RU2631933C1 - Method for differentiation of commercially important mites of amblyseius genus based on restrictive analysis - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: method involves DNA isolation from pre-collected biological material, subsequent PCR of the mitochondrial DNA cytochrome oxidase region, amplicon restriction analysis, and agarose gel electrophoresis. During PCR, primers are used: direct ITS1 GAATATGAGCCGGAATAGTAGGA, reverse ITS4 ATGTGTTGAAGTTACGGTCA, and restriction enzymes AccB1 I, AspLE, Ssp I are used for restriction analysis; the presence of DNA fragments of 509 and 129 bp in length when treated with restriction enzyme AccB1 I indicates belonging to the A. cucumeris species, the presence of DNA fragments of 381 and 260 bp in length when treated with restriction enzyme Ssp I indicates belonging to the A. barkeri species, and the presence of 405 and 227 bp DNA fragments when treated with restriction enzyme AspLE indicates belonging to the A. swirskii species, while the other two restriction enzymes do not have restriction sites.

EFFECT: arsenal of methods for differentiation of commercially significant mites by restriction analysis is expanded.

2 dwg, 1 ex

Description

The invention relates to the field of microbiology, in particular to molecular genetic methods for the identification of organisms - ticks of the genus Amblyseius, and can be used for the correct labeling of grown ticks, as well as assessing the purity and declared taxon of purchased products.

The mites of the genus Amblyseius (Neioselius) - Amblyseius swirskii, Amblyseius cucumeris and Amblyseius barkeri - are the most important commercially significant entomophages. These species are the most common and difficult to differentiate from each other species. The importance of differentiating these ticks is due to the fact that they are grown on similar nutrient substrates, having almost identical morphological features, unlike other ticks of the same genus, and there is a high probability of an incorrect species identification. Meanwhile, this is an important issue, because these species have different commercial value. A. swirskii is highly effective against whiteflies and thrips (Bolckmans K .; Houten Y. van; Hoogerbrugge N. Biological control of whiteflies and western flower thrips in greenhouse sweet peppers with the phytoseiid predatory mite Amblyseius swirskii Athiashenriot (Acari: Phytoseiidae). Second International Sympos on Biological Control of Arthropods, Davos, Switzerland, 12-16 September, p 555-565), while A. cucumeris and A. barkeri only against thrips. Therefore, A. swirskii is the most expensive agent, A. cucumeris is less expensive, and there is practically no demand for A. barkeri, because use of A. cucumeris against thrips is considered more effective than use of A. barkeri (Brdsgaard N.F., Stengaard Hansen L. Effect of Amblyseius cucumeris and Amblyseius barkeri as Biological Control Agents of Thrips tabaci on Glasshouse Cucumbers. Biocontrol Science and Technology. 1992 1992 , 2 (3): 215-223).

Differentiation of ticks of the genus Amblyseius is currently possible only by morphological characteristics, which is a complex task that only a highly qualified specialist can solve. Often, it is necessary to quickly identify the species in order to evaluate the batch of purchased products, as well as the species of cultivated entomophages for the replacement of culture with ticks of another species or genus that do not have useful traits. It is also often important to identify ticks living in greenhouses in order to adjust predator application rates. (Anisimov A.I., Dobrokhotov S.A. MORPHOLOGICAL FEATURES OF PREVENTIVE MITS AMBLYSEIUS MCKENZIEI AND A. CUCUMERIS. Protection and quarantine of plants. No. 1/2008).

These tick species differ in the nucleotide sequence of the DNA region, including the genes 18S rRNA, ITS1, 5.8S rRNA, ITS2,28S rRNA. Thus, in order to identify the species, it is necessary to amplify this region and sequence the obtained PCR product in order to obtain information about the nucleotide sequence. The disadvantage of this approach is the duration of the analysis, the price and the complexity. The solution is to use restriction analysis, which allows you to quickly identify these types of ticks. A significant advantage of the molecular genetic method for differentiating ticks is the possibility of determining them at any stage of development, regardless of gender.

A known method of PCR-RFLP for genotyping of cattle by alleles A and K of the DGAT1 gene (patent RU 2013103980 A, IPC C12N 15/06, C12Q 1/68), taken as a prototype, including PCR-RFLP for genotyping of cattle according to the A and K alleles of the DGAT1 gene, characterized in that at the PCR step other sequences of oligonucleotide primers are used: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3 '(SEQ ID NO: 1), DGAT1-2: 5'-CCGGTTTTG '(SEQ ID NO: 2), DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO: 3), and another restriction enzyme, TaqI, is used at the restriction step to generate genotype-c etsifichnyh fragments genotype AA = 82/18 bp, genotype CC = 100 bp and a genotype AK = 100/82/18 bp.

The disadvantage of this method is the small length of the restriction fragments, which does not allow the use of agarose gel electrophoresis, which is simpler and cheaper to perform than polyacrylamide gel electrophoresis.

We previously performed the analysis of the nucleotide sequence of a DNA region that includes the following genes: 18S rRNA, ITS1, 5.8S rRNA, ITS2,28S rRNA. Differences in the nucleotide sequence between three species of predatory ticks (A. swirskii, A. cucumeris and A. barkeri) were established, which allow us to develop a method for the rapid identification of these tick species based on restriction analysis (PCR-RFLP).

The technical result consists in the possibility of differentiating ticks at any stage of development, regardless of gender, as well as in the possibility of identification procedures without involving a highly specialized specialist for several hours.

The technical result is achieved by the fact that in the method of differentiation of commercially significant ticks of the genus Amblyseius based on restriction analysis, including the isolation of DNA from previously collected biological material, subsequent PCR of the mitochondrial DNA cytochrome oxidase, restriction analysis of amplicon, electrophoresis in an agarose gel, according to the invention, when carrying out PCR primers use: direct ITS1 GAATATGAGCСGGAATAGTAGGA, reverse ITS4 ATGTGTTGAAGTTACGGTCA, and restriction analysis is used for restriction analysis PS AccB1 I, AspLE, Ssp I, and the presence of DNA fragments 509 and 129 bp long. when treated with restriction enzyme AccB1 I indicates the belonging to the species A. cucumeris, the presence of DNA fragments 381 and 260 bp long. upon treatment with the restriction enzyme Ssp I indicates belonging to the species A. barkeri, and the presence of DNA fragments 405 and 227 pt long. n upon restriction enzyme digestion, AspLE indicates A. swirskii species, while the other two restriction enzymes do not have restriction sites.

In FIG. Figure 1 shows table 1 of the lengths of the expected fragments during cleavage of the DNA sequence of ticks previously amplified with primers ITS1 and ITS4.

In FIG. 2 shows the electrophoregram of restriction of PCR products, where 1 is the restriction enzyme AccB1 I; 2 - restriction enzyme AspLE; 3 - restriction enzyme Ssp I; M is a marker of the lengths of DNA fragments, the values are expressed in pairs of nucleotides.

Example

The method of tick differentiation based on restriction analysis of a pre-amplified DNA region, including the genes 18S rRNA, ITS1, 5.8S rRNA, ITS2,28S rRNA, is implemented as follows:

1. Biological material is collected (adult ticks, eggs, larvae) from a substrate for growing ticks or from plants. If the analysis is not done on the same day, then the samples are placed in a 70% alcohol solution.

2. DNA is extracted from the obtained samples, DNA can be extracted both using commercial kits of domestic and foreign manufacturers ("DNA technology", "Primetech", "Zymo research", BioSilica, etc.), and generally accepted methods (phenol chloroform extraction, CTAB method).

3. Perform PCR. The following temperature cycles are used: 94 ° С 4 min, 35 ° С 30 sec, 54 ° С 35 sec, 72 ° С 45 sec, final elongation 72 ° С 8 min. As primers, the following are used: direct: ITS1 GAATATGAGCCGGAATAGTAGGA, reverse: ITS4 ATGTGTTGAAGTTACGGTCA, these primers amplify a 638 bp product. A. cucumeris, 641 bp A. barkeri and 632 bp in A. swirskii.

4. The PCR products are subjected to restriction according to the following scheme: take 10 μl of the PCR product, add 1.5 μl of 10X reaction buffer, individual for each restriction enzyme, and 10 units restriction enzymes. The volume was adjusted to 15 μl with deionized water. The mixture is incubated for 1.5 hours at 37 ° C, the enzyme is inactivated by heating to 75 ° C for 15 minutes. The restriction products are visualized by electrophoresis on a 2% agarose gel. The following are used as restriction enzymes: AccB1 I, AspLE, Ssp I. Each of the restriction enzymes forms unique fragments for each type of tick (table 1).

The proposed method for differentiating predatory ticks is highly sensitive, well reproducible, and economical. Depending on the method of DNA extraction from biological samples, the analysis takes from 4.5 to 6 hours. The analysis can be carried out in laboratories with a thermal cycler, a centrifuge, an electrophoresis chamber, and related reagents and consumables.

Upon restriction enzyme treatment with AccB1 I, the PCR product of A. cucumeris DNA sample generated DNA fragments of 509 and 129 bp in length, AspLE and Ssp restriction enzymes did not have restriction sites. When restriction enzyme Ssp I treated the PCR product of A. barkeri DNA, 381 and 260 bp DNA fragments were formed; the restriction enzymes AccB1 I and AspLE did not have restriction sites. Upon AspLE restriction enzyme treatment with the PCR product of the A. swirskii DNA sample, DNA fragments of 405 and 227 bp were formed; the restriction enzymes AccB1 I and Ssp I did not have restriction sites.

Claims (1)

A method for differentiating commercially significant mites of the genus Amblyseius based on restriction analysis, including DNA extraction from pre-collected biological material, subsequent PCR of the mitochondrial DNA cytochrome oxidase, restriction analysis of amplicon, agarose gel electrophoresis, characterized in that primers are used for PCR: direct ITS1 GAATATGAGCCGGAATAGTAGGA, reverse ITS4 ATGTGTTGAAGTTACGGTCA, and for restriction analysis using restriction enzymes AccB1 I, AspLE, Ssp I, and the presence of DNA fragments a 509 and 129 bp when treated with restriction enzyme AccB1 I, it indicates A. cucumeris species, the presence of 381 and 260 bp DNA fragments when treated with restriction enzyme Ssp I, it belongs to the species A. barkeri, and the presence of DNA fragments 405 and 227 bp in length upon restriction enzyme digestion, AspLE indicates A. swirskii species, while the other two restriction enzymes do not have restriction sites.

Images