RU2653487C1 - Agent for treatment of human organism states related to decrease in the lif gene expression and/or decrease in the amount of protein of the factor inhibiting leucemia based on gene-therapeutic substances with lif gene, method of obtaining and using - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: group of inventions relates to medicine and concerns a means for correction of states of cells, different organs and tissues, as well as the human organs and tissues associated with a decrease in the expression of the LIF gene and/or a decrease in the amount of the protein of the factor inhibiting leukemia, based on gene therapeutic substances with the LIF gene, where the organs and tissues cells are selected from fibroblasts, endometrial cells of the uterus, epithelial cells; organs and tissues are selected from the skin, mucous membrane of the mouth or muscle tissue, which is, at least, one gene therapeutic substance selected from the group of gene therapeutic substances, each representing a genetic construct based on a vector plasmid comprising the cDNA of the LIF gene, with the coding sequence of the protein of the factor inhibiting leukemia, with deletions of 5' and 3'-nontranslated regions, in combination with a transport molecule or without it, when these gene therapeutic substances are introduced into human organs and tissues. Group of inventions also relates to a method for the preparation of said agent for treating the human body conditions associated with a decrease in LIF gene expression and/or a decrease in the amount of the protein of a factor inhibiting leukemia; a method of using said agent for treating the human body conditions, associated with a decrease in the expression of the LIF gene and/or a decrease in the amount of the protein of the factor inhibiting leukemia.

EFFECT: group of inventions provides a high and stable level of the target protein in the cells.

5 cl, 20 dwg, 18 ex

Description

FIELD OF THE INVENTION

The invention relates to molecular biology, biotechnology, genetic engineering and medicine and can be used to correct the pathological conditions of cells of various organs and tissues, as well as human organs and tissues proper, associated with a decrease in the level of LIF gene expression and / or a decrease in the amount of protein inhibiting factor leukemia, in particular for therapeutic purposes.

Prior level.

In the human body, low molecular weight proteins of cytokines are present, which carry out their biological effect through interaction with specific cellular surface receptors. Cytokines regulate the activation, differentiation and proliferation of immune and non-immune cells, are involved in the mediation of both inflammatory and immune responses, and are critical elements in the response of human organs and tissues to damage or viral infection.

The leukemia inhibiting factor ((leukemia inhibitory factor, LIF gene) is a highly glycated polypeptide with a molecular weight of 45-56 kDa, which is encoded by a gene localized in humans on chromosome 22ql2. It is a cytokine from the family of interleukin-6 (IL-6) acting by binding to a transmembrane receptor consisting of 2 subunits — the LIF receptor (LIFR) and glycoprotein dr130. This protein affects the proliferation, differentiation and survival of cells in various tissues, including reproductive tissue Act, where it is involved in many processes, starting with the growth and development of gametes and ending with the onset of pregnancy.

The leukemia inhibiting factor is one of the key paracrine markers of implantation, which is important during blastocyst apposition and adhesion. This protein has the properties of a pro-inflammatory and hematopoietic cytokine and partially duplicates the biological properties of IL-6, IL-11, etc. The concentration of the leukemia inhibiting factor in uterine washes and endometrial tissue samples is lower in patients with infertility of unknown origin, as well as in patients with unsuccessful IVF attempts compared to fertile women [Dimitriadis E et al. // Hum. Reprod. 2005; 11 (6): 613-30.]. Moreover, in women with infertility with pronounced expression of the LIF gene in the middle of the luteal phase, the chances of pregnancy were 6.4 times higher than in patients with reduced expression of the LIF gene [Serafini P et al. // Int J Gynecol Obstet 2008; 102: 23-7].

The leukemia inhibiting factor performs the following functions in the human body: it supports the growth and inhibition of differentiation of normal embryonic stem cells, stimulates the production of acute phase proteins by hepatocytes; affects the property of interleukin 3 to enhance megakaryocytic differentiation of myeloid progenitor cells and stimulate bone resorption and bone formation; with the development of the nervous system, it induces and enhances the synthesis of neuropeptides and acetylcholine in the sympathetic nervous system and is a neurotrophic survival factor, affects hematopoiesis, energy metabolism. The soluble form of the leukemia inhibiting factor protein can be determined in human body fluids such as serum, whole blood, synovial fluid and urine.

A quantitative assessment of this protein in healthy people and in patients suffering from various diseases helps to get a complete picture in various clinical situations. Of key importance is the determination of the glycosylated form of the protein of the factor inhibiting leukemia using antibodies obtained to such a molecule and a glycosylated standard. It has been shown that the level of this protein in blood, urine and other body fluids rises under pathological conditions, such as hypercalcemia, polycythemia, erythropoietic crisis, hyperthrombocythemia; in acute rejection of the allograft, especially the kidney; with osteoporosis. In humans, this protein plays an important role in inflammatory diseases of the lungs - in acute and chronic inflammation, as well as pneumonia. With rheumatoid arthritis, the amount of protein is increased in serum and synovial fluid, and it is also increased in cancer (adenocarcinoma, mesothelioma, melanoma), and peritonitis. It has been shown that many lines of human tumor cells constitutively produce detectable levels of leukemia inhibiting factor, whereas expression of this protein is usually induced by stimulating factors. The concentration of leukemia inhibiting factor in bone marrow is significantly increased in patients with hematologic diseases. The level of this protein in the amniotic fluid is greatly increased and is associated with intrauterine infections.

Thus, increasing the amount of leukemia inhibiting factor in the human body can be an example of protective function in pathological conditions.

US Pat. No. 5,712,156 shows a method for improving the implantation efficiency and survival of embryos using a recombinant-derived human leukemia inhibiting factor protein (LIF gene). Blastocysts were cultured for 48 hours in a medium with leukemia inhibiting factor protein and implanted in a sheep uterus. The number of blastocysts that survived was 4 times higher than in the case when the blastocysts were cultured in a medium without leukemia-inhibiting factor protein. When using recombinant mouse protein, no effect was found to increase embryo survival and implantation efficiency. WO2000001404 and US Pat. No. 5,962,321 also suggest the use of a leukemia inhibiting factor protein preparation as an agent that increases the likelihood of embryo implantation. The effectiveness of this method has been demonstrated in laboratory animals. The disadvantage of this approach is the high cost of obtaining pure recombinant protein, and the repeated introduction of protein increases the cost of treating the patient.

A more effective and promising method of treatment is the use of genetic therapeutic methods, in particular, the introduction of a genetic construct carrying the LIF gene cDNA directly into the endometrium.

", 2010, т. 16, додаток. - С. 159-160.). При этом использования полученных генетических конструкций в качестве генно-терапевтического средства не проводилось.Known research on obtaining genetic constructs with the LIF gene, which was carried out using RT-PCR technology using mRNA isolated from the placenta as a matrix. In PCR, primers were used to obtain cDNA encoding both a mature protein and a protein with a signal peptide. After determining the primary sequence of PCR products cloned in pUC28, the DNA fragment encoding the mature protein was subcloned into the pET24 expression vector. Induction of IPTG led to the synthesis in E. coli cells of a protein, a product of the LIF gene, which was obtained in refolded form, and its biological activity was tested on a culture of mouse mouse myeloid leukemic cells M1. For recombinant expression of LIF in mammalian cells, two recombinant plasmids based on the expression vector for eukaryotic cells pCVU55763 were constructed in which the cytomegalovirus promoter provides the expression of the recombinant LIF gene encoding a protein with a signal peptide. It was shown that genetically modified cells of three lines obtained by transfection with recombinant plasmids with the LIF gene express a glycosylated protein that is secreted into the culture medium (S.E. Rymar et al. // Journal of Medical Sciences

", 2010, v. 16, supplement. - S. 159-160.). However, the use of the obtained genetic constructs as a gene-therapeutic agent was not carried out.

In the application WO2002020609 A2, which refers to the use of the protein interleukin 11, which is similar in structure to the protein of the factor inhibiting leukemia, and refers to the same family of IL-6 cytokines, as well as polynucleotides encoding this protein in the treatment of strokes and neuropathy , as well as for the detection of agonist compounds (ligands) useful in therapy. In particular, the application refers to a polynucleotide that encodes an interleukin 11 protein for the manufacture of a medicament for the treatment of stroke or neuropathy, as well as for gene therapy. Such gene therapy involves introducing the polynucleotide sequence of the IL-11 gene into somatic cells by genetic engineering to replace the defective IL-11 gene, or to increase the production of interleukin 11 protein in a disease such as stroke. In a preferred embodiment, the polynucleotide comprises a native polynucleotide sequence encoding a natural protein of the IL-11 gene. A polynucleotide may contain non-coding 5 ′ and 3 ′ sequences — transcribed but untranslated sequences, splicing and polyadenylation signals, ribosome binding sites, and sequences that stabilize mRNA. Other embodiments of the present invention include polynucleotides encoding variants of a polypeptide in which amino acid residues are substituted, deleted or added, in any combination.

The disadvantage of this approach is that when creating a gene-therapeutic agent in this invention, methods are applied that lead to deletions, substitutions, insertions of amino acids of the target protein, which can lead to a change in its structure and properties, and also do not take into account the individual characteristics of the patient, connection with which a group of variations for this tool may be needed.

For the prototype, the authors adopted WO 0194605, which discloses methods for using polynucleotides encoding a cytokine or cytokine receptor in the preparation of transformed host cells and transgenic animals. In particular, the use of recombinant adeno-associated virus (Raav) based vector compositions containing polynucleotide sequences that express one or more mammalian cytokines or cytokine receptor polypeptides in a mammalian or human cell is described. The claimed vector may contain a portion of a nucleic acid that encodes a cytokine selected from the group consisting of interleukin, leptin, leukemia inhibiting factor (LIF), and neurotrophic factor. The vector composition may further comprise nanoparticles, namely, nanocapsules, liposomes, a lipid, or a lipid complex.

Also disclosed are methods of treating and alleviating the symptoms of various conditions and disorders in animals, including blindness, retinitis pigmentosa, age-related macular degeneration, obesity, anorexia, and related eating disorders, as well as neurological and musculoskeletal disorders, including, for example , amyotrophic lateral sclerosis, which are associated with a deficiency of a cytokine or cytokine receptor polypeptide in a mammal or human. The method includes the introduction of a genetic construct that encodes one or more cytokines or cytokine receptor polypeptides in a pharmaceutically acceptable carrier to the animal in an amount and for a period of time sufficient to treat or reduce the deficiency of polypeptides such as leptin (LEP), BDNF, LIF, BDNF receptor, LIF receptor, receptor for leptin, ciliary neurotrophic factor (CNTF) and CNTF polypeptide receptor.

The disadvantage of this approach is that when creating a gene-therapeutic agent in this invention, an adeno-associated virus is used that can integrate into the chromosome of the host cell, and also individual characteristics of the patient are not taken into account, which may require a group of variations for this agent.

Disclosure of invention

The objective of the invention is to provide a highly effective tool for treating the conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of protein of the leukemia inhibiting factor based on gene therapeutic substances with the LIF gene, which is a group of gene therapeutic substances, the use of which, taking into account the individual characteristics of the patient, there is an increase in the level of expression of the LIF gene and / or an increase in the amount of protein inhibiting factor lei kemia in the cells of organs and tissues and / or organs and tissues of the body

This problem is solved due to the fact that a tool has been created for treating the conditions of the human body associated with a decrease in the expression of the LIF gene and / or a decrease in the amount of protein of the leukemia-inhibiting factor based on gene therapeutic substances with cDNA of the LIF gene, which is at least one gene-therapeutic substance selected from the group of gene-therapeutic substances, each of which represents a genetic construct based on a vector plasmid comprising cDNA of the LIF gene, with the coding sequence the leukemia inhibiting factor protein with deletions of 5 'and 3'-untranslated regions, namely, obtained on the basis of a portion of native unmodified cDNA of the LIF gene SEQ ID No: 1, or modified cDNA of the LIF gene, while as a modified cDNA of the LIF gene using SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs, each which also contains regulatory elements that provide a high level of LIF gene expression in eukaryotic cells, in particular in the cell organs and tissues of a person, and capable of increasing the amount of protein of a factor inhibiting leukemia in the cells of organs and tissues and / or organs and tissues of a person, in particular in the cerebral cortex, hippocampus, in the lateral ventricles of the brain, cerebellum, thyroid gland, parathyroid gland, adrenal glands, appendix, bone marrow, lymph nodes, tonsils, spleen, heart, nasopharynx, bronchi, lungs, liver, gall bladder, liver, pancreas, salivary glands, stomach, duodenum, small intestine, large intestine, rectum, kidney, bladder, testes, spermatic cord, prostate, seminal vesicles, mammary glands, cervix, fallopian tubes, ovaries, placenta, skin, in the mucous membrane of the oral cavity, heart muscle tissue, skeletal muscle tissue, smooth muscle tissue, uterine endometrium, adipose tissue, soft tissues, in fibroblasts, uterine endometrial cells, epithelial and muscle cells in combination with or without a transport molecule when these gene therapeutic substances are introduced into human organs and tissues. Moreover, each genetic construct with a modified cDNA of the LIF gene contains a nucleotide sequence that includes a protein-coding region of the cDNA of the LIF gene that carries modifications that do not affect the structure of the protein of the leukemia-inhibiting factor, namely, nucleotide substitutions that do not lead to amino acid substitutions or breakage of the amino acid chain, or a combination of the above modifications and that do not affect the amino acid sequence encoded by this sequence. As a transport molecule, liposomes, or dendrimers of the 5th and higher generations, or amphiphilic block copolymers are used.

A method of obtaining a means for treating conditions of the human body associated with a decrease in the expression of the LIF gene and / or a decrease in the amount of the protein of the leukemia inhibiting factor according to claim 1, is to obtain each gene therapeutic substance from the group of gene therapeutic substances according to claim 1, in this case, cDNA of the LIF gene is obtained, then cDNA is placed in a vector plasmid capable of providing a high level of expression of this cDNA in cells of various human organs and tissues, they increase and secrete the required amount of genetically of this construct, then the genetic construct is combined with a transport molecule to transfect the obtained gene therapeutic substance of cells of organs and tissues and / or introduce the obtained gene therapeutic substance into human organs and tissues, using cDNA of the LIF gene with the coding sequence of the leukemia inhibiting factor protein , with deletions of 5 'and 3'-untranslated regions, namely, obtained on the basis of a portion of a native unmodified cDNA of the LIF gene SEQ ID No: 1, or a modified cDNA of the LIF gene, as a modified cDNA of the LIF gene, either SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination of these genetic constructs.

A method of using the agent for treating human body conditions associated with a decrease in LIF gene expression and / or a decrease in the amount of leukemia inhibiting factor protein, including female infertility, consists in transfecting a gene therapeutic substance selected from the group of created gene therapeutic substances according to claim 1. cells of organs and tissues of the patient and / or in the introduction into the organs and tissues of the patient autologous cells of the patient transfected with a gene-therapeutic substance selected from the group gene-therapeutic substances according to claim 1, and / or the introduction into the organs and tissues of a patient of a gene-therapeutic substance or several substances selected / selected from the group of created gene-therapeutic substances according to claim 1., or a combination of the indicated methods.

List of figures

In FIG. one

The nucleotide sequence of unmodified cDNA of the LIF gene with a length of 318 bp is presented. SEQ ID No: 1, which has a high homology with that shown in the GenBank database under the number NM_002309 and encodes a protein of the leukemia inhibiting factor (GenBank NP_002300.1).

In FIG. 2

Presents the nucleotide sequence of the modified cDNA of the LIF gene, SEQ ID No: 2, which contains 2 nucleotide substitutions G → C at positions 171 and 219; not leading to changes in the amino acid sequence of the protein of the factor inhibiting leukemia.

In FIG. 3

Presents the nucleotide sequence of the modified cDNA of the LIF gene, SEQ ID No: 3, which

contains 2 nucleotide substitutions G → C at positions 171 and 219; 2 nucleotide substitutions A → C at positions 264 and 480, which do not lead to changes in the amino acid sequence of the protein of the factor inhibiting leukemia.

In FIG. four

Presents the nucleotide sequence of the modified cDNA of the LIF gene, SEQ ID No: 4, which

contains 1 nucleotide substitution A → G at position 399, 2 nucleotide substitutions G → C at positions 171 and 219; 2 nucleotide substitutions A → C at positions 264 and 480, which do not lead to changes in the amino acid sequence of the protein of the factor inhibiting leukemia.

In FIG. 5

Presents the nucleotide sequence of the modified cDNA of the LIF gene, SEQ ID No: 5, which

contains 1 nucleotide substitution A → G at position 399, 4 nucleotide substitutions G → C at positions 171, 219, 417, 426; 2 nucleotide substitutions A → C at positions 264 and 480, which do not lead to changes in the amino acid sequence of the protein of the factor inhibiting leukemia.

In FIG. 6

Presents the nucleotide sequence of the modified cDNA of the LIF gene, SEQ ID No: 6, which

contains 1 nucleotide substitution A → G at position 399, 5 nucleotide substitutions G → C at positions 171, 219, 417, 426, 447; 2 nucleotide substitutions of A- ^ C at positions 264 and 480, which do not lead to changes in the amino acid sequence of the protein of the factor inhibiting leukemia.

In FIG. 7

Presents the nucleotide sequence of the modified cDNA of the LIF gene, SEQ ID No: 7, which

contains 2 nucleotide substitutions A → G at positions 399, 591; 6 nucleotide substitutions G → C at positions 171, 219, 417, 426, 447, 675; 2 nucleotide substitutions A → C at positions 264 and 480, which do not lead to changes in the amino acid sequence of the protein of the factor inhibiting leukemia.

In FIG. 8

For the subsequent correct determination of the gene therapeutic effect after transfection of fibroblasts with a gene therapeutic substance with cDNA of the LIF gene, an analysis of the endogenous expression of the LIF gene in a primary fibroblast culture was performed. The figure shows the graphs of the accumulation of products of polymerase chain reaction (PCR), corresponding to:

1 - cDNA of the LIF gene, fibroblasts with reduced expression of the LIF gene,

2 - cDNA of the LIF gene, fibroblasts with normal expression of the LIF gene,

3 - cDNA of the B2M gene, fibroblasts with reduced expression of the LIF gene,

4 - cDNA of the B2M gene, fibroblasts with normal expression of the LIF gene.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

In FIG. 9

In order to confirm the increase in the expression of the LIF gene in a fibroblast cell culture with reduced expression of the LIF gene during transfection of these cells with a gene therapeutic substance with cDNA of the LIF gene with the pCMV6-LIF genetic construct SEQ ID No: 1, plots of accumulation of PCR products corresponding to:

1 - cDNA of the LIF gene in fibroblasts with normal expression of the LIF gene,

2 - cDNA of the LIF gene in fibroblasts with reduced expression of the LIF gene before transfection of the GTS with cDNA of the LIF gene,

3 - cDNA of the LIF gene in fibroblasts with reduced expression of the LIF gene after transfection of GTS with cDNA of the LIF gene,

4 - cDNA of the LIF gene in fibroblasts with reduced expression of the LIF gene after transfection with a vector without cDNA of the LIF gene,

5 - cDNA of the B2M gene in fibroblasts with normal expression of the LIF gene,

6 - cDNA of the B2M gene in fibroblasts with reduced expression of the LIF gene before transfection of GTS with cDNA of the LIF gene,

7 - cDNA of the B2M gene in fibroblasts with reduced expression of the LIF gene after transfection of the GTS with cDNA of the LIF gene,

8 - cDNA of the B2M gene in fibroblasts with reduced expression of the LIF gene after transfection with a vector without cDNA of the LIF gene.

From the graphs it follows that in the case of transfection with a vector without inserting a cDNA of the LIF gene, the level of cDNA of the LIF gene in fibroblasts did not change, and in the case of transfection with a vector of cDNA of the LIF gene, the level of cDNA of fibroblasts with reduced expression of the LIF gene increased significantly (to a level higher than the level LIF gene cDNA in normal fibroblasts).

In FIG. 10

In order to confirm the increase in the amount of leukemia inhibiting factor protein in a cell culture of fibroblasts with normal LIF gene expression during transfection of these cells with the gene therapeutic substance containing the LIF gene cDNA, a graph of the change in the amount of leukemia inhibiting factor protein, untransfected fibroblasts (culture A) transfected vector pCDNA 3.1 (+) not containing cDNA of the LIF gene (culture B) and transfected with a gene therapeutic substance with the genetic construct pCDNA 3.1-LIF SEQ ID No: 1 (c ultura C). It follows from the graph that when fibroblasts are transfected with a gene-therapeutic substance with cDNA of the LIF gene, an increase in the amount of leukemia-inhibiting factor protein in the cell lysate occurs.

In FIG. eleven

In order to confirm the increase in the amount of the protein of the leukemia inhibiting factor in human skin when a cell culture of fibroblasts transfected with a gene-therapeutic substance is introduced into the skin, an analysis of the change in the amount of the protein of the leukemia inhibiting factor in the skin of patients is presented. At the same time, three variants of autologous fibroblast culture were injected into the patients - non-transfected (A), transfected with the pCMV6-XL5 vector (B) and transfected with the gene therapeutic substance with the pCMV6-LIF genetic construct SEQ ID No: 7 (C) - into the skin of the forearm. Also analyzed the quantitative level of the protein of the factor inhibiting leukemia in intact skin. An increase in the amount of the protein of the leukemia inhibiting factor in the skin of the patient in the area of the introduction of fibroblasts transfected with the gene-therapeutic substance of the cDNA of the LIF gene (C) was shown.

In FIG. 12

In order to confirm the increase in the amount of the protein of the factor inhibiting leukemia to various individual levels in cell cultures of fibroblasts of patients upon transfection of these cells with gene-therapeutic substances with a portion of the native unmodified LIF gene DNA and modified cDNA of the LIF gene, an analysis of the change in the quantitative level of the inhibitory factor protein is presented leukemia, in human skin fibroblast cultures, depending on the presence and type of modifications in the cDNA of the LIF gene used to transfect phi roblastov.

Fibroblast cultures of 18 patients were divided into 8 parts each from (A) to (H); the first parts (A) of patient cell cultures were transfected with the gene therapeutic substance pCMV6-LIF SEQ ID No: 1, parts (B) were transfected with the gene therapeutic substance pCMV6-LIF SEQ ID No: 2, parts (C) were transfected with the gene therapeutic substance pCMV6 -LIF SEQ ID No: 3, part (D) was transfected with the gene therapeutic substance pCMV6-LIF SEQ ID No: 4, part (E) was transfected with the gene therapeutic substance pCMV6-LIF SEQ ID No: 5, part (F) was transfected with gene with the therapeutic substance pCMV6-LIF SEQ ID No: 6, part (G) was transfected with the gene therapeutic substance pCMV6-LIF SEQ ID No: 7, part (H) was transfected with a vector plasmid not containing cDNA of the LIF gene.

Based on the analysis of the quantitative level of the protein of the factor inhibiting leukemia, we selected indicators for each part of the cell culture from each patient, which showed the maximum amount of protein of the factor inhibiting leukemia, and combined them into seven groups based on the following criterion:

In group 1, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 1,

in group 2, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 2,

in group 3, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 3,

in group 4, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 4,

in group 5, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 5,

in group 6, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 6,

in group 7, the maximum amount of leukemia inhibiting factor protein was observed upon transfection with pCMV6-LIF SEQ ID No: 7.

None of the cell cultures showed that the maximum amount of leukemia inhibiting factor protein was present upon transfection with a vector without insertion of cDNA of the LIF gene.

The figure 12 for each group of cell cultures shows a graph of indicators of the concentration of the protein of the factor inhibiting leukemia (averaged within the group, if the group includes more than one cell culture) for all involved in the experiment of gene-therapeutic substances after transfection of these cell cultures with gene therapeutic substances containing modified and native cDNA of the LIF gene.

It follows from the figure that the achievement of the maximum amount of leukemia-inhibiting factor protein in the skin fibroblast cultures of various patients upon their transfection with gene therapeutic substances is associated with the individual characteristics of the patients and depends on the presence and type of modifications in the cDNA of the LIF gene included in the gene therapy substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 1 (А)

parts of cell cultures transfected with GTS LIF SEQ ID No: 1 (A)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 2 (В)

parts of cell cultures transfected with GTS LIF SEQ ID No: 2 (B)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 3 (С)

parts of cell cultures transfected with GTS LIF SEQ ID No: 3 (C)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 4 (D)

parts of cell cultures transfected with GTS LIF SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 5 (Е)

parts of cell cultures transfected with GTS LIF SEQ ID No: 5 (E)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 6 (F)

parts of cell cultures transfected with GTS LIF SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 7 (G)

parts of cell cultures transfected with GTS LIF SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

parts of cell cultures transfected with placebo (H)

In FIG. 13

In order to confirm the increase in the expression of the LIF gene in cell culture of the human uterine endometrium upon transfection of these cells with a gene therapeutic substance with cDNA of the LIF gene in the pCMV6-Kan / Neo LIF genetic construct SEQ ID No: 2, plots of accumulation of PCR products corresponding to:

1 - cDNA of the LIF gene, endometrial cells before transfection

2 - cDNA of the LIF gene, endometrial cells after transfection

3 - cDNA of the B2M gene, endometrial cells before transfection

4 - cDNA of the B2M gene, endometrial cells after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the LIF gene in the culture of human uterine endometrial cells increased many times.

In FIG. fourteen

In order to confirm the increase in the expression of the LIF gene in a cell culture of the epithelium of the oral mucosa during transfection of these cells with a gene therapeutic substance with cDNA of the LIF gene, the graphs of the accumulation of PCR products are shown that correspond to:

1 - cDNA of the LIF gene, before transfection

2 - cDNA of the LIF gene, after transfection

3 - cDNA of the B2M gene, before transfection

4 - cDNA of the B2M gene, after transfection

The B2M gene was used as a reference.

From the figure it follows that as a result of transfection, the level of specific cDNA of the LIF gene increased many times.

In FIG. fifteen

In order to confirm the increase in the amount of the protein of the leukemia inhibiting factor in the human skin when a gene of therapeutic substance is introduced into the skin, an analysis of the change in the quantitative level of the leukemia inhibiting factor protein in the skin is presented. At the same time, the patient was injected with a gene-therapeutic substance containing a vector plasmid with cDNA of the LIF gene pCMV6-LIF SEQ ID No: 4 (B) and a placebo, which is a combination of the vector plasmid pCMV-XL5 without cDNA of the LIF gene with the transport molecule (A, was introduced ) - in the skin of the forearm. An increase in the amount of the protein of the leukemia inhibiting factor protein was shown in the biopsy of the skin of patient 1B, to which a gene therapeutic substance was introduced containing a genetic construct with cDNA of the LIF gene, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

In FIG. 16

In order to confirm the increase in the amount of protein of the factor inhibiting leukemia in the oral mucosa of a person with the introduction of a gene-therapeutic substance into the oral mucosa, an analysis of the change in the quantitative level of the protein of the factor inhibiting leukemia in the oral mucosa is presented. In this case, the patient was injected with a gene-therapeutic substance containing a vector plasmid with cDNA of the LIF pCDNA 3.1 gene LIF SEQ ID No: 5 (B) and a placebo pCDNA 3.1 (+) was introduced in parallel, which is a combination of a vector plasmid not containing the LIF cDNA gene with a transport molecule (A) - into the oral mucosa.

An increase in the quantitative level of the protein of the leukemia inhibiting factor protein was shown in the lysate of a biopsy sample of the oral mucosa of patient 1 B, to which a gene therapeutic substance containing a genetic construct with cDNA of the LIF gene was injected, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

In FIG. 17

In order to confirm the increase in the amount of the protein of the leukemia inhibiting factor in the human muscle tissue when the gene therapeutic substance is introduced into the muscle tissue, an analysis of the change in the amount of the protein of the leukemia inhibiting factor in the muscle tissue is presented. At the same time, the patient was injected with a gene therapeutic substance containing a vector plasmid with cDNA of the LIF gene - pCMV6-Kan / Neo LIF SEQ ID No: 6 (B) and a placebo pCMV6-Kan / Neo, which is a combination of a vector plasmid containing no cDNA gene, was introduced LIF with a transport molecule (A) - into muscle tissue in the area of the forearm. An increase in the amount of the protein of the leukemia inhibiting factor protein was shown in the biopsy of the muscle tissue of patient 1B, to which the gene therapeutic substance containing the genetic construct with cDNA of the LIF gene was injected, which indicates the effectiveness of the gene therapeutic substance.

Designations:

пациент 1А

patient 1A

пациент 1В

patient 1B

пациент 1В до введения ГТС

patient 1B before the introduction of the GTS

In FIG. eighteen

In order to confirm the increase in the amount of the protein of the leukemia inhibiting factor to a different individual level when the gene therapeutic substances with modified LIF gene cDNA and a portion of the native unmodified cDNA of the LIF gene were introduced into the skin of the patient, the quantitative level of the leukemia inhibiting factor cDNA protein in human skin was analyzed depending on the presence and type of modifications in the cDNA of the LIF gene.

Each of the 21 patients who were randomly selected was injected with 7 gene-therapeutic substances pCMV6-SEQ ID No: 1, pCMV6-SEQ ID No: 2, pCMV6-SEQ ID No: 3, pCMV6-SEQ into the skin of the forearm ID No: 4, pCMV6-SEQ ID No: 5, pCMV6-SEQ ID No: 6, pCMV6-SEQ ID No: 7, and placebo pCMV6-XL5.

Based on the results of the analysis of the amount of the protein of the leukemia inhibiting factor, the biopsy samples selected indicators for each biopsy from each patient, which showed the maximum quantitative levels of the protein of the leukemia inhibiting factor, and combined them into seven groups based on the following criterion:

In group 1, the maximum amount of leukemia inhibiting factor protein was observed with pCMV6-LIF SEQ ID No: 1,

in group 2, the maximum amount of protein of the factor inhibiting leukemia was observed with the introduction of pCMV6-LIF SEQ ID No: 2,

in group 3, the maximum amount of leukemia inhibiting factor protein was observed with pCMV6-LIF SEQ ID No: 3,

in group 4, the maximum amount of protein of the factor inhibiting leukemia was observed with the introduction of pCMV6-LIF SEQ ID No: 4,

in group 5, the maximum amount of protein of the factor inhibiting leukemia was observed with the introduction of pCMV6-LIF SEQ ID No: 5,

in group 6, the maximum amount of protein of the factor inhibiting leukemia was observed with the introduction of pCMV6-LIF SEQ ID No: 6,

in group 7, the maximum amount of leukemia inhibiting factor protein was observed with pCMV6-LIF SEQ ID No: 7.

None of the biopsy specimens showed that the maximum amount of leukemia inhibiting factor protein is present when a placebo is administered.

The figure 18 for each group of biopsy samples shows charts of protein concentration of the leukemia inhibiting factor protein (averaged within the group, if more than one biopsy is included in the group) for all participants in the experiment of gene-therapeutic substances after the introduction of these gene-therapeutic substances containing modified cDNA of the LIF gene and a portion of the native unmodified cDNA of the LIF gene.

From this example, it follows that the achievement of the maximum amount of leukemia-inhibiting factor protein in biopsies of the skin of various patients when they introduce gene-therapeutic substances into the skin is associated with the individual characteristics of patients and depends on the presence and type of modifications in the cDNA of the LIF gene included in the gene -therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient is necessary.

Designations:

биоптаты пациентов после введения ГТС LIF SEQ ID No: 1 (А)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 1 (A)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 2 (В)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 2 (B)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 3 (С)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 3 (C)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 4 (D)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 4 (D)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 5 (Е)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 5 (E)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 6 (F)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 6 (F)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 7 (G)

biopsy samples of patients after administration of the GTS LIF SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (Н)

biopsy samples of patients after placebo (N)

In FIG. 19

In order to determine the most effective gene therapeutic substance for a particular patient, the quantitative level of the leukemia inhibiting factor protein was analyzed in the cell lysates of the patient’s fibroblasts transfected with different genetic constructs containing a portion of the native unmodified cDNA of the LIF gene or modified cDNA of the LIF gene.

According to the analysis of the amount of the protein of the leukemia inhibiting factor, a variant of the gene therapeutic substance was isolated in the patient’s fibroblast culture, the transfection of which revealed the maximum concentration of the protein of the leukemia inhibiting factor in the cell culture lysate. In this experiment, the maximum concentration of the protein of the leukemia inhibiting factor in the lysate is observed upon transfection with a gene therapeutic substance based on pCMV6 LIF SEQ ID No: 1 containing a portion of the native unmodified cDNA of the LIF gene, as shown in Figure 19.

Thus, the most effective gene-therapeutic substance has been selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Designations:

1 - cell lysate after transfection of the GTS LIF SEQ ID No: 1 (A)

2 - cell lysate after transfection of the GTS LIF SEQ ID No: 2 (B)

3 - cell lysate after transfection of the GTS LIF SEQ ID No: 3 (C)

4 - cell lysate after transfection of the GTS LIF SEQ ID No: 4 (D)

5 - cell lysate after transfection of the GTS LIF SEQ ID No: 5 (E)

6 - cell lysate after transfection of the GTS LIF SEQ ID No: 6 (F)

7 - cell lysate after transfection of the GTS LIF SEQ ID No: 7 (G)

8 - cell lysate after placebo transfection (H)

In FIG. twenty

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of the leukemia-inhibiting factor protein was analyzed in the biopsy samples of the skin biopsies of this patient after the introduction of gene-therapeutic substances containing a portion of the native unmodified cDNA of the LIF gene or sections of modified cDNA of the LIF gene.

According to the analysis of the amount of the protein of the leukemia inhibiting factor protein, a variant of the gene therapeutic substance was isolated in the lysate of biopsy samples of the patient’s skin, the introduction of which reveals the maximum concentration of the leukemia inhibiting factor protein in the biopsy lysate. In this experiment, the maximum concentration of the protein of the leukemia inhibiting factor was noted with the introduction of the gene therapeutic substance based on pCMV6 LIF SEQ ID No: 7 containing the modified cDNA of the gene, as shown in figure 20.

Thus, the most effective gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

Designations:

1 - biopsy specimen lysate after administration of GTS LIF SEQ ID No: 1 (A)

2 - biopsy specimen lysate after administration of GTS LIF SEQ ID No: 2 (B)

3 - lysate of the biopsy specimen after administration of the GTS LIF SEQ ID No: 3 (C)

4 - biopsy specimen lysate after administration of GTS LIF SEQ ID No: 4 (D)

5 - biopsy specimen lysate after administration of GTS LIF SEQ ID No: 5 (E)

6 - biopsy specimen lysate after administration of GTS LIF SEQ ID No: 6 (F)

7 - biopsy specimen lysate after administration of GTS LIF SEQ ID No: 7 (G)

8 - lysate biopsy specimen after the introduction of placebo (N)

The implementation of the invention.

With a decrease in the expression of genes encoding proteins, for example, the LIF gene, a decrease in the amount of protein in the body occurs, which leads to pathological conditions.

Thus, a decrease in the expression of the LIF gene in the cells of the glandular epithelium of the uterine endometrium is experimentally modeled by the administration of the progesterone antagonist mifepristone on the 2nd day after ovulation in primates. The introduction of mifepristone to rhesus macaques in the early secretory phase of the cycle caused inhibition of blastocyst implantation [Ghosh D., Kumar P.G.L.L, Sengupta J. // Endocrinol 1998; 157: 1: 115-125].

In mice, LIF gene expression increases in the endometrial glands immediately before implantation, on the 4th day after ovulation, which is regulated by the factors of the mother's body. In mice knocked out by this gene, the processes of oogenesis and fertilization are not disturbed, but the resulting blastocysts are not capable of implantation. [Gyudays Linda S. // Probl. endocrinol., 1999; 5: 30-32].

Advantages of using the genetic construct with the LIF gene to correct the expression of the LIF gene and the quantitative level of the leukemia inhibiting factor protein in human and organ cells compared to using polynucleotides encoding a cytokine or cytokine receptor cloned in a recombinant adeno-associated virus plasmid (Raav ), as in the prototype patent WO 0194605 as follows:

1) it is easier to provide a higher and stable level of the target protein in the cells,

2) transportation of the gene-therapeutic substance to a larger spectrum of cells of human organs and tissues, as well as more efficient intracellular transportation of the gene-therapeutic substance,

3) individual characteristics of the patient are taken into account.

Thus, to create a group of gene therapeutic substances according to this invention, the LIF gene was chosen, and not the leukemia inhibiting factor protein encoded by this gene.

To obtain a group of gene-therapeutic substances carry out the following actions:

1. Obtaining a portion of the native cDNA of the LIF gene containing the protein coding region of the LIF gene, cloning it into an intermediate plasmid, cloning it into expression vector plasmids under the control of eukaryotic regulatory elements for expression of the target gene so that the resulting genetic constructs contain the cDNA coding nucleotide sequence leukemia inhibitory factor protein, which is a portion of the native unmodified cDNA of the LIF gene and which is used for further modification th.

2. The introduction of the LIF gene cDNA modifications into the cDNA sequence of nucleotides in order to create a series of cDNA of the LIF gene that provides a sufficient level of translation of the leukemia-inhibiting factor protein to combat pathological manifestations.

3. Cloning of a portion of the native unmodified cDNA of the LIF gene and the modified cDNA of the LIF gene obtained on its basis into vector plasmids capable of ensuring efficient expression of this cDNA in cells of human organs and tissues.

4. Transformation of each of the obtained genetic constructs of bacterial E. coli cells, analysis of transformed clones for the presence, orientation, and copy number of the cDNA insert and the growth of selected clones to obtain the number of plasmid DNA variants necessary for further work.

5. Isolation of a number of genetic constructs containing modified LIF gene DNA and a portion of the native unmodified cDNA of the LIF gene to create a group of gene-therapeutic substances based on them.

6. Creation of a group of gene therapeutic substances, each of which includes a genetic construct with modified cDNA of the LIF gene and a portion of the native unmodified cDNA of the LIF gene, or a combination of such a construct with a transport molecule for efficient transfection of various types of cells of organs and tissues and / or insertion into organs and human tissue.

To prove the effectiveness of the created gene-therapeutic substances, leading to an increase in the expression of the LIF gene, the following studies are carried out:

A) Cultivation of cultures of various types of cells from biopsies of various human organs and tissues, for example, human skin fibroblasts, or epithelial cells of the oral mucosa, or uterine endometrial epithelium cells.

B) Isolation of RNA from a cell culture, for example, human skin fibroblasts, or mucosal epithelial cells, or uterine endometrial epithelium, and analysis of LIF gene expression from the genome of these cells.

C) Transfection of a cell culture, for example, human skin fibroblasts, or oral mucosal epithelial cells, or uterine endometrial epithelial cells with gene-therapeutic substances containing a portion of native unmodified LIF gene cDNA and / or modified LIF gene cDNA and parallel transfection of the same cell culture vector plasmid that does not contain cDNA of the LIF gene in various combinations.

D) Comparative analysis of changes in the LIF gene mRNA level and / or changes in the amount of leukemia inhibiting factor protein after transfection in various combinations of cells, for example, human skin fibroblasts, or oral mucosal epithelial cells, or uterine endometrial epithelial cells with gene-therapeutic substances containing a portion of the native unmodified cDNA of the LIF gene and / or modified cDNA of the LIF gene and parallel transfection of the culture of the same cells with a vector plasmid that does not contain cDNA of the LIF gene. This analysis is carried out, in particular, before the proposed therapy in order to determine the most effective gene-therapeutic substance for the patient.

E) Introduction to patients in the organs and tissues of a cell culture transfected with a gene therapeutic substance with a cDNA of the LIF gene, for example, the introduction into the human skin of autologous fibroblasts transfected with a gene therapeutic substance with a cDNA of the LIF gene and parallel administration to patients in organs and tissues, for example , into the skin, cultures of the same cells untransfected and transfected with a vector without inserting cDNA of the LIF gene and / or introducing into the organs and tissues of gene-therapeutic substances, for example, the introduction of gene-therapy into human skin substances containing a portion of the native unmodified cDNA of the LIF gene and / or modified LIF cDNA, as well as a placebo in various combinations.

F) A comparative analysis of the amount of leukemia inhibiting factor protein in human organs and tissues, in particular in human skin, after the administration of cells of non-transfected and transfected gene therapy substances containing LIF gene cDNA and vector plasmids not containing LIF gene cDNA and / or gene-therapeutic substances containing a portion of native unmodified cDNA of the LIF gene or modified cDNA of the LIF gene, as well as a placebo.

G) Introduction to patients in organs and tissues, for example, in the mucous membrane of the oral cavity or muscle tissue, of gene-therapeutic substances containing a portion of native unmodified cDNA of the LIF gene and / or modified cDNA of the LIF gene, as well as a placebo.

H) A comparative analysis of the amount of leukemia inhibiting factor protein in human organs and tissues, in particular in the oral mucosa or human muscle tissue, after the introduction of gene-therapeutic substances containing a portion of native unmodified cDNA of the LIF gene and / or sections of modified cDNA LIF gene as well as placebo.

I) The introduction into patients of organs and tissues, for example, the introduction into the patient's skin of gene-therapeutic substances containing a portion of the native unmodified cDNA of the LIF gene and sections of modified cDNA of the LIF gene.

J) A comparative analysis of the amount of the protein of the leukemia inhibiting factor in the patient’s organs and tissues, in particular in the skin, after the introduction of gene therapeutic substances containing a portion of native unmodified cDNA of the LIF gene and regions of modified cDNA of the LIF gene. This analysis is carried out, in particular, before the proposed therapy in order to select the most effective gene-therapeutic substance for the patient from the group of gene-therapeutic substances.

Example 1

Obtaining and cloning of native unmodified cDNA of the LIF gene

Unmodified cDNA of the LIF gene is a nucleotide sequence that has high homology with the nucleotide sequence of the gene and LIF mRNA shown in the GenBank database under the number NM_002309; nucleotides 157 to 765 are translated into the amino acid sequence of the leukemia inhibiting factor protein corresponding to that given in GenBank under the number NP_002300.1.

3' (LIF-F1) и 930-911 5'

3' (LIF-R1) из последовательности мРНК LIF (NM_002309.), получают участок нативной немодифицированной кДНК гена LIF, содержащий кодирующую последовательность белка фактора, ингибирующего лейкемию, и частичные делеции 5' и 3'-нетранслируемых областей. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами, на амплификаторе Master CyclerGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера LIF F1 и LIF R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 сек., 35 циклов, включающих денатурацию при +98°С в течение 10 сек., отжиг праймеров при +65°С в течение 30 сек. и элонгацию при +68°С течение 2 минут.Total RNA is obtained from human blood cells using the PAXGeneBlood RNA Kit (Qiagen, Germany) and is used to obtain total cDNA by reverse transcription using RevertAid reverse transcriptase (ThermoScientific, USA) and random 9-nucleotide primers according to the method of the manufacturer of reverse transcriptase. Then, using the total cDNA as a template and specific, pre-kinered primers complementary to nucleotides 1-20 5 '

3 '(LIF-F1) and 930-911 5'

3 '(LIF-R1) from the LIF mRNA sequence (NM_002309.), A portion of the native unmodified cDNA of the LIF gene is obtained that contains the coding sequence of the leukemia inhibiting factor protein and partial deletions of 5' and 3'-untranslated regions. Polymerase chain reaction (PCR) is carried out using Phusion DNA polymerase (ThermoScientific, USA), giving products with blunt ends, on a Master CyclerGradient amplifier (Eppendorf, USA) in 50 μl. a reaction mixture containing 0.5 μl of total cDNA of the first chain, 0.1 μM of each primer LIF F1 and LIF R1, 250 μM of each deoxynucleotide triphosphate (dATP, dTCP, dTTP and dGTP), 100 mM Tris-HCl (pH 8.85 at 20 ° С), 50 mM ammonium sulfate, 250 mM potassium chloride, 0.01% Tween-20 and 5 units. Pfu DNA polymerase (PhusionThermo Scientific, USA) under the following conditions: initial denaturation at + 98 ° С for 30 sec., 35 cycles, including denaturation at + 98 ° С for 10 sec., Annealing of primers at + 65 ° С within 30 sec. and elongation at + 68 ° C for 2 minutes.

The amplification product was isolated from agarose gel using the QIAquickGelExtractionKit kit (Qiagen, Germany).

An amplified 931 bp cDNA fragment carrying a portion of the native unmodified cDNA of the LIF gene is cloned in pUC19 plasmid vector (NEB, USA, cat. No. N3041S). The DNA of the vector plasmid pUC19 (NEB, USA, KaT.HOMepN3041S) is digested with restriction enzyme giving blunt ends, for example, Smal (NEB, USA) and is treated with alkaline phosphatase. The amplified cDNA fragment and the linearized plasmid pUC19 are ligated with 400,000 U / ml phage T4 DNA ligase. (NEB, USA, Cat. No. M0202S) at the rate of 1 μl of the enzyme per 1 μg of DNA. Ligation is carried out in a volume of 20 μl in the presence of 2 mm ATP, 50 mm Tris-HCl, pH 7.6, 10 mm MgCl ₂ , 10 mm DTT for 10 hours at + 16 ° C.

The resulting mixture was transformed with competent E. coliTop10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on Petri dishes with L-agar containing 100 μg / ml ampicillin and 40 μl per cup of solutions of 100 mM IPTG and 2% X-gal. Separate colonies are analyzed for insertion by PCR with LIF-F1 and LIF-R1 primers and confirmed by Sanger sequencing.

Example 2

Obtaining genetic constructs with a plot of unmodified cDNA of the LIF gene

To express a portion of the unmodified cDNA of the LIF gene in cells of human organs and tissues, the variant cDNA of the LIF gene according to Example 1 is placed in a vector plasmid, the choice of which uses the following selection criteria:

1) the plasmid must necessarily be replicated in E. coli, preferably with high copy number;

2) the plasmid must have a bacterial selection factor;

3) the plasmid must have the presence of eukaryotic regulatory elements - the obligatory promoter and terminator (polyadenylation signal), for example, an enhancer and intron (e) element (s);

4) the plasmid must have a convenient polylinker for cloning. An example of such a plasmid can be pCMV6-XL5, pCMV6-Kan / Neo (OriGene, USA) or pCDNA 3.1 (+) (ThermoFisher Scientific, USA), or plasmid vectors of viral origin - for example, human adenovirus of the 5th serotype.

5) The plasmid may contain nucleotide sequences with regulatory elements for replication in mammalian cells, for example, such as SV40 ori from the monkey virus SV40 or ori P / EBNA-1 from the human Epstein-Barr virus.

6) The plasmid may also contain additional regulatory elements that enhance the translation of the protein, for example, binding sites with the transcription factor NFkB, which ensures the active transport of plasmid DNA into the cell nucleus for more efficient transcription of the target gene.

When cloning a portion of the unmodified cDNA of the LIF gene in pCDNA 3.1 (+), the coding nucleotide sequence is placed under the control of the human CMV promoter CMV, which is effective in eukaryotic cells, and the bovine growth hormone gene polyadenylation signal. This plasmid also has a bacterial selection factor, the ampicillin resistance gene, and a eukaryotic selection factor, the neomycin resistance gene.

When cloning a portion of the unmodified cDNA of the LIF gene in pCMV6-XL5, pCMV6-Kan / Neo, the coding nucleotide sequence is placed under the control of the human cytomegalovirus CMV promoter, effective in eukaryotic cells, and the polyadenylation signal of the human growth hormone gene. This plasmid also has a bacterial selection factor, the ampicillin resistance gene.

The vector plasmid pUC19-LIF with a portion of the native unmodified cDNA sequence of the LIF gene is used as a template for amplification with the following pairs of primers:

1) for orientation Hind III - LIF - Eco RI

LIF F2

LIF R2

2) for orientation Eco RI-LIF-Hind III

LIF F3

LIF R3

Amplification is carried out under the conditions described in Example 1. Next, the amplification products are reprecipitated with ethanol, the precipitates are washed with 70% ethanol and dissolved in 1x TE buffer, and then subjected to restriction with EcoRI and HindIII endonucleases.

The restriction products are separated by 1% agarose gel electrophoresis, stained with ethidium bromide solution and DNA fragments corresponding to the HindIII-5'NTR-cDNA insert gene LIF-3'NTR-EcoRI, or EcoRI-5'NTR-cDNA LIF-3 'NTR-HindIII and the linearized plasmid pCMV6-XL5 and pCMV6-Kan / Neo and pCDNA 3.1 (+) were excised, isolated from the gel using the QIAquickGelExtractionKit gel isolation kit from Example 1 and mixed. The resulting mixture of restriction fragments is ligated using T4 phage DNA ligase. Ligation is carried out for 10-15 minutes at room temperature, and then at 12 ° C for 10 hours. Ligation DNA is used to transform E. coli cells according to the standard method using calcium chloride. Transformed cells were selected on agar medium LB with ampicillin (100 μg / ml). Plasmid DNA was isolated from ampicillin-resistant colonies using the QiagenSpinMiniprepKit plasmid isolation kit, digested with restriction enzymes EcoRI and Hindlll, and the genetic construct was selected by DNA sequencing of genetic constructs using the Sanger method.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain the corresponding genes -therapeutic substances.

Thus, expression genetic ones are obtained. constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+), which contain a 318 bp nucleotide sequence with the primary structure * shown in FIG. 1 Seq ID No1.

Example 3

Modifications of cDNA of the LIF gene in genetic constructs to obtain gene-therapeutic substances based on them

Modifications are carried out in such a way as not to affect the primary protein structure of the factor that inhibits leukemia, namely, nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, and, accordingly, do not affect the amino acid sequence encoded by this sequence.

In particular, in order to obtain modified cDNAs of the LIF gene in order to increase the transcription and translation of the leukemia inhibiting factor protein in human tissues and organs into the region of the native 9 sequence of the codiNA of the LIF gene, using the principle of codon optimization, modifications are made by replacing the minor codons with synonymous ones major in such a way that the substitutions do not lead to changes in the amino acid sequence of the protein or the termination of the amino acid chain during translation, do not worsen the processes of transcription and trans yatsii.

All modifications are carried out in several stages by PCR mutagenesis using a QuikChLIFe II XL kit or QuikChLIFe Multi Site-Directed Mutagenesis Kit (Agilent Technologies, USA,) according to the manufacturer's recommendations. http://www.agilent.com/cs/library/userrnanuals/Public/200513.

To the plasmid DNA obtained according to Example 2, in the amount of 10-50 ng add 50-100 ng of primer containing the necessary replacement, insertion or deletion of a length of 19-45 N. p. and PCR was performed in a QuikChLIFe Multi reaction buffer (Agilent Technologies, USA) with a mixture of QuikChLIFe Multi mix enzymes (Agilent Technologies, USA) under the following conditions: 95 ° C, 1 min; further from 30 to 35 cycles: 95 ° С 1 minute, 55 ° С 1 minute, 65 ° С 2 minutes / 1000 bp After PCR, 1-2 μl of restriction enzyme Dpn I was added to the amplification mixture and incubated for 1-2 hours at 37 ° C. The resulting mixture was transformed with competent E. coli Tor10 cells (http://molbiol.ru/protocol/03_04.html), which were plated on L-agar plates containing 100 μg / ml ampicillin. Transformed colonies are analyzed for mutation by sequencing plasmid DNA using the Sanger method.

To obtain the modified cDNA of the LIF SEQ ID No. 2 gene, sequential PCR mutagenesis is carried out on plasmids pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan / Neo-LIF Seq ID No1 and pCDNA 3.1 (+) - LIF Seq ID No1 with primers, complementary to the portion of the native cDNA of the LIF gene shown in GenBank under the number NM_002309.4:

1. LIF 157-189 F:

Complementary to nucleotides 157-189, with the replacement of G → C at position 171;

2. LIF 208-234 F:

Complementary to nucleotides 208-234, with the replacement of G → C at position 219.

The nucleotide sequence of the cDNA of the LIF gene SEQ ID No: 2 thus modified contains 2 nucleotide substitutions G → C at positions 171 and 219; not leading to changes in the amino acid sequence of the leukemia inhibiting factor protein, and has a primary structure shown in FIG. 2.

To obtain the modified cDNA of the LIF SEQ ID No. 3 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan / Neo-LIF Seq ID No1 and pCDNA 3.1 (+) - LIF Seq ID No1 with primers, complementary to the portion of the native cDNA of the LIF gene shown in GenBank under the number NM_002309.4:

1. LIF 157-189 F:

Complementary to nucleotides 157-189, with the replacement of G → C at position 171;

2. LIF 208-234 F:

Complementary to nucleotides 208-234, with the replacement of G → C at position 219;

3. LIF 247-279 F:

Complementary to nucleotides 247-279, with the replacement of A → C at position 264;

4. LIF 466-503 F:

Complementary to nucleotides 466-503, with the replacement of A → C at position 480;

Thus modified nucleotide sequence of the cDNA of the LIF gene SEQ ID No: 3 contains 2 nucleotide substitutions G → C at positions 171 and 219; 2 nucleotide substitutions A → C at positions 264 and 480; not leading to changes in the amino acid sequence of the leukemia inhibiting factor protein, and has a primary structure shown in FIG. 3.

To obtain the modified cDNA of the LIF SEQ ID No. 4 gene, sequential PCR mutagenesis is carried out on plasmids pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan / Neo-LIF Seq ID No1 and pCDNA 3.1 (+) - LIF Seq ID No1 with primers, complementary to the portion of the native cDNA of the LIF gene shown in GenBank under the number NM_002309.4:

1. LIF 157-189 F:

Complementary to nucleotides 157-189, with the replacement of G → C at position 171;

2. LIF 208-234 F:

Complementary to nucleotides 208-234, with the replacement of G → C at position 219;

3. LIF 247-279 F:

Complementary to nucleotides 247-279, with the replacement of A → C at position 264;

4. LIF 466-503 F:

Complementary to nucleotides 466-503, with the replacement of A → C at position 480;

5. LIF 382-414 F:

Complementary to nucleotides 382-414, with the replacement of A → G at position 399;

The nucleotide sequence of the cDNA of the LIF gene thus modified SEQ ID No: 4 contains 1 nucleotide substitution A → G at position 399, 2 nucleotide substitutions G → C at positions 171 and 219; 2 nucleotide substitutions A → C at positions 264 and 480; not leading to changes in the amino acid sequence of the leukemia inhibiting factor protein, and has a primary structure shown in FIG. four.

To obtain a modified cDNA of the LIF SEQ ID No. 5 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan / Neo-LIF Seq ID No1 and pCDNA 3.1 (+) - LIF Seq ID No1 with primers, complementary to the portion of the native cDNA of the LIF gene shown in GenBank under the number NM_002309.4:

1. LIF 157-189 F:

Complementary to nucleotides 157-189, with the replacement of G → C at position 171;

2. LIF 208-234 F:

Complementary to nucleotides 208-234, with the replacement of G → C at position 219;

3. LIF 247-279 F:

Complementary to nucleotides 247-279, with the replacement of A → C at position 264;

4. LIF 466-503 F:

Complementary to nucleotides 466-503, with the replacement of A → C at position 480;

5. LIF 382-414 F:

Complementary to nucleotides 382-414, with the replacement of A → G at position 399;

6. LIF 403-444 F:

Complementary to nucleotides 403-444, with substitutions G → C, at positions 417, 426;

The nucleotide sequence of the cDNA of the LIF gene SEQ ID No: 5 thus modified contains 1 nucleotide substitution A → G at position 399, 4 nucleotide substitutions G → C at positions 171, 219, 417, 426; 2 nucleotide substitutions A → C at positions 264 and 480; not leading to changes in the amino acid sequence of the leukemia inhibiting factor protein, and has a primary structure shown in FIG. 5.

To obtain a modified cDNA of the LIF SEQ ID No. 6 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan / Neo-LIF Seq ID No1 and pCDNA 3.1 (+) - LIF Seq ID No1 with primers, complementary to the portion of the native cDNA of the LIF gene shown in GenBank under the number NM_002309.4:

1. LIF 157-189 F:

Complementary to nucleotides 157-189, with the replacement of G → C at position 171;

2. LIF 208-234 F:

Complementary to nucleotides 208-234, with the replacement of G → C at position 219;

3. LIF 247-279 F:

Complementary to nucleotides 247-279, with the replacement of A → C at position 264;

4. LIF 466-503 F:

Complementary to nucleotides 466-503, with the replacement of A → C at position 480;

5. LIF 382-414 F:

Complementary to nucleotides 382-414, with the replacement of A → G at position 399;

6. LIF 403-444 F:

Complementary to nucleotides 403-444, with G → C substitutions at positions 417, 426;

7. LIF 432-465 F:

Complementary to nucleotides 432-465, with substitution G → C at position 447;

The nucleotide sequence of the cDNA of the LIF gene SEQ ID No: 6 thus modified contains 1 nucleotide substitution A → G at position 399, 5 nucleotide substitutions G → C at positions 171, 219, 417, 426, 447; 2 nucleotide substitutions A → C at positions 264 and 480; not leading to changes in the amino acid sequence of the leukemia inhibiting factor protein, and has a primary structure shown in FIG. 6.

To obtain the modified cDNA of the LIF SEQ ID No. 7 gene, sequential PCR mutagenesis is performed on plasmids pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan / Neo-LIF Seq ID No1 and pCDNA 3.1 (+) - LIF Seq ID No1 with primers, complementary to the portion of the native cDNA of the LIF gene shown in GenBank under the number NM_002309.4:

1. LIF 157-189 F:

Complementary to nucleotides 157-189, with the replacement of G → C at position 171;

2. LIF 208-234 F:

Complementary to nucleotides 208-234, with the replacement of G → C at position 219;

3. LIF 247-279 F:

Complementary to nucleotides 247-279, with the replacement of A → C at position 264;

4. LIF 466-503 F:

Complementary to nucleotides 466-503, with the replacement of A → C at position 480;

5. LIF 382-414 F:

Complementary to nucleotides 382-414, with the replacement of A → G at position 399;

6. LIF 403-444 F:

Complementary to nucleotides 403-444, with G → C substitutions at positions 417, 426;

7. LIF 432-465 F:

Complementary to nucleotides 432-465, with substitution G → C at position 447;

8. LIF 572-606 F:

Complementary to nucleotides 572-606, with the replacement of A → G at position 591;

9. LIF 661-691 F:

Complementary to nucleotides 661-691, with the replacement of G → C at position 675;

The nucleotide sequence of the cDNA of the LIF gene thus modified SEQ ID No: 7 contains 2 nucleotide substitutions A → G at positions 399, 591; 6 nucleotide substitutions G → C at positions 171, 219, 417, 426, 447, 675; 2 nucleotide substitutions A → C at positions 264 and 480; not leading to changes in the amino acid sequence of the leukemia inhibiting factor protein, and has a primary structure shown in FIG. 7.

Thus, expression vectors based on the plasmids pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are obtained in which a portion of the native unmodified cDNA of the LIF gene (SEQ ID No: 1) and the modified nucleotide sequences of the cDNA of the LIF gene (SEQ ID No: 2, 3, 4, 5, 6, 7) encoding leukemia inhibiting factor protein.

Bacteria containing the obtained genetic constructs based on the vectors pCMV6-XL5, pCMV6-Kan / Neo and pCDNA 3.1 (+) are grown on LB liquid medium with ampicillin, lysed, and plasmid DNA is isolated for transfection with a special QiagenMaxiKit plasmid isolation kit to obtain the corresponding genes -therapeutic substances.

The resulting expression vectors are used to obtain gene-therapeutic substances based on them, which are subsequently used for transfection of eukaryotic cells of organs and tissues and / or introduction into human organs and tissues. As control plasmids, the original vector pCMV6 - XL5, (pCMV6-Kan / Neo) or pCDNA 3.1 (+) without the cDNA of the LIF gene was used.

Example 4

Growth of the genetic construct in bacterial culture

To obtain preparative amounts of a vector plasmid containing one of the LIF gene cDNA variants, the constructs of Example 3 transform the E.coli bacterial cells (T. Maniatis et al. Molecular Cloning. M., Mir, 1984) and the obtained bacterial clones are grown, containing the construct, in the presence of a bacterial selection factor - ampicillin resistance.

The ligase mixture of Example 3 is used to transform competent E. coli cells of strain XLblue. Preliminary selection of clones containing the cDNA insert of the LIF gene in the correct orientation and a single copy is carried out by hydrolysis of plasmid DNA with restriction enzymes EcoRI and Hindlll and analysis of restriction products by electrophoresis in 1.2% agarose gel. Selected clones are used for preparative growth of plasmid DNA for the purpose of further transfection into fibroblast cultures (epithelial cells of the oral mucosa, or uterine endometrial epithelial cells, etc.).

To obtain preparative amounts of the genetic expression constructs of Example 3, 20 ml of an overnight E.coli culture was grown in LB medium with 150 μg / ml ampicillin. 500 ml of LB medium with 100 μg / ml ampicillin were inoculated with this culture; growth was carried out in a shaker-incubator for 16 hours at 37 ° C and 200 rpm. Isolation of plasmid DNA was performed using the EndoFreePlasmidMaxiKit kit (Qiagen, Germany). The yield was 350 μg of DNA.

Example 5

Cultivation of eukaryotic cells, for example, fibroblasts for subsequent transfection with a gene therapeutic substance and analysis of LIF gene expression.

For subsequent transfection with a gene-therapeutic substance containing one of the LIF gene cDNA variants of Example 3, primary cultures of human fibroblasts are grown from biopsy samples of the patient’s skin.

Using a skin biopsy device, Epitheasy 3.5 (MedaxSRL) takes a skin biopsy sample from a zone protected from ultraviolet radiation, for example, behind the auricle or from the side inner surface in the area of the elbow joint, about 3 mm in size, weighing up to 20 mg. The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The primary cell culture was grown on Petri dishes at 37 ° C in an atmosphere containing 5% CO ₂ in DMEM medium with 10% fetal calf serum and ampicillin 100 U / ml. Trypsinization and reseeding is performed every 5 days; for trypsinization, the cells were washed with PBS and incubated for 30 minutes at 37 ° C in a solution containing 0.05% trypsin and 1 mM EDTA. To neutralize trypsin, 5 ml of culture medium was added to the cells and the suspension was centrifuged at 600 rpm for 5 minutes. The growth of fibroblast culture after 4-5 passages was carried out in 75 ml culture bottles in a medium containing 10 g / l DMEM, 3.7 g / l Na ₂ CO ₃ ) 2.4 g / l HEPES, 10% fetal serum and 100 U / ml ampicillin . The culture medium was changed every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 10 ⁶ cells was selected from the cell culture.

The part of the fibroblast culture intended for RNA isolation followed by analysis of the LIF gene transcription was centrifuged at 1000 rpm for 20 minutes and washed twice in PBS buffer by centrifugation at 600 rpm for 5 minutes. Then the cells were resuspended in 1.5 ml of the stabilizing reagent RNAlater and stored at 4 ° C for 10 days for subsequent RNA isolation.

RNA isolation was performed using the RNeasyMiniKit kit. (Qiagen, Germany). The isolated RNA was analyzed spectrophotometrically, measuring the ratio of optical density at 260 and 280 nm, as well as by capillary electrophoresis on a QIAxcel instrument (Qiagen, Germany) using an RNA Qiality Control cartridge. For further work, we used only those samples for which the total amount of isolated RNA was not less than 50 μg RNA, the ratio of D260: D280 was not less than 1.8, and the ratio of the 28S: 18S bands on capillary electrophoresis was not less than 1: 1.

The synthesis of total cDNA of the first strand was carried out using RevertAid reverse transcriptase (Thermo Scientific, USA), according to the manufacturer's recommendations. 1-2 μg of total RNA was used as a template for the synthesis of the first cDNA strand. 100-200 units were added to the reaction mixture for reverse transcription. reverse transcriptase and 10 pM random 9-nucleotide primer.

Example 6

Analysis of endogenous LIF gene expression in primary fibroblast culture

Analysis of the expression of the LIF gene from the fibroblast genome is carried out in order to subsequently correctly determine the gene therapeutic effect after transfection of these cells with genetic constructs with cDNA of the LIF gene.

For analysis, skin fibroblast cell lines, fibroblasts with low expression of the LIF gene and fibroblasts with normal expression of the LIF gene are used, from which RNA is isolated by a standard method (T. Maniatis et al. Molecular Cloning. M., Mir, 1984).

и обратный праймер LIF -RA1

Isolated RNA is analyzed by real-time PCR (SYBR GreenRealTimePCR). For amplification of cDNA (251-332 n.p.), specific for the LIF gene, use the direct primer LIF FA1

and reverse primer LIF -RA1

The length of the amplification product is -82 nucleotide. As a reference gene, the beta-2-microglobulin B2M gene is used, the expression level of which in fibroblasts is comparable to that normal for the LIF gene.

PCR amplification is performed using the SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) or another real-time PCR kit in 20 μl amplification mixture containing: 25 μl QuantiTect SYBR Green RT-PCR MasterMix, 2.5 mM magnesium chloride, 0.5 μm of each primer, 5 μl of total RNA. The reaction is carried out on a CFX96 amplifier (Bio-Rad, USA) under the following conditions: 1 reverse transcription cycle at 50 ° C for 30 minutes, denaturation 98 ° C for 15 minutes, then 40 cycles including denaturation 94 ° C for 15 seconds, primer annealing 62 ° С - 30 sec. and elongation of 72 ° C for 30 sec.

As a positive control, the concentration of amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the LIF and B2M genes is used. As a negative control, deionized water is used (PCR accumulation curves of the products of negative and positive controls are not shown in FIG. 8 to simplify visualization). The number of PCR products - cDNA of the LIF and B2M genes obtained as a result of amplification, is estimated in real time using the software of the Bio-RadCFXManager 2.1 amplifier.

Based on the analysis of LIF gene expression in different fibroblast cultures (with low LIF gene expression and normal LIF gene expression), clones were selected from patients of the same age and the same type of aging, in which the amount of PCR product corresponding to LIF gene cDNA was 10 -20 times lower than that of the B2M gene cDNA. The accumulation curves of specific PCR products are shown in figure 8.

Example 7

Transfection of a fibroblast cell culture with reduced expression of the LIF gene by a gene therapeutic substance in order to confirm an increase in the expression of the LIF gene in the culture of these cells

To evaluate the effectiveness of the gene therapeutic substance containing the unmodified cDNA of the LIF gene according to Example 2, the primary culture of human fibroblasts with reduced expression of the LIF gene selected in Example 6 is transfected with this gene therapeutic substance.

This fibroblast culture is grown in culture bottles (25 cm ² ) until the cells cover 50-70% of the surface of the bottle. The obtained cells are transfected with the gene therapeutic substance based on pCMV6-LIF SEQ ID No: 1 in the presence of a transport molecule (for example, dendrimer) and the vector pCMV6-XL5 as a control.

A 6-well plate with DMEM medium with 10% fetal calf serum (1.6 ml per well) was seeded with fibroblasts at a rate of 1-4 × 10 ⁵ cells per well. Cells were incubated for 18 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then, 2 μg of plasmid DNA was dissolved in serum-free DMEM with Tris-HCl buffer 20 mM with 1 mM EDTA, pH 7-8 (minimum DNA concentration - 0.1 μg / μl). The final volume of the mixture was 100 μl.

The 6th generation SuperFect Transfection Reagent dendrimer solution (Qiagen, Germany) was used as a transport molecule.

Preparation of the DNA dendrimer complex was carried out according to the manufacturer's method (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some changes: 5 μl (with a concentration of 0.5 μg / μl) was added to 15 μl of the dendrimer (with a concentration of 3 μg / μl) plasmid DNA and mixed thoroughly. Then the DNA mixture with the dendrimer was incubated for 5-10 minutes at a temperature of 15-25 ° C.

Medium was carefully selected from the wells of the cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml PBS buffer. To a solution containing DNA dendrimer complexes, 600 μl of fetal serum DMEM medium was added and the mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then, the culture medium was added and incubated for 24-48 hours at 37 ° C and in an atmosphere containing 5% CO ₂ ), after which the cDNA level of the LIF gene and the control cDNA of the B2M gene were estimated using real-time amplification as described in Example 6. Results analysis are shown in figure 9.

From the graphs it follows that in the case of transfection with a vector without insertion of the cDNA of the LIF gene, the level of cDNA of the LIF gene in fibroblasts did not change, and in the case of transfection with a vector of cDNA of the LIF gene, the level of fibroblast cDNA with reduced expression of the LIF gene increased significantly (to a level higher than the level LIF gene cDNA in normal fibroblasts).

It has been shown that in cells transfected with a gene therapeutic substance based on pCMV6-LIF SEQ ID No: 1, an increase in the expression of the target LIF gene is observed.

Example 8

Transfection of a fibroblast cell culture with normal expression of the LIF gene by a gene therapeutic substance with cDNA of the LIF gene to confirm an increase in the amount of leukemia inhibiting factor protein in the culture of these cells.

To assess the change in the amount of leukemia inhibiting factor protein, we used a human skin fibroblast culture according to Example 5, 6th generation SuperFect Transfection Reagent dendrimers (Qiagen, Germany) as a transport molecule, and an aqueous solution of dendrimers without plasmid DNA as a control (A ), the vector plasmid pCDNA 3.1 (+), which does not contain the cDNA of the LIF gene (B), as transfected agents, the gene therapeutic substance based on the vector plasmid pCDNA 3.1 (+), containing the cDNA of the LIF gene - pCDNA 3.1 LIF EQ ID No: 1 (C), Preparation of the DNA dendrimer complex and transfection of fibroblasts was performed according to Example 7.

After transfection, 0.1 ml of 1N HCI was poured into 0.5 ml of culture liquid, thoroughly mixed and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2N NaOH / 0.5M HEPES (pH 7-7.6) and mixed thoroughly.

This mixture was used to quantify the target protein. Quantification of the cDNA product of the LIF gene was carried out by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA) according to the manufacturer's methodology http: //www.abcam.com/ps/products/100/ab100582/documents/ab10058 2% 20LIF% 20Human% 20ELISA_Kit% 20v3% 20 (website) .pdf

The method of detecting results is colorimetric. The optical density of the samples was measured at a wavelength of 450 nm using a ChemWell automatic biochemical and enzyme immunoassay analyzer (Awareness TechNology Inc., USA) and is proportional to the concentration of LIF protein in the sample. The numerical value of the concentration is determined using a calibration curve constructed from calibrators with a known concentration of LIF protein, which is part of the kit. The difference between the optical density (OD) values of the calibrators supplied in triplicate did not exceed 10%.

Statistical processing of the results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/).

Thus, it was shown that transfection of fibroblasts with the obtained gene-therapeutic substance carrying the cDNA of the LIF gene leads to an increase in the amount of leukemia inhibiting factor protein in fibroblast cells. The results are shown in figure 10.

Example 9

The introduction into the human skin of a cell culture of fibroblasts transfected with a gene therapeutic substance with cDNA of the LIF gene in order to confirm the increase after this amount of protein of the leukemia inhibiting factor in a human skin biopsy

In order to analyze the change in the amount of the protein of the leukemia inhibiting factor in human tissues, three variants of autologous fibroblast culture were introduced into the skin of the forearm: untransfected (A), transfected with a vector without an insert, for example, pCMV6-XL5 (B) and transfected with a gene therapeutic substance based on pCMV6-LIF SEQ ID No: 7 (C) in combination with transport molecules - TRANSFAST TM Transfection Reagent liposomes (PROMEGA, USA).

The suspension of liposomes was prepared according to the manufacturer's method (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) with some changes: 0.4 ml of Nuclease-Free sterile water was added to 0.4 mg of liposome powder. The suspension was mixed well by shaking. The resulting intermediate product of the suspension of liposomes was kept for 18 hours at a temperature of -20 ° C, then thawed at room temperature, resuspended by shaking or on a table mixer type "VORTEX".

To prepare the DNA liposome complex, 400 μl of plasmid DNA solution (with a concentration of 150 μg / ml) was added to 400 μl of liposome solution (with a concentration of 1 mg / ml) and mixed thoroughly. Then the mixture of DNA with liposomes was incubated for 5-10 minutes at a temperature of 15-25 ° C and was further used as gene therapeutic substance.

For subsequent transfection of cells with a gene therapeutic substance, primary cultures of human fibroblasts were grown from biopsy samples of the skin of patients according to Example 5.

For transfection, the medium was carefully selected from the wells of a cell culture plate (without disturbing the cell layer) and the cells were washed with 3 ml of PBS buffer. To a solution containing DNA liposime complexes, 600 μl of fetal serum DMEM medium was added and this mixture was transferred to the wells of a cell plate. Cells were incubated with complexes for 2-3 hours at 37 ° C and in an atmosphere containing 5% CO ₂ . Then the medium was carefully removed and the cell layer was washed with 3 ml of PBS buffer. Then, the culture medium was added and incubated for 24-48 hours at 37 ° C in an atmosphere containing 5% CO ₂ .

Part of the cell culture was centrifuged at 700 rpm, the cells were washed twice with physiological saline, resuspended in physiological saline at the rate of 1 million cells in 200 μl and used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. Foci of introducing fibroblast cultures were located at a distance of 3-5 cm from each other.

The determination of the amount of leukemia inhibiting factor protein was evaluated in biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of a suspension of fibroblasts. A biopsy was performed from the injection sites of the fibroblast suspension, as well as from the intact skin, using an Epitheasy 3.5 skin biopsy device (MedaxSRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 3 mm, and the mass was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

As can be seen from figure 11, in the skin of the patient in the area of the introduction of fibroblasts transfected with the gene therapeutic substance based on pCMV6-LIF SEQ ID No: 7, there was an increase in the amount of the protein of the factor inhibiting leukemia, which may indicate an increase in the expression of the LIF gene. Whereas with the introduction of control fibroblast cultures (untransfected and transfected with the 6ej3 vector of the cDNA insert of the LIF gene pCMV6-XL5), the amount of the leukemia inhibiting factor protein in the skin did not change.

Thus, the efficacy of a gene therapeutic substance was shown when a cell culture of fibroblasts transfected with the obtained gene therapeutic substance carrying a modified cDNA of the LIF gene was introduced into the human skin, which leads to an increase in the amount of leukemia inhibiting factor protein in the skin in the injection zone.

Example 10

Transfection of fibroblast cultures from biopsies of a group of different patients with gene-therapeutic substances containing modified LIF gene cDNA and a portion of native unmodified LIF gene cDNA

In order to confirm the individual nature of the increase in the amount of leukemia inhibiting factor protein to a different level during transfection of cell cultures of fibroblasts of patients with gene therapeutic substances with modified cDNA of the LIF gene and a portion of the native cDNA of the LIF gene, the quantitative level of the leukemia inhibiting factor cDNA was analyzed in fibroblast cell lysates transfected with different gene therapeutic substances according to example 3, containing modified cDNA of the LIF gene and a portion of the native unmodified cDNA of the LIF gene in a group of patients depending on the presence and type of modifications in the cDNA of the LIF gene.

The sequence of the plot of the native unmodified cDNA of the LIF gene is shown in figure 1, SEQ ID No: 1., the sequences of the modified cDNA of the LIF gene are shown in figures 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ IP No: 5, SEQ ID No: 6, SEQ ID No: 7).

Fibroblast cultures were grown from the same skin biopsy samples taken from the inner lateral surface zone in the elbow joint zone of 18 patients randomly selected in Example 5, aliquots were selected and the level of leukemia inhibiting factor protein in cell lysates was evaluated. A cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 MMNaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethylsulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14000 rpm, the protein concentration in the supernatant was determined by the Bradford method ([Bradford M.M. (1976) Anal. Biochem. 72: 248-254]).

Then, each of the 18 fibroblast cultures was divided into 8 parts. One part, designated (A), was transfected according to Example 7 with a gene therapeutic substance based on pCMV6-SEQ ID No: 1 vector containing unmodified cDNA of the LIF gene (SEQ ID No: 1.) according to Example 2 in combination with a transport molecule - dendrimer as in example 7.

The second part, designated (B), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 2 vector containing the modified LIF gene cDNA (SEQ ID No: 2.) according to Example 3 in combination with a dendrimer transport molecule as in example 7.

The 3rd part, labeled (C), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 3 vector containing the modified LIF gene cDNA (SEQ ID No: 3.) according to Example 3 in combination with a transport the dendrimer molecule of Example 7.

The 4th part, labeled (D), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 4 vector containing the modified LIF gene cDNA (SEQ ID No: 4.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 5th part, designated (E), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 5 vector containing the modified LIF gene cDNA (SEQ ID No: 5.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 6th part, labeled (F), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 6 vector containing the modified LIF gene cDNA (SEQ ID No: 6.) according to Example 3 in combination with a transport molecule - dendrimer according to example 7.

The 7th part, designated (G), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 7 vector containing the modified LIF gene cDNA variant (SEQ ID No: 7.) according to Example 3 in combination with a transport molecule dendrimer according to example 7.

The 8th part, designated (H), was transfected in accordance with Example 7 with the vector plasmid pCMV6-XL5 that did not contain the cDNA of the LIF gene of Example 3 in combination with the transport molecule dendrimer of Example 7.

The determination of the amount of leukemia inhibiting factor protein was evaluated in biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Based on the results of determining the amount of protein of the factor inhibiting leukemia, indicators were selected for each part of the cell culture from each patient, which showed the maximum levels of the protein of the factor inhibiting leukemia and combined them into seven groups based on the following criterion:

In group 1, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of unmodified cDNA of the LIF gene SEQ ID No: 1. This group included 2 out of 18 cultures.

In group 2, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of the modified cDNA of the LIF gene SEQ ID No: 2. This group included 2 out of 18 cultures.

In group 3, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of the modified cDNA of the LIFSEQ ID No: 3 gene. This group included 3 out of 18 cultures.

In group 4, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of the modified cDNA of the LIF gene SEQ ID No: 4. This group included 3 out of 18 cultures.

In group 5, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of the modified cDNA of the LIFSEQ ID No: 5 gene. This group included 2 out of 18 cultures.

In group 6, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of the modified cDNA of the LIF gene SEQ ID No: 6. This group included 4 out of 18 cultures.

In group 7, the maximum amount of leukemia inhibiting factor protein was observed upon transfection of the modified cDNA of the LIF gene SEQ ID No: 7. This group included 2 out of 18 cultures.

None of the cell cultures transfected with a gene therapeutic substance with a vector plasmid lacking the LIF gene cDNA showed the maximum amount of leukemia inhibiting factor protein, unlike cell cultures transfected with gene therapeutic substances with genetic constructs containing cDNA LIF gene.

Figure 12 shows, for each group of cell cultures, charts of protein concentrations of the leukemia inhibiting factor protein (averaged within the group, if more than one cell culture is included in the group) for all genetically therapeutic substances participating in the experiment, after transfection these cell cultures with gene therapeutic substances containing a modified and a portion of the native cDNA of the LIF gene.

From this example, it follows that the achievement of the maximum amount of leukemia inhibiting factor protein in the skin fibroblast cultures of various patients upon their transfection with gene therapeutic substances is associated with the individual characteristics of the patients and depends on the presence and type of modifications in the cDNA of the LIF gene included in the gene -therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples for the maximum effectiveness of the therapeutic effect created by the gene-therapeutic substances within the group of gene-therapeutic substances is necessary. therapeutic substances.

Example 11

Introduction into the primary cell culture of the uterine endometrial epithelium of a gene-therapeutic substance with cDNA of the LIF gene in order to confirm the increase in the amount of protein of the leukemia-inhibiting factor

A cell culture of human endometrial epithelium was obtained by taking aspiration biopsy material. The transfection of this cell culture was performed with a gene therapeutic substance based on the plasmid pCMV6-Kan / Neo LIF SEQ ID No: 2, using PAMAM dendrimers (Weihai CY Dendrimer Technology) as a transport molecule. The plasmid pCMV6-Kan / Neo without cDNA of the LIF gene was used as a control.

Before transfection, a mixture of plasmid DNA was prepared on the basis that 0.1 μl of a plasmid DNA solution (1 μg / ml) and 0.3 μl of a RAMAM dendrimer solution (1 μg / ml) with 25 μl were added to 4 μl of buffer solution Hanks. The resulting mixture was gently pipetted and incubated at room temperature for 15 minutes.

Immediately before the experiment, the primary cell culture of the human endometrial epithelium was washed with DMEM. Then the cell culture was incubated for 1 h with the prepared transfection mixture at plus 37 ° C and 5% CO ₂ . As a control, 4 μl of Hanks buffer solution was added. After incubation, the cell culture was washed with DMEM, and then complete growth medium was added. Cell culture was observed under a Zeiss Axio Observer A1 microscope for 24 hours.

The cell culture of the human endometrial epithelium was collected 24, 48, 72 and 96 hours after transfection. The growth medium was selected, washed 2 times with Hanks buffer solution, 1 time with EDTA solution, then the cell culture was incubated in trypsin-EDTA solution at 37 ° C in the presence of 5% CO2 for 4 minutes. The trypsinization reaction was inhibited by the addition of growth medium. To get rid of the growth medium, the cell suspension was washed 2 times with Hanks buffer solution, followed by centrifugation. The resulting precipitate was resuspended in the preservative RNAlater (Qiagen, Germany).

RNA was isolated using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer's procedure. To eliminate DNA during the RNA isolation procedure, the RNAse-Free DNAse Set (Qiagen, Germany) was used.

The concentration of isolated RNA was measured spectrophotometrically using NanoDrop 2000 (ThermoFisher Scientific Inc.). The optical density of the RNA solution was measured in the range of 220-320 nm. For work, we used samples for which the total amount of isolated RNA was not less than 1j) ng / μl RNA, and the ratio A ₂₆₀ / A ₂₈₀ was not less than 1.8.

The quality of the isolated RNA was checked by capillary electrophoresis on a QIAxcel instrument (Qiagen, Germany) using an RNA Quality Control Kit cartridge using the BioGel Software program (Qiagen, Germany). The isolated RNA was stored at -80 ° C and was used for the synthesis of the first cDNA strand by RT-PCR.

The synthesis of total cDNA of the first strand was carried out using RevertAid reverse transcriptase (Thermo Scientific, USA) according to the manufacturer's procedure. To a 20 μl reaction mixture consisting of deionized water, 5X Reaction Buffer (250 mM Tris-HCl (pH 8.3 at 25 ° С), 250 mM KCl, 20 mM MgCl2, 50 mM DTT), dNTP (25 mM), 200 Units of reverse transcriptase and 5 pmoles of a random 9-nucleotide primer were introduced; 120 ng of total RNA was used as a template. Reverse transcription was carried out under the following conditions: 1 pre-incubation cycle at 25 ° C for 10 minutes, 1 incubation cycle of 52 ° C for 30 minutes, 1 incubation cycle of 85 ° C for 5 minutes.

Total cDNA was used for real-time PCR, which was performed on a CFX96 thermocycler (Bio-Rad, USA) using the iTaq Universal SYBR Green Supermix reaction mixture (Bio-Rad, USA), which contains the intercalating dye SYBR Green I. The reaction was carried out in a volume of 20 μl according to the manufacturer's instructions using the highly specific QuantiTect Primer Assay primers (Qiagen, Germany) to the LIF gene and to the reference B2M gene. As the matrix used: each sample after the stage of synthesis of total cDNA. The amplification results were evaluated in real time using the software Bio-Rad CFX Manager 2.1 (Bio-Rad USA) and qBase plus (Biogazelle, Belgium). PCR was carried out under the following conditions: initial denaturation at + 95 ° C for 30 sec., 45 cycles, including denaturation at + 95 ° C for 5 sec., Annealing of primers and elongation at + 60 ° C for 30 sec.

Identification of the obtained PCR products was carried out by capillary electrophoresis in a QX DNA High Resolution cartridge (Qiagen, Germany) using a QIAxcel capillary electrophoresis device (Qiagen, Germany). A QX Alignment Marker of 15-3000 bp was used as a leveling marker, and a QX DNA Size Marker of 50-800 bp was used as a length marker. After comparing the obtained data with the theoretically calculated length of both genes, taking into account the error of the device (± 10 bp), it was proved that the detected product corresponds to the LIF gene and the reference B2M gene. In samples with negative control, the product is not detected.

It was shown that, in a cell culture of human endometrial epithelium transfected with a gene therapeutic substance with LIF gene cDNA, there was an increase in the amount of leukemia inhibiting factor protein, which confirms the increased expression of the LIF gene when using a gene therapeutic substance with cDNA of the LIF gene. The results are shown in figure 13.

Example 12

Transfection of the cell culture of the epithelium of the mucous membrane of the oral cavity with a gene-therapeutic substance in order to confirm the increase in the expression of the LIF gene in this cell culture.

In order to determine the effectiveness of the gene therapeutic substance containing the LIF gene cDNA in various cell types, as well as to assess the effect of the transport molecule on the success of transfection with this substance, the epithelium of the human oral mucosa was transfected using amphiphilic block copolymers as the transport molecule .

Biopsies of the mucous membrane of the oral cavity weighing 40 mg were crushed into fragments up to 10 mm ³ . The primary cell culture was grown on Petri dishes at 37 ° C in an atmosphere containing 5% CO ₂ in DMEM medium with 10% fetal calf serum and ampicillin 100 U / ml. Trypsinization and reseeding is performed every 5 days; for trypsinization, the cells were washed with PBS and incubated for 30 minutes at 37 ° C in a solution containing 0.05% trypsin and 1 mM EDTA. To neutralize trypsin, 5 ml of culture medium was added to the cells and the suspension was centrifuged at 600 rpm for 5 minutes. The growth of the epithelial cell culture after 4-5 passages was carried out in 75 ml culture bottles in a medium containing 10 g / L DMEM, 3.7 g / l Na2CO3, 2.4 g / l HEPES, 10% fetal serum and 100 U / ml ampicillin. The culture medium was changed every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 105 cells was selected from the cell culture.

Amphiphilic block copolymers were used to transfect cells with a gene therapeutic substance containing cDNA of the LIF gene. The methodology was applied according to (IntJPharm, 2012, 427, 80-87) or in (Macromol. Biosci.2011, 11, 652-661), with some changes. The block copolymer was synthesized from a mixture of linear polyethyleneimine (PEI) (Polyscience Inc., USA) and bifunctional polyethylene glycol (PEG) N-hydroxysuccinimidyl-75-N- (3-maleimidopropionyl) -amido-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - tetracosoxapenta-heptacontanoate (MAL-dPEG ™ -NHS ester, Quanta BioDesign, Ltd., USA) in borate buffer. The polyplex was prepared 1 hour before the introduction into the cells, mixing the block copolymer solution with the DNA of the genetic construct pCMV6-Kan / Neo LIF SEQ ID No: 3 with the modified cDNA of the LIF gene SEQ ID No: 3. The transfection mixture was added to the cell suspension in 1 ml of DMEM culture medium with 10% fetal serum and ampicillin.

Since a construct containing a selection factor (resistance to geneticin) was used for transfection, the cells after transfection were grown in 25 cm ³ bottles with 5 ml of medium with geneticin for 12 days, changing the medium every 4 days. An aliquot of 500 μl of suspension was taken from each culture every 24 hours to isolate RNA and analyze the level of specific cDNA. RNA isolation was performed using the RNeasyMiniKit kit (Qiagen, Germany). RNA samples were grouped into 3 groups of 8 samples with a similar concentration and combined. The analysis of the specific LIF gene cDNA level was performed using real-time amplification according to the method and with the primers of Example 6 using the iTaqUniversalSYBRGreenSupermix reagent kit (Bio-Rad, USA), CFX96 amplifier (Bio-Rad, USA) and Bio-RadCFXManager software 2.1. The maximum increase in LIF transcription was observed on day 4. Figure 14 shows the accumulation curves of a specific amplification product corresponding to the cDNA of the LIF gene.

It was shown that in epithelial cells of the oral mucosa transfected with a gene therapeutic substance based on pCMV6-Kan / Neo LIF SEQ ID No: 3, using amphiphilic block copolymers as a transport molecule, the expression of the target LIF gene is enhanced.

Example 13

Introduction into the human skin of a gene-therapeutic substance with cDNA of the LIF gene in order to confirm at the same time an increase in the amount of protein of the leukemia-inhibiting factor in human skin.

In order to analyze the change in the amount of the protein of the leukemia inhibiting factor, the patients were injected with a gene therapeutic substance containing a genetic construct with cDNA of the LIF gene (B) and a placebo was introduced in parallel, which was a combination of a vector plasmid not containing cDNA of the LIF gene with transport molecule (A) - into the skin of the forearm.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the pCMV6 LIF SEQ ID No: 4 genetic construct, which contains the modified LIF gene cDNA (SEQ ID No: 4) and plasmid pCMV6-XL5, used as a placebo - which does not contain cDNA of the LIF gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 3-5 cm from each other.

The amount of leukemia inhibiting factor protein was evaluated in the biopsy samples of the patient’s skin by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. The biopsy was performed from skin areas in the area of the introduction of the gene-therapeutic substance and placebo, as well as from intact skin, using the Epitheasy 3.5 biopsy device (Medax SRL) below, as described in Example 9.

It was shown that in the patient’s skin in the area of the introduction of the gene-therapeutic substance with the LIF gene cDNA, there was an increase in the amount of leukemia-inhibiting factor protein, while with placebo, the amount of leukemia-inhibiting factor protein in the skin did not change, which indicates increased gene expression LIF when using a gene therapeutic substance with cDNA of the LIF gene. The results are shown in figure 15.

Example 14

Introduction into the mucous membrane of the human oral cavity of a gene-therapeutic substance with cDNA of the LIF gene in order to confirm the increase in the amount of protein of the leukemia-inhibiting factor in the human oral mucosa.

To analyze the change in the amount of protein of the leukemia inhibiting factor, patients were injected with a gene therapeutic substance containing a genetic construct with cDNA of the LIF gene (B) and a placebo, which is a combination of a vector plasmid containing no cDNA of the LIF gene with transport molecule (A) - was administered the mucous membrane of the oral cavity.

As a transport molecule, TRANS FAST ™ Transfection Reagent liposome powder (PROMEGA, USA) according to Example 9 was used. Next, the genetic construct pCDNA 3.1 LIF SEQ ID No: 5, which contains a modified cDNA of the LIF gene (SEQ ID No: 5), and plasmid pCDNA 3.1 (+), used as a placebo that does not contain cDNA of the LIF gene, each of which was dissolved in sterile water with a Nuclease-Free purification grade. To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 1-2 mm into the cartilaginous tissue of the auricles from the back side. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.3 ml for each. The foci of the introduction of gene-therapeutic substance and placebo were located at a distance of 2-4 cm from each other.

The amount of leukemia inhibiting factor protein was evaluated in lysates of biopsy samples of the patient’s oral mucosa by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. A biopsy was performed from areas of the oral mucosa in the area of the introduction of the gene-therapeutic substance, as well as from the intact areas and in the area of the placebo, using the Epitheasy 3.5 biopsy device (Medax SRL), further according to Example 9.

It was shown that the patient’s oral mucosa in the area of the introduction of a gene-therapeutic substance with cDNA of the LIF gene increased the amount of leukemia inhibiting factor protein, while with placebo, the amount of leukemia inhibiting factor protein in the oral mucosa did not change, which confirms enhancing the expression of the LIF gene when using a gene therapeutic substance with cDNA of the LIF gene. The results are shown in figure 16.

Example 15

Introduction into the muscle tissue of a human gene of a therapeutic substance with cDNA of the LIF gene in order to confirm an increase in the amount of protein of the factor inhibiting leukemia in human muscle tissue.

To analyze the change in the amount of the protein of the factor inhibiting leukemia, the patients were injected with a gene therapeutic substance containing a vector plasmid with cDNA of the LIF gene (B) and a placebo was introduced in parallel, which is a combination of a vector plasmid without cDNA of the LIF gene with transport molecule (A) - muscle tissue in the area of the forearm.

As a transport molecule, TRANSFAST ™ Transfection Reagent liposome powder (PROMEGA, USA) was used as in Example 9. Next, the pCMV6-Kan / Neo LIF SEQ ID No: 6 genetic construct, which contains the modified cIFNA of the LIF gene (SEQ ID No: 6), and plasmid pCMV6-Kan / Neo, used as a placebo, which does not contain cDNA of the LIF gene, each of which was dissolved in sterile water, Nuclease-Free purification.

To obtain gene therapeutic substances, DNA liposome complexes were prepared according to Example 9.

The resulting gene therapeutic substance and placebo were used for administration to a patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 15-20 mm. The volume of the injected solution of the gene-therapeutic substance and placebo is about 0.5 ml for each. The foci of the introduction of the gene-therapeutic substance and placebo were located at a distance of 5-7 cm from each other.

The amount of leukemia inhibiting factor protein was evaluated in lysates of biopsy specimens of the patient’s muscle tissue by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Biopsy samples were taken 3 days after the introduction of the gene-therapeutic substance. A biopsy was performed from muscle tissue in the area of the introduction of the gene-therapeutic substance, as well as from intact areas of the muscle and in the placebo, using the MAGNUM automatic biopsy device (company BARD, USA), hereinafter in Example 9.

It was shown that in the patient’s muscle tissue in the area of the introduction of the gene-therapeutic substance with LIF gene cDNA, there was an increase in the amount of leukemia-inhibiting factor protein, while with placebo, the amount of leukemia-inhibiting factor protein in muscle tissue did not change, which confirms increased expression LIF gene when using a gene therapeutic substance with cDNA of the LIF gene. The results are shown in figure 17.

Example 16

The introduction of a group of different patients of gene-therapeutic substances containing modified cDNA of the LIF gene and a portion of the native unmodified cDNA of the LIF gene.

In order to confirm the individual nature of the increase in the amount of the protein of the leukemia inhibiting factor to a different level when the gene therapeutic substances with modified and unmodified cDNA of the LIF gene were introduced into the skin of the patients, the quantitative level of the protein of the leukemia inhibiting factor was analyzed in the lysate biopsy samples of the patient group depending on the presence and type of modifications in the cDNA of the LIF gene.

The sequence of the plot of the native unmodified cDNA of the LIF gene is shown in figure 1, SEQ LIF ID No: 1, the sequences of the modified cDNA of the LIF gene are shown in figures 2-7 (SEQ LIF ID No: 2, SEQ LIF ID No: 3, SEQ LIF ID No: 4, SEQ LIF ID No: 5, SEQ LIF ID No: 6, SEQ LIF ID No: 7).

In this case, the genetic constructs, one of which contains a portion of the native unmodified cDNA of the LIF gene (SEQ ID No: 1), the second genetic construct contains a portion of the modified cDNA of the LIF gene (SEQ ID No: 2), and the third genetic construct contains a modified cDNA of the LIF gene (SEQ ID No: 3), the fourth genetic construct contains the modified LIF gene cDNA (SEQ ID No: 4), the fifth genetic construct contains the modified LIF gene cDNA (SEQ ID No: 5), the sixth genetic construct contains the modified LIF gene cDNA (SEQ ID No : 6), seventh g -kinetic construct contains the modified LIF cDNA gene (SEQ ID No: 7), eighth genetic construct (placebo) is a vector pCMV6 XL5, dissolved in sterile water Nuclease-Free degree of purification. To obtain gene therapeutic substances, DNA complexes were prepared in combination with transport molecules - liposomes according to example 9.

The resulting seven variants of gene therapeutic substances and a placebo were used for administration to the skin of patients. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Each of the 21 patients, who were randomly selected, was injected with 7 gene-therapeutic substances and a placebo into the skin of the forearm.

Biopsy samples were taken 72 hours after the introduction of gene-therapeutic substances. The biopsy was performed from the sites of the introduction of gene-therapeutic substances, placebo, as well as from intact skin, using the device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 3 mm, and the weight was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

A - biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 1, containing unmodified cDNA of the LIF gene (SEQ ID No: 1.) according to example 2 in combination with transport molecules - liposomes according to example 9. B - a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 2, containing a modified cDNA of the LIF gene (SEQ ID No: 2.) according to Example 3 in combination with transport molecules - liposomes according to Example 9. C - biopsy, obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 3, containing ifitsirovannuyu LIF gene cDNA (SEQ ID No: 3.) of Example 3 in combination with transport molecules - liposomes of Example 9.

D is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 4, containing a modified cDNA of the LIF gene (SEQ ID No: 4.) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

E is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 5, containing the modified cDNA of the LIF gene (SEQ ID No: 5) according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

F - biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 6, containing the modified cDNA of the LIF gene (SEQ ID No: 6) according to Example 3 in combination with the transport molecules - liposomes according to Example 9.

G is a biopsy obtained after the introduction of a gene-therapeutic substance based on pCMV6-SEQ ID No: 7, containing a modified cDNA of the LIF gene (SEQ ID No: 7.) according to Example 3 in combination with transport molecules - liposomes according to Example 9.

H is a biopsy obtained after the introduction of the vector plasmid pCMV6-XL5 that does not contain the cDNA of the LIF gene according to example 3 in combination with transport molecules - liposomes according to example 9.

The amount of leukemia inhibiting factor protein was evaluated in nine skin biopsy samples from each patient (A to H and intact skin biopsy) 72 hours after the administration of gene therapeutic substances by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Based on the analysis of the quantitative level of the protein of the factor inhibiting leukemia, we selected indicators for each biopsy from each patient, which showed the maximum levels of the protein of the factor inhibiting leukemia and combined them into seven groups, based on the following criterion:

In group 1, the maximum amount of leukemia-inhibiting factor protein was observed with the introduction of unmodified cDNA of the LIF gene SEQ ID No: 1. This group included 1 biopsy from 21.

In group 2, the maximum amount of leukemia-inhibiting factor protein was observed with the introduction of the modified cDNA of the LIF gene SEQ ID No: 2. This group included 3 biopsies from 21.

In group 3, the maximum amount of leukemia inhibiting factor protein was observed with the introduction of the modified cDNA of the LIF gene SEQ ID No: 3. This group included 3 biopsies from 21.

In group 4, the maximum amount of leukemia inhibiting factor protein was observed with the introduction of the modified cDNA of the LIF gene SEQ ID No: 4. This group included 4 of 21 biopsy samples.

In group 5, the maximum amount of leukemia inhibiting factor protein was observed with the introduction of the modified cDNA of the LIF gene SEQ ID No: 5. This group included 3 biopsies from 21.

In group 6, the maximum amount of leukemia-inhibiting factor protein was observed with the introduction of the modified cDNA of the LIF gene SEQ ID No: 6. This group included 4 out of 21 biopsy samples.

In group 7, the maximum amount of leukemia inhibiting factor protein was observed with the introduction of the modified cDNA of the LIF gene SEQ ID No: 7. This group included 3 biopsy samples from 21.

None of the biopsies into which the placebo gene therapy substances were introduced, a vector plasmid containing the LIF gene cDNA, showed the maximum amount of leukemia inhibiting factor protein, unlike the biopsies into which the gene therapy substances were injected with genetic constructs containing cDNA of the LIF gene.

The figure 18 for each group of biopsy samples shows diagrams of indicators of protein concentration (averaged within the group if more than one biopsy is included in the group) for all active gene-therapeutic substances participating in the experiment after the patients have been administered with these active gene-therapeutic substances substances containing modified and a portion of the native cDNA of the LIF gene.

From this example, it follows that the achievement of the maximum amount of leukemia-inhibiting factor protein in biopsies of the skin of various patients when they introduce gene-therapeutic substances into the skin is associated with the individual characteristics of patients and depends on the presence and type of modifications in the cDNA of the LIF gene included in the gene -therapeutic substances.

Each gene-therapeutic substance from the group of gene-therapeutic substances is effective in some significant group of patients. Therefore, in order to select the most effective gene-therapeutic substance from the group of gene-therapeutic substances for therapeutic purposes, a preliminary personalized study of the patient’s biopsy samples, or cells grown from these biopsy samples for the maximum effectiveness of the therapeutic effect created by the gene-therapeutic substances within the group of gene-therapeutic substances is necessary. therapeutic substances.

Example 17

Transfection of a patient’s fibroblast cell line with various therapeutic genes containing modified LIF cDNA and a portion of native unmodified LIF cDNA to personalize the choice of the most effective gene-therapeutic substance from the group of gene-therapeutic substances for this patient for subsequent transfection of the patient’s cells with this substance as part of a therapeutic procedure.

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of the leukemia-inhibiting factor protein was analyzed in the cell lysates of the patient’s fibroblasts transfected with different gene-therapeutic substances containing a portion of the native unmodified LIF gene cDNA and / or modified LIF gene cDNAs.

The sequence of the plot of the native unmodified cDNA of the LIF gene is shown in figure 1, SEQ LIF ID No: 1, the sequences of the modified cDNA of the LIF gene are shown in figures 2-7 (SEQ LIF ID No: 2, SEQ LIF ID No: 3, SEQ LIF ID No: 4, SEQ LIF ID No: 5, SEQ LIF ID No: 6, SEQ LIF ID No: 7).

Fibroblast cultures from the patient’s biopsy were grown according to Example 5, aliquots were taken and cell lysis was performed: the cell pellet corresponding to 2 × 10 ⁶ cells was washed with phosphate buffer and resuspended in ice in a lysis buffer containing 25 mM HEPES pH 7.9, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10% glycerol and 1 mM phenylmethyl sulfonyl fluoride. The lysate was centrifuged for 5 minutes at 14,000 rpm.

Then the patient’s fibroblast culture was divided into 8 parts. The first part, designated (A), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 1 vector containing a portion of the native unmodified cDNA of the LIF gene (SEQ ID No: 1.) according to Example 2 in combination with transport molecules - liposomes according to example 9.

The second part, designated (B), was transfected according to example 7 with a gene therapeutic substance based on the vector pCMV6-SEQ ID No: 2 containing a portion of the modified cDNA of the LIF gene (SEQ ID No: 2.) according to Example 3 in combination with transport molecules - liposomes of example 9.

The third part, designated (C), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 3 vector containing the modified LIF gene cDNA (SEQ ID No: 3.) according to Example 3 in combination with liposome transport molecules as in example 9.

The fourth part, designated (D), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 4 vector containing the modified LIF gene cDNA (SEQ ID No: 4.) according to Example 3 in combination with liposome transport molecules as in example 9.

The fifth part, designated (E), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 5 vector containing the modified LIF gene cDNA (SEQ ID No: 5.) according to Example 3 in combination with liposome transport molecules as in example 9.

The sixth part, designated (F), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 6 vector containing the modified LIF gene cDNA (SEQ ID No: 6.) according to Example 3 in combination with liposome transport molecules as in example 9.

The seventh part, designated (G), was transfected according to Example 7 with a gene therapeutic substance based on the pCMV6-SEQ ID No: 7 vector containing the modified cDNA of the LIF gene (SEQ ID No: 7.) according to Example 3 in combination with liposome transport molecules as in example 9.

The eighth part, designated (H), was transfected according to Example 7 with the vector plasmid pCMV6-XL5 that did not contain the cDNA of the LIF gene of Example 3 in combination with the transport lipid molecules of Example 9.

Determination of the amount of leukemia inhibiting factor protein in the patient’s fibroblast cell lysates was performed 72 hours after transfection by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

Based on the results of determining the amount of the protein of the leukemia inhibiting factor, a variant of the gene therapeutic substance was isolated in the patient’s fibroblast culture, during transfection of which the maximum amount of the protein of the leukemia inhibiting factor is observed in the cell culture lysate and, accordingly, the maximum expression of the LIF gene is observed. In this experiment, the maximum amount of leukemia inhibiting factor protein in the lysate was observed during transfection with a gene therapeutic substance based on pCMV6 LIF SEQ ID No: 1 containing unmodified cDNA of the LIF gene, as shown in Figure 19.

Thus, the most effective gene-therapeutic substance has been selected for this patient for subsequent transfection of the patient's cells as part of a therapeutic procedure.

Example 18

The introduction into the patient’s skin of various gene-therapeutic substances containing modified “LIF gene DNA and a portion of the native unmodified cDNA of the LIF gene to select from the group of gene-therapeutic substances the most effective gene-therapeutic substance for this patient for subsequent administration of this substance to the patient within therapeutic procedure.

In order to determine the most effective gene-therapeutic substance for a particular patient, the amount of the leukemia-inhibiting factor protein was analyzed in the biopsy samples of the skin biopsies of this patient after introducing into the skin gene-therapeutic substances containing modified LIF gene cDNA and / or a portion of the native cDNA of the gene LIF.

The sequence of the plot of the native unmodified cDNA of the LIF gene is shown in figure 1, SEQ LIF ID No: 1, the sequences of the modified cDNA of the LIF gene are shown in figures 2-7 (SEQ LIF ID No: 2, SEQ LIF ID No: 3, SEQ LIF ID No: 4, SEQ LIF ID No: 5, SEQ LIF ID No: 6, SEQ LIF ID No: 7).

The patient was administered 7 gene therapeutic substances and a placebo into the skin of the forearm.

The first gene therapeutic substance (A) based on pCMV6-SEQ ID No: 1, containing a portion of the native unmodified cDNA of the LIF gene (SEQ ID No: 1.) according to Example 2 in combination with the transport molecule dendrimer according to Example 7.

The second gene therapeutic substance (B) based on pCMV6-SEQ ID No: 2, containing the modified cDNA of the LIF gene (SEQ ID No: 2.) according to example 3 in combination with the transport molecule dendrimer according to example 7.

The third gene therapeutic substance (C) based on pCMV6-SEQ ID No: 3, containing the modified cDNA of the LIF gene (SEQ ID No: 3.) according to example 3 in combination with the transport molecule dendrimer according to example 7.

The fourth gene therapeutic substance (D) based on pCMV6-SEQ ID No: 4, containing the modified cDNA of the LIF gene (SEQ ID No: 4.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The fifth gene therapeutic substance (E) based on pCMV6-SEQ ID No: 5, containing the modified cDNA of the LIF gene (SEQ ID No: 5.) according to example 3 in combination with the transport molecule dendrimer according to example 7.

The sixth gene therapeutic substance (F) based on pCMV6-SEQ ID No: 6, containing the modified cDNA of the LIF gene (SEQ ID No: 6.) according to Example 3 in combination with the transport molecule dendrimer according to Example 7.

The seventh gene therapeutic substance (G) based on pCMV6-SEQ ID No: 7, containing the modified cDNA of the LIF gene (SEQ ID No: 7.) according to example 3 in combination with the transport molecule dendrimer according to example 7.

The eighth vector plasmid pCMV6-XL5 that does not contain cDNA of the LIF gene according to example 3 in combination with the transport molecule dendrimer of example 7.

Moreover, the genetic constructs, one of which contains a portion of the native unmodified cDNA of the LIF gene (SEQ ID No: 1), the second genetic construct contains the modified cDNA of the LIF gene (SEQ ID No: 2), and the third genetic construct contains the modified cDNA of the LIF gene (SEQ ID No: 3), the fourth genetic construct contains a modified LIF gene cDNA (SEQ ID No: 4), the fifth genetic construct contains a modified LIF gene cDNA (SEQ ID No: 5), the sixth genetic construct contains a modified LIF gene cDNA (SEQ ID No: 6), the seventh genetic this construct contains a modified cDNA of the LIF gene (SEQ ID No: 7), the eighth plasmid (placebo), is a vector pCMV6 XL5, was dissolved in sterile water with Nuclease-Free purification. To obtain gene therapeutic substances, DNA-dendrimer complexes were prepared according to Example 7.

The resulting seven variants of gene-therapeutic substances and placebo were used for administration to the patient. The introduction was carried out by the tunnel method with a 30G needle to a depth of 3 mm. The volume of the injected solution of each gene therapeutic substance was about 0.3 ml. The foci of the introduction of gene-therapeutic substances and placebo were located at a distance of 3-5 cm from each other.

Biopsy samples were taken 72 hours after the introduction of gene-therapeutic substances. The biopsy was performed from the sites of the introduction of gene-therapeutic substances, placebo, as well as from intact skin using the device for taking a skin biopsy Epitheasy 3.5 (Medax SRL). The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 3 mm, and the weight was up to 20 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethyl sulfonyl fluoride and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 minutes at 14,000 rpm. The supernatant was taken and used to quantify the target protein.

Determination of the amount of leukemia inhibiting factor protein was determined in nine biopsy samples of the patient’s skin 72 hours after the administration of the gene therapeutic substances by enzyme-linked immunosorbent assay (ELISA) using the Human LIF ELISA Kit (Abeam, USA), as described in Example 8.

According to the results of determining the amount of leukemia inhibiting factor protein, a variant of the gene therapeutic substance was isolated in the lysate of biopsy samples of the patient’s skin, with the introduction of which the maximum amount of the leukemia inhibiting factor protein in the skin was observed in the lysate of the skin biopsy, and the maximum expression of the LIF gene was observed. In this experiment, the maximum amount of the target protein in the lysate of the skin biopsy was noted with the introduction of the gene therapeutic substance based on pCMV6 LIF SEQ ID No: 2, containing the modified cDNA of the LIF gene, as shown in figure 20.

Thus, the most effective gene-therapeutic substance has been selected for this patient for its subsequent administration to the patient as part of a therapeutic procedure.

A tool has been developed for treating the conditions of the human body associated with a decrease in the expression of the LIF gene and / or a decrease in the amount of protein of the leukemia inhibiting factor, consisting of one or more gene therapeutic substances from the group of gene therapeutic substances for the correction of pathological conditions of cells of organs and tissues and / or human organs and tissues resulting from insufficient expression of the LIF gene, method for its preparation and use.

The invented tool for treating human body conditions associated with a decrease in LIF gene expression and / or a decrease in the amount of leukemia inhibiting factor protein, consisting of one or more gene therapeutic substances from the group of gene therapeutic substances using one of the modified cDNA of the LIF gene or region native unmodified cDNA of the LIF gene makes it possible in practice to use the gene-therapeutic substances included in the group to increase the amount of protein to the required level leukemia inhibiting factor in various cells of organs and tissues and / or organs and tissues of a person by increasing the expression of the LIF gene.

As a result of preliminary studies of the biopsy of the patient, or cells grown from these biopsies, determine which version of the gene therapeutic substance from the created group of gene therapeutic substances must be selected for this patient in order to increase the amount of protein of the leukemia inhibiting factor in the cells these organs and tissues and / or organs and tissues to the required level with respect to a particular patient. In cases where the use of a gene-therapeutic substance with a portion of a native unmodified cDNA of the LIF gene does not lead to the desired change in the level of the protein of the leukemia inhibiting factor in the cells of organs and tissues and / or organs and tissues, it is necessary to use a substance based on a modified cDNA gene LIF leading to more efficient expression of the LIF gene.

When using the claimed gene therapeutic substance, there is no embedding of exogenous genetic material in the genome of the cell.

The group of gene-therapeutic substances provides a high level of LIF gene expression by increasing the amount of leukemia inhibiting factor protein in the cells of organs and tissues and / or organs and tissues of a person, in particular, fibroblasts, epithelial and muscle cells, in the cells of the uterine endometrium, in combination with or without a transport molecule during transfection with these gene therapeutic substances of cells of human organs and tissues and / or in human organs and tissues, in particular, in the cerebral cortex, hippocampus, and lateral ventricles of of the brain, cerebellum, thyroid, parathyroid gland, adrenal glands, appendix, bone marrow, lymph nodes, tonsils, spleen, heart, nasopharynx, bronchi, lungs, liver, gall bladder, liver, pancreas, salivary glands, stomach, duodenum , small intestine, colon, rectum, kidney, bladder, testes, spermatic cord, prostate, seminal vesicles, mammary glands, cervix, fallopian tubes, ovaries, placenta, skin, in the mucous membrane of the oral cavity, heart mouse ary tissue, skeletal muscle, smooth muscle, endometrium, uterus, adipose tissue, soft tissues, combined with a transport molecule with or without the introduction of genetic therapeutic substances in human organs and tissues.

Thus, the above examples confirm the fulfillment of the task, namely, the creation of a highly effective agent for the treatment of human body conditions associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of protein of the leukemia inhibiting factor based on gene therapeutic substances with the LIF gene, which is a group of gene therapeutic substances, the use of which, taking into account the individual characteristics of the patient, leads to an increase in the level of expression of the LIF gene and / or Vyshen quantity factor protein inhibiting leukemia cells in organs and tissues and / or organs and tissues.

In addition, with the introduction of genetic constructs, in contrast to the introduction of the protein itself, the required frequency of their introduction is reduced due to the prolonged action, and intracellular delivery is also facilitated.

An increase in the efficiency of the correction of the quantitative level of the protein of the leukemia inhibiting factor in the cells of human organs and tissues is achieved due to the fact that with an insufficient amount of this protein due to a defect in the LIF gene, not a protein is used, but a genetic construct with cDNA of the LIF gene encoding this protein.

Industrial applicability.

All the above examples on the creation and use of the created group of gene therapeutic substances confirm its industrial applicability.

List of abbreviations

DNA - deoxyribonucleic acid

cDNA - complementary deoxyribonucleic acid

RNA - ribonucleic acid

mRNA - template ribonucleic acid

PCR - polymerase chain reaction

ml - milliliter, μl - microliter

l - liter

mcg - micrograms

mg - milligram

g - gram

μM - micromol

mm - millimole

rpm - revolutions per minute

nm - nanometer

cm - centimeter

MW - milliwatts

father f-relative fluorescence unit

GTS - a gene-therapeutic substance

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 1

ATGAAGGTCTTGGCGGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCGGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATACGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Figure 1

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 2

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATACGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Figure 2

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 3

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Figure 3

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 4

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Figure 4

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 5

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACCGACTTCCCCCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Figure 5

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 6

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACCGACTTCCCCCCCTTCCACGCCAACGGCACCGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

6

A method for treating conditions of the human body associated with a decrease in the level of expression of the LIF gene and / or a decrease in the amount of leukemia inhibiting factor protein based on gene therapeutic substances with the LIF gene, a method for producing and using

SEQ ID No: 7

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACCGACTTCCCCCCCTTCCACGCCAACGGCACCGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGGGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCCGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

7

Claims (5)

1. Means for correcting the state of cells of various organs and tissues, as well as human organs and tissues proper, associated with a decrease in the expression of the LIF gene and / or a decrease in the amount of protein of the leukemia inhibiting factor based on gene-therapeutic substances with the LIF gene, where organ cells and tissues selected from fibroblasts, uterine endometrial cells, epithelial cells; organs and tissues are selected from the skin, oral mucosa or muscle tissue, which is at least one gene therapeutic substance selected from the group of gene therapeutic substances, each of which represents a genetic construct based on a vector plasmid comprising LIF gene cDNA , with the coding sequence of the protein of the factor inhibiting leukemia, with divisions of 5 'and 3'-untranslated regions, namely, obtained on the basis of the plot of the native unmodified cDNA of the gene LIF SEQ ID No: 1, or modified cDNA of the LIF gene, with SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID as a modified cDNA of the LIF gene No: 7 or a combination of these genetic constructs, each of which also contains regulatory elements that increase the expression of the LIF gene in eukaryotic cells, in combination with or without a transport molecule when these gene-therapeutic substances are introduced into human organs and tissues. 2. The tool according to p. 1, characterized in that each genetic construct with a modified cDNA of the LIF gene contains a nucleotide sequence that includes a protein coding region of the cDNA of the LIF gene that carries modifications that do not affect the structure of the protein of the leukemia inhibiting factor, namely nucleotide substitutions that do not lead to amino acid substitutions or termination of the amino acid chain, or a combination of the above modifications, and do not affect the amino acid sequence encoded by this sequence. 3. The tool according to p. 1, characterized in that as a transport molecule using liposomes, or dendrimers of the 5th and higher generations, or amphiphilic block copolymers. 4. A method of obtaining a means for treating conditions of the human body associated with a decrease in LIF gene expression and / or a decrease in the amount of leukemia inhibiting factor protein according to claim 1, which consists in obtaining each gene therapeutic substance from the group of gene therapeutic substances according to claim 1., at the same time, cDNA of the LIF gene is obtained, then cDNA is placed in a vector plasmid capable of increasing the expression of this cDNA in cells of various human organs and tissues, the necessary amount of genetics is increased and secreted nth construct, then the genetic construct is combined with a transport molecule to transfect the obtained gene therapeutic substance of cells of organs and tissues and / or introduce the obtained gene therapeutic substance into human organs and tissues, using cDNA of the LIF gene with the coding sequence of the leukemia inhibiting factor protein , with deletions of 5 'and 3'-untranslated regions, namely, obtained on the basis of a portion of a native unmodified cDNA of the LIF gene SEQ ID No: 1 or modified cDNA of the LIF gene, while your modified LIF gene cDNA uses either SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6, or SEQ ID No: 7, or a combination these genetic constructs. 5. A method of using an agent for treating human body conditions associated with a decrease in LIF gene expression and / or a decrease in the amount of a protein of a leukemia inhibiting factor, namely female infertility, which consists in transfecting a gene therapeutic substance selected from the group of created gene therapeutic substances according to 1, cells of organs and tissues of a patient and / or in the introduction into the organs and tissues of a patient autologous cells of a patient transfected with a gene-therapeutic substance selected from the group GOVERNMENTAL genetic therapeutic substances of claim. 1, and / or during introduction into organs and tissue of the patient genetically therapeutic substance or several substances selected / selected from the group created by a genetic therapeutic substances according to Claim. 1 or a combination of the methods indicated.

Images