RU2644663C2 - Genetic structure rbct70 for expression of the main human stress protein in milk of transgenic animals - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, specifically to the recombinant production of human heat shock protein 70 (HSP70), and can be used to produce HSP70 in milk of transgenic animals. Based on expression vector pBCl1, an expression plasmid pHSP70 with a size of 16912 bp is obtained, with the map shown in Fig. 1, which contains the human HSP70 gene and encodes the lactoferrinsignal sequence.

EFFECT: invention makes it possible to obtain a high titer of human HSP70 having chaperone properties typical for native human HSP70 in milk of transgenic animals.

1 cl, 6 dwg

Description

Technical field

The invention relates to biotechnology, molecular biopharmacology and can be used to obtain biologically active heat shock protein 70 (HSP70) using genetically modified animals as bioreactors. Heat shock proteins 70 play a crucial role in the development of a mammalian organism under normal conditions and under various stressful effects, and in the future can be used as a therapeutic agent for the treatment of certain forms of human neurodegenerative diseases associated with improper protein synthesis and folding (“proteinopathy”) , as well as with sepsis (1, 2). Therefore, the production of eukaryotic HSP70 in quantities sufficient for further use in therapy is an important task.

Heat shock proteins play an important role in ensuring homeostasis of the body at all stages of its development, especially in the case of exposure to stress, toxins, radiation, sublethal temperature, acidosis, hypoxia or hyperoxia, energy depletion of the cell, as well as aging and microbial infections.

State of the art

At present, the basic functions of intracellular stress proteins, which are usually called heat shock proteins (HSPs), associated with the participation of these molecules in the processes of synthesis, folding, transport, repair of intracellular proteins (chaperone functions) and their important role in the cell protection system, have been studied in sufficient detail. from damaging environmental influences (protective functions). A particularly important role in normal cell homeostasis under normal and various harmful effects is played by the ancient and very conservative family of heat shock proteins with a molecular weight of 70 kilodaltons (HSP70). Currently, more than 10 representatives of HSP70 eukaryotes are known. HSP70 bacterial orthologs have also been described (3). The structure and functions of HSP70 are currently well understood. In this family of proteins, the amino-terminal part of the molecule contains a conserved ATPase domain (44 kDa), and the substrate-binding domain ( ^~ 25 kDa) necessary for recognition and binding of HSP70 to polypeptides is localized in the carboxyterminal part of the molecule. These domains are necessary for the efficient binding and transport of a wide variety of cellular proteins under normal conditions and with various pathologies.

The main functions of the HSP70 family proteins are to increase cellular thermotolerance to a whole range of damaging factors, including heat shock, hypoxia, etc. HSP70 is involved in renaturation and maintaining the integrity of the structure of cellular proteins and has a pronounced antiapoptotic effect. In addition, it participates in the degradation of proteins with impaired structure, prevents the formation of protein aggregates inside the cell, and also plays an important role in the processes of association-dissociation of proteins, as well as their translocation through the membranes of intracellular compartments and organelles (4, 5).

The most important functions of HSP70 are the ability of these proteins to prevent the formation of aggregates of damaged and / or denatured proteins, as well as the ability to act as carriers of immunogenic peptides. In particular, surface localization of HSP70 was detected in a number of tumor cell lines, in virus-infected lymphocytes, in activated macrophages and T-lymphocytes, and the existence of free HSP70 in the intercellular space was also detected (6). Based on the immunoadjuvant properties of HSP70, studies are underway to develop vaccines for the immunotherapy of malignant tumors (7).

A number of researchers have developed producers for the production of recombinant analogues of heat shock proteins HSP70 US Pat. Nos. 6,524,825 (publ. February 25, 2003); 5,919,620 (published on July 6, 1999).

Known genetic design and method for producing HSP70 in various organs, including the mammary glands (patent US 2005260746 A1). This patent differs from the claimed one in that a pig is used as a transgenic animal, while structural elements of the structure include HSP70 placed under the control of the cytomegalovirus enhancer and promoter. The resulting chimeric gene also contains the SV40 polyadenylation signal. Transgenic pigs containing such a construct express HSP70 in all organs, and not selectively in milk, which ensures the construct we have obtained.

In our work, we used one of the effective eukaryotic vectors pBC1, designed to create expression constructs for subsequent production of proteins of interest in the milk of transgenic animals. This vector and details of working with it are described in the instructions for the whale (“pBC1 Milk Expression Vector Kit for the Expression of Recombinant Proteins in the Milk of Transgenic Mice”.

The design used in this patent, in addition to the pBC1 vector, contains the signal peptide of human lactoferrin for the secretion of the protein of interest (HSP70) in the milk of transgenic animals.

An important advantage of the resulting design is that we were able to clone the lactoferrin “butt” signal sequence, which allows us to obtain a high protein titer (HSP70) without extra amino acids.

In the patent for the invention of the Russian Federation No. 2294210 (publ. May 13, 2005), we proposed the use of recombinant human HSP70 as protection against a number of dangerous damaging factors.

Currently, researchers are of great interest to the functions of HSP70 as intercellular signaling molecules that can cause the production of cytokines by cells of the immune system through receptor-mediated interactions. Other studies have shown that immunization with HSP70 preparations isolated from tumor and virus-infected cells causes a specific antitumor and antiviral cellular immune response. The specificity of this response is due to the ability of HSP70 to bind various proteins and peptides (including cancer and viral peptides) and deliver them to antigen-presenting cells. The possibility of the formation of HSP70 complexes with protein antigens in vitro allowed the development of antitumor and antiviral vaccines on their basis.

In recent decades, in cellular and animal models (mice, rats), it has been shown that recombinant HSP70 exhibits reliable protective properties in sepsis caused by bacterial toxins, as well as in various types of neurodegenerative diseases. These works were carried out on rodent models (6, 7).

Natural protein preparations of HSP70 mammals were isolated from tumor and normal muscle tissue. At the same time, tissues were accumulated and homogenized, the target protein was extracted, and the preparation was fractionated using several chromatographic steps, with purification on ATP-Sepharose columns. Obtaining the HSP70 protein preparation from human organs and tissues is extremely ineffective and dangerous in terms of the risk of contamination, including viruses, as well as bacterial toxins.

Genetic engineering methods currently allow producing analytical quantities of HSP70 in bacteria, which are necessary for studying various protein functions and working with model animals. However, HSP70 drugs produced in bacteria do not undergo post-translational modifications that occur in eukaryotic cells and may contain bacterial toxins.

Note that the target proteins, including HSP70, in principle, can be produced in various eukaryotic and prokaryotic systems.

It is known that in the world there are three main strategies for producing recombinant human proteins (through expression of a) in bacterial systems, b) in animal cell culture, c) using transgenic animals as a bioreactor. Each of these approaches has its advantages and disadvantages, but in terms of economic efficiency, the production of proteins based on transgenic animals is significantly superior to other methods.

When proteins are produced in transgenic animals, for example, in milk, the gene of this protein is cloned into the construct under the promoter of casein, lactoferrin or other “milk” protein genes. Thus, this construct is expressed only in the mammary gland of the animal. In addition, the target protein carries a fusion peptide at its C-terminus, which ensures its release into milk. Thus, transgenic animals synthesize the target protein into milk, from which it can then be purified. Although the proteins synthesized into milk are usually glycosylated, it was previously shown that this does not affect the properties of normally secreted proteins, such as lysozyme or lactoferrin.

The inventive objective of this patent application is to develop a method for producing biologically active human protein HSP70 in preparative quantities for use as a potential drug.

The technical result of the present invention is the preparation of biologically active, recombinant human HSP70 expressed in the milk of transgenic mice.

The conclusion about the biological activity of the HSP70 preparation obtained from milk was made on the basis of the ShAP-ELISA test, which allows one to adequately evaluate the chaperone properties of the obtained HSP70 preparation, as well as on the basis of the classical CTL (cytotoxic lymphocytes) test.

The implementation of the invention

Obtaining a construct for producing a functionally active natural variant of the HSP70 protein during expression of transgenic mice in the mammary gland.

Cloning of the HSP70 gene into an animal plasmid vector for injection.

HSP70 plasmid was created on the basis of the pBC1 vector (Invitrogen) and the genomic sequence of the human HSP70 gene (Fig. 1). Standard conditions for in vitro growth, cultivation conditions - line E. coli XL-2, medium 2xYT, ampicillin 50 μg / ml, 37 ° C, 18-20 hours.

Molecular biological properties of the recombinant plasmid: construction size: 16912 bp, vector part size: 5877 bp, marker: resistance to ampicillin.

Structural elements: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the genome of goats, the 5'-untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of the lactoferrin signal peptide and the coding region of the human HSP70 gene, ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; cloning site: NotI-SalI; encoded protein size: 659 a.o. The stability of the recombinant plasmid. Storage for 2 years (observation period) in the form of plasmid DNA at a temperature of minus 20 ° C.

An aliquot of plasmid DNA is removed from the refrigerator (storage temperature minus 20.0 ± 2.0 ° C) and the E. coli culture is transformed by electroporation. The transformed culture is cultured on 2xYT medium with the addition of 50 μg / ml ampicillin. The cultivation duration is from 18 to 20 hours at a temperature of + 37.0 ± 0.5 ° C.

Plasmid DNA is isolated by alkaline lysis.

Centrifuged at 4 ° C CF for 10-15 ', the medium is drained; then centrifuged 4krpm for 1 ', remove the remaining liquid. Resuspend in 10 (5) ml of “I” solution (Glucose 50mM, Tris-HCl, pH 8.0 25mM, EDTA 10mM); + 1 ml of freshly prepared lysozyme solution (10mg / ml in the "I" solution). Then they are kept at normal temperature for 15 ', add 20 ml of “II” solution (NaOH 0.2N, SDS 1%), sharply poured out, mixed at 0 ° С for 5'; add 10 ml of cold 10M AcONH ₄ (add 5 ml with a pipette dropwise), mix. Incubated at 0 ° C for 5 '.

Centrifuge 5krpm, at 4 ° C for 10 '; the supernatant is removed, divided into 2 tubes, 12.5 ml of isopropanol are added to each. Do this on a scale so that the tubes have equal weight; incubated at room temperature for 10 ', then centrifuged at 5krpm at 4 ° C for 10', discard the supernatant. Centrifuged at room temperature for 3 ', the remaining liquid is sucked off.

Suspend the pellet in 800μl 2 M AcONH ₄ , combine in one 2 ml tube; incubated at room temperature for 5 '; and centrifuged at room temperature for 10 '. The supernatant is transferred to a test tube with 800 μl of isopropanol; incubated at room temperature for 5 '; centrifuged at room temperature for 5 '; rinse with 70% EtOH; dissolved in 0.2-1 ml H ₂ O.

Isolated and purified plasmid DNA preparations are evaluated electrophoretically on a 0.8% agarose gel. Concentration is measured on a spectrophotometer and fluorometer. Restriction mapping is performed separately for EcoRI, HindIII, NotI-SalI. Restriction fragments are separated electrophoretically on a 0.8% agarose gel and compared with the reference cards shown in figures 2, 3, 4.

The resulting preparation is a purified DNA preparation of a recombinant plasmid for the expression of natural HSP70, which can be used to prepare a fragment for microinjection.

Transgenic Mouse Analysis

The creation of transgenic animals, the generation of offspring and the analysis of the presence of a transgene was carried out according to the methods described below (Section "Creating transgenic animals").

Using real-time PCR, the presence of transgenes in the mammary gland of transgenic mice was evaluated (Fig. 2). Thus, it was shown that transgenic mice express RNA in the mammary gland that encodes a natural variant of the HSP70 protein.

Analysis of the properties of natural HSP70 obtained in the mammary gland of transgenic mice.

Next, the approximate content of HSP70 (g / l) in the milk of transgenic mice was measured.). Milk is diluted 5 times in buffer comprising 20 mM NaH ₂ PO _4/300 mM NaCl pH 8.0, and then separated by disc electrophoresis in 10% polyacrylamide gel. After separation, the proteins were transferred onto a Hybond ECL membrane and treated with monoclonal antibodies to human HSP70. The protein was recognized by antibodies, but its electrophoretic mobility was higher than that of the control sample, which indicates its post-translational modification (Fig. 3).

Creating transgenic animals

Primary transgenes were obtained by microinjection of a DNA solution in TE buffer (DNA concentration of 5 ng / μl) into the male pronucleus of fertilized egg cells of hybrid mice (CBAxC57BL / 6) F1, followed by transplantation of surviving microinjected zygotes to pseudopregnant recipients.

Eggs were obtained after induction of superovulation. For this, immature females (CBAxC57BL / 6) F1 weighing 12-13 g were injected intraperitoneally 8 units. HFA (gonadotropin of serum of mares, company MOSAGROGEN), and then, after 46 hours, 8 units were intraperitoneally administered. HCG (human chorionic gonadotropin, Moscow endocrine plant). After this treatment, the females were planted with the male producers of the hybrid line (CBAxC57BL / 6) F1. The fact of mating was ascertained the next morning by the presence of a copulative plug. The scheme for obtaining superovulation: 13.00 h - HFA, after 46 h at 11.00 h - HCG. At 17.00 o'clock on the same day - replanting to male producers. The selection of donors was carried out the next day at 9.30 a.m. The Vivarium was lit from 7 a.m. to 7 p.m.

Females with copulative plugs were killed by cervical dislocation and oviducts were removed. Eggs were washed from the oviducts with HEPES_KSOM medium supplemented with hyaluronidase (Sigma) under a Zeiss Stemi DV4 binocular at a magnification of 32x. For washing, we used glass capillaries with an inner diameter of about 100 μm, made on a Narishige PC-10 puller and a Narishige MF-900 micro forge. The eggs were cultured for 2 h (37 ° C, 5% CO2) in a drop of HEPES-KSOM or KSOM medium under mineral oil, then placed in a microinjection chamber. Microinjections were performed in HEPES-KSOM medium under a Zeiss Axiovert 200M microscope at 400x-600x magnification using Narishige micromanipulators. For the manufacture of microinjection needles, the Sutter instrument Co P-97 puller was used. After the end of microinjections, the surviving cells were transferred into a drop of KSOM or HEPES-KSOM medium under mineral oil and cultured for 1 h to identify viable cells. Recipients were prepared as follows. Mature females (CBAxC57BL / 6) F1 weighing at least 24 g were planted with vasectomized males of the same line. Pseudopregnant recipients were selected the next morning by the presence of copulative plugs.

Zygotes that survived after microinjection were transplanted into the left oviduct of a pseudopregnant female. Depending on the number of cells surviving after microinjection, 10 to 20 zygotes were transplanted to one pseudopregnant female. To immobilize animals during the operation, avertin was used, which is a 2.5% solution in water of a solution of 1 g of 2.2.2 tribromoethanol in 1 ml of 2_methyl_2_butanol. Avertin was administered intraperitoneally at the rate of 15 μl per 1 g of animal weight.

The work was carried out on the basis of the Collective Use Center of the IBG RAS.

Offspring

In the absence of natural birth, on the 21st day after transplantation of microinjected ovules, the recipient was killed by cervical dislocation and a cesarean section was performed, after which the surviving cubs were placed on a pre-prepared nurse. 14-21 days after birth, a piece of tail was cut off in mice born after microinjections, DNA was extracted from them, and the presence of a transgene was analyzed by PCR.

Analysis of the presence of a transgene in offspring

DNA was isolated according to a standard protocol (Molecular Cloning, USA). DNA fragments were amplified using Taq polymerase (GIBCO / BRL, USA) in a buffer (with 2.5 mM MgCl2) supplied by the manufacturer in the presence of 0.2 mM dNTP and 0.3 μM of each primer.

For amplification of the gene used the following primers:

1 - 5'cgcaactccaccatccccaccaag

2 - 5'gccctctcgccctcgtacacctg

Obtaining milk containing the HSP70 preparation from transgenic mice.

1. Milk samples from transgenic mice were obtained 2-20 days after birth no more than 2 times per lactation. Milk is taken from an anesthetized intraperitoneal injection of Avertin solution (0.25%) of the mouse at a rate of 10 μl / g, to increase the milk yield of the mouse, oxytocin (10 units / ml) is administered at a rate of 10 μl / g.

Milk is taken using a milking machine, which is a peristaltic pump, creating a discharged atmosphere in a test tube for samples; it connects to a glass capillary, the second end of which is alternately brought up to the nipples of the mouse, and, due to the negative pressure in it, the milk is sucked out of the ducts of the mammary gland and enters the test tube for samples (Figure 4).

Milk was diluted with Tris-HCl pH8.0 / 300mM NaCl high-salt buffer in a ratio of 1:10 (10 parts of buffer per 1 part of milk), after which it was centrifuged for at least 8000 g and accelerated and the fat fraction was discarded.

Analysis of the biological activity of milk containing HSP70

I. The SHAP-ELISA test is a system by which the ability of the active part of the chaperone molecules, in this case HSP70, to recognize and bind a substrate, a denatured protein, is determined. In this modification of the test, an irreversibly denatured protein, carboxymethylated lactalbumin, is applied to the surface of a 96-well plate for immunological reactions. After removal of nonspecific binding, a solution of HSP70 in various concentrations is introduced into the wells, and then RSIII polyclonal antibodies obtained at the ZMK laboratory of the Russian Academy of Science. The test is based on the work of the Wawrzynow-Liberek 1991 and Cheetham 1994 groups and is described in detail in Lazarev et al. 2011 (8).

Obviously, the higher the signal, the greater part of the chaperone molecules is able to bind the substrate. In combination with an accurate method for determining the concentration of HSP70 (r-Hu-Hsp70, HSPA1A, isolated from E. coli biomass) taken as a reference, the relative chaperone activity can be calculated (Figure 5).

II. CTL (CTL) is a classic cytotoxic lymphocyte test in which the latter must recognize and kill tumor cells. The test is one of the key in immunology in determining the activity of cells of innate and acquired immunity. In our case, unactivated splenocytes isolated from C3H mice in accordance with the standard protocol serve as effectors; according to flow cytometry, 2–7% of the resulting splenocyte population are natural killers. The target for them are human erythroblastoma cells K-562, treated for 18 hours with HSP70 preparations (50 μg / ml). The test is based on the fact that upon incubation of cancer target cells with functionally active HSP70 their sensitivity to natural killers increases. The method is described in detail in (9). After joint incubation in the ratio of effectors (killers): tumor cells 50: 1 and 100: 1, the cells are placed in the wells of a 96-well plate, where after the introduction of the necessary components, the activity of LDH released into the environment from dying cells using the CytoTox test system is determined 96 (Promega). Figure 6

Brief Description of Drawings

Fig. 1. Map of the construct (rBSH70) containing the native HSP70 gene (Hsp70) for injection into animals. Structural elements of the construct: goat beta-casein promoter, lactoferrin signal sequence, tandem repeat of insulators from beta-globin chicken gene, TATA box, ampicillin resistance gene, replication origin from plasmid pBR322, cDNA copy of human HSP70 gene (obtained from Prof. HSP70) Morimoto GenBank Accession No M11717, amino acid sequence of the corresponding SwissProt P08107 protein (SEQ ID NO:

Fig. 2. Analysis of the presence of a transgene in offspring. PCR analysis of transgenic mice carrying a construct with a natural variant of the HSP70 protein. K - negative control (genomic DNA of wild-type mouse), K + positive control (human genomic DNA), Tr - transgenic mice diagnosed during this experiment. The fluorescence level is plotted on the abscissa, and the cell cycle number on the ordinate. DNA was isolated according to a standard protocol (Molecular Cloning, USA). DNA fragments were amplified using Taq polymerase (GIBCO / BRL, USA) in a buffer (with 2.5 mM MgCl2) supplied by the manufacturer in the presence of 0.2 mM dNTP and 0.3 μM of each primer.

Fig. 3. A. Result of Western hybridization with antibodies to human HSP70. 1 - human recombinant HSP70; 2 - milk from transgenic animals containing HSP70; 3 - bovine serum albumin (negative control). B. Western hybridization with antibodies recognizing HSP70.

Figure 4. Installation diagram for milking mice. A - Silicone hose; B - Test tube for samples; C - An external test tube within which a discharged atmosphere is maintained; D - Milk enters the sample tube through the needle-silicone-capillary system (the capillary contacts the nipple of the mammary gland of the mouse); E - Peristaltic pump; F - Appearance of the installation.

Fig. 5. Comparative chaperone activity measured in the test ShAP-ELISA. milk preparations containing HSP70. Wt-wild type (HSP70 expressed in E. coli bacteria; milk-milk of transgenic mice expressing HSP70.

Fig. 6. The effect of milk preparations containing HSP70 from the IMB RAS on the sensitivity of K-562 cells to the action of cytotoxic lymphocytes. Wt-wild type; milk-milk of transgenic mice.

Information sources

1. Kustanova GA, Murashev AN, Karpov VL, Margulis BA, Guzhova IV et al., (2006) Exogenous heat shock protein 70 mediates sepsis manifestations and decreases the mortality rate in rats. Cell Stress Chaperones 11: 276-286.

2. Bobkova NV, Garbuz DG, Nesterova I, Medvinskaya N, Samokhin A et al., (2014) Therapeutic effect of exogenous hsp70 in mouse models of Alzheimer's disease. J Alzheimers Dis 38 (2): 425-435.

DJ.Nat Commun. 2015 Feb 17;6:6307. doi: 10.1038/ncomms7307.3.Action of the Hsp70 chaperone system observed with single proteins.unes JM, Mayer-Hartl M, Hartl FU,

DJ.Nat Commun. 2015 Feb 17; 6: 6307. doi: 10.1038 / ncomms7307.

4. Kim YE, Hipp MS, Bracher A, Hayer-Hartl M, Hartl FU (2013) Molecular chaperone functions in protein folding and proteostasis. Annu Rev Biochem 82: 323-355.

5. Guzhova I, Margulis B (2006) Hsp70 chaperone as a survival factor in cell pathology. IntRevCytol 254: 101-149.

6. Ekimova IV, Nitsinskaya LE, Romanova IV, Pastukhov YF, Margulis BA et al., (2010) Exogenous protein Hsp70 / Hsc70 can penetrate into brain structures and attenuate the severity of chemically-induced seizures. J Neurochem 115 (4): 1035-1044.

7. Hansen JE ¹ , Sohn W. Kim C, et al. Antibody-mediated Hsp70 protein therapy. Brain Res. 2006 May 9; 1088 (1): 187-96.

8. Lazarev VF, Onokhin KV, Antimonova OI, Polonik SG, Guzhova IV, Margulis BA. Kinetics of chaperone activity of proteins Hsp70 and Hdj1 in human leukemia u-937 cells after preconditioning with thermal shock or compound u-133. Biochemistrv (Mosc). 2011 May; 76 (5): 590-5.

9. Shevtsov MA, Pozdnyakov AV, Mikhrina AL, et al., Effective immunotherapy of rat glioblastoma with prolonged intratumoral delivery of exogenous heat shock protein Hsp70. Int J Cancer. 2014 Nov 1; 135 (9): 2118-28.

Claims (1)

The rBSTS70 genetic construct, which is an expression plasmid 16912 bp in size, with the map shown in Fig. 1, obtained on the basis of the pBC1 expression vector, containing the human heat shock protein gene 70 (HSP70) and encoding the lactoferrin signal sequence for the production of the biologically active recombinant human heat shock protein 70 (HSP70) in the milk of transgenic animals.

Images