection with biologically active gene therapeutic substances is associated with the individual characteristics of the patients and depends on the presence and type of modifications of the SOD2 gene in the cDNA included in biologically active gene therapeutic substances.

Each biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to choose the most effective biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:1 (А)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 1 (A)

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:2 (В)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 2 (B)

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:3 (С)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 3 (C)

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:4 (D)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 4 (D)

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:5 (Е)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 5 (E)

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:6 (F)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 6 (F)

части клеточных культур, трансфицированных БАГТС SOD2 SEQ ID No:7 (G)

parts of cell cultures transfected with BAHTS SOD2 SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

parts of cell cultures transfected with placebo (H)

In FIG. 13

In order to confirm the increase in the expression of the SOD2 gene in cell culture of keratocytes and epithelial cells of the eye during transfection of these cells with a biologically active gene therapeutic substance with cDNA of the SOD2 gene, the graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the SOD2 gene, keratocytes before transfection

2 - cDNA of the SOD2 gene, corneal epithelium prior to transfection

3 - cDNA of the SOD2 gene, keratocytes after transfection

4 - cDNA of the SOD2 gene, corneal epithelium after transfection

5 - cDNA of the B2M gene, keratocytes before transfection

6 - cDNA of the B2M gene, corneal epithelium prior to transfection

7 - cDNA of the B2M gene, keratocytes after transfection

8 - cDNA of the B2M gene, corneal epithelium after transfection

The B2M gene was used as a reference.

It follows from the figure that as a result of transfection, the level of specific cDNA of the SOD2 gene in the culture of keratocytes and in the culture of the epithelium increased many times.

In FIG. fourteen

In order to confirm the increase in the expression of the SOD2 gene in the cell culture of chondroblasts during the transfection of these cells with a biologically active gene therapeutic substance with cDNA of the SOD2 gene, the graphs of the accumulation of PCR products corresponding to:

1 - cDNA of the SOD2 gene, before transfection

2 - cDNA of the SOD2 gene, after transfection

3 - cDNA of the B2M gene, before transfection

4 - cDNA of the B2M gene, after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the SOD2 gene increased many times.

In FIG. fifteen

In order to confirm the increase in the activity of superoxide dismutase-2 in human skin when a biologically active gene-therapeutic substance is introduced into the skin, an analysis of the change in the activity of superoxide dismutase-2 in the skin is presented. At the same time, the patient was injected with a biologically active gene therapeutic substance containing a vector plasmid with cDNA of the SOD2 pCMV6-SOD2 gene SEQ ID No: 4 (B) and a placebo, which is a combination of the vector plasmid pCMV-XL5 without the cODNA of the SOD2 gene with the transport molecule, was administered (A) - into the skin of the forearm. An increase in the activity of superoxide dismutase-2 in a skin biopsy of patient 1B was shown, to which a biologically active gene therapeutic substance containing a genetic construct with cDNA of the SOD2 gene was injected, which indicates the effectiveness of the biologically active gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения БАГТС

patient 1B before administration of BAGTS

In FIG. 16

In order to confirm the increase in the activity of superoxide dismutase-2 in the oral mucosa of a person with the introduction of a biologically active gene-therapeutic substance into the oral mucosa, an analysis of the change in the activity of superoxide dismutase-2 in the oral mucosa is presented. In this case, the patient was injected with a biologically active gene therapeutic substance containing a vector plasmid with cDNA of the SOD2 pCDNA 3.1 gene SOD2 SEQ ID No: 5 (B) and a placebo pCDNA 3.1 (+) was introduced in parallel, which is a combination of a vector plasmid that does not contain the SOD2 cDNA gene with transport molecule (A) - into the mucous membrane of the mouth.

An increase in the activity of superoxide dismutase-2 in the lysate of a biopsy sample of the oral mucosa of patient 1B was shown, to which a biologically active gene therapeutic substance containing a genetic construct with cDNA of the SOD2 gene was introduced, which indicates the effectiveness of the biologically active gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения БАГТС

patient 1B before administration of BAGTS

In FIG. 17

In order to confirm the increase in the activity of superoxide dismutase-2 in human muscle tissue when a biologically active gene-therapeutic substance is introduced into muscle tissue, an analysis of the change in the activity of superoxide dismutase-2 in muscle tissue is presented. In this case, a biologically active gene therapeutic substance containing a vector plasmid with the cDNA of the SOD2-pCMV6-Kan / NeoSOD2 gene SEQ ID No: 6 (B) was administered to the patient and a placebo pCMV6-Kan / Neo, which is a combination of a vector plasmid without cDNA, was administered SOD2 gene with a transport molecule (A) - into the muscle tissue of the gastrocnemius muscle. An increase in the activity of superoxide dismutase-2 in a biopsy of the muscle tissue of patient 1B was shown, which was injected with a biologically active gene therapeutic substance containing a genetic construct with cDNA of the SOD2 gene, which indicates the effectiveness of the biologically active gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения БАГТС

patient 1B before administration of BAGTS

In FIG. eighteen

In order to confirm the increase in the activity of superoxide dismutase-2 to a different individual level when biologically active gene therapeutic substances with modified and native SOD2 cDNA were introduced into the skin of the patients, the level of superoxide dismutase-2 activity in human skin was analyzed depending on the presence and type of modifications in the SOD2 cDNA gene .

Each of the 15 patients selected in random order was injected into the skin of the forearm with 7 biologically active gene therapeutic substances pCMV6-SEQ ID NO: 1, pCMV6-SEQ ID NO: 2, pCMV6-SEQ ID NO: 3, pCMV6-SEQ ID NO: 4, pCMV6-SEQ ID NO: 5, pCMV6-SEQ ID NO: 6, pCMV6-SEQ ID NO: 7, and placebo pCMV6-XL5.

Based on the results of the analysis of the level of activity of superoxide dismutase-2 in biopsy samples, we selected indicators for each biopsy sample from each patient, which showed the maximum levels of activity of superoxide dismutase-2 and combined them into seven groups, based on the following criterion:

In group 1, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID No: 1.

In group 2, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID No: 2.

In group 3, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID No: 3.

In group 4, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID No: 4,

In group 5, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID No: 5.

In group 6, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID NO: 6.

In group 7, the maximum activity of superoxide dismutase-2 protein was observed upon administration

pCMV6-SOD2 SEQ ID No: 7.

None of the biopsy specimens showed that the maximum activity of superoxide dismutase-2 protein is present when a placebo is administered.

Figure 18 shows, for each group of biopsy samples, charts of indicators of the inhibition of the color reaction (averaged within the group, if more than one biopsy is included in the group) for all active gene therapeutic substances participating in the experiment, after the patients have been given these active gene therapeutic substances containing modified and native cDNA of the SOD2 gene.

From this example, it follows that the achievement of the maximum activity of superoxide dismutase-2 in biopsies of the skin of various patients when biologically active gene-therapeutic substances are introduced into the skin is associated with the individual characteristics of the patients and depends on the presence and type of modifications in the SOD2 gene cDNA included in biologically active gene therapeutic substances.

Each biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:1 (А)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 1 (A)

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:2 (В)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 2 (B)

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:3 (С)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 3 (C)

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:4 (D)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 4 (D)

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:5 (Е)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 5 (E)

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:6 (F)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 6 (F)

биоптаты пациентов после введения БАГТС SOD2 SEQ ID No:7 (G)

biopsy samples of patients after administration of BAHTS SOD2 SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (Н)

biopsy samples of patients after placebo (N)

In FIG. 19

In order to determine the most effective biologically active gene-therapeutic substance in relation to a particular patient, the activity of superoxide dismutase-2 in cell lysates of this patient's fibroblasts transfected with different genetic constructs containing native or modified SOD2 gene cDNAs was analyzed.

According to the results of the analysis of the activity of superoxide dismutase-2 in the patient’s fibroblast culture, a variant of the biologically active gene-therapeutic substance was isolated, during transfection of which the maximum inhibition occurs in the cell culture lysate and, accordingly, the maximum activity of superoxide dismutase-2 is observed. In this experiment, the maximum inhibition in the lysate is observed upon transfection of a biologically active gene therapeutic substance based on pCMV6SOD2SEQ ID NO: 5 containing modified SOD2 cDNA, as shown in Figure 19.

Thus, the most effective biologically active gene-therapeutic substance was selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Designations:

1 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 1 (A)

2 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 2 (B)

3 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 3 (C)

4 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 4 (D)

5 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 5 (E)

6 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 6 (F)

7 - cell lysate after transfection of BAHTS SOD2 SEQ ID No: 7 (G)

8 - cell lysate after placebo transfection (H)

In FIG. twenty

In order to determine the most effective biologically active gene-therapeutic substance for a particular patient, the activity of superoxide dismutase-2 in the lysates of biopsy samples of the skin of this patient was analyzed after the introduction of biologically active gene-therapeutic substances containing native or modified SOD2 gene cDNA.

According to the results of the analysis of the activity of superoxide dismutase-2 in the lysate of biopsy samples of the patient’s skin, a variant of the biologically active gene-therapeutic substance was isolated, with the introduction of which there is maximum inhibition in the lysate of the skin biopsy and the maximum activity of superoxide dismutase-2 is observed. In this experiment, the maximum inhibition in the lysate was observed with the introduction of a biologically active gene therapeutic substance based on pCMV6 SOD2 SEQ ID NO: 6 containing modified SOD2 cDNA, as shown in Figure 20.

Thus, the most effective biologically active gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

Designations:

1 - biopsy sample lysate after administration of BAHTS SOD2 SEQ ID No: 1 (A)

2 - biopsy sample lysate after administration of BAHTS SOD2 SEQ ID No: 2 (B)

3 - biopsy specimen lysate after administration of BAHTS SOD2 SEQ ID No: 3 (C)

4 - biopsy sample lysate after administration of BAHTS SOD2 SEQ ID No: 4 (D)

5 - biopsy sample lysate after administration of BAHTS SOD2 SEQ ID No: 5 (E)

6 - biopsy sample lysate after administration of BAHTS SOD2 SEQ ID No: 6 (F)

7 - biopsy sample lysate after administration of BAHTS SOD2 SEQ ID No: 7 (G)

8 - lysate biopsy specimen after the introduction of placebo (N)

The implementation of the invention.

With a decrease in the activity of genes encoding redox balance proteins, for example, the SOD2 gene, the antioxidant activity of the protein in the body decreases.

For example, a study of transgenic mice with an inactivated SOD2 gene by homologous recombination showed that homozygotes (null) died within 10 days, they observed the development of cardiomyopathy, the accumulation of lipids in the liver and skeletal muscles, metabolic acidosis, and the development of neurodegenerative diseases. In heterozygous mice, pronounced defects of the mitochondria and the start of the apoptosis process were observed in the SOD2 allele, which manifested with age [PMID: 23862693], [PMID: 19293248], [PMID: 15890620], [PMID: 11514315], [PMID: 14679299]

The advantages of using a genetic construct with the SOD2 gene to correct the level of activity of superoxide dismutase-2 protein in cells of human organs and tissues, compared with the use of a modified superoxide dismutase-2 protein according to prototype US8926965 are as follows:

1) it is easier to provide a higher and stable level of protein in the cells,

2) a complex and expensive procedure for refolding and purification of a protein preparation is not required,

3) the transportation of biologically active gene-therapeutic substance to a larger spectrum of cells of human organs and tissues, as well as more efficient intracellular transportation of biologically active gene-therapeutic substance,

4) individual characteristics of the patient are taken into account.

Thus, to create a line of biologically active gene-therapeutic substances according to this invention, the SOD2 gene was chosen, and not the protein encoded by this gene.

To obtain a line of biologically active gene-therapeutic substances, the following actions are performed:

1. Obtaining a native cDNA of the SOD2 gene containing the protein coding region of the SOD2 gene, cloning it into an intermediate plasmid for further modifications of this cDNA.

2. Introduction of modifications of the SOD2 gene to the cDNA sequence of the cDNA nucleotide sequence to create the SOD2 gene cDNA line that provides the level of superoxide dismutase-2 protein translation sufficient to combat oxidative stress.

3. Cloning of native and modified cDNAs of the SOD2 gene into vector plasmids capable of ensuring efficient expression of this cDNA in cells of human organs and tissues.

4. Transformation of each of the obtained genetic constructs of bacterial E. coli cells, analysis of transformed clones for the presence, orientation, and copy number of the cDNA insert and the growth of selected clones to obtain the number of plasmid DNA variants necessary for further work.

5. Isolation of the line of genetic constructs containing the modified and native cDNA of the SOD2 gene to create a line of biologically active gene-therapeutic substances on its basis.

6. Creation of a line of biologically active gene-therapeutic substances, each of which includes a genetic construct with a modified or native SOD2 gene cDNA, or a combination of such a construct with a transport molecule for efficient transfection of various types of cells of organs and tissues and / or introduction into human organs and tissues .

To prove the effectiveness of the created biologically active gene therapeutic substances, leading to an increase in the expression of the SOD2 gene, the following studies are carried out:

A) Cultivation of cultures of various types of cells from biopsies of various human organs and tissues, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells.

B) Isolation of RNA from a cell culture, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, and analysis of transcription of the SOD2 gene from the genome of these cells.

C) Transfection of a cell culture, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, containing biologically active gene therapeutic substances containing native and / or modified codNAs of the SOD2 gene and parallel transfection of the same cell culture with a vector plasmid that does not contain SOD2 gene cDNA in various combinations.

D) Comparative analysis of changes in cDNA levels and / or changes in the activity of superoxide dismutase-2 protein after transfection in various combinations of cells, for example, human skin fibroblasts, or chondroblasts, or keratocytes, or corneal epithelial cells, with biologically active gene therapeutic substances containing native and / or modified cDNA of the SOD2 gene and parallel transfection of the culture of the same cells with a vector plasmid that does not contain cDNA of the SOD2 gene. This analysis is carried out, in particular, before the proposed therapy in order to determine the most effective biologically active gene-therapeutic substance for the patient.

E) The introduction into the organs and tissues of a cell culture of the SOD2 gene cDNA, for example, the introduction into the human skin of autologous fibroblasts transfected with a biologically active gene therapeutic substance with the SOD2 gene cDNA and the parallel introduction into the organs and tissues, for example, of the skin cultures of the same cells untransfected and transfected with a vector without inserting the SOD2 gene cDNA and / or introducing into the organs and tissues biologically active gene-therapeutic substances, for example, introducing a biologically active substance into human skin s genetic therapeutic substances containing native and / or modified cDNAs SOD2, and placebo in various combinations.

F) Comparative analysis of the activity of superoxide dismutase-2 protein in human organs and tissues, in particular in human skin, after the administration of cells untransfected and transfected with biologically active gene therapeutic substances containing the cDNA of the SOD2 gene and vector plasmids not containing cDNA of the SOD2 gene and / or biologically active gene therapeutic substances containing native or modified cDNA of the SOD2 gene, as well as a placebo.

G) Introduction to patients in organs and tissues, for example, the mucous membrane of the mouth, or muscle tissue of biologically active gene therapeutic substances containing native and / or modified cDNA of the SOD2 gene, as well as a placebo.

H) Comparative analysis of the activity of superoxide dismutase-2 protein in human organs and tissues, in particular in the oral mucosa, or human muscle tissue, after the administration of biologically active gene therapeutic substances containing native and / or modified SOD2 cDNA as well as placebo.

I) The introduction into patients of organs and tissues, for example, the introduction into the patient’s skin of biologically active gene-therapeutic substances containing native and modified cDNA of the SOD2 gene.

J) A comparative analysis of changes in the activity of superoxide dismutase-2 protein in the organs and tissues of a patient, in particular in the skin, after the administration of biologically active gene therapeutic substances containing native and modified cODNAs of the SOD2 gene. This analysis is carried out, in particular, before the proposed therapy in order to select the most effective biologically active gene-therapeutic substance for the patient from the line of biologically active gene-therapeutic substances.

Example 1

Obtaining native (unmodified) cODNA of the SOD2 gene.

Unmodified cDNA of the SOD2 gene is a nucleotide sequence identical to that given in the GenBank database under the number NM_000636.2; nucleotides 155 through 823 are translated into the amino acid sequence corresponding to that shown in GenBank under the number NP_000627.2.

Total RNA is obtained from human blood cells using the PAXGeneBlood RNA Kit (Qiagen, Germany) and is used to obtain total cDNA by reverse transcription using RevertAid reverse transcriptase (ThermoScientific, USA) and random 9-nucleotide primers according to the method of the manufacturer of reverse transcriptase. Then, using the total cDNA as a template and specific, pre-kinered primers complementary to nucleotides 37-54 5'-GCTCCCCGCGCTTTCTTA-3 '(SOD2F1) and 934-912 5'-AGCAACATCAAGAAATGCTACAA-3' (SOD2R1 S2 mOD sequence SOD2R1B2) NM_000636.2), receive SOD2 cDNA. Polymerase chain reaction (PCR) is carried out using Phusion DNA polymerase (ThermoScientific, USA), giving products with blunt ends. PCR is performed using a Master CyclerGradient amplifier (Eppendorf, USA) in 50 μl of the reaction mixture containing 0.5 μl of total cDNA of the first strand, 0.1 μM of each primer SOD2F1 and SOD2R1, 250 μM of each deoxynucleotide triphosphate (dATP, dTTP, dTTP and dGTP), 100 mM Tris-HCl (pH 8.85 at 20 ° C), 50 mM ammonium sulfate, 250 mM potassium chloride, 0.01% Tween-20 and 5 units. Pfu DNA polymerase (PhusionThermo Scientific, USA) under the following conditions: initial denaturation at 98 ° С for 30 sec., 35 cycles, including denaturation at 98 ° С for 10 sec., Annealing of primers at 58 ° С for 30 sec. . and elongation at + 68 ° C for 2 minutes

The amplification product was isolated from agarose gel using the QIAquickGelExtractionKit kit (Qiagen, Germany)

The amplified cDNA fragment carrying the SOD2 gene is cloned in pUC19 plasmid vector (NEB, USA, cat. No. N3041S). The DNA of the vector plasmid pUC19 (NEB, USA, cat. No. N3041S) is digested with Smal restriction enzyme (NEB, USA), or another blunt terminated restrictase enzyme, and is treated with alkaline phosphatase. The amplified cDNA fragment and the linearized plasmid pUC19 are ligated with 400,000 U / ml phage T4 DNA ligase. (NEB, USA, Cat. No. M0202S) at the rate of 1 μl of the enzyme per 1 μg of DNA. Ligation is carried out in a volume of 20 μl in the presence of 2 mm ATP, 50 mm Tris-HCl, pH 7.6, 10 mm MgCl ₂ , 10 mm DTT for 10 hours at 16 ° C.

The resulting mixture was transformed with competent E. coliTop10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on Petri dishes with L-agar containing 100 μg / ml ampicillin and 40 μl per cup of solutions of 100 mM IPTG and 2% X-gal. Individual colonies are analyzed for insertion by PCR with SOD2F1 and SOD2R1 primers and confirmed by Sanger sequencing, which shows the presence of clones with different orientations of the target gene: EcoRI-5'NTR-cDNA SOD2-3'NTRHindIII and HindIII - 5'NTR SOD2-3'NTR-EcoRI cDNA.

The thus obtained cloned partial (from 37 to 934 bp) native (unmodified) SOD2 gene sequence 898 bp in length in plasmid pUC19-SOD2, SEQ ID No: 1 has the primary structure shown in Figure 1.

Example 2

Obtaining modified cDNA of the SOD2 gene.

Modifications are carried out in such a way as not to affect the primary structure of the superoxide dismutase-2 protein, namely, deletions of 5 'untranslated regions or deletions of 3'-untranslated regions, or nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, or a combination of the above modifications and , respectively, not affecting the amino acid sequence encoded by this sequence.

In particular, in order to obtain the SOD2 gene cDNA line in order to increase the transcription and translation efficiency of superoxide dismutase-2 in human tissues and organs into the native SOD2 cDNA sequence, using the principle of codon optimization, modifications are made by replacing minor codons with synonymous major ones, and also deletion 5 'untranslated regions or deletions of 3'-untranslated regions so that the substitutions do not lead to changes in the amino acid sequence of the protein or the termination of the amino acid chain at t translations, did not worsen the processes of transcription and translation.

All modifications are carried out in several stages by PCR mutagenesis using a QuikChange II XL kit or QuikChangeMultiSite-DirectedMutagenesisKit (Agilent Technologies, USA,) according to the manufacturer's recommendations. Http://www.agilent.com/cs/library/usermanuals/Public/200513.

To plasmid DNA pUC 19-SOD2 SEQ ID No: 1 according to Example 1 (variant pUC 19-SOD2 SEQ ID No: 1 with the target gene orientation EcoRI-5'NTR-cDNA SOD2-3'NTRHindIII and variant pUC 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) in an amount of 10-50 ng add 50-100 ng of primer containing the necessary replacement, insertion or deletion 25-45 np long . and PCR is performed in a QuikChangeMultireactionbuffer buffer (AgilentTechnologies, USA) with a mixture of QuikChangeMultimix enzymes (AgilentTechnologies, USA) under the following conditions: 95 ° С, 1 min; further from 30 to 35 cycles: 95 ° С 1 minute, 55 ° С 1 minute, 65 ° С 2 minutes / 1000 bp After PCR, 1-2 μl of restriction enzyme Dpn I was added to the amplification mixture and incubated for 1-2 hours at 37 ° C. The resulting mixture was transformed with competent E. coliTop10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on L-agar plates containing 100 μg / ml ampicillin. Transformed colonies are analyzed for mutation by sequencing plasmid DNA using the Sanger method.

To obtain the modified SOD2 SEQ ID No: 2 cDNA, sequential PCR mutagenesis is performed with primers complementary to the native SOD2 SEQ ID No: 1 cDNA regions (pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target EcoRI-5'NTR-cDNASOD2 gene -3'NTRHindIII and pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) used as a matrix:

1. SOD2 191-208 F: 5 'CTGGCTCCCGTTTTGGGG-3', complementary to nucleotides 190-208, with the replacement G → C at position 199,

2. SOD2 275-298 F: 5 'CACATCAACGCCCAGATCATGCAG 3', complementary to nucleotides 275-298, with the substitution G → C at position 286,

3. SOD2 311-333 F: 5 'AAGCACCACGCCGCCTACGTGAA 3', complementary to nucleotides 311-333, with the substitution G → C at position 322.

The nucleotide sequence of the SOD2 SEQ ID No: 2 cDNA thus modified contains 3 nucleotide substitutions G → C at positions 199, 286 and 322, which do not lead to changes in the amino acid sequence of the superoxide dismutase-2 protein and has the primary structure shown in Figure 2.

To obtain the modified SOD2 SEQ ID No: 3 cDNA, sequential PCR mutagenesis is performed with primers complementary to the native SOD2 SEQ ID No: 1 cDNA regions (pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target EcoRI-5'NTR-cDNA gene SOD2-3'NTRHindIII and pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) used as a template:

1. SOD2 191-208 F: 5 'CTGGCTCCCGTTTTGGGG 3', complementary to nucleotides 191-208, with the replacement of G → C at position 199,

2. SOD2 275-298 F: 5 'CACATCAACGCCCAGATCATGCAG 3', complementary to nucleotides 275-298, with the substitution G → C at position 286,

3. SOD2 311-333 F: 5 'AAGCACCACGCCGCCTACGTGAA 3', complementary to nucleotides 311-333, with the substitution G → C at position 322.

4. SOD2 360-384 F: 5 'ACCAGGAGGCCTTGGCCAAGGGAGA 3', complementary to nucleotides 360-384, with the substitution G → C at position 370 and

5. SOD2 389-413 F: 5 'ACAGCCCAGATCGCTCTTCAGCCTG 3', complementary to nucleotides 389-413, with A → C at position 400.

The nucleotide sequence of the SOD2 SEQ ID No: 3 cDNA thus modified contains 4 nucleotide substitutions G → C at positions 199, 286, 322 and 370 and an A → C substitution at position 400, which does not lead to changes in the amino acid sequence of the superoxide dismutase-2 protein and has the primary structure shown in figure 3.

To obtain the modified SOD2 SEQ ID No: 4 cDNA, sequential PCR mutagenesis is performed with primers complementary to the native SOD2 SEQ ID No: 1 cDNA regions (pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target EcoRI-5'NTR-cDNA gene SOD2-3'NTRHindIII and pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) used as a template:

1. SOD2 191-208 F: 5 'CTGGCTCCCGTTTTGGGG 3', complementary to nucleotides 191-208, with the replacement G → C at position 199,

2. SOD2 275-298 F: 5 'CACATCAACGCCCAGATCATGCAG 3', complementary to nucleotides 275-298, with the substitution G → C at position 286

3. SOD2 311-333 F: 5 'AAGCACCACGCCGCCTACGTGAA 3', complementary to nucleotides 311-333, with the substitution G → C at position 322,

4. SOD2 360-384 F: 5 'ACCAGGAGGCCTTGGCCAAGGGAGA 3', complementary to nucleotides 360-384, with the substitution G → C at position 370,

5. SOD2 389-413 F: 5 'ACAGCCCAGATCGCTCTTCAGCCTG 3', complementary to nucleotides 389-413, with A → C at position 400.

6. SOD213-538 F: 5 'CCATCAAAAGAGACTTTGGTTCCTTT 3', complementary to nucleotides 513-538, with C → A substitutions at position 521 and T → A at position 523;

7. SOD2548-576F: 5'AAGGAGAAGCTGACCGCTGCATCTG-TTGG3 ', complementary to nucleotides 548-576, with the replacement G → C at position 562.

The nucleotide sequence of the SOD2 cDNA thus modified SEQ ID No: 4 contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 the replacement C → A at position 521 and the replacement T → A at position 523, which do not lead to changes in the amino acid sequence of the protein superoxide dismutase-2 and has a primary structure shown in figure 4.

To obtain the modified SOD2 SEQ ID No: 5 cDNA, sequential PCR mutagenesis is performed with primers complementary to the native SOD2 SEQ ID No: 1 cDNA regions (pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target EcoRI-5'NTR-cDNA gene SOD2-3'NTRHindIII and pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) used as a template:

1. SOD2 191-208 F: 5 'CTGGCTCCCGTTTTGGGG 3', complementary to nucleotides 191-208, with the replacement G → C at position 199,

2. SOD2 275-298 F: 5 'CACATCAACGCCCAGATCAT-GCAG 3', complementary to nucleotides 275-298, with the replacement of G → C at position 286,

3. SOD2 311-333 F: 5 'AAGCACCACGCCGCCTACGTGAA 3', complementary to nucleotides 311-333, with the substitution G → C at position 322,

4. SOD2 360-384 F: 5 'ACCAGGAGGCCTTGGCCAAGGGAGA 3',

complementary to nucleotides 360-384, with the replacement of G → C at position 370,

5. SOD2 389-413 F:

5 'ACAGCCCAGATCGCTCTTCAGCCTG 3', complementary to nucleotides 389-413, with the replacement of A → C at position 400,

6. SOD2 513-538 F: 5 'CCATCAAAAGAGACTTTGGTTC-CTTT 3', complementary to nucleotides 513-538, with C → A substitutions at position 521 and T → A at position 523;

7. SOD2 548-576F: 5 'AAGGAGAAGCTGACCGCTGCATC-TGTTGG 3', complementary to nucleotides 548-576, with the replacement G → C at position 562,

8. SOD2 621-650 F: 5 'GGGGACACCTGCAAATTGCTGCT-TGTCCAA 3', complementary to nucleotides 621-650, with substitutions T → C at position 629 and A → G at position 631,

9. SOD2 761-787F: 5 'GCTATTTGGAATGTGATCAACT-GGGAG 3', complementary to nucleotides 761-787, with the replacement A → G at position 775.

The nucleotide sequence of the SOD2 cDNA thus modified SEQ ID No: 5 contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 C → A substitution at position 521, T → A substitution at positions 523, T → C substitution at positions 629 and 2, A → G substitutions at positions 631 and 775, which do not lead to changes in the amino acid sequence of superoxide dismutase-2 protein and has a primary structure shown in figure 5.

To obtain the modified SOD2 SEQ ID No: 6 cDNA, sequential PCR mutagenesis is performed with primers complementary to the native SOD2 SEQ ID No: 1 cDNA regions (pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target EcoRI-5'NTR-cDNA gene SOD2-3'NTRHindIII and pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) used as a template:

1. SOD2 191-208 F: 5 'CTGGCTCCCGTTTTGGGG 3', complementary to nucleotides 191-208, with the replacement G → C at position 199,

2. SOD2 275-298 F: 5 'CACATCAACGCCCAGATCAT-GCAG 3', complementary to nucleotides 275-298, with the replacement G → C at position 286

3. SOD2 311-333 F: 5 'AAGCACCACGCCGCCTACGTGAA 3', complementary to nucleotides 311-333, with the substitution G → C at position 322.

4. SOD2 360-384 F: 5 'ACCAGGAGGCCTTGGCCAAGGGAGA 3', complementary to nucleotides 360-384, with the substitution G → C at position 370.

5. SOD2 389-413 F: 5 'ACAGCCCAGATCGCTCTTCAGCCTG 3', complementary to nucleotides 389-413, with A → C at position 400.

6. SOD2 513-538 F: 5 'CCATCAAAAGAGACTTTGGT-TCCTTT 3', complementary to nucleotides 513-538, with C → A at position 521 and T → A at position 523; and

7. SOD2 548-576 F: 5 'AAGGAGAAGCTGACCGCTGCATCT-GTTGG 3', complementary to nucleotides 548-576, with the replacement G → C at position 562.

8. SOD2 621-650 F: 5 'GGGGACACCTGCAAATTGCTGCT-TGTCCAA 3', complementary to nucleotides 621-650, with substitutions T → C at position 629 and A → G at position 631 and

9. SOD2 761-787 F: 5 'GCTATTTGGAATGTGATCAACT-GGGAG 3', complementary to nucleotides 761-787, with the replacement A → G at position 775.

10. SOD2 744-773 F: 5 'GGCCTGATTATCTGAAAGCTA-TTTGGAATG 3', complementary to nucleotides 744-773, with the replacement A → G at position 757,

11. SOD2 783-809 F: 5 'GGGAGAATGTGACTGAAAGA-TACATGG 3', complementary to nucleotides 783-809, with the replacement A → G at position 793.

The nucleotide sequence of the SOD2 cDNA thus modified SEQ ID No: 6 contains 5 nucleotide substitutions G → C at positions 199, 286, 322, 370, 562; A → C change at position 400 replacing C → A at position 521, replacing T → A at positions 523, replacing T → C at positions 629 and 4, replacing A → G at positions 631, 757, 775 and 793, which do not lead to changes in the amino acid sequence of superoxide dismutase-2 protein and has a primary structure shown in figure 6.

To obtain the modified SOD2 SEQ ID No: 7 cDNA, sequential PCR mutagenesis is performed with primers complementary to the native SOD2 SEQ ID No: 1 cDNA regions (pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target EcoRI-5'NTR-cDNA gene SOD2-3'NTRHindIII and pUC variant 19-SOD2 SEQ ID No: 1 with the orientation of the target HindIII gene - 5'NTR-cDNA SOD2-3'NTR-EcoRI) used as a template:

1. SOD2 191-208 F: 5 'CTGGCTCCCGTTTTGGGG 3', complementary to nucleotides 191-208, with the replacement G → C at position 199,

2. SOD2 275-298 F: 5 'CACATCAACGCCCAGATCAT-GCAG 3', complementary to nucleotides 275-298, with the replacement of G → C at position 286,

3. SOD2 311-333 F: 5 'AAGCACCACGCCGCCTACGTGAA 3', complementary to nucleotides 311-333, with the substitution G → C at position 322,

4. SOD2 360-384 F: 5 'ACCAGGAGGCCTTGGCCAAGGGAGA 3', complementary to nucleotides 360-384, with the substitution G → C at position 370,

5. SOD2 389-413 F: 5 'ACAGCCCAGATCGCTCTTCAGCCTG 3', complementary to nucleotides 389-413, with the replacement A → C at position 400,

6. SOD2 513-538 F: 5 'CCATCAAAAGAGACTTTGG-TTCSTTT 3', complementary to nucleotides 513-538, with C → A substitutions at position 521 and T → A at position 523;

7. SOD2 548-576 F: 5 'AAGGAGAAGCTGACCGCTGCATC-TGTTGG 3', complementary to nucleotides 548-576, with the replacement G → C at position 562.

8. SOD2 621-650 F: 5 'GGGGACACCTGCAAATTGCTGC-TTGTCCAA 3', complementary to nucleotides 621-650, with substitutions T → C at position 629 and A → G at position 631,

9. SOD2 761-787 F: 5 'GCTATTTGGAATGTGATCAAC-TGGGAG 3', complementary to nucleotides 761-787, with the replacement A → G at position 775.

10. SOD2 744-773 F: 5 'GGCCTGATTATCTGAAAGCTAT-TTGGAATG 3', complementary to nucleotides 744-773, with the replacement A → G at position 757,

11. SOD2 783-809 F: 5 'GGGAGAATGTGACTGAAAGAT-ACATGG 3', complementary to nucleotides 783-809, with the replacement A → G at position 793.

12. and also to remove the 5 'untranslated region of the SOD2 gene from the sequence with substitutions using PCR mutagenesis with primer: 5' GACTCTAGAGGATCCCCGCCACCATGTTGAGCCGGGCAGTGTG 3 'for the variant with the orientation of the target HindIII gene - 5'NTR--3'NOD EcoRI

13. and also to remove the 3 'untranslated region of the SOD2 gene from the sequence with substitutions using PCR mutagenesis with primer: 5' ATGGCTTGCAAAAAGTAAGGGTACCGAGCTCGAATTCACTGG 3 'for the variant with the orientation of the target HindIII gene - 5'NTR- cDNA SOD2 EcoRI

14. and also to remove the 5 'untranslated region of the SOD2 gene from the sequence with substitutions using PCR mutagenesis with primer: 5' GAATTCGAGCTCGGTACCCGCCACCATGTTGAGCCGGGCAGTG 3 'for the variant with the orientation of the target gene EcoRI-5'NTR-c'NDIII SOD2

15. and also to remove the 3 'untranslated region of the SOD2 gene from the substitutions using PCR mutagenesis with primer: 5' ATGGCTTGCAAAAAGTAAGGGGATCCTCTAGAGTCGACCTG 3 'for the variant with the orientation of the target gene EcoRI-5'NTR-cDNA SOD2-3

The nucleotide sequence of the SOD2 SEQ ID No: 7 cDNA thus modified does not contain untranslated 5 'and 3' regions of the gene and contains 5 G → C nucleotide substitutions at positions 199, 286, 322, 370, 562; A → C change at position 400 substitution C → A at position 521, substitution T → A at positions 523, substitution T → C at positions 629 and 4, substitutions A → G at positions 631, 757, 775 and 793 not leading to changes in the amino acid sequence of superoxide dismutase-2 protein and has a primary structure shown in figure 7.

Thus, a line of 7 vectors based on the pUC19 plasmid is obtained in which the native and modified nucleotide sequences of the SOD2 gene are cloned (each vector from the line is obtained in two variants and contains the target gene with the orientation of EcoRI-5'NTR-SOD2 cDNA -3'NTRHindIII and the target gene with the HindIII orientation - 5'NTR-cDNA SOD2-3'NTR-EcoRI to create genetic expression constructs based on different vectors) to create a line of biologically active gene-therapeutic substances.

Example 3

Creation of genetic constructs with modified and native cDNA of the SOD2 gene to obtain biologically active gene therapeutic substances based on them.

For the expression of SOD2 gene cDNA in cells of human organs and tissues, the obtained SOD2 cDNA variants of Example 1 and Example 2 are placed in a vector plasmid, the choice of which uses the following selection criteria:

1) the plasmid must necessarily be replicated in E. coli, preferably with high copy number;

2) the plasmid must have a bacterial selection factor;

3) in the vector there should be the presence of eukaryotic regulatory elements - the obligatory promoter and terminator (polyadenylation signal), for example, an enhancer and intron (e) element (s);

4) the presence of a convenient polylinker for cloning. An example of such a plasmid may be pCMV6-XL5, pCMV6-Kan / Neo (OriGene, USA) or pCDNA 3.1 (+) (ThermoFisher Scientific, USA).

When cloning the cDNA of the SOD2 gene into pCDNA 3.1 (+), the coding nucleotide sequence is placed under the control of the human cytomegalovirus CMV promoter, which is effective in eukaryotic cells, and the bovine growth hormone gene polyadenylation signal. This plasmid also has a bacterial selection factor, the ampicillin resistance gene, and a eukaryotic selection factor, the neomycin resistance gene. When cloning, the sequence of the HindIII and EcoRI sites in the polylinker pCDNA 3.1 (+) is taken into account, and therefore, for cloning into this vector, the HindIII-5'NTR-cDNA SOD2-3'NTR-Eco RI oriented fragment in pUC19 is used according to Example 1.

When cloning the cDNA of the SOD2 gene in pCMV6-XL5, pCMV6-Kan / Neo, the coding nucleotide sequence is placed under the control of the human cytomegalovirus CMV promoter, effective in eukaryotic cells, and the polyadenylation signal of the human growth hormone gene. This plasmid also has a bacterial selection factor, the ampicillin resistance gene. When cloning, the sequence of arrangement of EcoRI and HindIII sites in the polylinker pCMV6-XL5 (pCMV6-Kan / Neo) is taken into account, and therefore, Eco RI-5'NTR-cDNA SOD2-3'NTR-HindIII oriented fragment in pUC19 is used for cloning into this vector one.

Vector plasmids pUC19-SOD2 SEQ ID No: 1 with a partial native (unmodified) SOD2 gene sequence (from 37 to 934 bp), pUC19-SOD2 SEQ ID No: 2, pUC19-SOD2 SEQ ID No: 3, pUC19- SOD2 SEQ ID No: 4, pUC19-SOD2 SEQ ID No: 5, pUC19-SOD2 SEQ ID No: 6, with a partially modified nucleotide sequence of the SOD2 gene (from 37 to 934 bp) and pUC19-SOD2 SEQ ID No: 7 with modified cDNA of the SOD2 gene and lacking untranslated 5 'and 3' regions of this gene, as well as the vector plasmids pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) for further expression of the SOD2 gene in eukaryotic cells, hydrolyze restriction enzymes EcoRI and HindIII (NEB, USA) at 37 ° C in an appropriate buffer (T. Maniatis et al. Molecular Cloning. M., Mir, 1984).

Restriction products are separated by 1% agarose gel electrophoresis, stained with ethidium bromide solution and DNA fragments corresponding to the HindIII-5'NTR-cDNA insert gene SOD2-3'NTR-EcoRI, or Eco RI-5'NTR-cDNA SOD2- 3'NTR-HindIII and the linearized plasmid pCMV6-XL5 and pCMV6-Kan / Neo and pCDNA 3.1 (+) were excised, isolated from the gel using the QIAquickGelExtractionKit gel isolation kit from Example 1 and mixed. The resulting mixture of restriction fragments is ligated using T4 phage DNA ligase. Ligation is carried out for 10-15 minutes at room temperature, and then at 12 ° C for 10 hours. Ligation DNA is used to transform E-coli cells according to standard methods using calcium chloride.

Transformed cells were selected on agar medium LB with ampicillin (100 μg / ml). Plasmid DNA was isolated from ampicillin-resistant colonies using the QiagenSpinMiniprepKit plasmid isolation kit, digested with restriction enzymes EcoRI and HindIII, and the genetic constructs containing the SOD2 coding sequence under the control of the CMV cytomegalovirus promoter and the polyadenylation growth signal were selected denoted as pCMV6 SOD2 SEQ ID No: (1-7) or pCMV6-Kan / Neo SOD2 SEQ ID No: (1-7) or pCDNA 3.1SOD2 SEQ ID No: (1-7). The presence of the SOD2 gene cDNA insert, its sequence and orientation are also confirmed by DNA sequencing of genetic constructs according to the Sanger method.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain biologically appropriate active gene therapeutic substances.

The obtained genetic expression constructs are used to obtain biologically active gene therapeutic substances based on them, which are subsequently used for transfection of eukaryotic cells of organs and tissues and / or introduction into human organs and tissues. As control plasmids, the original vector pCMV6-XL5, (pCMV6-Kan / Neo), or pCDNA 3.1 (+) without the cDNA insert of the SOD2 gene is used.

Example 4

Building up the genetic construct in bacterial culture.

To obtain preparative amounts of a vector plasmid containing one of the SOD2 gene cDNA variants, the E. coli bacterial cells are transformed by the constructs of Example 3 (T. Maniatis et al. Molecular Cloning. M., Mir, 1984) and the obtained bacterial clones are grown, containing the construct, in the presence of a bacterial selection factor - ampicillin resistance.

The ligase mixture of Example 3 is used to transform competent E. coli cells of strain XLblue. Preliminary selection of clones containing the cDNA insert of the SOD2 gene in the correct orientation and a single copy is carried out by hydrolysis of plasmid DNA with restriction enzymes EcoRI and HindIII and analysis of restriction products by electrophoresis in 1.2% agarose gel. Selected clones are used for preparative growth of plasmid DNA for the purpose of further transfection into fibroblast cultures (chondroblasts, keratocytes, etc.).

To obtain preparative amounts of the genetic expression constructs of Example 3, 20 ml of an overnight E.coli culture was grown in LB medium with 150 μg / ml ampicillin. 500 ml of LB medium with 100 μg / ml ampicillin were inoculated with this culture; growth was carried out in a shaker-incubator for 16 hours at 37 ° C and 200 rpm. Isolation of plasmid DNA was performed using the EndoFreePlasmidMaxiKit kit (Qiagen, Germany). The yield was 350 μg of DNA.

Example 5

Cultivation of eukaryotic cells, for example, fibroblasts for subsequent transfection with a biologically active gene therapeutic substance and analysis of SOD2 gene expression.

For subsequent transfection with a biologically active gene therapeutic substance containing one of the SOD2 cDNA variants of Example 3, primary cultures of human fibroblasts are grown from biopsy samples of the patient’s skin.

Using a skin biopsy device, Epitheasy 3.5 (MedaxSRL) takes a biopsy sample of the skin from a zone protected from ultraviolet radiation, for example behind the auricle or from the side inner surface in the area of the elbow joint, about 3 mm in size, weighing up to 20 mg. The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The primary cell culture was grown on Petri dishes at 37 ° C in an atmosphere containing 5% CO ₂ in DMEM medium with 10% fetal calf serum and ampicillin 100 U / ml. Trypsinization and reseeding is performed every 5 days; for trypsinization, the cells were washed with PBS and incubated for 30 minutes at 37 ° C in a solution containing 0.05% trypsin and 1 mM EDTA. To neutralize trypsin, 5 ml of culture medium was added to the cells and the suspension was centrifuged at 600 rpm for 5 minutes. The growth of fibroblast culture after 4-5 passages was carried out in 75 ml culture bottles in a medium containing 10 g / l DMEM, 3.7 g / l Na ₂ CO ₃ , 2.4 g / l HEPES, 10% fetal serum and 100 U / ml ampicillin . The culture medium was changed every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 10 ⁶ cells was selected from the cell culture.

The part of the fibroblast culture intended for RNA isolation followed by SOD2 gene transcription analysis was centrifuged at 1000 rpm for 20 minutes and washed twice in PBS buffer by centrifugation at 600 rpm for 5 minutes. Then the cells were resuspended in 1.5 ml of the stabilizing reagent RNAlater and stored at 4 ° C for 10 days for subsequent RNA isolation.

RNA isolation was performed using the RNeasyMiniKit kit. (Qiagen, Germany). The isolated RNA was analyzed spectrophotometrically, measuring the ratio of optical density at 260 and 280 nm, as well as by capillary electrophoresis on a QIAxcel instrument (Qiagen, Germany) using an RNA Qiality Control cartridge. For further work, we used only those samples for which the total amount of isolated RNA was not less than 50 μg RNA, the ratio of D260: D280 was not less than 1.8, and the ratio of the 28S: 18S bands on capillary electrophoresis was not less than 1: 1.

The synthesis of total cDNA of the first strand was carried out using RevertAid reverse transcriptase (Thermo Scientific, USA), according to the manufacturer's recommendations. 1-2 μg of total RNA was used as a template for the synthesis of the first cDNA strand. 100-200 units were added to the reaction mixture for reverse transcription. reverse transcriptase and 10 pM random 9-nucleotide primer.

Example 6

Analysis of endogenous SOD2 gene expression in primary fibroblast culture.

An analysis of the transcription of the SOD2 gene from the fibroblast genome is carried out with the aim of subsequent correct determination of the gene therapeutic effect after transfection of these cells with genetic constructs with cDNA of the SOD2 gene.

For analysis, skin fibroblast cell lines, fibroblasts with low SOD2 gene expression, and fibroblasts with normal SOD2 gene expression are used, from which RNA is isolated by a standard method (T. Maniatis et al. Molecular Cloning. M., Mir, 1984).

Isolated RNA is analyzed by real-time PCR (SYBR GreenRealTimePCR). For amplification of the cDNA specific for the SOD2 gene, the direct primer SOD2FA1 5'-CTGATTTGGACAAGCAGCAA-3 'and the reverse primer SOD2-RA1 5'-CTGGACAAACCTCAGCCCTA-3' are used. The length of the amplification product is 199 nucleotides. As a reference gene, the beta-2-microglobulin B2M gene is used, the expression level of which in fibroblasts is comparable to that normal for the SOD2 gene.

PCR amplification is performed using the SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) or another real-time PCR kit in 20 μl amplification mixture containing: 25 μl QuantiTect SYBR Green RT-PCR MasterMix, 2.5 mM magnesium chloride, 0.5 μm of each primer, 5 μl of total RNA. The reaction is carried out on a CFX96 amplifier (Bio-Rad, USA) under the following conditions: 1 reverse transcription cycle at 50 ° C for 30 minutes, denaturation 98 ° C for 15 minutes, then 40 cycles including denaturation 94 ° C for 15 seconds, primer annealing at 60 ° C for 30 sec. and elongation of 72 ° C for 30 sec.

As a positive control, the concentration of amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the SOD2 and B2M genes is used. As a negative control, deionized water is used (PCR accumulation curves of the products of negative and positive controls are not shown in FIG. 8 to simplify visualization).

The amount of PCR products - cDNA of the SOD2 and B2M genes obtained as a result of amplification, is estimated in real time using the Bio-RadCFXManager 2.1 amplifier software.

Based on the analysis of SOD2 gene expression in different fibroblast cultures (with low SOD2 gene expression and normal SOD2 gene expression), clones were selected from patients of the same age and type of aging, in which the amount of PCR product corresponding to the SOD2 gene cDNA was 10 -20 times lower than that of the B2M gene cDNA. The accumulation curves of specific PCR products are shown in figure 8.

Example 7

Transfection of a fibroblast cell culture with reduced expression of the SOD2 gene by a biologically active gene therapeutic substance in order to confirm an increase in the expression of the SOD2 gene in the culture of these cells.

To evaluate the effectiveness of a biologically active gene therapeutic substance containing the unmodified cDNA of the SOD2 gene according to Example 3, this biologically active gene therapeutic substance is transfected with a primary human fibroblast culture with reduced SOD2 gene expression selected in Example 6.

This fibroblast culture is grown in culture bottles (25 cm ² ) until the cells cover 50-70% of the surface of the bottle. The obtained cells are transfected with a biologically active gene therapeutic substance based on pCMV6-SOD2 SEQ ID No: 1 in the presence of a transport molecule (for example, dendrimer) and pCMV6-XL5 vector as a control.

A 6-well plate with DMEM medium with 10% fetal calf serum (1.6 ml per well) was seeded with fibroblasts at a rate of 1-4 × 10 ⁵ cells per well. Cells were incubated for 18 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then, 2 μg of plasmid DNA was dissolved in serum-free DMEM with Tris-HCl buffer 20 mM with 1 mM EDTA, pH 7-8 (minimum DNA concentration - 0.1 μg / μl). The final volume of the mixture was 100 μl.

The 6th generation SuperFect Transfection Reagent dendrimer solution (Qiagen, Germany) was used as a transport molecule.

Preparation of the DNA dendrimer complex was carried out according to the manufacturer's method (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some changes: 5 μl (with a concentration of 0.5 μg / μl) was added to 15 μl of the dendrimer (with a concentration of 3 μg / μl) plasmid DNA and mixed thoroughly. Then the DNA mixture with the dendrimer was incubated for 5-10 minutes at a temperature of 15-25 ° C.

Medium was carefully selected from the wells of the cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml PBS buffer. To a solution containing DNA dendrimer complexes, 600 μl of fetal serum DMEM medium was added and the mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then, the culture medium was added and incubated for 24-48 hours at 37 ° C and in an atmosphere containing 5% CO ₂ , after which the SOD2 gene cDNA and the B2M control cDNA were evaluated using real-time amplification as described in Example 6. Results analysis are shown in figure 9.

From the graphs it follows that in the case of transfection with a vector without insertion of the SOD2 cDNA gene, the level of SOD2 cDNA in fibroblasts did not change, and in the case of transfection with a SOD2 cDNA vector, the level of fibroblast cDNA with reduced SOD2 gene expression increased significantly (to a level higher than the SOD2 cDNA level in normal fibroblasts).

It was shown that in cells transfected with a biologically active gene therapeutic substance based on pCMV6-SOD2SEQIDNo1, an increase in the expression of the target SOD2 gene is observed

Example 8

Transfection of a fibroblast cell culture with normal SOD2 gene expression by a biologically active gene therapeutic substance with SOD2 cDNA to confirm an increase in the activity of superoxide dismutase-2 protein in the culture of these cells.

To assess the change in the level of activity of superoxide dismutase-2 protein in a fibroblast culture, three cell culture variants were used - untransfected fibroblasts treated with an aqueous solution of dendrimers (A) transfected with a vector plasmid, for example, pCDNA 3.1 (+), which does not contain the SOD2 gene cDNA (B) and transfected with a biologically active gene therapeutic substance based on the same vector plasmid containing the cDNA of the SOD2 gene - pCDNA 3.1SOD2 SEQ ID No: 1 (C). Transfection of cells with a biologically active gene therapeutic substance based on pCDNA 3.1SOD2 SEQ ID No: 1 and pCDNA 3.1 (+) vector in the presence of transport molecules (dendrimers) is carried out as described in example 7.

A cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm.

The activity of superoxide dismutase-2 protein was determined by the indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA). The principle of the method is that superoxide dismutase-2 reduces the concentration of superoxide anion, which leads to inhibition of the reaction involving superoxide anion and, consequently, to a decrease in the color intensity of the analyzed solution containing WST-1 dye with an absorption maximum at 440 nm.

The analysis was carried out according to the method recommended by the manufacturer. From the graph shown in figure 10, it follows that the lysate culture of cells transfected with a biologically active gene therapeutic substance based on pCDNA 3.1SOD2SEQIDNo1, inhibits the color reaction completely without dilution and at a dilution of 1:10. Thus, it was shown that transfection of fibroblasts with a biologically active gene therapeutic substance carrying the cDNA of the SOD2 gene leads to an increase in the activity of superoxide dismutase-2 in fibroblast cells.

Example 9

The introduction into the human skin of a cell culture of fibroblasts transfected with a biologically active gene therapeutic substance with cDNA of the SOD2 gene in order to confirm the increase after this activity of superoxide dismutase-2 protein in a biopsy of human skin.

In order to analyze the changes in the activity of superoxide dismutase-2 protein in human tissues, three variants of autologous fibroblast culture were introduced into the skin of the forearm: untransfected (A), transfected with a vector without an insert, for example, pCMV6-XL5 (B) and modified with a biologically active gene therapeutic substance on based on pCMV6-SOD2 SEQ ID No: 7 (C) in combination with transport molecules - liposomes TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

The suspension of liposomes was prepared according to the manufacturer's method (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) with some changes: 0.4 ml of Nuclease-Free sterile water was added to 0.4 mg of liposome powder. The suspension was mixed well by shaking. The resulting intermediate product of the suspension of liposomes was kept for 18 hours at a temperature of -20 ° C, then thawed at room temperature, resuspended by shaking or on a table mixer type "VORTEX".

To prepare the DNA liposome complex, 400 μl of plasmid DNA solution (with a concentration of 150 μg / ml) was added to 400 μl of liposome solution (with a concentration of 1 mg / ml) and mixed thoroughly. Then the mixture of DNA with liposomes was incubated for 5-10 minutes at a temperature of 15-25 ° C and was further used as a biologically active gene therapeutic substance.

For subsequent transfection with a biologically active gene-therapeutic substance, primary cultures of human fibroblasts are grown from biopsy samples of the skin of patients according to Example 5.

For transfection, the medium was carefully selected from the wells of a cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml of PBS buffer. To a solution containing DNA liposome complexes, 600 μl of fetal serum DMEM medium was added and the mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then, the culture medium was added and incubated for 24-48 hours at 37 ° C in an atmosphere containing 5% CO ₂ .

Part of the cell culture was centrifuged at 700 rpm, the cells were washed twice with physiological saline, resuspended in physiological saline at the rate of 1 million cells in 200 μl and used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. Foci of introducing fibroblast cultures were located at a distance of 3-5 cm from each other. The activity of superoxide dismutase-2 was evaluated in the biopsy samples of the patient’s skin using an indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA) as described in Example 8. Biopsy samples were taken 3 days after the injection of the fibroblast suspension. A biopsy was performed from the injection sites of the fibroblast suspension, as well as from the intact skin, using an Epitheasy 3.5 skin biopsy device (MedaxSRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 3 mm, and the mass was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm.

As can be seen from figure 11, in the skin of the patient in the area of administration of fibroblasts transfected with a biologically active gene therapeutic substance based on pCMV6-SOD2 SEQ ID No: 7, the activity of superoxide dismutase-2 protein increased, whereas when control cultures of fibroblasts (untransfected and transfected with a vector without insertion of cDNA of the SOD2 pCMV6-XL5 gene) the activity of superoxide dismutase-2 protein in the skin did not change.

Thus, the effectiveness of a biologically active gene therapeutic substance carrying a modified SOD2 gene cDNA has been shown: transfection of fibroblasts with a biologically active gene therapeutic substance carrying a modified SOD2 gene cDNA leads to an increase in the activity of superoxide dismutase-2 protein in fibroblast cells.

Example 10

Transfection of fibroblast cultures from biopsies of a group of different patients with biologically active gene therapeutic substances containing modified and native to SOD2 DNA.

In order to confirm the individual nature of the increase in the activity of superoxide dismutase-2 protein to various levels during transfection of cell cultures of fibroblasts of patients with biologically active gene therapeutic substances with modified and native cODA of the SOD2 gene, the level of activity of superoxide dismutase-2 protein in cell lysates of fibroblasts transfected with different biologically active genes was analyzed -therapeutic substances according to example 3, containing modified and native SOD2 cDNA in the pa cents depending on the presence and type of modifications in the cDNA of the SOD2 gene.

The sequence of native SOD2 cDNA is shown in Figure 1, SEQ ID No: 1., The sequences of modified SOD2 cDNA are shown in Figure 2-7 (SEQ ID No: 2. SEQ ID No: 3. SEQ ID No: 4, SEQ ID No: 5 , SEQ ID No: 6, SEQ ID No: 7).

Fibroblast cultures were grown from the same skin biopsy samples taken from the area of the inner lateral surface in the elbow joint of 20 patients randomly selected in Example 5, aliquots were selected and the level of superoxide dismutase-2 in cell lysates was evaluated. A cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonyl fluoride . The lysate was centrifuged for 5 minutes at 14,000 rpm, the protein concentration in the supernatant was determined by the Bradford method ([Bradford M.M. (1976) Anal. Biochem. 72: 248-254.]).

Then, each of the 20 fibroblast cultures was divided into 8 parts. One part, designated (A), was transfected according to Example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 1, containing SOD2 unmodified to DNA (SEQ ID No: 1.) According to Example 3 in combination with transport molecules - liposomes according to example 9. The second part, designated (B), was transfected according to example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 2, containing variant 1 of the modified SOD2 cDNA (SEQ ID No: 2.) according to example 3 in combination with transport molecules - liposomes according to example 9. 3rd the part indicated by (C) was transfected in accordance with Example 7 with a biologically active gene therapeutic substance based on the pCMV6-SEQ ID NO: 3 vector containing variant 2 of the modified SOD2 cDNA SEQ ID No: 3 according to Example 3 in combination with liposome transport molecules according to example 9. The 4th part, indicated by (D), was transfected according to example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 4 containing variant 3 of the modified SOD2 cDNA (SEQ ID No: 4.) according to Example 3 in combination with transport molecules - liposomes according to example 9. 5th hour b, designated (E), was transfected in accordance with Example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 5 containing 4 variants of the modified cODNA SOD2 SEQ ID No: 5 according to Example 3 in combination with transport molecules - liposomes according to Example 9. The 6th part, labeled (F), was transfected according to Example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 6, containing variant 5 of the modified SOD2 cDNA SEQ ID No: 6.) according to Example 3 in combination with transport molecules - liposomes according to example 9. 7th part, about the aforementioned (G) was transfected according to Example 7 with a biologically active gene therapeutic substance based on the pCMV6-SEQ ID No: 7 vector containing variant 6 of the modified SOD2 cDNA SEQ ID No: 7 according to Example 3 in combination with the liposome transport molecules of Example 9 The 8th part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 not containing the SOD2 cDNA according to Example 3 in combination with the transport liposome molecules of Example 9.

Superoxide dismutase-2 activity was determined 72 hours after transfection with an indirect colorimetric method using the SOD AssayKit-WST kit (Sigma-Aldrich, USA). The analysis was carried out according to the method recommended by the manufacturer. Preliminarily, the degree of inhibition of the color reaction was evaluated depending on the concentration of the pure superoxide dismutase-2 preparation. Based on the data of previous experiments described in example 8, the lysate was diluted 5 times.

Based on the results of the analysis of the level of activity of superoxide dismutase-2, we selected indicators for each part of the cell culture from each patient, which showed the maximum levels of activity of superoxide dismutase-2 and combined them into seven groups, based on the following criterion:

In group 1, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed upon transfection of unmodified SOD2 cDNA. This group included 3 out of 20 cultures.

In group 2, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed during transfection of 1 variant of modified SOD2 cDNA. This group includes 3 cultures out of 20

In group 3, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed during transfection of 2 variant modified SOD2 cDNA. This group included 2 out of 20 cultures.

In group 4, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed upon transfection of 3 variant modified SOD2 cDNA. This group included 2 out of 20 cultures.

In group 5, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed during transfection with 4 variant modified SOD2 cDNA. This group included 3 out of 20 cultures.

In group 6, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed during transfection with variant 5 of the modified SOD2 cDNA. This group included 2 out of 20 cultures.

In group 7, the maximum inhibition in the lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed during transfection of 6 variant modified SOD2 cDNA. This group included 5 out of 20 cultures.

None of the cell cultures was observed that the maximum inhibition in the lysate, corresponding to the maximum activity of superoxide dismutase-2, is present upon transfection with a vector that does not contain the cDNA of the SOD2 gene.

Figure 12 shows, for each group of cell cultures, charts of indicators of the inhibition of the color reaction (averaged within the group, if more than one cell culture is included in the group) for all active gene therapeutic substances participating in the experiment, after transfection of these cell cultures active gene-therapeutic substances containing modified and native cDNA of the SOD2 gene

From this example, it follows that the achievement of the maximum activity of superoxide dismutase-2 in the skin fibroblast cultures of various patients upon their transfection with biologically active gene therapeutic substances is associated with the individual characteristics of the patients and depends on the presence and type of modifications of the SOD2 gene in the cDNA included in biologically active gene -therapeutic substances.

Each biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples, is required for maximum therapeutic effect created by biologically active gene-therapeutic substances in the line of biologically active gene-therapeutic substances.

Example 11

Transfection of a cell culture of keratocytes and epithelial cells of the eye with a biologically active gene therapeutic substance without a transport molecule in order to confirm the increase in SOD2 gene expression in these cell cultures.

In order to determine the effectiveness of a biologically active gene therapeutic substance containing SOD2 cDNA in various types of cells, keratocytes and epithelial cells of the human cornea were transfected without using transport molecules.

Biopsy material from the limb region in the form of a circle with a diameter of 1-1.5 mm was placed in a Petri dish in a balanced Hanks saline solution, dispase (20 μl 25 u / ml) and gentamicin were added and incubated for 24 hours at 4 ° C. Then the epithelial layer was separated from the stroma and both tissues were cut into pieces of 1-2 mm ³ .

A suspension of epithelial cells was obtained by incubating pieces of tissue in a solution of Trypsin-EDTA for 15 minutes at 37 ° C. Trypsinization was stopped by the addition of a soybean trypsin inhibitor in PBS. Cell suspensions were washed by centrifugation at 700 rpm and resuspended in serum-free DMEM with gentamicin. Cells were grown in 25 cm ² vials with 5 ml of medium at 37 ° C and in an atmosphere containing 5% CO ₂ . After 24 hours, non-adherent cells were removed and 5 ml of fresh medium was added. Reseeding was performed every 7 days in a ratio of 1: 2-1: 3.

A keratocyte suspension was obtained by incubation in RPMI-1640 medium with collagenase 300 u / ml for 2 hours. Then the cells were washed and resuspended in DMEM medium with 20% calf serum and antibiotic-antimycotic. Cells were grown in 25 cm2 vials with 1 ml of medium at 37 ° C and in an atmosphere containing 5% CO ₂ . Reseeding was performed every 7 days in a ratio of 1: 4.

Since the efficiency of keratocyte transfection is low, we used a biologically active gene therapeutic substance based on the plasmid pCMV6-Kan / Neo SOD2 SEQ ID No: 2, containing an additional selection factor, the neo ^r gene, which confers antibiotic resistance to geneticin.

A biologically active gene therapeutic substance was added to the cells and the cells were incubated for 1 hour at 37 ° C. After incubation, serum-free DMEM medium was added to the epithelial cells and DMEM medium containing 10% fetal calf serum to keratocytes was continued and incubated for 24 hours. After a 24-hour incubation, the cells were seeded in a new DMEM medium containing 400 μg / mL of the selection factor antibiotic G418 (Geneticin). Surviving cells were cultured for 2 weeks in 25 cm ³ vials with 5 ml of G418 medium. A total of 24 samples of cultures of epithelial cells and 24 samples of cultures of keratocytes were grown.

An aliquot of 500 μl of suspension was taken from each culture every 24 hours to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with a similar concentration and combined. The analysis of the level of specific cDNA of the SOD2 gene was performed using real-time amplification according to the procedure and with the primers of Example 6 using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-RadUSA) and Bio-RadCFXManager 2.1 software. The maximum increase in the expression (transcription) of the SOD2 gene was observed on day 3 for epithelial cells and on day 5 for keratocytes.

The figure 13 shows the curves of accumulation of a specific amplification product corresponding to the cDNA of the SOD2 gene in keratocytes and epithelial cells of the cornea.

It has been shown that in keratocytes and epithelial cells of the human cornea transfected with a biologically active gene therapeutic substance based on pCMV6-Kan / Neo SOD2 SEQ ID No: 2, without a transport molecule, the expression of the target SOD2 gene is enhanced

Example 12

Transfection of a cell culture of chondroblasts with a biologically active gene therapeutic substance in order to confirm the increase in SOD2 gene expression in these cell cultures.

Human chondroblasts were transfected using amphiphilic block copolymers as a transport molecule in order to determine the effectiveness of a biologically active gene therapeutic substance containing SOD2 cDNA in various cell types, as well as to assess the effect of a transport molecule on the success of transfection with this substance.

Cartilage biopsy samples weighing 50-150 mg were crushed into fragments up to 10 mm ³ and incubated in a buffer solution with collagenase II, hyaluronidase and trypsin for 48 hours at 37 ° C. Cells were washed with serum-free DMEM medium, resuspended in the same medium with gentamicin and grown at 37 ° C and in an atmosphere containing 5% CO ₂ in 75 cm2 vials with 15 ml of medium. Growth was carried out in a serum-free medium, since in a monolayer culture, chondrocytes change their shape and biochemical properties. Reseeding was performed every 4 days in a ratio of 1: 3, the cells were removed from the surface of the vial with trypsin-EDTA solution with 0.02% Versen solution.

Amphiphilic block copolymers were used to transfect cells with a biologically active gene therapeutic substance of the cDNA of the SOD2 gene. The methodology was applied according to (IntJPharm, 2012, 427, 80-87) or in (Macromol. Biosci. 2011, 11, 652-661), with some changes. The block copolymer was synthesized from a mixture of linear polyethyleneimine (PEI) (Polyscience Inc., USA) and bifunctional polyethylene glycol (PEG) N-hydroxysuccinimidyl-75-N- (3-maleimidopropionyl) -amido-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - tetracosoxapenta-heptacontanoate (MAL-dPEG ™ -NHS ester, Quanta BioDesign, Ltd., USA) in borate buffer. A polyplex was prepared 1 hour before the introduction into the cells by mixing the solution of the block copolymer with DNA of the genetic construct pCMV6-Kan / Neo SOD2 SEQ ID No: 3 with the modified cODNA SOD2 SEQ ID No: 3. The transfection mixture was added to the cell suspension in 1 ml of DMEM culture medium with 10% fetal serum and ampicillin.

Since a construct containing a selection factor (resistance to geneticin) was used for transfection, the cells after transfection were grown in 25 cm ³ bottles with 5 ml of medium with geneticin for 12 days, changing the medium every 4 days. An aliquot of 500 μl of suspension was taken from each culture every 24 hours to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with a similar concentration and combined. The analysis of the level of specific SOD2 cDNA was performed using real-time amplification according to the procedure and with the primers of Example 6 using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-Rad, USA) and Bio-RadCFXManager 2.1 software . The maximum increase in SOD2 transcription was observed on day 5. The figure 14 shows the curves of accumulation of a specific amplification product corresponding to the cDNA of the SOD2 gene.

It was shown that in chondroblasts transfected with a biologically active gene therapeutic substance based on pCMV6-Kan / Neo SOD2 SEQ ID No: 3, using amphiphilic block copolymers as a transport molecule, the expression of the target SOD2 gene is enhanced

Example 13

The introduction into the human skin of a biologically active gene therapeutic substance with cDNA of the SOD2 gene in order to confirm the increase in the activity of superoxide dismutase-2 in human skin.

In order to analyze the changes in the activity of the superoxide dismutase-2 protein, the patients were injected with a biologically active gene therapeutic substance containing a genetic construct with SOD2 gene cDNA (B) and a placebo, which is a combination of a vector plasmid without SOD2 gene cDNA with a transport molecule (A) - into the skin of the forearm.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the pCMV6 SOD2 SEQ ID No: 4 genetic construct, which contains the modified SOD2 gene cDNA (SEQ ID No: 4), and the plasmid pCMV6-XL5 used as a placebo - which does not contain the cDNA of the SOD2 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain biologically active gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting biologically active gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of the biologically active gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of a biologically active gene-therapeutic substance and a placebo were located at a distance of 3-5 cm from each other.

The activity of superoxide dismutase-2 was evaluated in biopsy samples of the patient’s skin using the indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA) in Example 8. Biopsy samples were taken 3 days after the introduction of a biologically active gene therapeutic substance. A biopsy was performed from skin areas in the area where the biologically active gene therapeutic substance and placebo were injected, as well as from intact skin, using an Epitheasy 3.5 biopsy device (Medax SRL) as described in Example 9 below.

It was shown that in the patient’s skin in the area of the introduction of a biologically active gene-therapeutic substance with the SOD2 cDNA, there was an increase in the activity of superoxide dismutase-2, while with placebo, the activity of superoxide dismutase-2 in the skin did not change. The results are shown in figure 15.

Example 14

Introduction into the human mucous membrane of the human mouth of a biologically active gene therapeutic substance with cDNA of the SOD2 gene in order to confirm an increase in the activity of superoxide dismutase-2 in the human oral mucosa.

In order to analyze the changes in the activity of the superoxide dismutase-2 protein, the patients were given a biologically active gene therapeutic substance containing a genetic construct with SOD2 gene cDNA (B) and a placebo, which is a combination of a vector plasmid containing no SOD2 gene cDNA with transport molecule (A) - in the mucous membrane of the mouth.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the genetic construct pCDNA 3.1 SOD2 SEQ ID No: 5, which contains the modified cODNA of the SOD2 gene (SEQ ID No: 5), and plasmid pCDNA 3.1 (+), used as a placebo, which does not contain cDNA of the SOD2 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain biologically active gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting biologically active gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 1-2 mm. The volume of the injected solution of the biologically active gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of a biologically active gene-therapeutic substance and a placebo were located at a distance of 2-4 cm from each other.

The activity of superoxide dismutase-2 was evaluated in lysates of biopsy samples of the patient's oral mucosa by the indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA).

Biopsy samples were taken 3 days after the introduction of a biologically active gene therapeutic substance. A biopsy was performed from areas of the oral mucosa in the area where the biologically active gene therapeutic substance was injected, as well as from intact areas and in the placebo area, using the Epitheasy 3.5 biopsy device (Medax SRL), further according to Example 9.

It was shown that in the mucous membrane of the patient’s mouth in the area of the introduction of a biologically active gene therapeutic substance with cDNA of the SOD2 gene, there was an increase in the activity of superoxide dismutase-2, while with placebo, the activity of superoxide dismutase-2 in the oral mucosa did not change. The results are shown in figure 16.

Example 15

The introduction of a biologically active gene therapeutic substance into the muscle tissue with the cDNA of the SOD2 gene in order to confirm the increase in the activity of superoxide dismutase-2 in human muscle tissue.

In order to analyze the changes in the activity of the superoxide dismutase-2 protein, the patients were injected with a biologically active gene therapeutic substance containing a vector plasmid with the SOD2 gene cDNA (B) and a placebo, which is a combination of a vector plasmid containing no SOD2 cDNA gene with the transport molecule (A) - into the muscle tissue of the calf muscle.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the genetic construct pCMV6-Kan / Neo SOD2 SEQ ID No: 6, which contains the modified cDNA of the SOD2 gene SEQ ID No: 1, and plasmid pCMV6 -Kan / Neo, used as a placebo, which does not contain cDNA of the SOD2 gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade.

To obtain biologically active gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting biologically active gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 15-20 mm. The volume of the injected solution of a biologically active gene-therapeutic substance and placebo is about 0.5 ml for each. The foci of the introduction of a biologically active gene-therapeutic substance and placebo were located at a distance of 5-7 cm from each other

The activity of superoxide dismutase-2 was evaluated in lysates of biopsy specimens of the patient’s muscle tissue using the indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA).

Biopsy samples were taken 3 days after the introduction of a biologically active gene therapeutic substance. A biopsy was performed from muscle tissue in the area where the biologically active gene therapeutic substance was injected, as well as from intact areas of the muscle and in the placebo area, using the MAGNUM automatic biopsy device (company BARD, USA), further according to Example 9.

It was shown that, in the patient’s muscle tissue, in the area of the introduction of a biologically active gene therapeutic substance with cDNA of the SOD2 gene, there was an increase in the activity of superoxide dismutase-2, while with placebo, the activity of superoxide dismutase-2 in muscle tissue did not change. The results are shown in figure 17.

Example 16

Introduction to a group of different patients of biologically active gene therapeutic substances containing modified and native SOD2 cDNA.

In order to confirm the individual nature of the increase in the activity of superoxide dismutase-2 protein to various levels when biologically active gene therapeutic substances with modified and native SOD2 gene cDNA are introduced into the skin of the patients, the level of superoxide dismutase-2 protein activity in the skin biopsy lysate of a group of patients was analyzed depending on the presence and type of cDNA modifications of the SOD2 gene.

The sequence of native SOD2 cDNA is shown in Figure 1, SEQ SOD2 ID No: 1., The sequences of modified SOD2 cDNA are shown in Figures 2-7 (SEQ SOD2 ID No: 2, SEQ SOD2 ID No: 3, SEQ SOD2 ID No: 4, SEQ SOD2 ID No: 5, SEQ SOD2 ID NO: 6, SEQ SOD2 ID No: 7).

Moreover, the genetic constructs, one of which contains the native cDNA of the gene SOD2 SEQ ID No: 1, the second genetic construct contains the modified cDNA of the gene SOD2 SEQ ID No: 2, the third genetic construct contains the modified cDNA of the gene SOD2 SEQ ID No: 3, the fourth genetic construct contains a modified cDNA of the gene SOD2 SEQ ID No: 4, the fifth genetic construct contains a modified cDNA of the gene SOD2 SEQ ID No: 5, the sixth genetic construct contains a modified cDNA of the gene SOD2 SEQ ID No: 6, the seventh genetic construct contains a ovannuyu cDNA gene SOD2 SEQ ID No: 7, Eighth genetic construct (placebo) is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. To obtain biologically active gene therapeutic substances, DNA dendrimer complexes were prepared according to Example 7.

The resulting seven variants of biologically active gene therapeutic substances and a placebo were used for administration to the skin of patients. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each biologically active gene-therapeutic substance was about 0.3 ml. The foci of the introduction of biologically active gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Each of the 15 patients, randomly selected, was given 7 biologically active gene-therapeutic substances and a placebo in the skin of the forearm.

Biopsy samples were taken 72 hours after the administration of biologically active gene therapeutic substances. Biopsies were performed from sites where biologically active gene therapeutic substances, placebo, and intact skin were injected using the Epitheasy 3.5 skin biopsy device (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 3 mm, and the weight was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm.

A - biopsy obtained after the introduction of a biologically active gene-therapeutic substance based on pCMV6-SEQ ID No: 1, containing unmodified cDNA SOD2 EQ ID No: 1 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

B — a biopsy obtained after the introduction of a biologically active gene therapeutic substance based on pCMV6-SEQ ID NO: 2, containing variant 1 of the modified SOD2 cDNA SEQ ID No: 2 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

C is a biopsy obtained after the introduction of a biologically active gene therapeutic substance based on pCMV6-SEQ ID No: 3, containing variant 2 of the modified SOD2 cDNA SEQ ID No: 3 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

D is a biopsy obtained after the introduction of a biologically active gene therapeutic substance based on pCMV6-SEQ ID No: 4, containing variant 3 of the modified cODNA SOD2 SEQ ID No: 4 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

E - is a biopsy obtained after the introduction of a biologically active gene-therapeutic substance based on pCMV6-SEQ ID No: 5, containing 4 variants of the modified SOD2 cDNA SEQ ID No: 5 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

F - biopsy obtained after the introduction of a biologically active gene-therapeutic substance based on pCMV6-SEQ ID No: 6, containing variant 5 of the modified cDNA SOD2 SEQ ID No: 6.) According to example 3 in combination with a transport molecule - dendrimer according to example 7.

G is a biopsy obtained after the introduction of a biologically active gene therapeutic substance based on pCMV6-SEQ ID No: 7, containing variant 6 of the modified SOD2 cDNA (SEQ ID No: 7.) According to Example 3 in combination with the transport molecule dendrimer according to Example 7 .

H is a biopsy obtained after the introduction of the vector plasmid PCMV6-XL5, not containing the cDNA of the SOD2 gene of Example 3 in combination with the transport molecule dendrimer of Example 7.

The activity of superoxide dismutase-2 protein was determined in nine skin biopsies from each patient (from A to H and in the intact skin biopsy) 72 hours after the introduction of biologically active gene therapeutic substances by an indirect colorimetric method using the SOD Assay Kit-WST (Sigma-Aldrich kit , USA). The analysis was carried out according to the method recommended by the manufacturer. Preliminarily, the degree of inhibition of the color reaction was evaluated depending on the concentration of the pure superoxide dismutase-2 preparation. Based on the data of previous experiments described in example 8, the lysate was diluted 5 times.

Based on the results of the analysis of the level of activity of superoxide dismutase-2, we selected indicators for each biopsy from each patient, which showed the maximum levels of activity of superoxide dismutase-2 and combined them into seven groups, based on the following criterion:

In group 1, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed with the introduction of unmodified SOD2 cDNA. This group included 2 biopsies out of 15.

In group 2, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed when 1 variant of modified SOD2 cDNA was introduced. This group included 1 biopsy sample of 15.

In group 3, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed with the introduction of 2 variants of modified SOD2 cDNA. This group included 1 biopsy sample of 15.

In group 4, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed with the introduction of 3 variants of modified SOD2 cDNA. This group included 1 biopsy sample from 15.

In group 5, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed with the introduction of 4 variants of modified SOD2 cDNA. This group included 4 out of 15 biopsy samples (26.66% of the total).

In group 6, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed with the introduction of 5 variants of modified SOD2 cDNA. This group included 1 biopsy sample from 15.

In group 7, the maximum inhibition in the biopsy sample lysate, which corresponds to the maximum activity of superoxide dismutase-2, was observed with the introduction of the 6th variant of modified SOD2 cDNA. This group included 5 biopsies out of 15.

None of the biopsy specimens showed that the maximum inhibition of the color reaction, corresponding to the maximum activity of superoxide dismutase-2, is present with the introduction of a placebo vector plasmid that does not contain the cDNA of the SOD2 gene.

None of the biopsy specimens showed that the maximum inhibition of the color reaction, corresponding to the maximum activity of superoxide dismutase-2, is present with the introduction of a placebo vector plasmid that does not contain the cDNA of the SOD2 gene.

Figure 18 shows, for each group of biopsy samples, charts of indicators of the inhibition of the color reaction (averaged within the group, if more than one biopsy is included in the group) for all active gene therapeutic substances participating in the experiment, after the patients have been given these active gene therapeutic substances containing modified and native cDNA of the SOD2 gene.

From this example it follows that the achievement of the maximum activity of the superoxide dismutase-2 protein in biopsies of the skin of various patients when biologically active gene-therapeutic substances are introduced into the skin is individual in nature and is associated with the individual characteristics of the patients and depends on the presence and type of modifications in the SOD2 gene cDNA, included in biologically active gene therapeutic substances.

Each biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances is effective in some significant group of patients. Therefore, to select the most effective biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples or cells grown from these biopsy samples for the maximum therapeutic effect of biologically active gene-therapeutic substances as part of a line of biologically active gene therapeutic substances.

Example 17

Transfection of a patient’s fibroblast cell line with various biologically active gene therapeutic substances containing modified and native SOD2 cDNA to personalize from the line of biologically active gene therapeutic substances the most effective biologically active gene therapeutic substance for this patient for subsequent transfection of patient cells with this substance as part of a therapeutic procedure.

In order to determine the most effective biologically active gene-therapeutic substance in relation to a particular patient, the activity of superoxide dismutase-2 in cell lysates of this patient's fibroblasts transfected with different biologically active gene-therapeutic substances containing native or modified SOD2 cDNA was analyzed. The sequence of native SOD2 cDNA is shown in Figure 1, SEQ ID No: 1., The sequences of modified SOD2 cDNA are shown in Figure 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5 , SEQ ID NO: 6, SEQ ID No: 7).

Fibroblast cultures were grown from the patient’s biopsy sample of Example 5, aliquots were taken and cell lysis was performed: the cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethyl sulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm, the protein concentration in the supernatant was determined by the Bradford method.

Superoxide dismutase-2 activity was determined by the indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA). The analysis was carried out according to the method recommended by the manufacturer. Preliminarily, the degree of inhibition of the color reaction was evaluated depending on the concentration of the pure superoxide dismutase-2 preparation.

Then the patient’s fibroblast culture was divided into 8 parts. One part, designated (A), was transfected according to Example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 1 containing unmodified SOD2 DNA SEQ ID No: 1 according to Example 3 in combination with liposome transport molecules according to example 9. The second part, indicated by (B), was transfected according to example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 2, containing variant 1 of the modified cODNA SOD2 SEQ ID No: 2 according to example 3 in combination with transport molecules - liposomes according to example 9. 3rd cha the one indicated by (C) was transfected in accordance with Example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 3 containing variant 2 of the modified cODNA SOD2 SEQ ID No: 3 according to Example 3 in combination with liposome transport molecules according to example 9. The 4th part, labeled (D), was transfected according to example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 4, containing variant 3 of the modified cODNA SOD2 SEQ ID No: 4 according to Example 3 in combination with transport molecules - liposomes according to example 9. 5th part, about the aforementioned (E) was transfected according to Example 7 with a biologically active gene therapeutic substance based on the pCMV6-SEQ ID No: 5 vector containing 4 variant modified SOD2 cDNA SEQ ID No5 according to Example 3 in combination with liposome transport molecules according to Example 9. 6 the fifth part, designated (F), was transfected according to Example 7 with a biologically active gene therapeutic substance based on the vector pCMV6-SEQ ID No: 6, containing variant 5 of the modified cODNA SOD2 SEQ ID No: 6 according to Example 3 in combination with transport molecules - liposomes according to example 9. 7th part, designated the given one (G) was transfected according to Example 7 with a biologically active gene therapeutic substance based on the pCMV6 SEQ ID No: 7 vector containing variant 6 of the modified cDNA SOD2 SEQ ID No: 7 according to Example 3 in combination with the liposome transport molecules of Example 9. The 8th part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 not containing SOD2 cDNA according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

Superoxide dismutase-2 activity was determined 72 hours after transfection. Based on the data of previous experiments described in example 8, the lysate was diluted 5 times.

According to the results of the analysis of the activity of superoxide dismutase-2 in the patient’s fibroblast culture, a variant of the biologically active gene-therapeutic substance was isolated, during transfection of which the maximum inhibition occurs in the cell culture lysate and, accordingly, the maximum activity of superoxide dismutase-2 is observed. In this experiment, the maximum inhibition in the lysate was observed during transfection with a biologically active gene therapeutic substance based on pCMV6 SOD2 SEQ ID No: 5 containing a modified SOD2 cDNA, as shown in Figure 19.

Thus, the most effective biologically active gene-therapeutic substance was selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Example 18

The introduction into the patient’s skin of various biologically active gene-therapeutic substances containing the modified and native SOD2 gene cDNA with the aim of personalizing the selection of the most effective biologically active gene-therapeutic substance from the line of biologically active gene-therapeutic substances for this patient for subsequent administration of this substance to the patient as part of a therapeutic procedure.

In order to determine the most effective biologically active gene-therapeutic substance for a particular patient, the activity of superoxide dismutase-2 in the lysates of biopsy samples of the skin of this patient was analyzed after the introduction of biologically active gene-therapeutic substances into the skin containing native or modified SOD2 gene cDNA. The sequence of native SOD2 cDNA is shown in Figure 1, SEQ ID NO: 1., The sequences of modified SOD2 cDNA are shown in Figure 2-7 (SEQ ID NO: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5 , SEQ ID No: 6, SEQ ID No: 7)

The patient was administered 7 biologically active gene therapeutic substances and a placebo into the skin of the forearm.

The first biologically active gene therapeutic substance (A) based on pCMV6-SEQ ID No: 1, containing unmodified SOD2 cDNA SEQ ID No: 1 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The second biologically active gene therapeutic substance (B) based on pCMV6-SEQ ID No: 2, containing variant 1 of the modified SOD2 cDNA SEQ ID No: 2 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The 3rd biologically active gene therapeutic substance (C) based on pCMV6-SEQ ID No: 3, containing variant 2 of the modified SOD2 cDNA SEQ ID No: 3 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The 4th biologically active gene therapeutic substance (D) based on pCMV6-SEQ ID No: 4, containing variant 3 of the modified SOD2 cDNA SEQ ID No: 4 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The 5th biologically active gene therapeutic substance (E) based on pCMV6-SEQ ID No: 5, containing the 4th variant of the modified SOD2 cDNA SEQ ID No: 5 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The 6th biologically active gene therapeutic substance (F) based on pCMV6-SEQ ID No: 6, containing variant 5 of the modified SOD2 cDNA SEQ ID No: 6 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The 7th biologically active gene therapeutic substance (G) based on pCMV6-SEQ ID No: 7, containing variant 6 of the modified SOD2 cDNA SEQ ID No: 7 according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

8th - vector plasmid pCMV6-XL5, not containing SOD2 cDNA according to example 3 in combination with a transport molecule - dendrimer according to example 7.

Moreover, the genetic constructs, one of which contains the native cDNA of the gene SOD2 SEQ ID No: 1, the second genetic construct contains the modified cDNA of the gene SOD2 SEQ ID No: 2, the third genetic construct contains the modified cDNA of the gene SOD2 SEQ ID No: 3, the fourth genetic construct contains a modified cDNA of the gene SOD2 SEQ ID No: 4, the fifth genetic construct contains a modified cDNA of the gene SOD2 SEQ ID No: 5, the sixth genetic construct contains a modified cDNA of the gene SOD2 SEQ ID No: 6, the seventh genetic construct contains a SOD2 SEQ ID No ovannuyu cDNA gene: 7, eighth plasmid - a placebo, is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. To obtain biologically active gene therapeutic substances, DNA dendrimer complexes were prepared according to Example 7.

The resulting seven variants of biologically active gene therapeutic substances and a placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each biologically active gene-therapeutic substance was about 0.3 ml. The foci of the introduction of biologically active gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Biopsy samples were taken 72 hours after the administration of biologically active gene therapeutic substances. Biopsies were performed from sites where biologically active gene therapeutic substances, placebo, and intact skin were injected using the Epitheasy 3.5 skin biopsy device (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 3 mm, and the weight was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm.

Superoxide dismutase-2 activity was determined in nine biopsy specimens of the patient’s skin 72 hours after the administration of biologically active gene therapeutic substances by the indirect colorimetric method using the SOD Assay Kit-WST kit (Sigma-Aldrich, USA). The analysis was carried out according to the method recommended by the manufacturer. Preliminarily, the degree of inhibition of the color reaction was evaluated depending on the concentration of the pure superoxide dismutase-2 preparation. Based on the data of previous experiments described in example 8, the lysate was diluted 5 times.

According to the results of the analysis of the activity of superoxide dismutase-2 in the lysate of biopsy samples of the patient’s skin, a variant of the biologically active gene-therapeutic substance was isolated, with the introduction of which maximum inhibition in the skin biopsy of the skin is observed and the maximum activity of superoxide dismutase-2 is observed, respectively. In this experiment, the maximum inhibition in the skin biptate lysate was observed with the introduction of a biologically active gene therapeutic substance based on pCMV6SOD2SEQ ID NO: 6 containing a modified SOD2 cDNA, as shown in Figure 20.

Thus, the most effective biologically active gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

A line of biologically active gene-therapeutic substances has been created for the correction of pathological conditions of cells of organs and tissues and / or human organs and tissues associated with oxidative stress due to insufficient expression of the SOD2 gene, a method for its preparation and use.

The created line of biologically active gene therapeutic substances using one of the modified or native cDNA of the SOD2 gene makes it possible in practice to use the biologically active gene therapeutic substances in the line to increase the activity of superoxide dismutase-2 protein in various cells of organs and tissues and / or human organs and tissues.

As a result of preliminary studies of the biopsy of the patient, or cells grown from these biopsies, determine which version of the biologically active gene therapeutic substance from the created line of biologically active gene therapeutic substances should be selected for this patient in order to increase the activity of superoxide dismutase protein the cells of these organs and tissues and / or organs and tissues to the required level in relation to a particular patient. In cases where the use of a biologically active gene therapeutic substance with native SOD2 gene cDNA does not lead to the desired change in the level of activity of superoxide dismutase-2 protein in the cells of organs and tissues and / or organs and tissues, it is necessary to use a substance based on the modified cODNA of the SOD2 gene, leading to more efficient expression of the SOD2 gene.

When using the claimed biologically active gene therapeutic substance, the exogenous genetic material is not embedded in the cell genome.

The line of biologically active gene therapeutic substances provides a high level of SOD2 gene expression, increasing the activity of superoxide dismutase-2 protein in cells of organs and tissues and / or organs and tissues of a person, in particular, in hematopoietic cells, or hepatocytes, or mesenchymal stem cells, or chondroblasts, or pancreatic cells (for example, in pancreatic islet cells), or skin myocytes or fibroblasts, or keratocytes, or corneal epithelial cells, or in neurons, ganglia, Schwann cells, astrocytes, oligodendrocytes, microglia, or in spermatozoa, or in nephrons, or endothelial cells, or epithelial cells in combination with or without a transport molecule during transfection with these biologically active gene therapeutic substances of human and / or human cells and / or organs and human tissues, in particular in the skin, joints, liver, adrenal glands, kidneys, brain and spinal cord, lungs, heart, blood vessels, gastrointestinal tract, prostate, pancreas, eye, cornea, mucous membrane e, cartilage, muscle tissue in combination with or without a transport molecule when these biologically active gene-therapeutic substances are introduced into human organs and tissues.

Thus, the above examples confirm the fulfillment of the task, namely, the creation of a line of biologically active gene therapeutic substances, when used with respect to the cells of organs and tissues and / or human organs and tissues, defects in the SOD2 gene that affect the expression of this gene or the level of activity of the superoxide dismutase-2 protein encoded by this gene, and the insufficient activity of the superoxide dismutase-2 protein caused by factors affecting the expression of the SOD2 gene is also compensated.

An increase in the efficiency of correction of the level of activity of superoxide dismutase-2 protein in cells of human organs and tissues is achieved due to the fact that when the protein is insufficient due to a defect in the SOD2 gene, it is not a protein that is used, but a genetic construct with cODA of the SOD2 gene that encodes this protein. With the introduction of genetic constructs, in contrast to the introduction of the protein itself, as in the prototype, the required frequency of their introduction is reduced due to the prolonged action, and intracellular delivery is also facilitated.

In addition, individual characteristics of the patient are taken into account.

Industrial applicability.

All the above examples on the creation and use of the created line of biologically active gene-therapeutic substances confirm its industrial applicability.

List of abbreviations

DNA - deoxyribonucleic acid

cDNA - complementary deoxyribonucleic acid

RNA - ribonucleic acid

mRNA - template ribonucleic acid

PCR - polymerase chain reaction

ml - milliliter, μl - microliter

l - liter

mcg - micrograms

mg - milligram

g - gram

μM - micromol

mm - millimole

rpm - revolutions per minute

nm - nanometer

cm - centimeter

MW - milliwatts

father f-relative fluorescence unit

BAHTS - biologically active gene therapeutic substance

PBC - Phosphate-buffered saline

DMEM - double modification of the needle environment

Claims (5)

1. A tool for the correction of pathological conditions of cells of organs and tissues and / or organs and tissues of a person based on the SOD2 gene associated with oxidative stress, where the cells of organs and tissues are selected from cells of fibroblasts, keratocytes and epithelial cells of the eye, chondroblasts; organs and tissues are selected from the skin, mucous membrane of the human mouth or human muscle tissue, which is a combination of biologically active gene therapeutic substances, each of which is a gene therapeutic substance selected from a group of gene therapeutic substances, each representing a genetic construct for the basis of a vector plasmid comprising the cDNA of the SOD2 gene, with the coding sequence of a superoxide dismutase-1 protein, with deletions of 5 'and 3'-untranslated regions, namely, obtained on the basis of a portion of native unmodified cDNA of the SOD2 gene SEQ ID No: 1, or a modified cDNA of the SOD2 gene, while SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, are used as a modified cDNA of the SOD2 gene or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each of which also contains regulatory elements that ensure transcription of this sequence in eukaryotic cells, organs and human tissues and can provide high level of SOD2 gene expression and increase superac protein activity siddismutase-1 in the cells of organs and tissues and / or organs and tissues of a person, in combination with or without a transport molecule. 2. The tool according to p. 1, characterized in that each of the totality of the created genetic constructs with cDNA of the SOD2 gene contains a nucleotide sequence that includes a protein coding region of the cODA of the SOD2 gene, which carries modifications that do not affect the structure of the superoxide dismutase-1 protein, and namely, nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, or a combination of the above modifications and, accordingly, do not affect the amino acid sequence encoded by this sequence nness. 3. The tool according to claim 1, characterized in that in each of the totality of biologically active gene therapy substances created, liposomes, or dendrimers of the 5th and higher generations, or amphiphilic block copolymers are used as a transport molecule. 4. The method of obtaining funds under item 1, which consists in the fact that receive cDNA of the SOD2 gene, then place the cDNA in a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, increase and secrete the required amount of genetic design, then the genetic construct is combined with a transport molecule to transfect the obtained biologically active gene therapeutic substance of cells of organs and tissues and / or introduce the obtained biologically active gene therapy substance into the organs and tissues of a person, using the cDNA of the SOD2 gene SEQ ID No: 1, or SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7. 5. The method of using the means for the correction of pathological conditions of cells of organs and tissues and / or organs and human tissues, based on the SOD2 gene, associated with a quantitative reduction of the SOD2 protein according to claim 1, which consists in transfecting the patient selected specifically for this patient on the basis of a preliminary experiment on determination of the most effective variant from the biologically active gene therapy substances created and presented in combination to the patient’s organs and tissues of the patient’s autologous cells transfected with gene-tera evticheskoy substance selected from the plurality of established gene therapy substances, and / or during introduction into organs and tissue of the patient genetically therapeutic substance or several substances selected / selected from the group created by a gene therapy substance, or a combination of the methods indicated.

Images