RU2740480C1 - Method for identification of bedbugs of genus polymerus - p_cognatus and p_vulneratus based on restriction analysis of cytochrome oxidase gene of mitochondrial dna - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology. Invention is a method for identifying bedbugs of genus Polymerus - P. cognatus and P. vulneratus based on restriction analysis of mitochondrial DNA cytochrome oxidase gene, involving DNA recovery from preassembled biological material, subsequent PCR of the cytochrome oxidase region of the mitochondrial DNA subunit 1, the restriction analysis of the amplicon, the agarose gel electrophoresis, characterized by that primers of the List of sequences are used for PCR: direct mHemF1 (SEQ ID NO: 1) and reverse LepR1 (SEQ ID NO: 2), restriction enzyme RsaI is used in restriction enzyme analysis, wherein presence of fragments: 131, 324 bp for restriction endonuclease RsaI indicates the pest belonging to the species Polymerus vulneratus or Polymerus cognatus.

EFFECT: invention enables to identify a pest at its early stages of development (eggs, larvae) irrespective of insect sex, as well as enables to perform identification procedures for several hours without involving a highly specialized entomologist.

1 cl, 2 dwg, 1 ex

Description

The invention relates to the field of microbiology, namely to molecular-genetic methods for identifying organisms - pests of beets and legumes - P. cognatus and P. vulneratus and can be used to determine the presence of these pests in plant crops.

The genus Polymerus Hahn, 1831 includes 20 species belonging to three subgenera - Polymerus s.str. (4 species), Poeciloscytus Fieber, 1858 (14 species) and Pachycentrum Gapon, 2014 (3 species) (Kerzhner & Josifov, 1999; Gapon, 2014). Two species in the genus, P. cognatus and P. vulneratus (beet bugs), are among the pests of beets and legumes (alfalfa, sainfoin, clover, peas, beans, etc.) in Europe, especially in its eastern part (Sorauer , 1956; Putshkov, 1966, 1972; Golub, 1983). Their habitation, in addition to natural ecosystems, in agroecosystems together with other species of the genus requires prompt identification. However, differences in body color that are commonly used in species identification are unclear due to significant and overlapping variation in characters. The preparation of genital preparations and the study of microscopic structures to accurately determine the species of individuals of the genus Polymerus is laborious work (Gapon DA Revision of the genus Polymerus (Heteroptera: Miridae) in the Eastern Hemisphere. Part 1: Subgenera Polymerus, Pachycentrum subgen.nov. And new genus Dichelocentrum gen.nov. Zootaxa, 2014, Vol, 3787 (1), 87 pp.). It requires mastering a complex manual technique, a considerable amount of time, which does not always meet the requirements of plant protection. Larvae of early ages of different species, especially in the subgenus Poeciloscytus Fieber, 1858 of the fauna of the Palaearctic, practically do not differ, and there are no keys for their identification. However, in the practice of protecting plants from pests, there is a need for timely diagnosis of the presence of pests on crops in order to predict their number and carry out protective measures.

Identification of P. cognatus and P. vulneratus from other representatives of the genus Polymerus is currently possible by morphological characters (Gapon DA Revision of the genus Polymerus (Heteroptera: Miridae) in the Eastern Hemisphere. Part 1: Subgenera Polymerus, Pachycentrum subgen.nov. And new genus Dichelocentrum gen.nov. Zootaxa, 2014, Vol, 3787 (1), 87 pp.), which is a difficult task that only a highly qualified specialist entomologist can solve.

Described is a method of PCR-RFLP for genotyping cattle for alleles A and K of the DGAT1 gene (patent RU 2528743, IPC C12N 15/06, C12Q 1/68, 20.09.2014), including PCR-RFLP for genotyping cattle for alleles A and K of the DGAT1 gene. Detection of the results of PCR-RFLP was carried out by horizontal electrophoresis in 3% agarose gel in TBE buffer (pH 8.0) containing ethidium bromide at a concentration of 0.5 μg / ml, followed by visualization of the amplified products in an ultraviolet transilluminator (= 310 nm). At the PCR step, the sequences of oligonucleotide primers are used: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3 '(SEQ ID NO: 1), DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAT1 (SEQ ID NO: 1) 5'-AGGATCCTCACCGCGGTAGGTCAGG-3 '(SEQ ID NO: 3), and at the stage of restriction restriction enzyme - TaqI is used, with the generation of genotype-specific fragments: genotype AA = 82/18 bp, genotype KK = 100 bp, and genotype AK = 100 / 82/18 bp.

A set of reagents for detecting bed bugs is known (US patent 2013/0011836 A1, 01/10/2013). The method is based on a molecular genetic method for identifying bedbugs using TaqMan probes. The disadvantage of this method is its applicability only for the identification of bugs of the family Cimicidae.

There is a known method for identifying a spider mite using PNR (patent CN102181552 A, 09/14/2011). The method is based on the use of a specialized short primer in the polymerase chain reaction followed by visualization of the PCR results using electrophoresis. The disadvantage of this method is the ability to identify by the presented method only representatives of ticks of the genus Tetranychus.

As a prototype, a method for identifying a bug of a harmful turtle {Eurygaster integriceps) (patent RU 2617935, IPC C12Q 1/68, 28.04.2017) is taken, in which biological material is collected and DNA is isolated. PCR of the cytochrome oxidase site of mitochondrial DNA is performed. Forward EuCO1F: GAATATGAGCCGGAATAGTAGGA and reverse EuCO1R: ATGTGTTGAAGTTACGGTCA were used as primers. PCR products are subjected to restriction. The following restriction enzymes are used: Ah1 I, BamH I, Bst2U I, Psi I. Visualization of restriction products is carried out by electrophoresis in a 2% agarose gel. The presence of one of the sets of fragments: 317, 268 bp. for restriction enzyme Ah1 I, 471, 114 bp for BamH I, 364, 221 bp for Bst2U I and 435, 150 bp for Psi, I indicates that the pest belongs to the genus Eurygaster integriceps. The invention allows for 4.5 to 6 hours to carry out the identification of Eurygaster integriceps at different stages of its development and regardless of the sex of the insect.

The objective of the present invention is to develop a molecular genetic method for identifying pests of beets and legumes - P. cognatus and P. vulneratus, which does not require the presence of a narrowly qualified specialist, in order to increase the efficiency of measures to treat crops from the pest.

A significant advantage of the claimed molecular genetic method for identifying pests is the ability to determine it even at the stage of eggs, larvae and pupa, regardless of gender, which in turn will allow the use of preventive plant protection measures.

We preliminarily analyzed the nucleotide sequence of the subunit 1 cytochrome oxidase gene in representatives of the genus Polymerus in Russia. The sequences were entered into the international GenBank system under the numbers: MH607420-MH607427, MH607440, MH607441, MH607428, MH607436, MH607415-MH607419, MH752746-MH752750, MH607429, MH607437, MH760397438, MH Differences in the nucleotide sequence between P. cognatus and P. vulneratus and other species of the genus Polymerus were established, which make it possible to develop a method for the rapid identification of these species of bugs based on restriction analysis of the cytochrome oxidase gene of subunit 1.

The identification of the pest in the described method is carried out on the basis of restriction analysis of the previously amplified gene of cytochrome oxidase subunit 1 with the RsaI restriction enzyme.

The technical result is the identification of the pest in its early stages of development (eggs, larvae), regardless of the sex of the insect, as well as the possibility of carrying out identification procedures for several hours, without the involvement of a highly specialized specialist entomologist.

The technical result is achieved by the fact that in the method of identifying pests of the genus Polymerus - P.cognatus and P.vulneratus on the basis of restriction analysis of the mitochondrial DNA cytochrome oxidase gene, including the isolation of DNA from pre-collected biological material, the subsequent PCR of the cytochrome oxidase site of the subunit 1 of mitochondrial DNA, restriction analysis of the amplicon, carrying out electrophoresis on an agarose gel, according to the invention, primers of the Sequence List are used for PCR: forward mHemF1 (SEQ ID NO: 1) and reverse LepR1 (SEQ ID NO: 2), restriction analysis uses RsaI restriction enzyme, the presence of fragments: 131, 324 bp for the RsaI restriction enzyme indicates that the pest belongs to the species Polymerus vulneratus or Polymerus cognatus.

The method for identifying pests P. cognatus and P. vulneratus based on restriction analysis of the previously amplified cytochrome oxidase gene of subunit 1 is implemented as follows:

1. Collection of biological material (adult insects, eggs, larvae) is carried out from crops of beets or legumes. If the analysis is not performed on the same day, then the samples are placed in a 70% alcohol solution.

2. Isolation of DNA from the obtained samples, DNA extraction can be carried out using both commercial kits of domestic and foreign manufacturers ("DNA technologies", "Syntol", "Zymo research", BioSilica, etc.), and conventional methods (phenol -chloroform extraction, CTAB method).

3. Carry out PCR. The following temperature cycles were used: 94 ° C 4 min, 35 ° C cycles 94 ° C 30 sec 54 ° C 30 sec, 72 ° C 40 sec, final elongation 72 ° C 8 min. The following primers were used: forward mHemF1 (SEQ ID NO: 1): GCATTYCCACGAATAAATAAYATAAG, reverse LepR1 (SEQ ID NO: 2): TAAACTTCTGGATGTCCAAAAAATCA, these primers amplify the cytochrome oxidase gene product of subunit 1 of 45 n in length.

4. PCR products are subjected to restriction according to the following scheme: take 10 μl of PCR product, add 1.5 μl of 10X reaction buffer and 10 units. restriction enzymes. The volume is made up to 15 μl with deionized water. The mixture is incubated for 1.5 hours at 37 ° C, the enzyme is inactivated by heating to 75 ° C for 15 minutes.

Restriction products are visualized by electrophoresis in 2% agarose gel. RsaI is used as a restriction enzyme. The restriction enzyme forms unique fragments for two pests of the Polymerus genus, P. cognatus and P. vulneratus (Fig. 1).

FIG. 1 shows Table 1: The lengths of the expected fragments upon cleavage of the 455 bp cytochrome oxidase sequence; in fig. 2 shows an Electropherogram of the restriction products of PCR cytochrome oxidase, subunit 1

Example

Electrophoregram (Fig. 2): 1 - DNA sample No. 1; 2 - DNA sample # 2; 3 - DNA sample No. 3; 4 - DNA sample No. 4; 5 - DNA sample No. 5; M - marker of lengths of DNA fragments, values are expressed in base pairs. K - PCR product before restriction; R is the PCR product after restriction.

When processing the PCR product of DNA samples No. 1-4 with the restriction enzyme RsaI, fragments of 131 bp isolated from the bugs of the genus Polymerus. and 324 bp were not formed, therefore, the bugs from which these DNA samples were isolated are not considered harmful. Upon treatment with the restriction enzyme RsaI of the PNR product of DNA sample No. 5, fragments of 131 bp were formed. and 324 bp, therefore, the representative of the bug of the genus Polymerus, from which the DNA sample was obtained, belongs to one of the harmful species of bugs - P. vulneratus or P. cognatus.

The proposed method for identification of bugs of the pests of the Polymerus genus - P. cognatus and P. vulneratus is highly sensitive, well reproducible and not expensive. Depending on the method used for isolating DNA from biological samples, the analysis takes from 4.5 to 6 hours. The analysis can be carried out in laboratories with a thermal cycler, centrifuge, electrophoresis chamber and associated reagents and consumables.

--->

Sequence listing

<110> Voronezh State University

<120> Primers for amplification of the subunit 1 cytochrome oxidase gene

<130> 2019

<160> 2

<210> 1

<211> 26

<212> DNA

<213> Artificial sequence <400> 1

gcattyccac gaataaataa yataag 26

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence <400> 2

taaacttctg gatgtccaaa aaatca 26

<---

Claims (1)

Method for identification of bedbugs of pests of the genus Polymerus - P. cognatus and F.vulneratus based on restriction analysis of the mitochondrial DNA cytochrome oxidase gene, including DNA isolation from pre-collected biological material, subsequent PNR of the cytochrome oxidase section of mitochondrial DNA subunit 1, restriction analysis of amplicon, electrophoresis of aglikon , characterized in that the primers of the Sequence List are used for PCR: forward mHemF1 (SEQ ID NO: 1) and reverse LepR1 (SEQ ID NO: 2), restriction analysis uses the restriction enzyme RsaI, and the presence of fragments: 131, 324 bp for Restrictase RsaI indicates that the pest belongs to the species Polymerus vulneratus or Polymerus cognatus.

Images