KR102260717B1 - Composition for identification of a mutant of a Pleurotus ostreatus cap color and identification method using the same - Google Patents

Abstract

The present invention relates to a composition for discriminating Pleurotus ostreatus cap color mutation comprising a first primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8 and a second primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10, and a method for discriminating Pleurotus ostreatus cap color mutation using the same. According to the configuration of the present invention, even if a fruit body is not formed, it is possible to accurately determine Pleurotus ostreatus cap color mutation in a single reaction in a short time, so the quality control of Pleurotus ostreatus is easy and high-quality Pleurotus ostreatus can be produced with a high yield.

Description

Composition for identification of a mutant of a Pleurotus ostreatus cap color and identification method using the same

The present invention relates to a composition for discriminating oyster mushroom oyster mushroom and a method for discriminating oyster oyster mushroom mutant color using the same.

Oyster mushroom is a white decay fungus that grows on the old trees of broad-leaved trees, and it is a fungus that grows wild over several continents. In Korea, it occurs mainly on dead trees of broad-leaved trees from early autumn to early winter. Oyster mushroom is recognized as a nutritionally excellent food because it is rich in essential amino acids, vitamins and minerals. It contains a lot of dietary fiber and is known to be effective in preventing obesity due to its low lipid content.

Oyster mushroom is the most popular mushroom in Korea. In 2017, 53,532 tons were produced, ranking first among all mushroom items. There are 43 oyster mushroom varieties officially registered for variety protection in Korea (National Seed Resources), more than 17 in Japan (Ministry of Agriculture, Forestry and Fisheries). Korea has traditionally been dominant in oyster mushroom varieties. Representative varieties cultivated in Korea are Heuktari, Konji 7, and Hwaseong 2, etc. In particular, Konji No. 7 was nurtured by the Mushroom Research Institute at Gyeonggi Agricultural Research and Extension Services in 2014, and its freshness is maintained up to 35 days due to its long storage period. This is 7 days longer than the existing Chunchu No. 2, which has a long shelf life. And it is reported that the production is stable and the quality is excellent.

On the other hand, the genome of oyster mushroom is less stable than other higher animals and plants, so the rate of degeneration or mutation during cultivation is high. The symptoms of degeneration of mushroom bacteria are various, and there are cases where the mycelium growth rate is slowed and fruiting bodies (mushrooms) do not occur. Another symptom of deterioration found in mushroom farms is a change in the color of the cape. The cap color of normal bacteria is dark brown or grayish-brown, but when degeneration due to mutation occurs, the cap color changes to white or brighter than normal bacteria. This change is passed on to the next generation.

In actual mushroom production sites, it is often found that the color of oyster mushrooms deteriorates, which is a problem. Because the color of oyster mushrooms is a quality indicator that consumers and distributors consider important, auction prices for mushrooms that have changed color fall.

The symptoms of this degeneration are reported to be due to mutations in a part of the genome (1. Li, Aimin, et al. "Inheritance of strain instability (sectoring) in the commercial button mushroom, Agaricus bisporus." Applied and Environmental Microbiology. 60.7 (1994): 2384-2388. / 2. Kim, SY, Kim, KH, Im, CH, Ali, A., Lee, CY, Kong, WS, & Ryu, JS (2014).Identification of degenerate nuclei and Development of a SCAR marker for Flammulina velutipes. PloS one , 9 (9), e107207.), it is very difficult to precisely detect and determine whether it is a normal or mutant fungus before growing mushrooms and seeing fruiting bodies.

As a background technology for the present invention, Republic of Korea Patent Publication No. 10-2018-0092751 (2018.08.20) describes a primer set for differentiating the mushroom mushroom color and its use. By analyzing the genome sequence, a blue-colored specific molecular marker was developed and its use is described.

An object of the present invention is to provide a primer set that can generate a specific band for each line with a normal green color and a line with a mutated green color in oyster mushroom, and can quickly and accurately discriminate between a normal type and a mutated line in a single reaction. will be.

Another object of the present invention is to provide a detection kit capable of discriminating the oyster mushroom's green mutation in a single reaction, regardless of the location and time of detection, using the composition for discriminating the oyster mushroom's green mutation.

Another object of the present invention is to provide a method for discriminating oyster mushroom oyster mushroom oyster color mutation by using the composition for discriminating oyster mushroom oyster color mutation quickly and accurately in one reaction.

Other objects and advantages of the present invention will become more apparent by the following detailed description of the invention, claims and drawings.

According to one aspect, the first primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8; and a second primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10; A composition for discriminating oyster mushroom green mutation is provided, comprising one or more primer sets among them.

According to one embodiment, the oyster mushroom may be Konji No.7.

According to one embodiment, the oyster mushroom may be a mushroom mycelium.

According to another aspect, there is provided a kit for discriminating oyster mushroom cap color mutation, comprising the composition for discriminating oyster mushroom cap color mutation of the present application.

According to another aspect, (i) isolating the DNA from the sample; (ii) amplifying the DNA isolated in step (i) using the composition for discriminating the oyster mushroom fresh color mutation of the present application; and (iii) confirming the PCR product amplified in step (ii);

According to one embodiment, in the method for determining the oyster mushroom green mutation of the present application, the oyster mushroom may be Konji No.7.

According to one embodiment, by providing a primer set capable of generating a specific band for each line in which the color of the oyster mushroom is normal and the line in which the color of the oyster mushroom is mutated, it is possible to quickly and accurately determine whether or not the oyster mushroom is mutated in the yellow color in one reaction. have.

According to one embodiment, by using the composition for discriminating the oyster mushroom mutant color according to the present invention, it is possible to determine whether the cultivar has mutation in the oyster color before growing the mushroom, so that it is possible to determine whether or not the mutation is in the oyster color within 1 day without raising the actual fruiting body. can be checked Therefore, there is an advantage that quality control can be done properly because it can be cultivated so that the original color of the corresponding oyster mushroom can be expressed without a green mutant individual.

In particular, even in a mushroom spawn culture center, the composition for identifying oyster mushroom fresh color mutations of the present invention can be utilized for self-quality assurance.

According to one embodiment, since the oyster mushroom green mutation can be removed at the initial stage of cultivation, high-quality oyster mushrooms can be produced in high yield.

1 shows the characteristics of a binuclear mycelium mushroom produced by crossbreeding between mononuclear hyphae of konji 7 and konji 7 gadsaek mutant together with mushrooms of konji 7 and konji 7 mutant according to an embodiment of the present invention. it has been shown Based on the color and morphology, it can be seen that P2 mononuclear hyphae caused a mutation in the color trait.
FIG. 2 shows the results of the amplification band after PCR reaction for oyster mushroom No. 7 mononuclear mycelium NO8 and its mutant Konji No. 7 mononuclear mycelium P2 using the primer set according to an embodiment of the present invention. .
3 is a PCR amplification band showing the discriminant marker polymorphism in the Konji No. 7 wild type (NO8) and the fresh mutant type (P2) by the first primer set and the second primer set according to an embodiment of the present invention. is shown.
4 shows the nucleotide sequences of PCR amplification products of Konji No. 7 wild type (NO8) and purple mutant type (P2) by the first primer set according to an embodiment of the present invention.
5 shows the nucleotide sequences of PCR amplification products of Konji No. 7 wild type (NO8) and purple mutant type (P2) by the second primer set according to an embodiment of the present invention.

Since the present invention can apply various transformations and can have various embodiments, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and it should be understood to include all modifications, equivalents and substitutes included in the spirit and scope of the present invention.

The terms used in the present application are only used to describe specific embodiments, and are not intended to limit the present invention. In the present application, terms such as “comprise” or “have” are intended to designate that a feature, number, step, operation, component, part, or combination thereof described in the specification exists, but one or more other features It should be understood that this does not preclude the existence or addition of numbers, steps, operations, components, parts, or combinations thereof.

In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

According to one aspect, the first primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8; and a second primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10; A composition for discriminating the oyster mushroom green mutant is provided, comprising one or more primer sets among them.

As used herein, a "primer" is a short DNA manipulation used as a starting point by a DNA (RNA) synthetase in nucleic acid (DNA, RNA) synthesis. It has a nucleotide sequence complementary to a nucleic acid sequence that is intended to be specifically replicated. . The nucleotide sequence and length of the primer are used for the initialization reaction that starts the synthesis of the desired nucleic acid sequence, and its specific length and nucleotide sequence are used such as the complexity, reaction temperature, and ion concentration of the nucleic acid (DNA, RNA) to be synthesized and amplified. depends on the conditions

In addition, the nucleotide sequence of the primer set according to the present invention can be modified using a label that allows it to be detected by various methods. The primer set may include a label that can be mainly detected using photochemical or spectroscopy, biochemical, immunochemical or other chemical means.

A desired nucleic acid sequence can be amplified through a polymerase chain reaction (PCR) using the primer set according to the present invention, and the amplification method of the target base sequence is for amplifying a nucleic acid molecule known in the art in addition to the polymerase chain reaction. Any suitable method may be applied.

The primer set of the present application is mutated from the normal line of the oyster mushroom cultivar, and can quickly and accurately discriminate the mutated line with a single reaction.

Although not limited thereto, the oyster mushroom variety may be Konji No. 7.

Furthermore, the oyster mushroom may be at least one of Konji No. 7 mononuclear mycelium NO8 and Konji No. 7 blue mutant mononuclear mycelium P2.

Among the oyster mushroom varieties, konji No. 7 normal bacteria was mesophilic, and the average yield per bottle was 121g/1,100ml, effective hard water 16 pieces, weight per stalk 11.6g, stem thickness 16.8mm, and cap diameter 46.6mm. The color of the cap that consumers are paying attention to has a dark brown color with a brightness (L) of 43.5. The degree of redness (a) was 2.4, and the degree of yellowness (b) was 12.2.

The average yield per bottle of the oyster mushroom cultivar Konji No. 7 green mutant was 107g/1,100ml, effective hard water 20 pieces, per stalk weight 8.9g, stem thickness 13.7mm, and cap diameter 39.1mm. The color of the cap that consumers are paying attention to has a light brown color with a brightness (L) of 56.9. The degree of redness (a) was 0.1, and the degree of yellowness (b) was 8.9.

In this way, unlike the normal Konji 7 bacteria, the Konji 7 green mutant had a high lightness (L), and the difference was 13.4. Therefore, the auction price may be low as the oyster mushroom is recognized as low quality in the domestic market, which prefers the dark green color.

On the other hand, the difference between normal Konji No. 7 and Gonji No. 7 green mutant was 14 g per bottle in production, which is directly related to price and considered important by mushroom growers, and the normal bacteria increased by 13% compared to the green mutant. In the domestic oyster mushroom market, large mushrooms are preferred. Normal Konji 7 has 16 effective hard water per bottle and weighs 11.6 g per pod, whereas Konji 7 fresh-colored mutant has 20 effective hard water and weighs 8.9 g per bottle, so the quality is poor.

Therefore, if it is cultivated using a fungus that has the Gonji No. 7 green mutation, the damage to the farmer will be enormous. Therefore, it is necessary to check whether the progenitor or spawn is a normal Gonji 7 bacteria in the mycelial state. In other words, it is important to determine whether a mushroom is a normal or mutant one before actually growing it. However, in order to discriminate the Konji No. 7 normal bacteria and the Konji No. 7 green mutant, the only method of directly growing mushrooms is the only method, so a lot of time and effort is required to identify the green mutant.

However, by using the composition of the present invention, the DNA fragment is amplified in a specific pattern for each Konji No. 7 normal bacteria and the Konji No. 7 blue mutant, and the Konji No. 7 normal bacteria and the Konji No. 7 green mutant can be discriminated. In addition, the composition of the present invention can specifically discriminate between Konji No. 7 normal bacteria and Konji No. 7 green mutants in a single reaction, and it is possible to discriminate between normal bacteria and Konji No. 7 green mutants before growing mushrooms. .

In addition, since the Gonji No. 7 green mutant produces a mutation that brightens the green color that consumers do not like and the yield is also reduced, it is necessary to quickly identify the green mutant for the need for stable cultivation of the Konji No. 7 normal bacteria in the farmhouse. Therefore, by using the composition of the present invention, it is possible to remove the oyster mushroom green mutant at the initial stage of cultivation, so that high-quality oyster mushrooms can be produced in high yield.

The sample used for PCR in the present invention can be used by isolating gDNA (genome DNA, genomic DNA) from mushroom mycelium or fruiting body.

According to one embodiment, the oyster mushroom may be a mushroom mycelium. Therefore, it is possible to accurately determine whether or not a green mutation occurs even in the mycelium stage without cultivating the fruiting body.

According to another aspect, there is provided a kit for discriminating Konji No. 7 normal bacteria and Konji No. 7 green mutants, comprising the composition for discriminating Konji No. 7 normal bacteria and Konji No. 7 green mutants of the present application.

The kit of the present invention includes a first primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8; and a second primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10; In addition to one or more sets of primers, one or more other component compositions, solutions, or devices suitable for the assay method may be included.

In addition, the kit is not limited thereto, but a kit including essential elements for performing PCR analysis may be suitable. The kit may further include reagents for nucleic acid extraction, amplification, product detection, and instructions therefor, in addition to the primer set comprising SEQ ID NO: 7 to SEQ ID NO: 10 of the present invention, test tube or other suitable container, buffer, DNA polymerases, dNTPs, DNase, RNase inhibitors, buffers and sterile distilled water and the like may be included.

According to another aspect, (i) isolating the DNA from the sample; (ii) amplifying the DNA isolated in step (i) using the composition for discriminating the oyster mushroom fresh color mutation of the present application; and (iii) confirming the PCR product amplified in step (ii);

Step (i) of isolating the DNA can use a method known in the art, but is not limited thereto, by inoculating the mycelium in MCM (muchroom complete medium) medium, culturing the mycelium and collecting the mycelium in a microwave oven. It can be used after treatment, cooling treatment and centrifugation. A target sequence may be amplified by performing an amplification reaction using the isolated gDNA (genome DNA) as a template and using the primer set of the present invention as a primer.

The step (ii) of amplifying the target sequence may be performed through PCR. The primer annealing temperature of the PCR may be 50 ~ 65 ℃, 56 ~ 62 ℃ may be more suitable, the extension temperature may be 65 ~ 80 ℃, 68 ~ 75 ℃ may be more suitable, but limited thereto it's not going to be

The PCR may be carried out using a conventional PCR device, and the PCR device may be, for example, a real-time PCR device, a thermal block PCR device, or a digital PCR device. As such, it may be GeneAtlas (E02 (Astec Co. Japan), but is not limited thereto.

The PCR device can simultaneously identify one or more oyster mushroom green mutations, and can further quantify the amount of target nucleic acid.

Although not limited thereto, the oyster mushroom variety may be Konji No. 7.

Furthermore, the oyster mushroom may be at least one of Konji No. 7 mononuclear mycelium NO8 and Konji No. 7 blue mutant mononuclear mycelium P2.

Step (iii) of confirming the amplified product may be performed through gel electrophoresis, capillary electrophoresis, DNA chip, radiometric measurement, fluorescence measurement, or phosphorescence measurement. Although not limited thereto, the PCR amplified product after PCR is electrophoresed, stained with Safeview (iNtRON Biotechnology, Korea), and the formed DNA band is detected by irradiating with UV light in Konji No. 7 normal bacteria and Konji No. 7 blue mutant bacteria. You can check the patterns appearing at the same time.

If the size of the product amplified with the first primer set of the present application is 238 bp (SEQ ID NO: 17), it is determined as a normal oyster mushroom, and when the size of the amplified product is 228 bp (SEQ ID NO: 18), it can be determined as a green mutant oyster mushroom.

If the size of the product amplified with the second primer set of the present application is 178 bp (SEQ ID NO: 19), it is determined as a normal oyster mushroom, and if the size of the amplified product is 169 bp (SEQ ID NO: 20), it can be determined as a green mutant oyster mushroom.

Hereinafter, preferred embodiments of the present invention will be described in detail. The following examples are only for illustrating the present invention, and the scope of the present invention should not be construed as being limited by these examples. In addition, although only examples using specific compounds are illustrated in the following examples, it is apparent to those skilled in the art that similar effects can be exerted even when equivalents thereof are used.

Example

Oyster mushroom Konji No. 7 normal bacteria Konji No. 7 fresh color mutant for discrimination primer set making

1. Isolation of mutant mononuclear mycelium from oyster mushroom Konji No. 7 green mutant

In order to search for a band specific to the green mutant, mononuclear mycelium of the green mutant No. 7 gonji oyster mushroom was isolated. Oyster mushroom is usually a binuclear fungus, and there are two haploid nuclei in one cell. These haploid nuclei produce a protoplast with the cell wall of the mycelium removed, and then in the process of regenerating the cell wall again, there is one cell per cell at a low rate. Can be converted to mononuclear hyphae containing a haploid nucleus. First, a Lysing enzyme (Sigma) containing a cell wall component degrading enzyme was treated to dissolve the cell wall of the Gonji No. 7 green mutant mycelium. The protoplasts from which the cell wall has been removed prevent lysis by controlling the osmotic pressure with 0.6M sugar solution, and spread it on mushroom complete medium (MCM) containing 0.6M sugar solution and incubated at 25°C. After 10-20 days, the mycelial colonies that were regenerated were isolated and observed under a microscope, and strains without clamp connection were isolated. For oyster mushrooms, clamps do not exist in the case of mononuclear hyphae, and clamps appear in binucleated hyphae. A plurality of hyphae without clamps were isolated and crossed with each other to separate mononuclear hyphae of a combination in which clamps were formed. Nutari is a tetrapolar hermaphrodite strain, and there are 4 mating types, and mating occurs only when compatible mononuclear hyphae meet. The crossbreeding between mononuclear hyphae isolated from Konji No. 7 green mutant means that the two haploid nuclei contained in Konji No. 7 green mutant were correctly separated.

The mononuclear hyphae constituting the Gonji 7 normal bacteria were purchased from Gyeonggi Agricultural Research and Development Institute as NO8 and MT, grown in mushroom complete medium (MCM), preserved at 4℃, and used in the experiment. Using two types of parent mononuclear hyphae (MT and MO8) constituting Konji 7 normal bacteria and 2 types of mononuclear hyphae (P1 and P2) derived from Konji 7 green mutation (P1 and P2), two types of combination, namely, “Konji 7 Normal bacteria-NO8 × Konji 7 green mutant-P1” “Konji 7 normal bacteria-MT × Konji 7 green mutant-P2” were crossed. For the control group, “Konji No. 7 normal bacteria-MT×Konji 7 normal bacteria-NO8” and “Konji 7 green mutant-P1×Konji 7 green mutant-P2 combinations were also crossed. Clamps were created in the 4 combinations, and the crossover was successful. Four kinds of hybridized binuclear mycelium were inoculated in a medium containing 70% moisture (poplar sawdust: rice bran = 8:2, volume ratio) and grown, and the shape of the mushroom was observed. In the combination of “Konji No. 7 Normal Bacteria-MT×Konji No. 7 Blue Mutation-P2”, the same mushrooms as those of Konji No. 7 Green Mutation were generated, and “Konji No. 7 Normal Bacteria-NO8×Konji No. 7 Green Mutation-P1” was found in Konji No. 7 Mushrooms identical to those of normal bacteria were generated.In the combination of MT×NO8 and P1×P2, the same mushrooms as normal Konji No. 7 and green mutant Konji No. 7 were generated, respectively. These results show that P2 mononuclear hyphae of Konji No. 7 green mutant were mutated. A related photograph is shown in Figure 1 below.

2. Oyster mushroom Konji No. 7 -NO8 and Konji No. 7 fresh color mutant -P2 genome sequence comparison

Inoculate Konji No. 7-NO8 and Konji No. 7 green mutant-P2 genome mycelium in a liquid medium of complete mushroom medium, and freeze-dry the mycelium after culturing the mycelium using a kit (GenEx Plant plus!, GeneAll Co.) to use gDNA (genome). DNA) was extracted. This was decoded using a Nanopore NGS nucleic acid analyzer and de novo assembly was performed to compare the nucleic acid sequences of Konji No. 7-NO8 and Konji No. 7 blue mutant-P2.

A sequence difference was found between the Konji No. 7 NO8 mononuclear hyphae and the Konji No. 7 blue mutant P2 mononuclear hyphae in a total of 27 sites, and these mutation regions are shown in Table 1 below.

No Konji No. 7 (NO8) Konji No.7 blue mutant (NO8) Chromosome/Contig location Chromosome/Contig location One 02_contig3 110,815 P2_04_contig2 654,499 2 02_contig3 116,820 3 02_contig3 182,316 4 02_contig3 191,364 5 02_contig3 194,160 P2_03_contig1 362,697 6 02_contig3 249,569 P2_08_contig1 2,210,239 7 02_contig3 274,190 8 02_contig3 299,147 9 02_contig3 323,222 10 02_contig3 480,003 P2_04_contig2 2,096,890 11 02_contig3 511,093 12 02_contig3 512,715 P2_02_contig1 1,832,822 13 02_contig3 606,494 14 02_contig3 622,785 15 05_contig1 509,981 P2_05_contig1 511,338 16 11_contig1 1,157 P2_04_contig2 680,834 17 11_contig1 1,016,956 18 11_contig2 317,560 P2_11_contig2 315,524 19 11_contig3 979,907 20 12_contig1 5,989 21 12_contig1 213,358 22 12_contig1 221,188 23 12_contig1 222,517 24 12_contig1 238,833 25 12_contig1 253,618 P2_07_contig1 2,535,060 26 12_contig1 278,862 27 12_contig1 299,309

Primers were designed based on the sequences of the above 27 mutation regions. To increase the efficiency of primer selection, virtual PCR (in silico PCR) is performed on the synthesized primer sequence on the genome sequence of Konji No. 7-NO8 mononuclear hyphae and Konji No. 7 blue mutant-P2 to produce a PCR synthetic band of the desired size. Eight sites were selected and shown in Table 2 below. Primers capable of amplifying these regions are shown in Table 3 below.

No Konji No. 7 (NO8) Konji No. 7 blue mutation (P2) location Chromosome/Contig Amplification expected size Chromosome/Contig Amplification expected size 2 116,820 02/contig3 428 not detected not detected 9 323,222 02/contig3 330 not detected not detected 13 606,494 02/contig3 325 not detected not detected 15 509,981 05/contig1 312 05/contig1 231 18 317,560 11/contig2 445 11/contig2 374 21 213,358 12/contig1 409 not detected not detected 22 221,188 12/contig1 333 not detected not detected 26 278,862 12/contig1 318 not detected not detected

No Left Primer Right Primer 2 GAGATCGTCCTCAGAGTCAGTC (SEQ ID NO: 1) TTAACAATGCGATGATTGATGT (SEQ ID NO: 2) 9 ACATGTGTGAAAGTGGATGAAA (SEQ ID NO: 3) ATACATATTCGGGTGTAAAGCG (SEQ ID NO: 4) 13 ACTATGGAAGGACTTGGTGATG (SEQ ID NO: 5) TGCGAAGTGAAATATGGTTACA (SEQ ID NO: 6) 15 CAGAAACATCTCTTCCGCTATC (SEQ ID NO: 7) TGATCGTAGTCTGTACCGTGAG (SEQ ID NO: 8) 18 AATAGATGCATAAGCCAGGAAG (SEQ ID NO: 9) GACGGTGTTTGTAGAAGAGGAG (SEQ ID NO: 10) 21 CGGATGTTTGTAGAGTAGAGCC (SEQ ID NO: 11) GTATTCGGAGGCAAGAACATAC (SEQ ID NO: 12) 22 TTGAGATCGAAGACTGAGTTGA (SEQ ID NO: 13) TCAAGTAACCGCTAAACTCCAC (SEQ ID NO: 14) 26 GTACGTGCCGATAATATGGAT (SEQ ID NO: 15) TCATAGCTCAACTGCTCGATAA (SEQ ID NO: 16)

3. Oyster mushroom Konji No. 7 -NO8 and Konji No. 7 fresh color Mutation-P2 Discriminant Specific primer making

8 primer sets obtained from the genomic sequence comparison analysis and virtual PCR results of the Konji No. 7-NO8 and Konji No. 7 green mutant-P2, and gDNA extracted from the mycelium of the oyster mushroom Konji No. 7-NO8 and Konji No. 7 green mutant-P2 (genomic DNA) and PCR were performed to confirm polymorphism of the amplified DNA. In particular, although the amplified DNA is amplified at the same time in Konji No. 7-NO8 and Konji No. 7 blue mutant-P2, the size of the amplified DNA is different so that the difference between the two strains can be confirmed. .

To determine whether the primers show polymorphism between normal bacteria and fresh-colored mutants, the mycelium obtained by the above method was freeze-dried, and gDNA was extracted using a kit (GenExTM Plant plus! Sx, GeneAll Co.). Then, the concentration was measured, and PCR (polymerase chain reaction) was performed.

The total amount of PCR reaction is 20 μl, 20 ng of genomic DNA isolated from the mycelium of each strain, 4 types of dNTPs (2.0 mM each), heat-resistant DNA polymerase (e-taq polymerase, Solgent, Korea) 1.0 unit, 10 pmol Primers, 20 ng mushroom gDNA and buffer (10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl 2 , 0.01% gelatin) were thoroughly mixed.

Using the primers obtained from the genome sequence comparison analysis, PCR reaction was carried out using gDNA derived from the mycelium of Konji No. 7-NO8 and Konji No. 7 blue mutant-P2, and specific DNA products with different sequences between lines were obtained. Polymorphism was confirmed.

The PCR reaction was performed using GeneAtlas E02 (Astec Co.), and the reaction conditions were initial DNA denaturation by maintaining at 95°C for 2 minutes, denaturing DNA by maintaining at 95°C for 20 seconds, and annealing temperature of 58 35 cycles were performed at ℃ 40 sec, and the extension temperature was 72 ℃ 60 sec. Then, the final synthesis was performed at 72 °C for 5 minutes.

The PCR amplification product was electrophoresed on 3.0% agarose gel, stained with Safeview (iNtRON Biotechnology, Korea), and the DNA polymorphic band was detected by UV irradiation, which is shown in FIG. 2 .

Based on the above polymorphism pattern, a combination of co-dominant primer sets 15 and 18 showing a polymorphism phenomenon was selected because a DNA band was simultaneously observed in Konji No. 7-NO8 and Konji No. 7 blue mutant-P2, but the size was different. These primer sequences are shown in Table 4 below.

No. Primer name Sequence (5'-3') Size(bp) SEQ ID NO: 7 15F CAGAA ACATC TCTTC CGCTA TC 22 SEQ ID NO: 8 15R TGATC GTAGT CTGTA CCGTG AG 22 SEQ ID NO: 9 18F AATAG ATGCA TAAGC CAGGA AG 22 SEQ ID NO: 10 18R GACGG TGTTT GTAGA AGAGG AG 22

In order to confirm the polymorphism pattern of the selected oyster mushroom discrimination primer according to the present invention, a polymerase chain reaction was performed. Table 5 shows the reaction conditions of the polymerase chain reaction (PCR) according to this example.

Reaction Tm (℃ Time Initial denaturation 95 2 m Denaturation 35 cycles 95 20 s Annealing 58 40 s Extension 72 60 s Final Extension 72 5 m

The PCR amplification product was electrophoresed on 3.0% agarose gel, stained with Safeview (iNtRON Biotechnology, Korea), and detected by irradiating the DNA polymorphism band with UV, stored with Gel-Doc system (Bio-rad) and printed. As shown in FIG. 3 .

That is, FIG. 3 is a PCR amplification band showing the discriminant marker polymorphism in Konji No. 7 wild type (NO8) and fresh mutant type (P2) by the first primer set and the second primer set according to an embodiment of the present invention The results are shown.

In addition, Figure 4 shows the nucleotide sequences (SEQ ID NOs: 17 and 18) of PCR amplification products of Konji No. 7 wild type (NO8) and blue mutant type (P2) by the first primer set according to an embodiment of the present invention. , Figure 5 shows the nucleotide sequences (SEQ ID NOs: 19 and 20) of PCR amplification products of Konji No. 7 wild type (NO8) and blue mutant type (P2) by the second primer set according to an embodiment of the present invention.

3 to 5 , by using the first primer set or the second primer set of the present application, it is possible to quickly and accurately determine whether the oyster mushroom is mutated in the green color in one reaction.

Although the present invention has been described in detail through specific examples, this is intended to describe the present invention in detail, and the present invention is not limited thereto, and by those of ordinary skill in the art within the technical spirit of the present invention. It is clear that it can be modified or improved. All simple modifications and variations of the present invention fall within the scope of the present invention, and the specific protection scope of the present invention will be made clear by the appended claims.

<110> Korea National College of Agriculture and Fisheries <120> Composition for identification of a mutant of a Pleurotus ostreatus cap color and identification method using the same <130> NPF34110 <160> 20 <170> PatentIn version 3.2 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 1 gagatcgtcc tcagagtcag tc 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 2 ttaacaatgc gatgattgat gt 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 3 acatgtgtga aagtggatga aa 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 4 atacatattc gggtgtaaag cg 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 5 actatggaag gacttggtga tg 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 6 tgcgaagtga aatatggtta ca 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 7 cagaaacatc tcttccgcta tc 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 8 tgatcgtagt ctgtaccgtg ag 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 9 aatagatgca taagccagga ag 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 10 gacggtgttt gtagaagagg ag 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 11 cggatgtttg tagagtagag cc 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 12 gtattcggag gcaagaacat ac 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 13 ttgagatcga agactgagtt ga 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 14 tcaagtaacc gctaaactcc ac 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 15 gtacgttgcc gataatatgg at 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 16 tcatagctca actgctcgat aa 22 <210> 17 <211> 238 <212> DNA <213> Pleurotus ostreatus <400> 17 ttgagaaatg catcccttca gtcggatatt aactttcaag gggagcagaa ggctttcctt 60 caagtcctct tggttaatcc gggcttaccc aggtatgtgg gcccaaaagc gctgagcgcc 120 agatatccca atccagaggc cgaagaaggg cccgggtgag ttgaaggtgc tcagacattg 180 acattgagat gccgggcagg gtcaatagct gttagggagt attcgcggtg atacatga 238 <210> 18 <211> 228 <212> DNA <213> Pleurotus ostreatus <400> 18 ttgagaaatg catcccttca gtcggatatt aactttcaag gggagcagaa ggctttcctt 60 caagtcctct tggttaatcc gggcttaccc aggtatgtgg gcccaaaagc gcatatccca 120 atccagaggc cgaagaaggg cccgggtgag ttgaaggtgc tcagacattg acattgagat 180 gccgggcagg gtcaatagct gttagggagt attcgcggtg atacatga 228 <210> 19 <211> 178 <212> DNA <213> Pleurotus ostreatus <400> 19 gggatgtcgg atcatctttc tctgtcgtag caaatatagt cgaagtacct ttgaaagttt 60 tgcccggccg ccagagggaa ttcagcaact tctgtcagca aggtgattgc tcccgtcacc 120 tctgatgttc gaacggggtg ttaatgccat tttaggttct atttaagacg aacggtgc 178 <210> 20 <211> 169 <212> DNA <213> Pleurotus ostreatus <400> 20 gggatgtcgg atcatctttc tctgtcgtag caaatatagt cgaagtacct ttgaaagttt 60 tgcagaggga attcagcaac ttctgtcagc aaggtgattg ctcccgtcac ctctgatgtt 120 cgaacggggt gttaatgcca ttttaggttc tatttaagac gaacggtgc 169

Claims (6)

a first primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8; and
a second primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10; A composition for discriminating a oyster mushroom green mutation comprising one or more primer sets among them, and discriminating the oyster mushroom konji 7 mutant.
delete According to claim 1,
The oyster mushroom is a mushroom mycelium, a composition for identifying oyster mushroom fresh color mutation.
A kit for discriminating oyster mushroom cap color mutation, comprising the composition for discriminating the oyster mushroom cap color mutation according to claim 1 or 3.
(i) isolating DNA from the sample;
(ii) amplifying the DNA isolated in step (i) using the composition for discriminating oyster mushroom green mutation according to claim 1; and
(iii) confirming the PCR product amplified in step (ii); including, wherein the oyster mushroom is Konji No. 7, a method for determining the oyster mushroom green mutation.
delete

Images