RU2491343C1 - Genetic constructs ltf3, ltf5, ltf7, ltf10, ltf11 for producing recombinant human lactoferrin (versions) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to production of genetically engineered genetic constructs for expression of recombinant human lactoferrin protein and can be used to create transgenic animals carrying human lactoferrin gene and to produce in production quantities of isoforms of recombinant human lactoferrin.

EFFECT: invention enables to obtain a high level of resulting target protein which properties do not differ from the properties of native lactoferrin obtained from human milk.

5 cl, 10 dwg, 1 tbl, 4 ex

Description

Technical field

The invention relates to the field of biotechnology, molecular genetics, molecular biology, genetic engineering, in particular to the creation of five genetic engineering genetic constructs for the expression of a recombinant human lactoferrin protein. The proposed invention can be used to create transgenic animals carrying the gene of isoforms of human lactoferrin, and to obtain commercially recombinant human lactoferrin protein. The use of these constructs for producing transgenic animals allows one to obtain a high level of production of the target protein, whose properties do not differ from those of native lactoferrin obtained from human milk.

State of the art

Known genetic design and method for producing lactoferrin (US patent No. 7,087,808). The present invention describes a method for the expression and subsequent secretion of recombinant proteins, coagulation factor IX and lactoferrin, in transgenic mammalian milk. This invention differs from the claimed one in that a pig is used as a transgenic animal, while the structural elements are represented by transgenes encoding the tandem of blood coagulation factor IX and pig lactoferrin, where both transgenes are controlled by a specific promoter, namely, bovine alpha-lactalbumin.

A known method for the production of recombinant lactoferrin and its peptides (in particular, its iron-binding peptide) in transgenic animals (US Patent No. 6,635,447). The genetic design of this invention differs from the claimed invention and is characterized by the following structural elements: the promoter is selected from the group consisting of alcohol dehydrogenase, argB, a-amylase, glucoamylase, benA; the termination sequence is selected from the group: a-amylase, glucoamylase, alcohol dehydrogenase, benA; the linker sequence is selected from the group of a-amylase, glucoamylase and lactoferrin. The expression level of the target protein in all inventions reached 10 mg / l, which is 5% of the total protein of the cell. A similar approach to the production of recombinant lactoferrin, a similar yield of the target protein using genetic constructs in transgenic animals, is demonstrated in US patents No. 6,228,614, No. 6,100,054, No. 5,849,881, No. 5,766,939, No. 5,571,691.

Thus, the genetic constructs known from the prior art, designed to produce recombinant human lactoferrin in the milk of transgenic mammals, exhibit different structural elements and a relatively low level of lactoferrin production. Genetic constructs consisting of a tandem repeat of insulators from the beta-globin gene of chickens, a beta-casein promoter from the goat genome, a 5'-untranslated region containing the first two exons of the beta-casein gene, a coding region containing variants of the lactoferrin genomic sequence, 3'- beta-casein gene genomic fragment, ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; cloning site: NotI-SalI, first proposed by the authors.

The statement of the problem and the disclosure of the invention

The objective of the invention is the creation of recombinant plasmids designed for high production of human lactoferrin protein. Recombinant plasmids have biological characteristics that allow the use of this construct for highly efficient production of human lactoferrin in the milk of transgenic goats. The proposed invention allows to achieve the level of the target protein up to 16 g / L.

One of the effective eukaryotic vectors is the plasmid pBC1, designed to create expression constructs for subsequent production of proteins of interest in the milk of transgenic animals. The design can also be used to create transgenic mice and other mammals, such as cows. To achieve effective production of proteins of interest in the milk of transgenic animals, regulatory elements such as the goat beta-casein gene promoter, chicken genome insulators, and effective transcription terminators are used.

The essence of the invention is that as a result of sequential cloning of a genomic copy of the human lactoferrin gene into the pBC1 vector, recombinant plasmids are obtained to create transgenic animals and produce human lactoferrin protein in their milk. Five recombinant plasmids have been proposed, LTF3, LTF5, LTF7, LTF10, LTF11, which provide a high level of production of the target protein.

In the framework of this invention, the term "transferrins" means a family of iron-transporting proteins, which includes transferrin, ovotransferrin, lactoferrin. All of these proteins have structural similarities.

In the framework of this invention, the term "genetic construct" means a plasmid, phage, any other version of an artificially created vector that provides the production of a recombinant protein of lactoferrin.

As used herein, a “promoter" means a regulatory nucleotide sequence of DNA that controls the transcription of recombinant human lactoferrin.

For the purposes of this invention, “lactoferrin isoform” means any of two functionally similar lactoferrin proteins having the same functions but not identical sequences. The isoform consisting of 711 amino acids has a repeat of 4 arginines, the isoform consisting of 710 amino acids has a repeat of 3 arginines. Isoform 711 is characteristic of the inhabitants of Russia, 710 - for the American continent.

The basis of the invention

Transgenic animals are a convenient source of human protein production. At present, many models of transgenic animals have been created that make it possible to obtain proteins necessary for humans, such as growth hormone, protein C, a1-antitrypsin, serum albumin, and urokinase (Kim et al., 1999). The expression of recombinant proteins in animal milk is controlled by promoters of a number of “milk” proteins, including as 1-casein, b-casein, b-lactoglobulin, WAP, a-lactalbumin, while promoters of genes such as goat b-casein, b- sheep lactoglobulin and as cow cow 1-casein are most effective for heterologous expression of target proteins (Maga et al., 1995; Hatano et al., 1998; Ninomiya et al., 1994; Wei et al., 1995; Carver et al., 1993; Barash et al., 1994; Meade et al., 1990).

Human lactoferrin is one of the most “attractive” objects, in relation to which attempts are being made to obtain large quantities using transgenic animals. Lactoferrin belongs to transferrins - a special protein family that carries out the transport of iron in the body. Due to this property, lactoferrin has the ability to chelate iron in microorganisms, which is the basis of its bactericidal effect (Artym, 2006). In addition to the antibacterial effect, lactoferrin has many other important biological functions - immunostimulating, regulation of myelopoiesis, antioxidant, anti-inflammatory (Actor et al., 2009; Amini et al., 2011; Ashby et al., 2011; Kruzel et al., 2007) . Such a diverse spectrum of its activities dictates the need for large quantities of lactoferrin, including by its secretion into milk of transgenic animals.

To date, technologies have been developed to produce recombinant human lactoferrin from the milk of transgenic animals. Thus, by intraductally introducing an adenoviral vector encoding human lactoferrin cDNA, the level of protein production was about 2 grams per liter (Han et al., 2007). In another study with transgenic rabbits, the level of lactoferrin production was about 2.3 mg / ml (Han et al., 2008), another experiment on transgenic mice showed a recombinant human lactoferrin yield of 500 μg / ml (Kim et al., 1999). In all these studies, on transgenic animals of various families, the possibility of controlling the effective secretion of a recombinant human protein has been convincingly demonstrated, which provides great opportunities for improving technological methods for obtaining a given level of a target protein.

Brief Description of the Drawings

Figure 1. Genetic map of LTF construct 3. Description of structural elements is given in the text.

Figure 2. Genetic map of the LTF construct 5. A description of the structural elements is given in the text.

Figure 3. Genetic map of LTF design 7. Description of structural elements are given in the text.

Figure 4. Genetic map of the LTF 10 construct. Description of structural elements is given in the text.

Figure 5. Genetic map of the LTF design 11. A description of the structural elements is given in the text.

Figure 6. Verification of the presence of transgenes in the genome of mice by real-time PCR. The result from real-time PCR is presented, demonstrating the dependence of the amount of PCR product on cycles. Tr are transgenes, K + human genomic DNA, K- non-transgenic mouse A). Check for the presence of the LTF 3 transgene; B) Check for the presence of the LTF 5 transgene; C) Verification of the presence of the LTF 7 transgene; D) Verification of the presence of the LTF 10 transgene; E) Check for the presence of the LTF 11 transgene.

Figure 7. Verification of the specificity of transgene expression in various mouse tissues. 1 - mammary gland; 2 - the liver; 3 - spleen; 4 - ovaries; 5 - kidneys; 6 - pancreas; 7 - heart; 8 - lungs; 9 - thymus; 10 - the brain; 11 - muscle tissue.

Figure 8. Inheritance of the level of production of lactoferrin in generations of transgenic mice for various transgenes.

Figure 9. Checking the presence of transgenes of the goat genome by real-time PCR. The result of real-time PCR is presented. Tr are transgenes, K + human genomic DNA, K- non-transgenic goat. A) Check for the presence of the LTF 3 transgene; C) Check for the presence of the LTF 5 transgene.

Figure 10. The result of real-time PCR. The dependence of the amount of PCR product on cycles is presented. Two repetitions from each sample. A. Primers for human lactoferrin. Tr is the genomic DNA of a transgenic mouse, K + is the human genomic DNA, and K is the genomic DNA of a non-transgenic mouse. B. Normalizing PCR.

Table 1. The average content of lactoferrin (g / l) in the milk of mice for various designs.

Examples of carrying out the invention

The implementation of the invention is illustrated by the following examples.

Example 1. Obtaining the genetic construct of LTF3.

An aliquot of plasmid DNA is removed from the refrigerator (storage temperature 20.0 ± 2.0 ° C) and the E. coli culture is transformed by electroporation. The transformed culture is cultured on 2xYT medium with the addition of 50 μg / ml ampicillin. The cultivation duration is from 18 to 20 hours at a temperature of + 37.0 ± 0.5 ° C.

Plasmid DNA is isolated by alkaline lysis.

Centrifuged at 4 ° C CF for 10-15 ', the medium is drained; then centrifuged 4 krpm for 1 ', remove the remaining liquid. Resuspend in 10 (5) ml of “I” solution (Glucose 50 mM, Tris-HCl, pH 8.0 25 mM, EDTA 10 mM); +1 ml of a freshly prepared lysozyme solution (10 mg / ml in the "I" solution). Then they are kept at normal temperature for 15 ', add 20 ml of “II” solution (NaOH 0.2N, SDS 1%), sharply poured, mixed at 0 ° С for 5'; add 10 ml of cold 10M AcONH ₄ (add 5 ml with a pipette dropwise), mix. Incubated at 0 ° C for 5 '.

Centrifuged 5 krpm, at 4 ° C for 10 '; the supernatant is removed, divided into 2 tubes, 12.5 ml of isopropanol are added to each. Do this on a scale so that the tubes have equal weight; incubated at room temperature for 10 ', then centrifuged at 5 krpm at 4 ° C for 10', discard the supernatant. Centrifuged at room temperature for 3 ', the remaining liquid is sucked off.

Suspend the pellet in 800µl 2 M AcONH ₄ , combine in one 2 ml tube; incubated at room temperature for 5 '; and centrifuged at room temperature for 10 '. The supernatant was transferred to a test tube with 800 µl of isopropanol; incubated at room temperature for 5 '; centrifuged at room temperature for 5 '; rinse with 70% EtOH; dissolved in 0.2-1 ml H ₂ O.

Isolated and purified plasmid DNA preparations are evaluated electrophoretically on a 0.8% agarose gel. Concentration is measured on a spectrophotometer and fluorometer. Restriction mapping is performed separately for EcoRI, HindIII, NotI-SalI. Restriction fragments are separated electrophoretically on a 0.8% agarose gel and compared with the reference cards shown in figures 2, 3, 4.

The resulting preparation is a purified DNA preparation of the recombinant plasmid LTF3, which can be used to prepare a fragment for microinjection. Recombinant plasmid LTF3 deposited in the transgenbank of the Institution of the Russian Academy of Sciences of the Institute of Gene Biology, Russian Academy of Sciences.

Example 2. Pedigree of recombinant plasmids.

2.1. Plasmid LTF3.

Plasmid LTF3 was created on the basis of the vector pBCl (Invitrogen) and the genomic sequence of the human lactoferrin gene; number of passages at the time of certification: 1.

Standard in vitro growth conditions, cultivation conditions are E. coli XL-2 line, 2xYT medium, ampicillin 50 μg / ml, 37 ° C, 18-20 hours.

Molecular biological properties of the recombinant plasmid: construct size: 37253 bp, vector part size: 5877 bp, marker: resistance to ampicillin.

Structural elements: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the genome of goats, the 5'-untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of lactoferrin consisting of 6 exons and introns between them, this is followed by a cDNA copy of a gene representing 7-17 exons without introns, a 3'-genomic fragment of the beta-casein gene, ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; cloning site: NotI-SalI; encoded protein size: 710 a.o .; protein encoded sequence: SEQ ID NO: 1

The stability of the recombinant plasmid. Storage for 2 years (observation period) in the form of plasmid DNA at a temperature of minus -20 ° C.

The genetic map of the LTF3 construct is shown in FIG. 1, the nucleotide sequence is represented as SEQ ID NO: 3.

2.2. Plasmid LTF5.

Obtaining a recombinant plasmid LTF5 similar to that described above in Example 1.

Recombinant plasmid LTF5 has the following characteristics: design size: 49509 bp; structural elements: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the goat genome, 5'-untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of lactoferrin consisting of 17 exons and introns between them, 3'-genomic fragment of lactoferrin, ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322. encoded protein size: 710 a.o .; the sequence of the encoded protein: SEQ ID NO 1.

The genetic map of the LTF5 construct is shown in FIG. 2, the nucleotide sequence is represented as SEQ ID NO: 4.

2.3. Plasmid LTF7.

Obtaining a recombinant plasmid LTF7 similar to that described above in Example 1.

The recombinant plasmid LTF7 has the following characteristics: construct size: 50301 bp, vector part size: 5877 bp, marker trait: ampicillin resistance.

Structural elements: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the genome of goats, 5'-untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of lactoferrin consisting of 17 exons and introns between them, 3'-genomic fragment of the beta-casein gene, ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322. Cloning Saig: NotI-SalI.

The size of the encoded protein: 710 a.o .; the sequence of the encoded protein: SEQ ID NO 1.

The genetic map of the LTF7 construct is shown in FIG. 3, the nucleotide sequence is represented as SEQ ID NO: 5. Plasmid LTF10.

Obtaining a recombinant plasmid LTF10 similar to that described above in Example 1.

The recombinant plasmid LTF10 has the following characteristics: construct size: 50642 bp, vector part size: 5877 bp, marker trait: ampicillin resistance.

Structural elements: tandem repeat of insulators from the beta-globin gene of chickens, the whole human lactoferrin gene (human lactoferrin promoter, 5'-untranslated region of human lactoferrin, the coding region contains the genomic sequence of lactoferrin consisting of 17 exons and introns between them, 3'-genomic fragment lactoferrin), ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322. Cloning Site: NotI-SalI.

The size of the encoded protein: 711 a.o .; the sequence of the encoded protein: SEQ ID NO 2.

The genetic map of the LTF10 construct is shown in FIG. 4, the nucleotide sequence is represented as SEQ ID NO: 6.

2.5. Plasmid LTF11.

The preparation of the recombinant plasmid LTF11 is similar to that described in Example 1. The recombinant plasmid LTF11 has the following characteristics: construct size: 32051 bp, structural elements: tandem repeat of insulators from the beta-globin chicken gene, beta-casein promoter from the goat genome, 5 ' - the untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of lactoferrin consisting of 6 exons and introns between them, followed by a cDNA copy of the gene representing 7-17 exon without introns, 3 'genomic fragment of lactoferrin gene, ampicillin resistance gene, bla-promoter, origin of replication from plasmid pBR322. The size of the encoded protein: 711 a.o .; the sequence of the encoded protein: SEQ ID NO 2.

The genetic map of the LTF11 construct is shown in FIG. 5, the nucleotide sequence is represented as SEQ ID NO: 7.

Example 3. Tissue specificity of transgene expression in mammals

Using RT-PCR followed by real-time PCR, the presence of transgenes was evaluated and the level of RNA in various mouse tissues was measured. The data obtained showed that the expression level in the mammary gland is 5-1000 times higher than the expression level in other tissues. The strongest expression is observed in the mammary gland (1) and muscles (11). The gel is coated with RT-PCR of lactoferrin (indicated by LTF) and RT-PCR of the normalization gene G3PDH (indicated by ----). (Figures 6, 7).

The inheritance of the level of lactoferrin production in generations of transgenic mice for various transgenes is shown in Figure 8. The average lactoferrin content (g / l) in the milk of mice for various constructs is presented in Table 1.

Similarly, the presence of transgenes in the goat genome was evaluated (Figure 9).

Example 4. Dependence of the level of transgene expression on the number of copies embedded in the genome.

The number of copies of the transgene was determined by real-time PCR using the intercalating dye SYBR Green. Human genomic DNA was used as a reference point, in which the number of copies of lactoferrin was considered equal to two. The genomic DNA of mice was isolated from the tails, the human genomic DNA was isolated from the blood. To minimize the non-specific signal from mouse lactoferrin, unique primers for the human lactoferrin intron were selected that did not have significant homology with the mouse lactoferrin sequence. Used primers for human lactoferrin: 5'-CCCAGCATCAGACAACCACTAATC, 5'-AGGAAGCCAGACACAAGAGACC. In PCR, 100 ng of genomic DNA was taken. The amount of genomic DNA was measured on a Qubit fluorometer (Invitrogen) and additionally normalized real-time PCR was performed. For normalization, primers for the Bp4 gene were used, universal for man and mouse: CGGGAGCAGGTGGACCAGGG, GTGTCCAGTAGTCGTGTGATGAGGTG. The number of copies was determined by the formula: Number = 2 * E ^∧ (C (t) _to -C (t)), where C (t) _to and C (t) are the threshold cycles of human DNA and transgene, respectively. E is the effectiveness of PCR (Figure 15).

The number of copies of the transgene was determined and the relationship between the copy number of the transgene and the production of lactoferrin in the milk of transgenic animals was analyzed. With an increase in the number of copies to about 20, a gradual increase in production is observed, with a further increase in the number of copies, the level remains approximately unchanged. The relationship between the number of copies and the production of lactoferrin is illustrated by the following proportions:

- 1-2 copies - average production of 6 mg / ml

- 3-5 copies - average production 7.2 mg / ml

- 6-10 copies - average production 7.9 mg / ml

- 11-20 copies - average production of 11.3 mg / ml

- 21-50 copies - average production 18.9 mg / ml

- more than 50 copies - the average production of 14.2 mg / ml.

Table 1 Design The content of lactoferrin, M ± m (g / l) LTF3 9.239 ± 0.725 LTF5 16.662 ± 1.720 LTF7 12.171 ± 0.979 LTF10 10,215 ± 1,122 LTF11 12.396 ± 1.838

Literary sources

- Actor JK, Hwang SA, Kruzel ML. Lactoferrin as a natural immune modulator. Curr Pharm Des. 2009; 15 (17): 1956-73.

- Amini AA, Nair LS. Lactoferrin: a biologically active molecule for bone regeneration. Curr Med Chem. 2011; 18 (8): 1220-9.

- Artym J. [Antitumor and chemopreventive activity of lactoferrin]. Postepy Hig Med Dosw (Online). 2006; 60: 352-69.

- Ashby B, Garrett Q, Willcox M. Bovine lactoferrin structures promoting comeal epithelial wound healing in vitro. Invest Ophthalmol Vis Sci. 2011 Apr 25; 52 (5): 2719-26.

- Barash, I., Faerman, A., Ratovitsky, T., Puzis, R., Nathan, M., Hurwitz, DR, and Shani, M. (1994) Ectopic expression of 6-lactoglobulin / human serum albumin fusion genes in transgenic mice: hormonal regulation and in situ localization. Transgenic Res. 3, 141-151.

- Carver, AS, Dalrymple, MA, Wright, G., Cottom, DS, Reeves, DB, Gibdon, YH, Keenan, JL, Barrass, JD, Scott, AR, Colman, A., and Garner, 1. (1993 ) Transgenic livestock as bioreactors: stable expression of human a1-antitrypsin by a flock of sheep. Bio / Technology 11, 1263-1270.

- Han ZS, Li QW, Zhang ZY, Xiao B, Gao DW, Wu SY, Li J, Zhao HW, Jiang ZL, Hu JH. High-level expression of human lactoferrin in the milk of goats by using replication-defective adenoviral vectors. Protein Expr Purif. 2007 May; 53 (1): 22 5-31.

- Han ZS, Li QW, Zhang ZY, Yu YS, Xiao B, Wu SY, Jiang ZL, Zhao HW, Zhao R, Li J. Adenoviral vector mediates high expression levels of human lactoferrin in the milk of rabbits. J Microbiol Biotechnol. 2008 Jan; 18 (1): 153-9.

- Hatano, N., Eversole-Cire, P., Ferguson-Smith, AG, Jones, PA, Surani, MA, and Sasaki, H. (1998) Enhancer-dependent, locus-wide regulation of the imprinted mouse insulin-like growth factor II gene. J. Biochem. 123, 984-991.

- Kim SJ, Sohn BH, Jeong S, Pak KW, Park JS, Park IY, Lee TH, Choi YH, Lee CS, Han YM, Yu DY, Lee KK. High-level expression of human lactoferrin in milk of transgenic mice using genomic lactoferrin sequence. J Biochem. 1999 Aug; 126 (2): 320-5.

- Kruzel ML, Actor JK, Boldogh I, Zimecki M. Lactoferrin in health and disease. Postepy Hig Med Dosw (Online). 2007; 61: 261-7.

- Maga, E.A. and Murray, J.D. (1995) Mammary gland expression of transgenes and the potential for altering the properties of milk. Bio / Technology 13, 1452-1457.

- Meade, H., Gates, L., Lacy, E., and Lonberg, N. (1990) Bovine as 1-casein gene sequences direct high level expression of active human urokinase in mouse milk. Bio / Technology 8, 443-446.

- Ninomiya, T., Hirabayashi, M., Sagara, J., and Yuki, A. (1994) Functions of protein gene 5-flanking regions on growth hormone gene. Mol. Reprod. Deu. 37, 275-283.

- Wei, Y., Yarns, S., Greenberg, N.M., Whitsett, J., and Rosen, J.M. (1995) Production of human surfactant protein C in milk of transgenic mice. Transgenic Res. 4, 232-240.

Claims (5)

1. The genetic construct of LTF3, the sequence of which is presented as SEQ ID NO: 3, encoding a human lactoferrin protein, intended for the production of recombinant human lactoferrin in transgenic mammalian milk, characterized by the following structural features: size - 37253 bp; marker sign - ampicillin resistance; the size of the vector part is 5877 bp .; structural elements of the vector part: ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; description of the cloned fragment: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the genome of goats, the 5'-untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of lactoferrin, consisting of 6 exons and introns between them, followed by a cDNA copy of the gene, representing 7-17 exons without introns, 3'-genomic fragment of the beta-casein gene; fragment size - 31376 bp .; cloning site - NotI, SalI; the size of the encoded protein is 710 a.o .; the sequence of the encoded protein of SEQ ID NO: 1. 2. The genetic construct of LTF5, the sequence of which is presented as SEQ ID NO: 4, encoding a human lactoferrin protein, intended for the production of recombinant human lactoferrin in transgenic mammalian milk, characterized by the following structural features: size - 49509 bp; marker sign - ampicillin resistance; the size of the vector part is 5877 bp .; structural elements of the vector part: ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; description of the cloned fragment: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the genome of goats, the 5'-untranslated region contains the first two exons of the beta-casein gene; the coding region contains the genomic sequence of lactoferrin, consisting of 17 exons and introns between them, a 3'-genomic fragment of lactoferrin; fragment size - 43632 bp .; cloning site - NotI, SalI; the size of the encoded protein is 710 a.o .; the sequence of the encoded protein is SEQ ID NO: 1. 3. The genetic construct of LTF7, the sequence of which is presented as SEQ ID NO: 5, encoding a human lactoferrin protein, intended for the production of recombinant human lactoferrin in transgenic mammalian milk, characterized by the following structural features: construction size - 50642 bp; the size of the vector part is 5877 bp; marker sign - ampicillin resistance; structural elements: tandem repeat of insulators from the beta-globin gene of chickens, the entire human lactoferrin gene (human lactoferrin promoter, 5'-untranslated region of human lactoferrin; the coding region contains the genomic sequence of lactoferrin, consisting of 17 exons and introns between them, 3'-genomic lactoferrin fragment), ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; cloning site - NotI-SalI; the size of the encoded protein is 710 a.o .; the sequence of the encoded protein is SEQ ID NO: 1. 4. The genetic design of LTF10, the sequence of which is presented as SEQ ID NO: 6, encoding a human lactoferrin protein, intended for the production of recombinant human lactoferrin in transgenic mammalian milk, characterized by the following structural features: construction size - 50642 bp; the size of the vector part is 5877 bp; marker sign - ampicillin resistance; structural elements: tandem repeat of insulators from the beta-globin gene of chickens, the whole human lactoferrin gene (human lactoferrin promoter, 5'-untranslated region of human lactoferrin, the coding region contains the genomic sequence of lactoferrin, consisting of 17 exons and introns between them, 3'-genomic lactoferrin fragment), ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; cloning site - NotI-SalI; the size of the encoded protein is 711 a.s .; the sequence of the encoded protein is SEQ ID NO: 2. 5. The genetic construct of LTF11, the sequence of which is presented as SEQ ID NO: 7, encoding a human lactoferrin protein, intended for the production of recombinant human lactoferrin in transgenic mammalian milk, characterized by the following structural features: size - 32051 bp; marker sign - ampicillin resistance; the size of the vector part is 5877 bp .; structural elements of the vector part: ampicillin resistance gene, bla promoter, origin of replication from plasmid pBR322; description of the cloned fragment: tandem repeat of insulators from the beta-globin gene of chickens, beta-casein promoter from the genome of goats, the 5'-untranslated region contains the first two exons of the beta-casein gene, the coding region contains the genomic sequence of lactoferrin, consisting of 6 exons and introns between them, followed by a cDNA copy of a gene representing 7-17 exons without introns, a 3'-genomic fragment of the lactoferrin gene; fragment size - 26174 bp .; cloning site - NotI, SalI; the size of the encoded protein is 711 a.s .; the sequence of the encoded protein is SEQ ID NO: 2.

Images