KR102427786B1 - Cell for regulating production of exosome, composition including the same, exosome obtained therefrom and method for producing exosomes - Google Patents

Abstract

The present invention relates to cells for promoting exosome production cultured by regulating the expression of proteins of the Gasdermin family, exosomes obtained therefrom, and a method for producing exosomes, and has an effect of increasing the production of exosomes.

Description

Exosome-producing regulatory cells, compositions comprising the same, exosomes and exosome production methods obtained therefrom

The present invention relates to exosomes and methods for producing exosomes.

Exosomes are nano-sized endoplasmic reticulum that are naturally created within cells, and contain proteins and genetic information. It is involved in regulation, angiogenesis, and the progression of various diseases. Exosomes, which are biological nanovesicles, have recently attracted great attention as a drug delivery system due to their advantages such as avoidance of immune response, excellent human compatibility, drug loading function, target delivery effect to specific cells, and blood stability. are receiving

In addition, apoptotic cell-derived exosomes are vesicles derived from endosomes secreted from cells that die due to apoptosis, and are exosomes in size, density, and protein. , and has its own surface proteins, S1PR1 and S1PR3 (Sphingosine-1-phosphate receptor 1 and 3). In addition, apoptotic exosomes act as damage-associated molecular patterns (DAMPs) that increase the secretion of inflammatory cytokines and chemokines in macrophages and animal models.

In order to use these exosomes commercially, large amounts and high quality exosomes are required. However, the amount of exosomes currently obtainable is only a very small amount, and the development of materials capable of increasing the production of exosomes is still insufficient.

Therefore, more research is needed on new methods for producing exosomes.

International Publication WO2012/087241 (2012.06.28)

The problem to be solved by the present invention is to provide a cell for regulating the production of exosomes cultured by regulating the expression of gas dermin family proteins.

Another object to be solved by the present invention is to provide an exo-some production control composition comprising cells for regulating the production of exosomes cultured by regulating the expression of gas dermin family (Gasdermin family) proteins.

Another problem to be solved by the present invention is to provide an exosome obtained from cells for controlling the production of exosomes cultured by regulating the expression of gas dermin family proteins.

Another problem to be solved by the present invention is to transfect any one cell selected from the group consisting of stem cells, immune cells, somatic cells, cell lines and tumor cells with a vector in which the gene of the Gasdermin family protein is recombined. post-culturing; It provides an exosome production method comprising a.

One embodiment of the present invention provides a cell for regulating the production of exosomes cultured by regulating the expression of gas dermin family (Gasdermin family) protein.

In one embodiment of the present invention, the gas dermin family protein may be at least one selected from the group consisting of GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), and DFNB59.

In one embodiment of the present invention, the gas dermin family (Gasdermin family) protein is at least one selected from the group consisting of GSDMA, GSDMC, GSDMD and GSDME (DFNA5), it may be to promote the production of some exo . The protein that promotes the exosome production may be preferably one or more of GSDMD and GSDME (DFNA5), and more preferably GSDME (DFNA5).

One embodiment of the present invention is GSDME (DFNA5); and at least one selected from the group consisting of GSDMA, GSDMC and GSDMD; It provides a cell for promoting the production of exosomes cultured by regulating the expression of the gas dermin group (Gasdermin family) protein comprising a.

In one embodiment of the present invention, the gas dermin family (Gasdermin family) protein may be present in the membrane of the exosome.

In one embodiment of the present invention, the cells, stem cells, immune cells, somatic cells, cell lines, or tumor cells may be obtained by treating an apoptosis-inducing substance.

In one embodiment of the present invention, the stem cells, mesenchymal stem cells pluripotent stem cells (pluripotent stem cells), pluripotent stem cells (multipotent stem cells), or unipotent stem cells (unipotent stem cells) may be .

In one embodiment of the present invention, the immune cells, dendritic cells (dendritic cells), natural killer cells (natural killer cells), T cells (T cells), B cells (B cells), regulatory T cells (regulatory T cells) cells, Treg cells, natural killer T cells, innate lymphoid cells, macrophages, granulocytes, chimeric antigen receptor-expressing T cells (CAR-T: Chimeric) antigen receptor-T cell), lymphokine-activated killer cells (LAK), and cytokine-induced killer cells (CIK: Cytokine Induced Killer Cell) may be selected from the group consisting of.

In one embodiment of the present invention, the somatic cells are, fibroblasts, chondrocytes, synovial cells, keratinocytes, adipocytes, osteoblasts. , may be selected from the group consisting of osteoclasts and peripheral blood mononuclear cells.

In one embodiment of the present invention, the cell lines are CHO cells, NS0 cells, Sp2/0 cells, BHK cells, C127 cells, HEK293 cells, HEK293T cells, HEK-293 STF cells, 293T/17 cells, 293T/17 cells. SF cells, or HEK-293.2sus cells, HT-1080 cells, PER.C6 cells, NuLi-1 cells, ARPE-19 cells, VK2/E6E7 cells, Ect1/E6E7 cells, RWPE-2 cells, WPE-stem cells, End1/E6E7 cells, WPMY-1 cells, NL20 cells, NL20-TA cells, WT 9-7 cells, WPE1-NB26 cells, WPE-int cells, RWPE2-W99 cells, and BEAS-2B cells. it could be

In one embodiment of the present invention, the tumor cells are human ovarian cancer cell lines (SKOV3, OVCAR3), human breast cancer cell lines (MCF-7, T47D, BT-474), human hepatocarcinoma cell lines (Hep3B, HepG2), human glia Glioblastoma cell lines (U87MG, U251), human colorectal cancer cell lines (SW480, HT-29, HCT116, Caco-2), human lung cancer cell lines (A549, NCIH358, NCI-H460), human prostate cancer cell line (22RV1), human uterus It may be one selected from the group consisting of a cervical cancer cell line (HeLa), a human melanoma cell line (A375), and a human gastric cancer cell line (NCI-N87).

One embodiment of the present invention provides a composition for regulating exosome production comprising cells for regulating exosome production cultured by regulating the expression of gas dermin family (Gasdermin family) protein.

In one embodiment of the present invention, the cell, 　 number of exosomes, 　 exosomes 　 derived proteins, 　 and 　 exosomes 　 content of 　 derived RNA may be increased.

One embodiment of the present invention provides an exosome obtained from a cell for controlling the production of exosomes cultured by regulating the expression of gas dermin family (Gasdermin family) protein.

In one embodiment of the present invention, the exosome is obtained from cells cultured by overexpressing one or more gasdermin family proteins selected from the group consisting of GSDMA, GSDMC, GSDMD and GSDME (DFNA5). have.

In one embodiment of the present invention, the exosome is, GSDME (DFNA5); and at least one selected from the group consisting of GSDMA, GSDMC and GSDMD; It may be obtained from cells cultured by overexpressing a gas dermin family protein containing a.

In one embodiment of the present invention, the exosome may be an apoptosis-derived exosome (apoptotic exosome).

In one embodiment of the present invention, the diameter of the exosome may be 100 nm to 250 nm.

In one embodiment of the present invention, after transfecting a vector in which a gene of a gasdermin family protein is recombined into any one cell selected from the group consisting of stem cells, immune cells, somatic cells, cell lines and tumor cells. culturing; It provides an exosome production method comprising a.

In one embodiment of the present invention, the exosome production method comprises the steps of separating the exosomes from the culture medium after inducing apoptosis (apoptosis) in the cells; may further include

In one embodiment of the present invention, the gas dermin group (Gasdermin family) protein in the exosome production method is at least one selected from the group consisting of GSDMA, GSDMC, GSDMD and GSDME (DFNA5), and the production of exosomes may be to increase

In one embodiment of the present invention, the gas dermin family protein in the exosome production method is GSDME (DFNA5); and at least one selected from the group consisting of GSDMA, GSDMC and GSDMD, and may be to increase the production of exosomes.

According to the cell for controlling the production of exosomes cultured by regulating the expression of gasdermin family proteins of the present invention and the method for producing exosomes using the same, there is an effect of controlling the production of exosomes. The exosomes can be used in various fields such as medicine, pharmaceuticals, food and cosmetics.

1 shows an increase in the production of apoptotic exosomes by Gasdermin overexpression in HeLa cell lines.
Figure 2 shows the increase in the production of apoptotic exosomes by Gasdermin overexpression in the 293T cell line.
Figure 3 shows that apoptotic exosome production is inhibited by knock-out of DFNA5 and GSDMD.
4 shows changes in exosome production according to time in DFNA5 overexpressed cell lines and knock-out cell lines.
Figure 5 shows the data on the accumulation of gasdermin family proteins in the exosomes.
6 shows the accumulation of the full-length form and degraded form of the Gasdermin family protein in the membrane of the exosome.

Hereinafter, the present application will be described in more detail.

The following specific functional descriptions are only exemplified to describe embodiments according to the concept of the present application, and the embodiments according to the concept of the present application may be implemented in various forms and are limited to the embodiments described in this specification. should not be construed as

Since the embodiment according to the concept of the present application may have various changes and may have various forms, specific embodiments will be described in detail herein. However, this is not intended to limit the embodiments according to the concept of the present application to a specific disclosed form, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present application.

The terminology used herein is used only to describe specific embodiments and is not intended to limit the present application. The singular expression includes the plural expression unless the context clearly dictates otherwise.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and are not to be interpreted in an ideal or excessively formal meaning unless explicitly defined in the present specification. .

In the present specification, "Gasdermin family" protein is GSDMA consisting of the amino acid sequence of SEQ ID NO: 2, GSDMB consisting of the amino acid sequence of SEQ ID NO: 4, GSDMC consisting of the amino acid sequence of SEQ ID NO: 6, amino acid sequence of SEQ ID NO: 8 It consists of GSDMD consisting of, DFNA5 (GSDME) consisting of the amino acid sequence of SEQ ID NO: 10, and DFNB59 consisting of the amino acid sequence of SEQ ID NO: 12.

In one embodiment of the present invention, the "Gasdermin family" gene is a GSDMA gene consisting of SEQ ID NO: 1, a GSDMB gene consisting of SEQ ID NO: 3, a GSDMC gene consisting of SEQ ID NO: 5, a GSDMD gene consisting of SEQ ID NO: 7 , the DFNA5 (GSDME) gene consisting of SEQ ID NO: 9 and the DFNB59 gene consisting of SEQ ID NO: 11. These genes may include not only the gene consisting of the nucleotide sequence of each SEQ ID NO: but also variants that may occur in human subjects, for example, consisting of the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9 or 11 Genes in which one or several bases have been deleted, substituted, and/or added in a gene include those produced by mutations based on polymorphisms or mutations. In addition, each gene is 80% or more, for example, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, 99.5% or more with respect to the nucleotide sequence of SEQ ID NO: 7 , including variants consisting of a nucleotide sequence having an identity of at least 99.7% or at least 99.9%. The identity of the nucleotide sequence can be determined using known algorithms such as BLAST and FASTA. In addition, each gene includes a variant consisting of a nucleotide sequence hybridized under stringent conditions with respect to a gene consisting of the nucleotide sequence of each SEQ ID NO. In addition, in the present specification, as an example of stringent hybridization conditions, for example, as a post-hybrid washing condition, it may be a condition of about "1×SSC, 0.1% SDS, 37° C." normally. Although not particularly limited, as more stringent hybrid conditions, it may be about “0.5×SSC, 0.1% SDS, 42° C.”, and as strict hybrid conditions about “0.1×SSC, 0.1% SDS, 65° C.”. These mutant genes encode a protein having the same function as the protein consisting of the amino acid sequence of SEQ ID NO: 8.

In one embodiment of the present invention, GSDMA protein, GSDMB protein, GSDMC protein, GSDMD protein, DFNA5 (GSDME) protein, and DFNB59 protein are not only proteins consisting of the amino acid sequence of each SEQ ID NO: Including, a protein in which one or several amino acids are deleted, substituted, and/or added in a protein comprising the sequence of each SEQ ID NO: includes those produced by mutation based on polymorphism or mutation. However, these mutant human proteins have the same function as the 　 protein consisting of the amino acid sequence of each SEQ ID NO.

와 IL18의 분비가 일어나고 결국에는 세포막의 파열과 함께 파이롭토시스(pyroptosis)가 일어나 세포내 구성분의 세포외 분비를 유도한다. In the present specification, "GSDMD (GasderminD)" refers to caspase [caspase 1, caspase 4 and caspase 5 (human) or caspase 1 and caspase 11 (mouse)] activated by the inflammation control complex (inflammasome) by cleavage. The N-terminal domain is separated from the C-terminal inhibitory domain, and the separated N-terminal domain is oligomerized in the cell membrane and a hole with a diameter of 10-16 nm is drilled. Through this hole, the inflammatory cytokine IL1

and IL18 secretion, and eventually pyroptosis occurs with rupture of the cell membrane, leading to extracellular secretion of intracellular components.

As used herein, the GSDME (GasderminE) protein expressed as the "DFNA5" gene is cleaved by caspase 3, which is activated during apoptosis, and induces secondary necrosis or pyroptosis. Except for DFNB59, all N-terminal domains of Gasdermin can puncture the cell membrane.

As used herein, “Pyroptosis” is a type of cell death that is similar to necrosis but is not apoptosis but is characterized by pore formation in the plasma membrane, cell expansion and plasma membrane disruption.

As used herein, the term "cytokine" refers to proteins secreted by immune cells. After cytokines are secreted from cells, they can affect other cells or the cells themselves. That is, it induces the proliferation of macrophages or promotes the differentiation of secretory cells themselves.

In the present specification, inflammation-regulating complex (inflammasomes) is a substance that induces the maturation of inflammatory cytokines such as IL-1t related to innate immune defenses such as infection or stress of cells.

In one embodiment of the present invention, the exosome production control composition may include a vector comprising a gasdermin group gene.

In one embodiment of the present invention, the exosome production control composition may include a culture medium.

The culture medium is DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, DMEM/F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-10), DMEM/F -12 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12), α-MEM (α-Minimal essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Isocove's Modified Dulbecco's Medium), KnockOut DMEM, E8 (Essential) 8　Medium), etc., may be used commercially prepared medium or artificially synthesized medium, but is not limited thereto.

The culture medium generally includes a carbon source, a nitrogen source, and a trace element component, and may further include amino acids, antibiotics, and the like.

The culture medium may further include a protein synthesis inhibitory enzyme. Specifically, Cycloheximide, Anisomycin, Aurintricarboxylic acid, Diphtheria toxin, Edeine, Fusidic acid, Factamycin (Pactamycin), puromycin (Puromycin), ricin (Ricin), sodium fluoride (Sodium fluoride), sparsomycin (Sparsomycin), tetracycline (Tetracycline), any one selected from the group consisting of trichoderma (Trichoderma) However, it is not limited thereto, and it can be substituted if it is a protein synthesis inhibitor of a similar mechanism.

The culture medium may further include TNFα. The TNFα may be included at a concentration of 5 to 500 ng/mL.

The present inventors found that the Gasdermin family proteins (GSDMA, GSDMC, GSDMD, DFNA5) were expressed in the membrane of apoptotic exosomes through research experiments, and overexpression of Gasdermin family proteins resulted in apoptosis It was confirmed that it affects the secretion of apoptotic exosome. Specifically, it was confirmed that DFNA5 is an important regulator of apoptotic exosome secretion and promotes the production of apoptotic exosomes according to the increase in DFNA5 expression. In addition, it was confirmed that the expression of GSDMA, GSDMC and / or GSDMD protein can also promote the production of exosomes. In addition, proteins of the Gasdermin family, including DFNA5, GSDMA, GSDMC, and/or GSDMD, can increase exosome production with increasing dose.

In one embodiment of the present invention, GSDMA, GSDMC, GSDMD, and/or DFNA5, which are proteins of the Gasdermin family, may be exosome marker proteins. Proteins of GSDMA, GSDMC, GSDMD, and/or DFNA5 may exist in the membrane of exosomes in a full-length form and in a degraded form. Therefore, it can be used as a marker to determine and quantify the presence or absence of apoptotic exosomes in samples of various clinical diseases.

And, since overexpression of GSDMB and / or DFNB59 protein among proteins of the Gasdermin family can inhibit the production of apoptotic exosomes, GSDMB and / or DFNB59 protein can be utilized as a marker to inhibit exosome secretion. .

The exosome may be an apoptosis-derived exosome or a stem cell-derived exosome.

The apoptosis-derived exosome may be obtained by treating an apoptosis-inducing substance in stem cells, immune cells, somatic cells, cell lines, or tumor cells.

The stem cell may be a mesoderm stem cell, a pluripotent stem cell, a multipotent stem cell, or a unipotent stem cell, but is limited thereto. doesn't happen

The pluripotent stem cells may be embryonic stem cells (ES Cells), undifferentiated germline cells (EG Cells), dedifferentiated stem cells (iPS Cells), or induced pluripotent stem cells (iPSCs). However, it is not limited thereto.

The multipotent stem cells are mesenchymal stem cells (adipose-derived, bone marrow-derived, umbilical cord blood or umbilical cord-derived, etc.), hematopoietic stem cells (derived from bone marrow or peripheral blood, etc.), nervous system stem cells, germ stem cells, etc. It may be an adult stem cell of, but is not limited thereto.

The mesenchymal stem cells (MSC) are human embryonic stem cell-derived mesenchymal stem cells hES-MSC (Human embryonic stem cell-derived mesenchymal stroma cells), bone marrow-derived mesenchymal stem cells BM-MSC (Bone marrow mesenchymal stem cell), It may be umbilical cord-derived mesenchymal stem cells (UC-MSC), or adipose-derived mesenchymal stem cells (ADSC), but is not limited thereto.

The stem cells may be autologous or allogeneic stem cells, and may be derived from any type of animal, including human and non-human mammals, whether the stem cells are derived from an adult or an embryo, but are not limited thereto. .

Specifically, the stem cells may be embryonic stem cells, adult stem cells, or induced pluripotent stem cells, but is not limited thereto.

As used herein, the term "embryonic stem cell" is a cell extracted during embryonic development, and the inner cell mass is extracted from the blastocyst embryo just before the fertilized egg is implanted in the mother's uterus and cultured in vitro. means that

The embryonic stem cells are pluripotent (pluripotent) or totipotent (totipotent) capable of differentiating into cells of all tissues of an individual, meaning a cell having self-renewal ability (selfrenewal), broad meaning These include embryoid bodies derived from embryonic stem cells.

The embryonic stem cells may include, but are not limited to, embryonic stem cells derived from all types of human, monkey, pig, horse, cow, sheep, dog, cat, mouse, rabbit, and the like.

As used herein, "adult stem cells" are cells extracted from cord blood, bone marrow, blood, etc. of mature adults, and refer to cells just before differentiation into cells of specific organs, and develop into tissues in the body when necessary. It refers to cells in an undifferentiated state with the ability to

The adult stem cells include adult stem cells of various tissue origins from humans or animals, mesenchymal stromal cells derived from human or animal tissues, mesenchymal stem cells derived from induced pluripotent stem cells derived from human or animal tissues, and human or animal tissues. It may include, but is not limited to, tissue-derived pluripotent stem cells.

As used herein, the term "induced pluripotent stem cell (iPSC)" refers to cells induced to have pluripotent differentiation ability from differentiated cells through an artificial reverse differentiation process, can be used for meaning.

The artificial dedifferentiation process is performed by introduction of a virus-mediated or non-viral vector using a retrovirus, a lentivirus and a Sendai virus, a non-viral-mediated dedifferentiation factor using a protein and a cell extract, or a stem cell extract , a dedifferentiation process by a compound, etc. may be included.

The induced pluripotent stem cells have almost the same characteristics as embryonic stem cells, specifically, have a similar cell shape, have similar expression of 　 genes and 　 proteins, have pluripotency in vitro and in vivo, and develop teratoma. When inserted into the blastocyst of a mouse, a chimera mouse is formed, and germline transmission of the gene is possible.

The induced pluripotent stem cells may include, but are not limited to, induced pluripotent stem cells derived from all types of human, monkey, pig, horse, cow, sheep, dog, cat, mouse, rabbit, and the like.

The human or animal tissue may be selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta.

The stem cells of various tissue origins from humans or animals may be, for example, hematopoietic stem cells, mammary stem cells, intestinal stem cells, vascular endothelial stem cells, neural stem cells, olfactory neural stem cells and/or testicular stem cells, However, the present invention is not limited thereto.

The immune cells, dendritic cells (dendritic cells), natural killer cells (natural killer cells), T cells (T cells), B cells (B cells), regulatory T cells (regulatory T cells, Treg cells), natural killer T natural killer T cells, innate lymphoid cells, macrophages, granulocytes, chimeric antigen receptor-expressing T cells (CAR-T), lymphocytic It may be selected from the group consisting of phosphorus-activated killer cells (LAK: Lymphokine-activated killer Cell) and cytokine-induced killer cells (CIK: Cytokine Induced Killer Cell).

The somatic cells, fibroblasts, chondrocytes, synovial cells, keratinocytes, adipocytes, osteoblasts, osteoclasts, and peripheral blood It may be selected from the group consisting of peripheral blood mononuclear cells.

The cell line is CHO cells, NS0 cells, Sp2/0 cells, BHK cells, C127 cells, HEK293 cells, HEK293T cells, HEK-293 STF cells, 293T/17 cells, 293T/17 SF cells, or HEK-293.2sus cells. , HT-1080 cells, PER.C6 cells, NuLi-1 cells, ARPE-19 cells, VK2/E6E7 cells, Ect1/E6E7 cells, RWPE-2 cells, WPE-stem cells, End1/E6E7 cells, WPMY-1 cells , NL20 cells, NL20-TA cells, WT 9-7 cells, WPE1-NB26 cells, WPE-int cells, RWPE2-W99 cells, and BEAS-2B cells.

The tumor cells are ovarian cancer, breast cancer, liver cancer, brain cancer, colorectal cancer, prostate cancer, cervical cancer, lung cancer, stomach cancer, skin cancer, pancreatic cancer, oral cancer, rectal cancer, laryngeal cancer, thyroid cancer, parathyroid cancer, colon cancer, bladder cancer, peritoneal cancer, adrenal cancer , tongue cancer, small intestine cancer, esophageal cancer, renal pelvic cancer, kidney cancer, heart cancer, duodenal cancer, ureter cancer, urethral cancer, pharyngeal cancer, vaginal cancer, tonsil cancer, anal cancer, pleural cancer, thymus cancer or nasopharyngeal cancer .

The tumor cells include human ovarian cancer cell lines (SKOV3, OVCAR3), human breast cancer cell lines (MCF-7, T47D, BT-474), human hepatocarcinoma cell lines (Hep3B, HepG2), human glioblastoma cell lines (U87MG, U251), Human colorectal cancer cell line (SW480, HT-29, HCT116, Caco-2), human lung cancer cell line (A549, NCIH358, NCI-H460), human prostate cancer cell line (22RV1), human cervical cancer cell line (HeLa), human melanoma It may be selected from the group consisting of a cell line (A375), and a human gastric cancer cell line (NCI-N87).

As used herein, "promotion of production" means that the production, generation, release, etc. of a specific substance is increased within the same time as compared to the control group.

Specifically, it means that the amount of exosomes produced from stem cells and the content of proteins, RNA, etc. within the exosomes are increased.

Hereinafter, the present invention will be described in detail by way of experimental examples, examples and comparative examples. However, the following Examples and Comparative Examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following Examples.

Experimental example 1: Preparation of Cells and reagents

HeLa cell line (human cervical cancer) was cultured in minimal essential media (MEM) supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin. The 293T (human embryonic kidney) cell line was cultured in DMEM supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin. Staurosporine was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Each antibody was purchased from the following companies: Anti-GSDMA (ProSci, CA), anti-GSDMB (Santa Cruz, CA), anti-GSDMC ( ProteinTech, Manchester, UK), anti-GSDMD (Sino biological, Beijing, China) anti-DFNA5 (Sino biological, Beijing, China), anti-DFNB59 (Novusbio, Colorado), anti-GAPDH (Santa Cruz, CA), anti -tubulin (Sigma-Aldrich, Yongin, Korea), anti-CD63 (Santa Cruz, CA), anti-S1PR1 (EMD Millipore, Princeton, NJ), anti-S1PR3 (Santa Cruz, CA).

Experimental example 2: Lentivirus Particle production and stable cell line production

GSDMA, GSDMB, GSDMC, GSDMD, DFNA5(GSDME), or DFNB59 cDNA was purchased from Sino biological (Beijing, China), pCDH-CMV-MCS-EF1-puro Lentiviral vector (System Biosciences) or pCDH-EF1-MCS- It was subcloned into T2A-puro Lentivrial vector (System Biosciences). All lentiviral vectors were transfected into 293TN cells (System Biosciences) using Lipofectamine 2000 transfection reagents (Invitrogen). After 2 days, psudo-virus particles were collected and then infected with HeLa cells and 293T cells. HeLa cells and 293T cells were treated with puromycin (2 ug/ml) from the second day of infection and cultured for 2 more weeks to select cells expressing the gasdermin family gene. And the overexpression of the gene was confirmed by western blot.

Experimental example 3: CRISPR / Cas9 Knock-out cell line production using the system

Knock-out cell line was constructed using Feng Zhang lab. LentiCRISPR v2 vector (Addgene #52961). Four pairs of oligonucleotides (20 mers) each capable of targeting DFNA5 and GSDMD were prepared, cloned into LentiCRISPR v2, lentiviral particles were prepared as above, and then infected with HeLa cells. After 2 weeks of puromycin (2 ug/ml) selection, gene knock-out was confirmed by western blot.

Experimental example 4: cell death of the apoptotic exosome separation

After induction of cell apoptosis (apoptosis), apoptotic exosomes were isolated from the conditioned media. The culture medium was centrifuged twice at 300 x g for 5-20 minutes and at 2,000 x g for 5-40 minutes, and the suspension (supernatants) was ultracentrifuged at 100,000 x g for 20-120 minutes to finally isolate exosomes. The isolated exosome pellet was suspended in PBS (phosphate-buffered cell line) or RIPA buffer (pH 7.5, 50 mM Tris-Cl, 150 mM NaCl, 1 mM EDTA). For separation of the exosome membrane component, exosomes suspended in PBS were treated with 100 mM Na ₂ CO ₃ (pH 11) for 1 hour, and then washed with PBS.

Experimental example 5: Nanoparticles Tracking Analysis

Nanoparticle tracking analysis was performed using ZetaView Nanoparticle Tracking Analyzer under the following conditions: camera sensitivity (80), shutter (250), frame rate (30f/s), Min brightness (20), Max size (1000), Min size (8), traces (12).

< Example 1>. HeLa in cell lines Gasdermin by overexpression of family genes Exo increased secretion of moth

After overexpressing Gasdermin family genes [GSDMA, GSDMB, GSDMC, GSDMD, DFNA5(GSDME), DFNB59] in HeLa cell line, staurosporine (1 uM) was treated for 24 hours to induce apoptosis. Exosomes were isolated from the culture medium, and the number and diameter of exosomes were analyzed by nanoparticle tracking analysis (NTA) and the expression of exosome marker proteins (CD63, S1PR1, S1PR3) was analyzed by western blot.

Figure 1 (A) is a HeLa cell line after overexpressing Gasdermin family genes [GSDMA, GSDMB, GSDMC, GSDMD, DFNA5 (GSDME), DFNB59], staurosporine (1 uM) treatment for 24 hours to induce apoptosis (apoptosis) Exosomes were isolated from one culture medium and the expression of marker proteins (CD63, S1PR1, S1PR3) of the exosomes was analyzed by western blot. 1 (B) and (C) is a nanoparticle tracking analysis (NTA) of the number and diameter of the exosomes. Table 1 shows the amount of secretion of apoptotic exosomes from HeLa cell lines overexpressing Gasdermin.

As a result, as shown in FIG. 1 and Table 1, overexpression of GSDMA, GSDMC, GSDMD, and DFNA5 statistically significantly increased the secretion of exosome-sized particles with a diameter of 100 to 200 nm, and exosome marker CD63, Expression of S1PR1 and S1PR3 was similarly increased. In particular, overexpression of DFNA5 increased the secretion of exosomes the most. On the other hand, overexpression of GSDMB and DFNB59 statistically significantly inhibited the secretion of exosomes.

Cells Mean Particle Number/ 10 ⁷ Cells S.D. ./ 10 ⁷ Cells HeLa 4.62857 ×10 ¹² 1.56 × 10 ¹⁰ Vector 4.69286 ×10 ¹² 1.65 × 10 ¹⁰ GSDMA 5.27104 ×10 ¹² 2.44 ×10 ¹⁰ GSDMB 2.17699 ×10 ¹² 8.21 ×10 ⁹ GSDMC 7.09091 ×10 ¹² 4.30 ×10 ¹⁰ GSDMD 7.04082 ×10 ¹² 8.07 × 10 ¹⁰ DFNA5 2.14286 ×10 ¹³ 1.56 × 10 ¹¹ DFNB59 1.48819 ×10 ¹² 7.30 ×10 ¹⁹

< Example 2>. in the 293T cell line Gasdermin by overexpression of family genes Exo increased secretion of moth

After treatment with staurosporine (10 uM) in 293T cell line overexpressing the Gasdermin family gene, cultured for 48 hours to induce apoptosis.

Figure 2(A) is a 239T cell line after overexpressing Gasdermin family genes [GSDMA, GSDMB, GSDMC, GSDMD, DFNA5(GSDME), DFNB59], staurosporine (1 uM) treatment for 24 hours to induce apoptosis (apoptosis) This is the result of isolating exosomes from one culture medium and analyzing the expression of the exosome marker proteins CD63, S1PR1, and S1PR3 by western blot. Figure 2 (B) shows the result of nanoparticle tracking analysis (NTA) the number of exosomes. Table 2 shows the amount of apoptotic exosome secretion of 239T cell line overexpressing Gasdermin.

As a result, as shown in FIG. 2 and Table 2, DFNA5 overexpression among gasdermin family genes increased exosome secretion in 293T cells, and DFNB59 overexpression statistically significantly inhibited exosome secretion.

Cells Mean Particle Number/ 10 ⁷ Cells S.D. ./ 10 ⁷ Cells 293T 7.54 ×10 ¹⁰ 5.72 ×10 ⁹ Vector 7.28 ×10 ¹⁰ 1.09 × 10 ¹⁰ GSDMA 8.33 ×10 ¹⁰ 5.27 ×10 ⁹ GSDMB 6.8 × 10 ¹⁰ 9.16 ×10 ⁹ GSDMC 8.42 ×10 ¹⁰ 1.01 × 10 ¹⁰ GSDMD 8.61 ×10 ¹⁰ 6.48 ×10 ⁹ DFNA5 1.79 × 10 ¹¹ 1.49 × 10 ¹⁰ DFNB59 3.6 × 10 ¹⁰ 3.88 ×10 ⁹

< Example 3> with DFNA5 GSDMD's by knock-out apoptotic exosomes inhibition of secretion

After knock-out of DFNA5 and GSDMD using CRSPR/Cas9 in gasdermin, which increased exosome secretion upon overexpression in HeLa cell line, the secretion of apoptotic exosome by stauroporine treatment was measured.

3A and 3D show that four cell lines each of which were knocked-out of DFNA5 or GSDMD by CRISPR/Cas9 were made, and expression inhibition was confirmed by western blot. 3B and E show the expression of exosome markers by western blot. Then, each cell line was treated with staurosporine (1 uM) for 24 hours and the number of exosomes separated after separation was measured by the NTA method, and is shown in C and F of FIG. 3 .

Cells Mean Particle Number/ 10 ⁷ Cells S.D. ./ 10 ⁷ Cells HeLa 4.55 × 10 ¹² 4.81 ×10 ¹¹ Vector 3.7 × 10 ¹² 6.56 ×10 ¹¹ DFNA5 KO-1 2.52 × 10 ¹¹ 4.48 ×10 ¹⁰ DFNA5 KO-2 2.94 ×10 ¹¹ 4.34 ×10 ¹⁰ DFNA5 KO-3 1.386 ×10 ¹¹ 2.94 ×10 ¹⁰ DFNA5 KO-4 3.08 × 10 ¹¹ 2.8 × 10 ¹⁰

Cells Mean Particle Number/ 10 ⁷ Cells S.D. ./ 10 ⁷ Cells HeLa 4.69 ×10 ¹² 3 × 10 ¹¹ Vector 4.76 ×10 ¹² 3.57 × 10 ¹¹ GSDMD KO-1 2.73 × 10 ¹² 2.21 × 10 ¹¹ GSDMD KO-2 2.87 ×10 ¹² 1.29 × 10 ¹¹ GSDMD KO-3 3.22 × 10 ¹² 3.54 × 10 ¹¹ GSDMD KO-4 3.01 × 10 ¹² 2.74 ×10 ¹¹

Tables 3 and 4 show the apoptotic exosome secretion amount of the DFNA5 knock-out HeLa cell line and the apoptotic exosome secretion amount of the GSDMD knock-out HeLa cell line, respectively.

As a result, as shown in FIG. 3, Table 3 and Table 4, the secretion of exosomes was completely inhibited in all four cell lines in which DFNA5 was knocked out. Confirmed. GSDMD knock-out partially inhibited exosome secretion.

< Example 4> DFNA5 Time-dependent response of overexpressing and knock-out cell lines exosomes change in secretion

HeLa cell lines, HeLa cell lines infected with control vector, and HeLa cell lines overexpressing or knocking out DFNA5 were treated with staurosporine (1 uM), and then the exosomes produced over time were isolated and the exosomes were recovered by the NTA method. The number was measured and the expression of exosome markers was measured by western blot.

In Figure 4, A is a control vector-infected HeLa cell line, a HeLa cell line overexpressing or knock-out of DFNA5 was treated with staurosporine (1 uM), and the exosomes secreted over time were separated and exosomes by NTA method. shows the number of, B is the measurement of the exosome marker expression by western blot (H: from parental HeLa cells; V: vector-infected HeLa cells; D: the cells over-expressing DFNA5; K: the cells knocked out in DFNA5).

Referring to FIG. 4 , overexpression of DFNA5 sharply increased the production of exosomes over time compared to the control group, but knock-out of DFNA5 inhibited the production of exosomes at all times. These results show that by regulating the expression of DFNA5, the secretion of apoptotic exosomes from cells can be controlled.

< Example 5> Apoptotic of exosomes to promote production Gasdermin family protein

In the HeLa cell line, the transformed control vector, and the HeLa cell line overexpressing the Gasdermin family gene, the expression of Gasdermin was compared and analyzed with the cell lysate treated with normal cell lysate (lysate) and staurosporine (1 uM).

5 shows HeLa cells, transformed control vector, and Gasdermin-overexpressing HeLa cells treated with staurosporine (1 uM), exosomes separated, and the same amount of untreated control cell line lysate (C), staurosporine-treated cell line The lysate (S) and the apoptosis exosome lysate (A) show western blot for each type of gasdermin family protein (arrow: full-length gasdermin; arrowhead: Degraded gasdermin).

Figure 6 shows Gasdermin-overexpressed HeLa cells treated with staurosporine (1 uM), exosomes separated, normal cell line lysate with the same protein amount (C), staurosporine-treated cell line lysate (S), staurosporine treatment Cell culture medium (C' Media), exosomes, and exosome membranes (Exo Memb) were subjected to western blot for each type of gasdermin family protein (arrow: full-length gasdermin; arrowhead: Degraded). gasdermin)

Referring to FIG. 6 , the full-length and degraded forms of GADMA, GSDMC, GSDMD, and DFNA5 are accumulated in the membrane of exosomes isolated from the culture solution of HeLa cells treated with stauroporine. confirmed that there is.

Therefore, the full-length form and degraded form of GSDMA, GSDMC, GSDMD, and DFNA5, gasdermin family proteins that increase the secretion of apoptotic exosomes, are novel exosome markers present in the membrane of exosomes. and can be applied as a target to determine and quantify the presence or absence of apoptotic exosomes in specimens of various clinical diseases. And through these studies, exosomes can play a role in various human diseases.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> CK-Exogene Co., Ltd. <120> CELL FOR REGULATING PRODUCTION OF EXOSOME, COMPOSITION INCLUDING THE SAME, EXOSOME OBTAINED THEREFROM AND METHOD FOR PRODUCING EXOSOMES <130> 20P0604T <150> KR 10-2020-0078274 <151> 2020-06-26 <160> 12 <170 > KoPatentIn 3.0 <210> 1 <211> 1338 <212> DNA <213> Homo sapiens <400> 1 atgaccatgt ttgaaaatgt cacccgggcc ctggccagac agctaaaccc tcgaggggac 60 ctgacaccac ttgacagcct catcgacttc aagcgcttcc atcccttctg cctggtgctg 120 aggaagagga agagcacgct cttctggggg gcccggtacg tccgcaccga ctacacgctg 180 ctggatgtgc ttgagcccgg cagctcacct tcagacccaa cagacactgg gaattttggc 240 tttaagaata tgctggacac ccgagtggag ggagatgtgg atgtaccaaa gacggtgaag 300 gtgaagggaa cggcagggct ctcgcagaac agcactctgg aggtccagac actcagtgtg 360 gctcccaagg ccctggagac cgtgcaggag aggaagctgg cagcagacca cccattcctg 420 aaggagatgc aagatcaagg ggagaacctg tatgtggtga tggaggtggt ggagacggtg 480 caggaggtca cactggagcg agccggcaag gcagaggcct gcttctccct ccccttcttc 540 gccccattgg ggctacaggg atccataaat cacaaggagg ctgtaaccat ccccaagggc 600 tgcgtcctgg ccttt cgagt gagacagctg atggtcaaag gcaaagatga gtgggatatt 660 ccacatatct gcaatgataa catgcaaacc ttccctcctg gagaaaagtc aggagaggag 720 aaggtcatcc ttatccaggc atctgatgtt ggggacgtac acgaaggctt caggacacta 780 aaagaagaag ttcagagaga gacccaacaa gtggagaagc tgagccgagt agggcaaagc 840 tccctgctca gctccctcag caaacttcta gggaagaaaa aggagctaca agaccttgag 900 ctcgcacttg aaggggctct agacaaggga catgaagtga ccctggaggc actcccaaaa 960 gatgtcctgc tatcaaagga ggccgtgggc gccatcctct atttcgttgg agccctaaca 1020 gagctaagtg aagcccaaca gaagctgctg gtgaaatcca tggagaaaaa gatcctaccc 1080 gtgcagctaa agctggtgga gagcacgatg gaacagaact tcctgctgga taaagagggt 1140 gttttccccc tgcaacctga gctgctctcc tcccttgggg acgaggagct gaccctcacg 1200 gaggctctag tcgggctgag tggcctggaa gtgcagagat cgggccccca atatatgtgg 1260 gacccagaca ccctccctcg cctctgtgct ctttatgcag gcctctctct ccttcagcag 1320 cttaccaagg cctcctaa 1338 <210> 2 <211> 445 <212> PRT <213 > Homo sapiens <400> 2 Met Thr Met Phe Glu Asn Val Thr Arg Ala Leu Ala Arg Gln Leu Asn 1 5 10 15 Pr o Arg Gly Asp Leu Thr Pro Leu Asp Ser Leu Ile Asp Phe Lys Arg 20 25 30 Phe His Pro Phe Cys Leu Val Leu Arg Lys Arg Lys Ser Thr Leu Phe 35 40 45 Trp Gly Ala Arg Tyr Val Arg Thr Asp Tyr Thr Leu Leu Asp Val Leu 50 55 60 Glu Pro Gly Ser Ser Pro Ser Asp Pro Thr Asp Thr Gly Asn Phe Gly 65 70 75 80 Phe Lys Asn Met Leu Asp Thr Arg Val Glu Gly Asp Val Asp Val Pro 85 90 95 Lys Thr Val Lys Val Lys Gly Thr Ala Gly Leu Ser Gln Asn Ser Thr 100 105 110 Leu Glu Val Gln Thr Leu Ser Val Ala Pro Lys Ala Leu Glu Thr Val 115 120 125 Gln Glu Arg Lys Leu Ala Ala Asp His Pro Phe Leu Lys Glu Met Gln 130 135 140 Asp Gln Gly Glu Asn Leu Tyr Val Val Met Glu Val Val Glu Thr Val 145 150 155 160 Gln Glu Val Thr Leu Glu Arg Ala Gly Lys Ala Glu Ala Cys Phe Ser 165 170 175 Leu Pro Phe Phe Ala Pro Leu Gly Leu Gln Gly Ser Ile Asn His Lys 180 185 190 Glu Ala Val Thr Ile Pro Lys Gly Cys Val Leu Ala Phe Arg Val Arg 195 200 205 Gln Leu Met Val Lys Gly Lys Asp Glu Trp Asp Ile Pro His Ile Cys 210 215 220 Asn Asp Asn Met Gln Thr Phe Pro Gly Glu Lys Ser Gly Glu Glu 225 230 235 240 Lys Val Ile Leu Ile Gln Ala Ser Asp Val Gly Asp Val His Glu Gly 245 250 255 Phe Arg Thr Leu Lys Glu Glu Val Gln Arg Glu Thr Gln Gln Val Glu 260 265 270 Lys Leu Ser Arg Val Gly Gln Ser Ser Leu Leu Ser Ser Leu Ser Lys 275 280 285 Leu Leu Gly Lys Lys Lys Glu Leu Gln Asp Leu Glu Leu Ala Leu Glu 290 295 300 Gly Ala Leu Asp Lys Gly His Glu Val Thr Leu Glu Ala Leu Pro Lys 305 310 315 320 Asp Val Leu Leu Ser Lys Glu Ala Val Gly Ala Ile Leu Tyr Phe Va l 325 330 335 Gly Ala Leu Thr Glu Leu Ser Glu Ala Gln Gln Lys Leu Leu Val Lys 340 345 350 Ser Met Glu Lys Lys Ile Leu Pro Val Gln Leu Lys Leu Val Glu Ser 355 360 365 Thr Met Glu Gln Asn Phe Leu Leu Asp Lys Glu Gly Val Phe Pro Leu 370 375 380 Gln Pro Glu Leu Leu Ser Ser Leu Gly Asp Glu Glu Leu Thr Leu Thr 385 390 395 400 Glu Ala Leu Val Gly Leu Ser Gly Leu Glu Val Gln Arg Ser Gly Pro 405 410 415 Gln Tyr Met Trp Asp Pro Asp Thr Leu Pro Arg Leu Cys Ala Leu Tyr 420 425 430 Ala Gly Leu Ser Leu Leu Gln Gln Leu Thr Lys Ala Ser 435 440 445 <210> 3 <211> 1212 <212> DNA <213> Homo sapiens <400> 3 atgttcagcg tatttgagga aatcacaaga attgtagtta aggagatgga tgctggaggg 60 gatatgattg ccgttagaag ccttgttgat gctgatagat tccgctgctt ccatctggtg 120 ggggagaaga gaactttctt tggatgccgg cactacacaa caggcctcac cctgatggac 180 attctggaca cagatgggga caagtggtta gatgaactgg attctgggct ccaaggtcaa 240 aaggctgagt ttcaaattct ggataatgta gactcaacgg gagagttgat agtgagatta 300 cccaaagaaa taacaatttc aggcagtttc cagggcttcc accatcagaa aatcaagata 360 tcggagaacc ggatatccca gcagtatctg gctacccttg aaaacaggaa gctgaagagg 420 gaactaccct tttcattccg atcaattaat acgagagaaa acctgtatct ggtgacagaa 480 actctggaga cggtaaagga ggaaaccctg aaaagcgacc ggcaatataa attttggagc 540 cagatctctc agggccatct cagctataaa cacaagggcc aaagggaagt gaccatcccc 600 ccaaatcggg tcctgagcta tcgagtaaag cagcttgtct tccccaacaa ggagacgatg 660 aagaaggatg gtgcttcatc ctgtttagga aagtctttgg gttcggagga ttccagaaac 720 atgaaggaga agttggagga catggagagt gtcctcaagg acctgacaga ggagaagaga 780 aaagatgtgc taaactccct cgctaagtgc ctcggcaagg aggatattcg gcaggatcta 840 gagcaaagag tatctgaggt cctgatttcc ggggagctac acatggagga cccagacaag 900 cctctcctaa gcagcctttt taatgctgct ggggtcttgg tagaagcgcg tgcaaaagcc 960 attctggact tcct ggatgc cctgctagag ctgtctgaag agcagcagtt tgtggctgag 1020 gccctggaga aggggaccct tcctctgttg aaggaccagg tgaaatctgt catggagcag 1080 aactgggatg agctggccag cagtcctcct gacatggact atgaccctga ggcacgaatt 1140 ctctgtgcgc tgtatgttgt tgtctctatc ctgctggagc tggctgaggg gcctacctct 1200 gtctcttcct aa 1212 <210> 4 <211> 403 <212> PRT <213> Homo sapiens <400> 4 Met Phe Ser Val Phe Glu Glu Ile Thr Arg Ile Val Val Lys Glu Met 1 5 10 15 Asp Ala Gly Gly Asp Met Ile Ala Val Arg Ser Leu Val Asp Ala Asp 20 25 30 Arg Phe Arg Cys Phe His Leu Val Gly Glu Lys Arg Thr Phe Phe Gly 35 40 45 Cys Arg His Tyr Thr Thr Gly Leu Thr Leu Met Asp Ile Leu Asp Thr 50 55 60 Asp Gly Asp Lys Trp Leu Asp Glu Leu Asp Ser Gly Leu Gln Gly Gln 65 70 75 80 Lys Ala Glu Phe Gln Ile Leu Asp Asn Val Asp Ser Thr Gly Glu Leu 85 90 95 Ile Val Arg Leu Pro Lys Glu Ile Thr Ile Ser Gly Ser Phe Gln Gly 100 105 110 Phe His His Gln Lys Ile Lys Ile Ser Glu Asn Arg Ile Ser Gln Gln 115 120 125 Tyr Leu Ala Thr Leu Glu Asn Arg Lys Leu Lys Arg Glu Leu Pro Phe 130 135 140 Ser Phe Arg Ser Ile Asn Thr Arg Glu Asn Leu Tyr Leu Val Thr Glu 145 150 155 160 Thr Leu Glu Thr Val Lys Glu Glu Thr Leu Lys Ser Asp Arg Gln Tyr 165 170 175 Lys Phe Trp Ser Gln Ile Ser Gln Gly His Leu Ser Tyr Lys His Lys 180 185 190 Gly Gln Arg Glu Val Thr Ile Pro Asn Arg Val Leu Ser Tyr Arg 195 200 205 Val Lys Gln Leu Val Phe Pro Asn Lys Glu Thr Met Lys Lys Asp Gly 210 215 220 Ala Ser Ser Cys Leu Gly Lys Ser Leu Gly Ser Glu Asp Ser Arg Asn 225 230 235 240 Met Lys Glu Lys Leu Glu Asp Met Glu Ser Val Leu Lys Asp Leu Thr 245 250 255 Glu Glu Lys Arg Lys Asp Val Leu Asn Ser Leu Ala Lys Cys Leu Gly 260 265 270 Lys Glu Asp Ile Arg Gln Asp Leu Glu Gln Arg Val Ser Glu Val Leu 275 280 285 Ile Ser Gly Glu Leu His Met Glu Asp Pro Asp Lys Pro Leu Leu Ser 290 295 300 Ser Leu Phe Asn Ala Ala Gly Val Leu Val Glu Ala Arg Ala Lys Ala 305 310 315 320 Ile Leu Asp Phe Leu Asp Ala Leu Leu Glu Leu Ser Glu Glu Gln Gln 325 330 335 Phe Val Ala Glu Ala Leu Glu Lys Gly Thr Leu Pro Leu Leu Lys Asp 340 345 350 Gln Val Lys Ser Val Met Glu Gln Asn Trp Asp Glu Leu Ala Ser Ser 355 360 365 Pro Pro Asp Met Asp Tyr Asp Pro Glu Ala Arg Ile Leu Cys Ala Leu 370 375 380 Tyr Val Val Val Ser Ile Leu Leu Glu Leu Ala Glu Gly Pro Thr Ser 385 390 395 400 Val Ser Ser <210> 5 <211> 1527 <212> DNA <213> Homo sapiens <400> 5 a tgccctcca tgttggaacg cattagcaaa aatttggtca aagagattgg aagcaaagac 60 ctgacacctg tcaaatacct attgagtgcc accaaattac gtcagtttgt tatattacga 120 aagaagaagg attctcgttc atcattttgg gaacaatctg actatgttcc agttgaattc 180 tccctcaatg acatcctgga gccaagttct tcagtcctag aaactgttgt gacaggaccg 240 ttccacttca gtgacattat gatccagaag cataaggctg acatgggtgt gaatgttggt 300 atagaagtga gtgtgtcagg ggaggcctct gtggaccatg gatgctccct cgagtttcaa 360 attgttacca tcccatcacc aaacctggaa gactttcaaa aaaggaaact gttggatcca 420 gagccatcat ttctgaagga gtgccggagg agaggggaca acctgtacgt ggtgacagag 480 gctgttgaac tgatcaacaa tactgtgctg tacgatagca gtagtgtgaa tattttaggg 540 aaaattgctc tttggattac ctatggcaag ggtcaaggcc aaggagagag tctcagagtg 600 aagaagaagg cgctgactct tcagaaaggc atggtgatgg cttataagag aaagcagctg 660 gttatcaagg agaaagccat tctcatctca gatgatgatg aacagagaac ctttcaagat 720 gagtacgaaa tttccgaaat ggtaggctac tgtgctgcga ggagtgaggg gttgctacca 780 tcatttcata ccatctctcc aaccctcttc aatgcctcat ccaatgatat gaagttaaaa 840 ccagagctat ttctgacacagcaatttttg agcgggcatt tgccaaaata cgaacaagtt 900 cacatcctcc cagtaggaag aatagaggaa cccttctggc aaaatttcaa gcatctacaa 960 gaggaggttt tccagaaaat aaagacactg gctcagctct caaaggatgt tcaggatgtc 1020 atgttctaca gtatcctggc catgctcaga gacagagggg ctctacagga cctgatgaac 1080 atgctggaat tggacagctc aggtcatttg gatggccctg gtggtgccat cctaaagaaa 1140 cttcaacagg attcaaacca tgcatggttt aacccaaagg accccattct ttatctcctt 1200 gaagccataa tggtgctgag tgacttccaa cacgatttgc tggcctgttc catggagaag 1260 aggatcctgc ttcagcaaca ggagctggta aggagcatcc tggagccaaa cttcagatac 1320 ccctggagca ttcccttcac cctcaaacct gagctcctcg ccccactcca gagtgagggt 1380 ttggccatca cctatggcct gctggaggag tgtggcctta ggatggagct ggataacccc 1440 aggtcaacct gggatgtaga agcaaagatg cccctgtctg ccctctatgg gactctctcg 1500 ttgctgcagc agctggctga ggcctaa 1527 <210> 6 <211> 508 <212> PRT <213> Homo sapiens <400> 6 Met Pro Ser Met Leu Glu Arg Ile Ser Lys Asn Leu Val Lys Glu Ile 1 5 10 15 Gly Ser Lys Asp Leu Thr Pro Val Lys Tyr Leu Leu Leu Ser Ala Thr Lys 2 0 25 30 Leu Arg Gln Phe Val Ile Leu Arg Lys Lys Lys Asp Ser Arg Ser Ser 35 40 45 Phe Trp Glu Gln Ser Asp Tyr Val Pro Val Glu Phe Ser Leu Asn Asp 50 55 60 Ile Leu Glu Pro Ser Ser Ser Val Leu Glu Thr Val Val Thr Gly Pro 65 70 75 80 Phe His Phe Ser Asp Ile Met Ile Gln Lys His Lys Ala Asp Met Gly 85 90 95 Val Asn Val Gly Ile Glu Val Ser Val Ser Gly Glu Ala Ser Val Asp 100 105 110 His Gly Cys Ser Leu Glu Phe Gln Ile Val Thr Ile Pro Ser Pro Asn 115 120 125 Leu Glu Asp Phe Gln Lys Arg Lys Leu Leu Asp Pro Glu Pro Ser Phe 130 135 140 Leu Lys Glu Cys Arg Arg Arg Gly Asp Asn Leu Tyr Val Val Thr Glu 145 150 155 160 Ala Val Glu Leu Ile Asn Asn Thr Val Leu Tyr Asp Ser Ser Ser Val 165 170 175 Asn Ile Leu Gly Lys Ile Ala Leu Trp Ile Thr Tyr Gly Lys Gly Gln 180 185 190 Gly Gln Gly Glu Ser Leu Arg V al Lys Lys Lys Ala Leu Thr Leu Gln 195 200 205 Lys Gly Met Val Met Ala Tyr Lys Arg Lys Gln Leu Val Ile Lys Glu 210 215 220 Lys Ala Ile Leu Ile Ser Asp Asp Asp Glu Gln Arg Thr Phe Gln Asp 225 230 235 240 Glu Tyr Glu Ile Ser Glu Met Val Gly Tyr Cys Ala Ala Arg Ser Glu 245 250 255 Gly Leu Leu Pro Ser Phe His Thr Ile Ser Pro Thr Leu Phe Asn Ala 260 265 270 Ser Ser Asn Asp Met Lys Leu Lys Pro Glu Leu Phe Leu Thr Gln Gln 275 280 285 Phe Leu Ser Gly His Leu Pro Lys Tyr Glu Gln Val His Ile Leu Pro 290 295 300 Val Gly Arg Ile Glu Glu Pro Phe Trp Gln Asn Phe Lys His Leu Gln 305 310 315 320 Glu Glu Val Phe Gln Lys Ile Lys Thr Leu Ala Gln Leu Ser Lys Asp 325 330 335 Val Gln Asp Val M et Phe Tyr Ser Ile Leu Ala Met Leu Arg Asp Arg 340 345 350 Gly Ala Leu Gln Asp Leu Met Asn Met Leu Glu Leu Asp Ser Ser Gly 355 360 365 His Leu Asp Gly Pro Gly Gly Ala Ile Leu Lys Lys Leu Gln Gln Asp 370 375 380 Ser Asn His Ala Trp Phe Asn Pro Lys Asp Pro Ile Leu Tyr Leu Leu 385 390 395 400 Glu Ala Ile Met Val Leu Ser Asp Phe Gln His Asp Leu Leu Ala Cys 405 410 415 Ser Met Glu Lys Arg Ile Leu Leu Gln Gln Gln Glu Leu Val Arg Ser 420 425 430 Ile Leu Glu Pro Asn Phe Arg Tyr Pro Trp Ser Ile Pro Phe Thr Leu 435 440 445 Lys Pro Glu Leu Leu Ala Pro Leu Gln Ser Glu Gly Leu Ala Ile Thr 450 455 460 Tyr Gly Leu Leu Glu Glu Cys Gly Leu Arg Met Glu Leu Asp Asn Pro 465 470 475 480 Arg S er Thr Trp Asp Val Glu Ala Lys Met Pro Leu Ser Ala Leu Tyr 485 490 495 Gly Thr Leu Ser Leu Leu Gln Gln Leu Ala Glu Ala 500 505 <210> 7 <211> 1455 <212> DNA <213> Homo sapiens < 400> 7 atggggtcgg cctttgagcg ggtagtccgg agagtggtcc aggagctgga ccatggtggg 60 gagttcatcc ctgtgaccag cctgcagagc tccactggct tccagcccta ctgcctggtg 120 gttaggaagc cctcaagctc atggttctgg aaaccccgtt ataagtgtgt caacctgtct 180 atcaaggaca tcctggagcc ggatgccgcg gaaccagacg tgcagcgtgg caggagcttc 240 cacttctacg atgccatgga tgggcagata cagggcagcg tggagctggc agccccagga 300 caggcaaaga tcgcaggcgg ggccgcggtg tctgacagct ccagcacctc aatgaatgtg 360 tactcgctga gtgtggaccc taacacctgg cagactctgc tccatgagag gcacctgcgg 420 cagccagaac acaaagtcct gcagcagctg cgcagccgcg gggacaacgt gtacgtggtg 480 actgaggtgc tgcagacaca gaaggaggtg gaagtcacgc gcacccacaa gcgggagggc 540 tcgggccggt tttccctgcc cggagccacg tgcttgcagg gtgagggcca gggccatctg 600 agccagaaga agacggtcac catcccctca ggcagcaccc tcgcattccg ggtggcccag 660 ctggttattg actctgactt ggacgtcctt ctcttcccgg ataagaagca gaggaccttc 720 cagccacccg cgacaggcca caagcgttcc acgagcgaag gcgcctggcc acagctgccc 780 tctggcctct ccatgatgag gtgcctccac aacttcctga cagatggggt ccctgcggag 840 ggggcgttca ctgaagactt ccagggccta cgggcagagg tggagaccat ctccaaggaa 900 ctggagcttt tggacagaga gctgtgccag ctgctgctgg agggcctgga gggggtgctg 960 cgggaccagc tggccctgcg agccttggag gaggcgctgg agcagggcca gagccttggg 1020 ccggtggagc ccctggacgg tccagcaggt gctgtcctgg agtgcctggt gttgtcctcc 1080 ggaatgctgg tgccggaact cgctatccct gttgtctacc tgctgggggc actgaccatg 1140 ctgagtgaaa cgcagcacaa gctgctggcg gaggcgctgg agtcgcagac cctgttgggg 1200 ccgctcgagc tggtgggcag cctcttggag cagagtgccc cgtggcagga gcgcagcacc 1260 atgtccctgc cccccgggct cctggggaac agctggggcg aaggagcacc ggcctgggtc 1320 ttgctggacg agtgtggcct agagctgggg gaggacactc cccacgtgtg ctgggagccg 1380 caggcccagg gccgcatgtg tgcactctac gcctccctgg cactgctatc aggactgagc 1440 caggagcccc actag 1455 <210> 8 <211 > 484 <212> PRT <213> Homo sapiens <400> 8 Met G ly Ser Ala Phe Glu Arg Val Val Arg Arg Val Val Gln Glu Leu 1 5 10 15 Asp His Gly Gly Glu Phe Ile Pro Val Thr Ser Leu Gln Ser Ser Thr 20 25 30 Gly Phe Gln Pro Tyr Cys Leu Val Val Arg Lys Pro Ser Ser Ser Trp 35 40 45 Phe Trp Lys Pro Arg Tyr Lys Cys Val Asn Leu Ser Ile Lys Asp Ile 50 55 60 Leu Glu Pro Asp Ala Ala Glu Pro Asp Val Gln Arg Gly Arg Ser Phe 65 70 75 80 His Phe Tyr Asp Ala Met Asp Gly Gln Ile Gln Gly Ser Val Glu Leu 85 90 95 Ala Ala Pro Gly Gln Ala Lys Ile Ala Gly Gly Ala Ala Val Ser Asp 100 105 110 Ser Ser Ser Thr Ser Met Asn Val Tyr Ser Leu Ser Val Asp Pro Asn 115 120 125 Thr Trp Gln Thr Leu Leu His Glu Arg His Leu Arg Gln Pro Glu His 130 135 140 Lys Val Leu Gln Gln Leu Arg Ser Arg Gly Asp Asn Val Tyr Val Val 145 150 155 160 Thr Glu Val Leu Gln Thr Gln Lys Glu Val Glu Val Thr Arg Thr His 165 170 175 Lys Arg Glu Gly Ser Gly Arg Phe Ser Leu Pro Gly Ala Thr Cys Leu 180 185 190 Gln Gly Glu Gly Gln Gly His Leu Ser Gln Lys Lys Thr Val Thr Ile 195 200 205 Pr o Ser Gly Ser Thr Leu Ala Phe Arg Val Ala Gln Leu Val Ile Asp 210 215 220 Ser Asp Leu Asp Val Leu Leu Phe Pro Asp Lys Lys Gln Arg Thr Phe 225 230 235 240 Gln Pro Pro Ala Thr Gly His Lys Arg Ser Thr Ser Glu Gly Ala Trp 245 250 255 Pro Gln Leu Pro Ser Gly Leu Ser Met Met Arg Cys Leu His Asn Phe 260 265 270 Leu Thr Asp Gly Val Pro Ala Glu Gly Ala Phe Thr Glu Asp Phe Gln 275 280 285 Gly Leu Arg Ala Glu Val Glu Thr Ile Ser Lys Glu Leu Glu Leu Leu 290 295 300 Asp Arg Glu Leu Cys Gln Leu Leu Leu Leu Glu Gly Leu Glu Gly Val Leu 305 310 315 320 Arg Asp Gln Leu Ala Leu Arg Ala Leu Glu Glu Ala Leu Glu Gln Gly 325 330 335 Gln Ser Leu Gly Pro Val Glu Pro Leu Asp Gly Pro Ala Gly Ala Val 340 345 350 Leu Glu Cys Leu Val Leu Ser Ser Gly Met Leu Val Pro Glu Leu Ala 355 360 365 Ile Pro Val Val Tyr Leu Leu Gly Ala Leu Thr Met Leu Ser Glu Thr 370 375 380 Gln His Lys Leu Leu Ala Glu Ala Leu Glu Ser Gln Thr Leu Leu Gly 385 390 395 400 Pro Leu Glu Leu Val Gly Ser Leu Leu Glu Gln Ser Ala Pro Trp Gln 405 410 415 Glu Arg Ser Thr Met Ser Leu Pro Pro Gly Leu Leu Gly Asn Ser Trp 420 425 430 Gly Glu Gly Ala Pro Ala Trp Val Leu Leu Asp Glu Cys Gly Leu Glu 435 440 445 Leu Gly Glu Asp Thr Pro His Val Cys Trp Glu Pro Gln Ala Gln Gly 450 455 460 Arg Met Cys Ala Leu Tyr Ala Ser Leu Ala Leu Leu Ser Gly Leu Ser 465 470 475 480 Gln Glu Pro His <210> 9 <211> 1491 <212> DNA <213> Homo sapiens <400> 9 atgtttgcca aag caaccag gaattttctt agagaagttg atgctgatgg tgacctgatt 60 gcagtatcaa atctgaatga ctctgataag ttacagcttc taagtctggt gacaaaaaag 120 aagagattct ggtgctggca gagacccaag taccagtttt tatccctcac ccttggcgat 180 gtactcatag aagaccaatt tccgagtcca gtggtcgtgg agtcggactt tgtgaaatac 240 gagggcaagt ttgcaaacca cgtgagtgga accctggaga ctgcactggg gaaggtcaag 300 ctgaacctgg ggggcagcag ccgcgtagag agccagtctt catttggaac cctgaggaag 360 caggaggtgg atttgcagca gctcatcaga gactctgccg agagaacaat aaatctgaga 420 aaccctgtgc tccagcaggt gctggaagga aggaatgagg tcctgtgcgt tttgacacag 480 aagatcacga cgatgcagaa gtgtgtgatc tctgagcaca tgcaggtcga ggagaagtgt 540 ggtggcatcg tgggcatcca gaccaagacg gtgcaggtgt cagcgacgga ggatgggaat 600 gtcaccaagg actccaacgt ggtgctggag atcccagctg ccaccaccat tgcctacggt 660 gtcattgagt tatacgtgaa actggacggc cagttcgagt tctgccttct ccgagggaag 720 caaggtggct tcgagaacaa gaagagaatt gactctgtct acctggaccc cctggtcttt 780 cgagagtttg cattcataga catgccagat gctgcgcatg ggatatcttc ccaggatgga 840 ccattaagtg ttttaaagca agcgaccctg ct cctggaga ggaatttcca tccatttgcg 900 gagctgcctg agccacaaca gacagctttg agtgacatct tccaggcggt cctatttgat 960 gatgaactac tcatggtcct ggaaccagtg tgcgatgacc tggtcagcgg cctctcgccc 1020 acagtggcgg tgctggggga gctgaagccc cggcagcagc aggaccttgt ggccttcctg 1080 cagctggtgg ggtgcagctt acagggtggg tgtccgggcc ccgaggatgc aggcagcaag 1140 cagctgttta tgacagccta cttcttggtc agtgccctcg cagaaatgcc agatagcgca 1200 gcagctctgc tgggcacttg ctgcaaactc cagatcattc ccacactgtg ccacttgctt 1260 cgtgctctgt ctgatgatgg agtatctgat cttgaagacc caaccttgac tcccctgaaa 1320 gatacagaaa ggtttgggat tgtgcagcgc ttgtttgcct cagctgacat tagtctggag 1380 agactgaagt catctgtgaa agctgtcatt ctgaaggact ctaaagtctt cccactgctt 1440 ctttgtataa ccctgaatgg actctgtgct ttaggcagag aacattcata a 1491 <210> 10 <211> 496 <212> PRT <213> Homo sapiens <400> 10 Met Phe Ala Lys Ala Thr Arg Asn Phe Leu Arg Glu Val Asp Ala Asp 1 5 10 15 Gly Asp Leu Ile Ala Val Ser Asn Leu Asn Asp Ser Asp Lys Leu Gln 20 25 30 Leu Leu Ser Leu Val Thr Lys Lys Lys Arg Phe Trp Cys Trp Gln Arg 35 40 45 Pro Lys Tyr Gln Phe Leu Ser Leu Thr Leu Gly Asp Val Leu Ile Glu 50 55 60 Asp Gln Phe Pro Ser Pro Val Val Val Glu Ser Asp Phe Val Lys Tyr 65 70 75 80 Glu Gly Lys Phe Ala Asn His Val Ser Gly Thr Leu Glu Thr Ala Leu 85 90 95 Gly Lys Val Lys Leu Asn Leu Gly Gly Ser Ser Arg Val Glu Ser Gln 100 105 110 Ser Ser Phe Gly Thr Leu Arg Lys Gln Glu Val Asp Leu Gln Gln Leu 115 120 125 Ile Arg Asp Ser Ala Glu Arg Thr Ile Asn Leu Arg Asn Pro Val Leu 130 135 140 Gln Gln Val Leu Glu Gly Arg Asn Glu Val Leu Cys Val Leu Thr Gln 145 150 155 160 Lys Ile Thr Thr Met Gln Lys Cys Val Ile Ser Glu His Met Gln Val 165 170 175 Glu Glu Lys Cys Gly Gly Ile Val Gly Ile Gln Thr Lys Thr Val Gln 180 185 190 Val Ser Ala Thr Glu Asp Gly Asn Val Thr Lys Asp Ser Asn Val Val 195 200 205 Leu Glu Ile Pro Ala Ala Thr Thr Ile Ala Tyr Gly Val Ile Glu Leu 210 215 220 Tyr Val Lys Leu Asp Gly Gln Phe Glu Phe Cys Leu Leu Arg Gly Lys 225 230 235 240 Gln Gly Gly Phe Glu Asn Lys Lys Arg Ile Asp Ser Val Tyr Leu Asp 245 250 255 Pro Leu Val Phe Arg Glu Phe Ala Phe Ile Asp Met Pro Asp Ala Ala 260 265 270 His Gly Ile Ser Ser Gln Asp Gly Pro Leu Ser Val Leu Lys Gln Ala 275 280 285 Thr Leu Leu Leu Glu Arg Asn Phe His Pro Phe Ala Glu Leu Pro Glu 290 295 300 Pro Gln Gln Thr Ala Leu Ser Asp Ile Phe Gln Ala Val Leu Phe Asp 305 310 315 320 Asp Glu Leu Leu Met Val Leu Glu Pro Val Cys Asp Asp Leu Val Ser 325 330 335 Gly Leu Ser Pro Thr Val Ala Val Leu Gly Glu Leu Lys Pro Arg Gln 340 345 350 Gln Gln Asp Leu Val Ala Phe Leu Gln Leu Val Gly Cys Ser Leu Gln 355 360 365 Gly Gly Cys Pro Gly Pro Glu Asp Ala Gly Ser Lys Gln Leu Phe Met 370 375 380 Thr Ala Tyr Phe Leu Val Ser Ala Leu Ala Glu Met Pro Asp Ser Ala 385 390 395 400 Ala Ala Leu Leu Gly Thr Cys Cys Lys Leu Gln Ile Ile Pro Thr Leu 405 410 415 Cys His Leu Leu Arg Ala Leu Ser Asp Asp Gly Val Ser Asp Leu Glu 420 425 430 Asp Pro Thr Leu Thr Pro Leu Lys Asp Thr Glu Arg Phe Gly Ile Val 435 440 445 Gln Arg Leu Phe Ala Ser Ala Asp Ile Ser Leu Glu Arg Leu Lys Ser 450 455 460 Ser Val Lys Ala Val Ile Leu Lys Asp Ser Lys Val Phe Pro Leu Leu 465 470 475 480 Leu Cys Ile Thr Leu Asn Gly Leu Cys Ala Leu Gly Arg Glu His Ser 485 490 495 <210> 11 <211> 1059 <212> DNA <213> Homo sapiens <400> 11 atgtttgctg ctgctaccaa gagctttgtc aagcaagttg gagatggagg gagattagtt 60 cctgttccaa gcctcagtga agctgacaaa tatcaacctc taagtctggt ggtaaaaaag 120 aagcgatgct ttctgtttcc tagatataaa tttacttcaa caccttttac actgaaagat 180 attctcctag gagacagaga aatttcagct ggtatttcat cttatcaatt actgaattat 240 gaagatgaat cagatgtttc actctatgga aggcgaggta accatattgt aaatgacgtt 300 gggattaacg ttgctggatc agattccatt gcagtgaaag cttcatttgg tatagtaacc 360 aaacatgaag tggaagtatc aacattactc aaagaaatta ctacacgaaa aattaacttt 420 gaccacagct tgatacgtca tgtcaaggagc agcagaaagg cagtattgtg tgtggtcatg 480 gagagcatcc gaaccacacg acagtgctca ctgtctgtgc atgctggaat tcgaggggaa 540 gcaatgcggt tgatactttat ggatgagtttttactttat ggatgagtgaacag tcatactttat ggatgagttga ata cctggatggt 660 gcctttgacc tttgtgtcac ttcagtgtca aaaggaggat ttgaaaggga agaaacggca 720 acatttgcac tgctgtacag gttgagaaat atcctatttg aaagaaatag aagagtgatg 780 gatgtcattt ctcgttcaca gctttacttg gatgatcttt tttctgacta ctatgacaaa 840 cctctcagca tgactgatat ttcactcaaa gaagggaccc atatccgagt taacttactt 900 aatcacaaca ttcccaaagg gccttgcata ctctgtggaa tggggaactt caaaagggag 960 acagtttatg ggtgctttca gtgttctgtt gatggtcaga agtatgtgag acttcatgca 1020 gttccttgtt ttgatatttg gcacaagagg atgaaataa 1059 <210> 12 <211> 352 <212> PRT <213> Homo sapiens <400> 12 Met Phe Ala Ala Ala Thr Lys Ser Phe Val Lys Gln Val Gly Asp Gly 1 5 10 15 Gly Arg Leu Val Pro Val Pro Ser Leu Ser Glu Ala Asp Lys Tyr Gln 20 25 30 Pro Leu Ser Leu Val Val Lys Lys Lys Arg Cys Phe Leu Phe Pro Arg 35 40 45 Tyr Lys Phe Thr Ser Thr Pro Phe Thr Leu Lys Asp Ile Leu Leu Gly 50 55 60 Asp Arg Glu Ile Ser Ala Gly Ile Ser Ser Tyr Gln Leu Leu Asn Tyr 65 70 75 80 Glu Asp Glu Ser Asp Val Ser Leu Tyr Gly Arg Arg Gly Asn His Ile 85 90 95 Val Asn Asp Val Gly Ile Asn Val Ala Gly Ser Asp Ser Ile Ala Val 100 105 110 Lys Ala Ser Phe Gly Ile Val Thr Lys His Glu Val Glu Val Ser Thr 115 120 125 Leu Leu Lys Glu Ile Thr Thr Arg Lys Ile Asn Phe Asp His Ser Leu 130 135 140 Ile Arg Gln Ser Arg Ser Ser Arg Lys Ala Val Leu Cys Val Val Met 145 150 155 160 Glu Ser Ile Arg Thr Thr Arg Gln Cys Ser Leu Ser Val His Ala Gly 165 170 175 Ile Arg Gly Glu Ala Met Arg Phe His Phe Met Asp Glu Gln Asn Pro 180 185 190 Lys Gly Arg Asp Lys Ala Ile Val Phe Pro Ala His Thr Thr Ile Ala 195 200 205 Phe Ser Val Phe Glu Leu Phe Ile Tyr Leu Asp Gly Ala Phe Asp Leu 210 215 220 Cys Val Thr Ser Val Ser Lys Gly Gly Phe Glu Arg Glu Glu Thr Ala 225 230 235 240 Thr Phe Ala Leu Leu Tyr Arg Leu Arg Asn Ile Leu Phe Glu Arg Asn 245 250 255 Arg Arg Val Met Asp Val Ile Ser Arg Ser Gln Leu Tyr Leu Asp Asp 260 265 270 Leu Phe Ser Asp Tyr Tyr Asp Lys Pro Leu Ser Met Thr Asp Ile Ser 275 280 285 Leu Lys Glu Gly Thr His Ile Arg Val Asn Leu Leu Asn His Asn Ile 290 295 300 Pro Lys Gly Pro Cys Ile Leu Cys Gly Met Gly Asn Phe Lys Arg Glu 305 310 315 320 Thr Val Tyr Gly Cys Phe Gln Cys Ser Val Asp Gly Gln Lys Tyr Val 325 330 335Arg Leu His Ala Val Pro Cys Phe Asp Ile Trp His Lys Arg Met Lys 340 345 350

Claims (16)

GSDME (DFNA5); GSDMD; and
GSDMA and one or more selected from the group consisting of GSDMC; gas dermin group (Gasdermin family) cells for promoting the production of exosomes cultured by regulating the expression of proteins containing.
The method according to claim 1,
The gas dermin group (Gasdermin family) protein,
Cells for promoting exosome production, characterized in that present in the membrane of the exosomes.
The method according to claim 1,
The cells are
Stem cells, immune cells, somatic cells, cell lines or cells for promoting exosome production, characterized in that obtained by treating apoptosis-inducing substances in tumor cells.
4. The method according to claim 3,
The stem cells are
Mesenchymal stem cells (mesoderm stem cells), pluripotent stem cells (pluripotent stem cells), pluripotent stem cells (multipotent stem cells), or unipotent stem cells (unipotent stem cells) characterized in that the exosome production promoting cells .
4. The method according to claim 3,
The immune cells are
dendritic cells, natural killer cells, T cells, B cells, regulatory T cells, Treg cells, natural killer T cells cell), innate lymphoid cells, macrophages, granulocytes, chimeric antigen receptor-expressing T cells (CAR-T: Chimeric antigen receptor-T cells), lymphokine-activated killer cells ( LAK: Lymphokine-activated killer Cell) and cytokine-induced killer cells (CIK: Cytokine Induced Killer Cell) cells for promoting exosome production, characterized in that selected from the group consisting of.
4. The method according to claim 3,
The somatic cells are
Fibroblast, chondrocyte, synovial cell, keratinocyte, adipocyte, osteoblast, osteoclast and peripheral blood mononuclear cells Blood mononuclear cell) cells for promoting exosome production, characterized in that selected from the group consisting of.
4. The method according to claim 3,
The cell line,
CHO cells, NS0 cells, Sp2/0 cells, BHK cells, C127 cells, HEK293 cells, HEK293T cells, HEK-293 STF cells, 293T/17 cells, 293T/17 SF cells, or HEK-293.2sus cells, HT-1080 Cells, PER.C6 cells, NuLi-1 cells, ARPE-19 cells, VK2/E6E7 cells, Ect1/E6E7 cells, RWPE-2 cells, WPE-stem cells, End1/E6E7 cells, WPMY-1 cells, NL20 cells, Cells for promoting exosome production, characterized in that selected from the group consisting of NL20-TA cells, WT 9-7 cells, WPE1-NB26 cells, WPE-int cells, RWPE2-W99 cells, and BEAS-2B cells.
4. The method according to claim 3,
The tumor cells are
Human ovarian cancer cell lines (SKOV3, OVCAR3), human breast cancer cell lines (MCF-7, T47D, BT-474), human hepatocarcinoma cell lines (Hep3B, HepG2), human glioblastoma cell lines (U87MG, U251), human colorectal cancer cell lines (SW480, HT-29, HCT116, Caco-2), human lung cancer cell line (A549, NCIH358, NCI-H460), human prostate cancer cell line (22RV1), human cervical cancer cell line (HeLa), human melanoma cell line (A375) , And a cell line for promoting exosome production, characterized in that selected from the group consisting of a human gastric cancer cell line (NCI-N87).
A composition for promoting exosome production comprising the cell of any one of claims 1 to 8.
10. The method of claim 9,
The cells are
A composition for promoting exosome production, characterized in that increasing the number of exosomes, exosome-derived protein, or the content of exosome-derived RNA.
An exosome obtained from the cell of any one of claims 1 to 8.
12. The method of claim 11,
The exosome is
GSDME (DFNA5); GSDMD; and
GSDMA and at least one selected from the group consisting of GSDMC; gas dermin group (Gasdermin family), comprising the exosome, characterized in that obtained from cells cultured by overexpressing the protein.
13. The method of claim 12,
The exosomes are exosomes, characterized in that the apoptosis-derived exosomes (apoptotic exosome).
14. The method of claim 13,
The exosome has a diameter of 100 nm to 250 nm.
Stem cells, immune cells, somatic cells, cell lines and any one cell selected from the group consisting of tumor cells, gas dermin group (Gasdermin family) the step of culturing after transfecting a vector recombinant protein gene; including,
The gas dermin group (Gasdermin family) protein,
GSDME (DFNA5); GSDMD; and
At least one selected from the group consisting of GSDMA and GSDMC;
Exosome production method, characterized in that increasing the production of exosomes.
16. The method of claim 15,
separating the exosomes from the culture medium after inducing apoptosis in the cells; Exosome production method further comprising a.

Images