CN108611435B

CN108611435B - Method and primer for identifying same-core sterile single spore strain of agaricus bisporus and mating type of same-core sterile single spore strain

Info

Publication number: CN108611435B
Application number: CN201810487586.7A
Authority: CN
Inventors: 陈辉; 张津京; 汪虹; 黄建春; 王倩
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2018-05-21
Filing date: 2018-05-21
Publication date: 2022-03-25
Anticipated expiration: 2038-05-21
Also published as: CN108611435A

Abstract

A method and primer for identifying the homonuclear sterile single spore strain and the mating type of the agaricus bisporus are provided, wherein the genome DNA of the agaricus bisporus is extracted, then PCR amplification is carried out by using a primer ABA1F1 and a primer ABA1R1, the obtained PCR amplification product is cut by endonuclease, and then the cut product is detected by 1-2% agarose gel electrophoresis; if the DNA fragment ABH1 obtained by amplification with specific primers can only be A⁺The enzyme digestion of the factor is carried out, and the strain is considered to be A of the homonuclear sterile monospore strain⁺Mating types of factors; if the DNA fragment ABH1 obtained by amplification with specific primers can only be A^‑The enzyme digestion of the factor is carried out, and the strain is considered to be A of the homonuclear sterile monospore strain^‑Mating type of factor. The method is used for identifying the homonuclear sterile monogenic strain and the mating type of the agaricus bisporus, and has the advantages of short time consumption, simple and convenient operation, high precision, mushroom production requirement and low cost.

Description

Method and primer for identifying same-core sterile single spore strain of agaricus bisporus and mating type of same-core sterile single spore strain

Technical Field

The invention relates to a method for identifying homonuclear sterile single spore strains of agaricus bisporus and mating types of the agaricus bisporus, and belongs to the technical field of biological detection.

Background

Agaricus bisporus (Agaricus bisporus) with Chinese name of Agaricus campestris, and white mushroom. It contains rich protein, polysaccharide, vitamins, nucleotide and unsaturated fatty acid, and has rich nutrients, rich meat quality, delicious taste, low heat energy and high health function. According to statistics of the edible fungus society of China, the total yield of agaricus bisporus in the country in 2015 reaches 337 million tons, wherein the industrialized daily yield of the agaricus bisporus reaches 417 tons, which indicates that the agaricus bisporus is more and more favored by consumers in China.

With the rapid development of the agaricus bisporus planting industry, the agaricus bisporus is not only related to the advanced cultivation process, but also related to the fact that the agaricus bisporus has strains suitable for factory production in China. As2796 is a new agaricus bisporus variety cultured by a crossbreeding method for the first time in China and becomes the only current variety in China. However, most of domestic industrial varieties of agaricus bisporus are imported abroad. There is no real factory variety which is completely suitable for domestic production process. The main reason is that agaricus bisporus breeders do not completely crack the separated agaricus bisporus homonuclear sterile single spore strains, and the cross breeding process of the agaricus bisporus is restricted. Generally, the breeder mushrooms the collected basidiospores, and if the basidiospores cannot be fruiting, the breeder considers the basidiospores as a single-spore sterile strain. This process is cumbersome, time-consuming and labor-intensive, and the mating type of the resulting monospore strain cannot be determined.

Disclosure of Invention

The invention aims to provide a method for identifying the homonuclear sterile single spore strain of agaricus bisporus and the mating type of the agaricus bisporus.

In order to achieve the purpose, the technical scheme provided by the invention is as follows: a primer for identifying the homonuclear sterile single spore strain and the mating type of the agaricus bisporus, wherein the primer comprises:

ABA1F1：ATCGTCGCAAGGGTAGGTAAGA；

ABA1R1：ATTTACTGAGCCGTCGGAAGAG。

in order to achieve the purpose, the technical scheme provided by the invention is as follows: a method for identifying the homonuclear sterile single spore strain of agaricus bisporus and the mating type thereof comprises the steps of extracting the genome DNA of the agaricus bisporus, carrying out PCR amplification by using a primer ABA1F1 and a primer ABA1R1, carrying out enzyme digestion on the obtained PCR amplification product by using endonuclease, and detecting the enzyme digestion product by 1-2% agarose gel electrophoresis;

ABA1F1：ATCGTCGCAAGGGTAGGTAAGA；

ABA1R1：ATTTACTGAGCCGTCGGAAGAG。

the preferable technical scheme is as follows: the PCR amplification reaction system comprises: 50 ng/. mu.l of Agaricus bisporus genomic DNA 0.5. mu.l, 10. mu. mol/L of primer 2. mu.l, 0.1mmol/L dNTP 2. mu.l, high fidelity enzyme pfu 0.5. mu.l, 5. mu.l of PCR buffer using ddH₂The amount of O was adjusted to 50. mu.l.

The preferable technical scheme is as follows: the conditions of the PCR amplification reaction are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles.

The preferable technical scheme is as follows: the enzyme digestion reaction conditions are as follows: (1) a. the⁺Factor endonuclease 0.5. mu.l, A^-The endonuclease content of factor was 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11. mu.l in a total volume of 20. mu.l, incubated at 37 ℃ for 3 hours; carrying out electrophoresis on the enzyme digestion product by using 1-2% agarose gel, dyeing by using a GeneFinder fluorescent dye and photographing; (2) a. the⁺Factor endonuclease 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11.5. mu.l, total volume 20. mu.l, incubation at 37 ℃ for 3 hours, electrophoresis of the enzyme digestion product on 1-2% agarose gel, staining with GeneFinder fluorescent dye and photography; (3) a. the^-The endonuclease content of factor was 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11.5. mu.l, total volume 20. mu.l, incubation at 37 ℃ for 3 hours, electrophoresis of the cleaved products on 1-2% agarose gel, staining with GeneFinder fluorescent dye and photography.

The preferable technical scheme is as follows: if the PCR amplification product can only be A⁺The enzyme digestion of the factor is carried out, so that the strain is A of the homonuclear sterile monospore strain⁺Mating types of factors; if the PCR amplification product can only be A^-The enzyme digestion of the factor is carried out, so that the strain is A of the homonuclear sterile monospore strain^-Mating type of factor, if PCR amplification product is bothCan be covered with A⁺The factor endonuclease can be cut by A^-The enzyme of the factor is used for enzyme digestion, and the strain is a double karyon strain.

The preferable technical scheme is as follows: a. the⁺The endonuclease of the factor is selected from endonucleases BsaHI, BtsSaI, BsmI, BspHI, EcoRV, StyI, NdeI, BanI, BpmI; a. the^-The endonuclease of the factor is selected from the group consisting of endonucleases XmnI, DrdI, TsoI, TliI, AraI, SmlI, XhoI, BsoBI, PaeR7I, BmeT110, PshAI, SpeI, BaeGI, Bsp1286I, Bme1580I, SapI, BspQI, SfcI.

The preferable technical scheme is as follows: a. the⁺The endonuclease of the factor is endonuclease EcoRV, A^-The endonuclease of the factor is endonuclease XhoI, BmeT110I or SpeI.

The preferable technical scheme is as follows: the method for extracting the genome DNA of the agaricus bisporus comprises the following steps: collecting spores of mature Agaricus bisporus fruiting body with spore collector, and adding ddH₂Diluting O to 10⁵And (3) coating 100 mu l of spore suspension on a PDA (personal digital assistant) plate after cfu/ml of spore suspension, transferring a single colony growing on the PDA plate to a new PDA plate, directly picking hyphae after the culture is finished, putting the hyphae in a DNA lysate, and carrying out warm bath at 80 ℃ for 5min to obtain the bacillus coagulans.

The preferable technical scheme is as follows: the method for extracting the genome DNA of the agaricus bisporus comprises the following steps: culturing mycelium of Agaricus bisporus strain in liquid PDA at 25 deg.C for 5-7 days, collecting mycelium, and performing enzyme digestion with muramidase with mass concentration of 1.5%, wherein the enzymolysis temperature is 30 deg.C and the enzymolysis time is 3 h; washing the protoplast with 0.6M mannitol, collecting, and diluting the protoplast to 10⁵Spore suspension with cfu/ml concentration, then coating 100 mul spore suspension on PDA plate, and culturing at 25 deg.C; placing single colony hypha germinated by protoplast in DNA lysate, and performing warm bath at 80 deg.C for 5min to obtain the final product.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

aiming at the two problems of difficulty in screening and difficulty in identifying sterile mating types of the agaricus bisporus single-spore sterile strains, a section of specific gene sequence is firstly screened aiming at a mating type A factor genome sequence of the agaricus bisporus, enzyme digestion sites are designed according to SNP sites of the screened gene sequence, and a special sequence is subjected to enzyme digestion by utilizing an enzyme digestion mode, so that the method for distinguishing the single-spore sterile strains with different mating types and the application of the method in agaricus bisporus breeding can be realized.

Drawings

FIG. 1 is a diagram for distinguishing the enzyme digestion map of the same-nucleus sterile strain of Agaricus bisporus by using an enzyme digestion method.

FIG. 2 shows electrophoretogram of spore homonuclear sterile strain screened by enzyme cutting method.

FIG. 3 restriction electrophoresis of protoplast strains.

Detailed Description

The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.

The first embodiment is as follows: method for identifying homonuclear sterile single spore strain of agaricus bisporus and mating type of agaricus bisporus

The invention establishes a method for simply and rapidly identifying the homonuclear sterile single spore strain of the agaricus bisporus and the mating type thereof based on a molecular marker technology.

The invention is based on the mating type gene A factor sequence of agaricus bisporus, PCR amplification is carried out on the characteristic segment of the mating type gene of agaricus bisporus, amplification primers are seq.No.1 and seq.No.2, the lengths of the characteristic segment obtained by amplification in monokaryons with different mating types are 737bp and 730bp respectively, and the characteristic segment with the length of 737bp is named as A⁺The factor, the sequence of which is shown in seq.No. 4; the length of the DNA fragment is 730bp and is named as A^-The factor, the sequence of which is shown in seq.No. 3; .

A of two monokaryons⁺And A^-The factors were aligned and found to differ only in the SNP site. And (3) carrying out enzyme digestion according to different sites and different enzyme digestion sites of two sequences of the factor A, screening strains of the monokaryons according to the difference of enzyme digestion maps, and identifying the mating types of the monokaryons.

These are notThe same site is from A⁺Factor to A^-The factor bits are respectively: t is₉₃-A₉₃,C₁₂₇-G₁₂₇, T₁₇₀-C₁₆₉,T₁₇₇-G₁₇₄,T₂₂₉-C₂₂₉,G₂₄₁A₂₄₂-A₂₄₁T₂₄₂,T₂₅₈-G₂₅₇,A₃₃₃-G₃₃₁,C₃₉₂-G₃₉₂,A₄₁₇T₄₁₉-C₄₁₁C₄₁₃,G₄₈₃C₄₈₅A₄₈₆-A₄₈₉T₄₉₁G₄₉₂,G₄₉₉-A₅₀₅,C₅₀₄-T₅₁₀,G₅₂₇A₅₂₈-C₅₁₈T₅₁₉,C₅₃₃T₅₃₄-A₅₂₄A₅₂₅,-/-G₅₆₂,T₅₇₀-A₅₇₈。

A⁺The specific cleavage sites of the factor sequence are: BsaHI₉₀, BtSaI₁₂₆, BSmI₁₇₃, BspHI₂₃₇,EcoRV₂₅₆,StyI₂₅₉, NdeI₃₃₆,BanI₄₈₃,BpmI₄₈₆; A^-The specific enzyme cutting sites are: XmnI₁₉₃,DrdI₂₃₃, TsoI₂₇₁, TliI/AraI/SmlI/XhoI/BsoBI/PaeR7I₃₂₆,BmeT110₃₂₇,PshAI₃₈₉,SpeI₄₁₇, BaeGI/Bsp1286I/Bme1580I₄₉₄, SapI/BspQI₅₂₄, SfcI₅₇₅。

To A⁺Performing enzyme digestion on the factor specific fragment, wherein the size of the specific fragment subjected to enzyme digestion by the endonuclease BsaHI is 90bp and 640bp, the size of the specific fragment subjected to enzyme digestion by BtsaI is 126bp and 604bp, and the size of the specific fragment subjected to enzyme digestion by the BSmI is 173bp and 557 bp; the size of the BspHI enzyme digestion specific fragment is 237bp and 493 bp; the sizes of the EcoRV enzyme digestion specific fragments are 256bp and 474 bp; the size of the StyI enzyme digestion specific fragment is 259bp and 471 bp; the size of the NdeI enzyme digestion specific fragment is 336bp and 394 bp; the size of the BanI enzyme digestion specific fragment is 247bp and 483 bp; the size of the BanI enzyme digestion specific fragment is 336bp and 394 bp; the size of the BpmI enzyme digestion specific fragment is 247bp and 483 bp.

To A^-Factor specificityCarrying out enzyme digestion on the fragments, wherein the sizes of specific fragments obtained by the enzyme digestion of endonuclease XmnI are 193bp and 543bp, and the sizes of specific fragments obtained by the enzyme digestion of DrdI are 233bp and 503 bp; the size of the TsoI enzyme digestion specific fragment is 271bp and 465 bp; the sizes of the TliI/AraI/SmlI/XhoI/BsoBI/PaeR7I enzyme digestion specific fragments are 326bp and 410 bp; the size of the BmeT110 enzyme digestion specific fragment is 327bp and 409 bp; the size of the PshAI enzyme digestion specific fragment is 389bp and 347 bp; the size of the SpeI enzyme digestion specific fragment is 417bp and 319 bp; the size of the enzyme digestion specific fragment of BaeGI/Bsp1286I/Bme1580I is 242bp and 494 bp; the size of the digestion specific fragment of the SapI/BspQI is 212bp and 524 bp; the size of the SfcI enzyme digestion specific fragment is 161bp and 575 bp.

Using the obtained A⁺And A^-Combining the incision enzymes respectively according to different incision enzyme sites on the factor sequence, then incising the PCR product obtained by PCR amplification, carrying out 1.5% agarose gel electrophoresis on 5 mu l of the obtained incision enzyme product, and observing the incision enzyme result.

The PCR amplification conditions are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, 30 cycles, and storage at 4 deg.C. The reaction system is as follows: 50 ng/. mu.l genomic DNA 0.5. mu.l, 10. mu. mol/L primer 2. mu.l, 0.1mmol/L dNTP 2. mu.l, fidelity enzyme 0.5. mu.l, 5. mu.l PCR buffer with ddH₂The amount of O was adjusted to 50. mu.l.

The enzyme cutting conditions are as follows: endonuclease A was 0.5. mu.l, endonuclease B was 0.5. mu.l, endonuclease Buffer was 2. mu.l, PCR product was 6. mu.l, ddH2O 11. mu.l in a total volume of 20. mu.l, and incubation was carried out at 37 ℃ for 3 hours.

The method is applied to screening spore monokaryon strains and distinguishing their mating types and screening protoplast homonuclear sterile strains and distinguishing their mating types.

A primer for identifying the homonuclear sterile single spore strain and the mating type of the agaricus bisporus, wherein the primer comprises:

ABA1F1：ATCGTCGCAAGGGTAGGTAAGA；

ABA1R1：ATTTACTGAGCCGTCGGAAGAG。

a method for identifying the homonuclear sterile single spore strain of agaricus bisporus and the mating type thereof comprises the steps of extracting the genome DNA of the agaricus bisporus, carrying out PCR amplification by using a primer ABA1F1 and a primer ABA1R1, carrying out enzyme digestion on the obtained PCR amplification product by using endonuclease, and detecting the enzyme digestion product by 1-2% agarose gel electrophoresis;

ABA1F1：ATCGTCGCAAGGGTAGGTAAGA；

ABA1R1：ATTTACTGAGCCGTCGGAAGAG。

the preferred embodiment is: the PCR amplification reaction system comprises: 50 ng/. mu.l of Agaricus bisporus genomic DNA 0.5. mu.l, 10. mu. mol/L of primer 2. mu.l, 0.1mmol/L dNTP 2. mu.l, high fidelity enzyme pfu 0.5. mu.l, 5. mu.l of PCR buffer using ddH₂The amount of O was adjusted to 50. mu.l.

The preferred embodiment is: the conditions of the PCR amplification reaction are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles.

The preferred embodiment is: the enzyme digestion reaction conditions are as follows: (1) a. the⁺Factor endonuclease 0.5. mu.l, A^-The endonuclease content of factor was 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11. mu.l in a total volume of 20. mu.l, incubated at 37 ℃ for 3 hours; carrying out electrophoresis on the enzyme digestion product by using 1-2% agarose gel, dyeing by using a GeneFinder fluorescent dye and photographing; (2) a. the⁺Factor endonuclease 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11.5. mu.l, total volume 20. mu.l, incubation at 37 ℃ for 3 hours, electrophoresis of the enzyme digestion product on 1-2% agarose gel, staining with GeneFinder fluorescent dye and photography; (3) a. the^-The endonuclease content of factor was 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11.5. mu.l, total volume 20. mu.l, incubation at 37 ℃ for 3 hours, electrophoresis of the cleaved products on 1-2% agarose gel, staining with GeneFinder fluorescent dye and photography.

The preferred embodiment is: if the PCR amplification product can only be A⁺The enzyme digestion of the factor is carried out, so that the strain is A of the homonuclear sterile monospore strain⁺Mating types of factors; if the PCR amplification product can only be A^-The enzyme digestion of the factor is carried out, so that the strain is A of the homonuclear sterile monospore strain^-Mating type of factor produced if PCR amplifiedArticle can be covered by A⁺The factor endonuclease can be cut by A^-The enzyme of the factor is used for enzyme digestion, and the strain is a double karyon strain.

The preferred embodiment is: a. the⁺The endonuclease of the factor is selected from endonucleases BsaHI, BtsSaI, BsmI, BspHI, EcoRV, StyI, NdeI, BanI, BpmI; a. the^-The endonuclease of the factor is selected from the group consisting of endonucleases XmnI, DrdI, TsoI, TliI, AraI, SmlI, XhoI, BsoBI, PaeR7I, BmeT110, PshAI, SpeI, BaeGI, Bsp1286I, Bme1580I, SapI, BspQI, SfcI.

The preferred embodiment is: a. the⁺The endonuclease of the factor is endonuclease EcoRV, A^-The endonuclease of the factor is endonuclease XhoI, BmeT110I or SpeI.

The preferred embodiment is: the method for extracting the genome DNA of the agaricus bisporus comprises the following steps: collecting spores of mature Agaricus bisporus fruiting body with spore collector, and adding ddH₂Diluting O to 10⁵And (3) coating 100 mu l of spore suspension on a PDA (personal digital assistant) plate after cfu/ml of spore suspension, transferring a single colony growing on the PDA plate to a new PDA plate, directly picking hyphae after the culture is finished, putting the hyphae in a DNA lysate, and carrying out warm bath at 80 ℃ for 5min to obtain the bacillus coagulans.

In the present embodiment, the mating type gene A is based on the difference in SNP sites of specific fragments obtained by PCR amplification⁺And A^-The cleavage sites on the sequence of the factor are different. Screened A⁺The enzyme cutting site of the factor is selected from EcoRV, which can convert A into⁺Cutting the factor sequence into 257bp and 479 bp; from A^-The restriction enzyme sites of the factor are selected from restriction enzymes XhoI or BmeT110I or SpeI for respectively restriction enzyme cutting, and 327bp and 409bp, 328bp and 407bp, 313bp and 418bp size sequences can be respectively obtained.

The enzyme cutting conditions are as follows: endonuclease EcoRV 0.5. mu.l, endonuclease XhoI or BmeT110I or SpeI0.5. mu.l, M Buffer 2. mu.l, PCR product 6. mu.l, ddH₂O11. mu.l in a total volume of 20. mu.l were incubated at 37 ℃ for 3 hours. Mu.l of the obtained cleavage product was subjected to 1.5% agarose gel electrophoresis, and the cleavage result was observed.

The enzyme cutting result is divided into three types: the DNA sequence can be cut into 257bp and 479bp sequences only by the endonuclease EcoRV, and the mating type is A⁺(ii) a Can only be cut by endonuclease XhoI or BmeT110I or SpeI to obtain 327bp and 409bp or 328bp and 407bp or 313bp and 418bp sequences, and the mating type is A^-The strains which can be simultaneously cut by EcoRV and XhoI or BmeT110I or SpeI are the diakaryon strains.

The results of this embodiment are shown in FIG. 1, where M is marker; 1 is cutting ABA1F1 fragment by using an endonuclease EcoRV; 2-4 cutting ABA1F1 fragment by using endonucleases XhoI, BmeT110I and speI respectively; 5 is a double cleavage of the ABA1F1 fragment with EcoRV and Xho I. The four lower arrows indicate the known A of the endonuclease⁺The EcoRV enzyme cleaves the banding pattern of the A1B1 fragment, and it is shown that the endonucleases Xho I, Bmet110I and Spe I are unable to cleave single spores.

Example two: method for identifying homonuclear sterile single spore strain of agaricus bisporus and mating type of agaricus bisporus

High fidelity enzyme pfu, dNTPs, enzyme Buffer from Biyunnan Biotech, Inc., endonucleases EcoRV and Xho I from great Jersey, specific primers ABA1F 1: ATCGTCGCAAGGGTAGGTAAGA and ABA1R 1: ATTTACTGAGCCGTCGGAAGAG was purchased from Shanghai Biotechnology, Inc.

Agaricus bisporus spores were collected from fruiting bodies of strain A15 grown by edible fungus Cooperation in Shanghai Council. Collecting spores of mature fruiting body with steamed stuffed bun collector, and adding ddH₂Diluting O to 10⁵Spore suspension at concentration, 100. mu.l was spread on PDA plates. The single colonies that grew on the plate were then transferred to a PDA plate.

Performing mycelium PCR on the separated strain, namely directly picking a trace amount of mycelium and placing the trace amount of mycelium in a DNA lysate, and performing warm bath at 80 ℃ for 5min to obtain a template for performing PCR. The DNA lysate was purchased from Shanghai Biotech Ltd.

The PCR amplification conditions were: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, 30 cycles, and storage at 4 deg.C. The reaction system is as follows: 50 ng/. mu.l genomic DNA 0.5. mu.l, 10. mu. mol/L primer 2. mu.l, 0.1mmol/LdNTP 2. mu.l, fidelity enzyme 0.5. mu.l, 5. mu.l PCR buffer, using ddH₂The amount of O was adjusted to 50. mu.l.

The obtained PCR product is directly subjected to two types of single enzyme digestion, namely enzyme digestion by EcoRV and Xho I respectively.

The enzyme digestion conditions are as follows: the endonuclease EcoRV was 0.5. mu.l, 2. mu.l of M Buffer, 6. mu.l of the PCR product, and 11.5. mu.l of ddH2O in a total volume of 20. mu.l, and incubated at 37 ℃ for 3 hours. The cleaved products were electrophoresed on a 1.5% agarose gel, stained with GeneFinder fluorescent dye and photographed.

Endonuclease XhoI was 0.5. mu.l, 2. mu.l of M Buffer, PCR product 6. mu.l, ddH₂O was 11.5. mu.l, the total volume was 20. mu.l, and the mixture was incubated at 37 ℃ for 3 hours. The cleaved products were electrophoresed on a 1.5% agarose gel, stained with GeneFinder fluorescent dye and photographed. As shown in FIG. 2, X1 and E1 refer to the same spore sterile mononuclear strain which is simultaneously digested by XhoI and EcoRV; x2 and E2 refer to the same spore sterile monogenic strain cut with XhoI and EcoRV simultaneously.

And (4) analyzing results: one of 24 randomly selected spore-germinating bacterial strains can be cut by EcoRV enzyme and cannot be cut by XhoI enzyme, so that the bacterial strain is proved to be A of homonuclear sterile single spore bacterial strain⁺Mating types of factors; the other strain can be cut by XhoI and cannot be cut by EcoRV, which indicates that the strain is A of homonuclear sterile single spore strain^-Mating type of factor.

Example three: method for identifying homonuclear sterile single spore strain of agaricus bisporus and mating type of agaricus bisporus

High fidelity enzymes pfu, dNTPs, enzyme Buffer from picnic biotechnology ltd, endonucleases EcoRV and Xho i from great saprophyton, lywallzyme from guangzhou institute of microbiology, specific primers ABA1F 1: ATCGTCGCAAGGGTAGGTAAGA and ABA1R 1: ATTTACTGAGCCGTCGGAAGAG was purchased from Shanghai Biotechnology, Inc.

The preparation technology of protoplast of agaricus bisporus strain As2796 comprises the following steps: culturing mycelium of Agaricus bisporus As2796 strain in liquid PDA at 25 deg.C for 5-7 days, collecting mycelium, and performing enzyme digestion with 1.5% muramidase at 30 deg.C for 3 hr. The protoplasts obtained were collected by washing with 0.6M mannitol. The obtained protoplasts were diluted to 105 concentrations, 100. mu.l thereof was plated on PDA plates and cultured at 25 ℃.

Hypha PCR is carried out on single colony hyphae germinated by the protoplast: directly picking out trace amount of mycelia, placing in DNA lysate, and performing warm bath at 80 deg.C for 5min to obtain template for PCR. The DNA lysate was purchased from Shanghai Biotech Ltd.

The PCR amplification conditions were: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, 30 cycles, and storage at 4 deg.C. The reaction system is as follows: mu.l of 50 ng/. mu.l genomic DNA, 2. mu.l of 10. mu. mol/L primer, 2. mu.l 0.1mmol/L dNTP, 0.5. mu.l fidelity enzyme, 5. mu.l PCR buffer, and filled to 50. mu.l with ddH 2O.

Endonuclease XhoI was 0.5. mu.l, 2. mu.l of M Buffer, PCR product 6. mu.l, ddH₂O was 11.5. mu.l, the total volume was 20. mu.l, and the mixture was incubated at 37 ℃ for 3 hours. The cleaved products were electrophoresed on a 1.5% agarose gel, stained with GeneFinder fluorescent dye and photographed. As shown in FIG. 3, X1 and E1 refer to the same protoplast monogenic sterile strain that is digested simultaneously with XhoI and EcoRV; x2 and E2 refer to the same protoplast monogenic sterile strain cut by XhoI and EcoRV at the same time; x3 and E3 refer to the same protoplast monogenic sterile strain cut with XhoI and EcoRV simultaneously.

And (4) analyzing results: as shown in FIG. 3, 24 protoplast-germinated strains were randomly selected,specifically synthesized primers ABA1F1 and ABA1R1 are used for amplification, and endonuclease EcoRV and XhoI are used for respectively performing single enzyme digestion on PCR products to obtain three protoplast homonuclear sterile strains. The three protoplast homonuclear sterile strains can be simultaneously digested by XhoI and EcoRV, and their mating type factors are A of homonuclear sterile single spore strain^-Mating type of factor.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> a method and primers for identifying homonuclear sterile single spore strain of Agaricus bisporus and mating type thereof

<160>4

<210>1

<211>22

<212>DNA

<213> Artificial sequence

<400>1

ATCGTCGCAA GGGTAGGTAA GA

<210>2

<211>22

<212>DNA

<213> Artificial sequence

<400>2

ATTTACTGAG CCGTCGGAAG AG

<210>3

<211>730

<212>DNA

<213> Artificial sequence

<400>3

ATCGTCGCAA GGGTAGGTAA AATCGATGAA AGTCTTGCAC AGAGAAGTGA TACGCGACGA 60

GATGCTATCC ACCAGGGCTT TATCTTCCGG CGTCAGTTGG TTGGCGTTGG TCGCTTTCAT 120

TATGTCCACT GCCAGTGTAT TCCAAGTTTG CTCGAAGTCC TCCATAGAAT GCTCATTTGA 180

AGCGGCGAGG AACGATTGTT CAGCCTGAAG CAAACGCTTG CGTATCGATG AGATAGTCAT 240

GATGGGATAT GAAGATATCC AAGGTTGCGG CGTGCCACGG CGTATGCAGA GGAAATGGAG 300

AGAGAGAAAA GGCAGACAAT GGGCAATCTC GAAGCATATG ACTGATTAAG TAAGACAATG 360

GGACATTAAC ACGATGCACC TGACTGTTCT CACTTTCGCA CTCCTTCCTT CCCAGTTCTT 420

ACCTTCCTCA CCATGTCTCC CAAAATCCAA GAAACCTGTC GAGCTATCTT GGACTCGCTG 480

ACGGCACCCT CATTCAATGT CTCCAGGCCA CCTCTTCAAT TCGGCGGACT TCCTAATTCA 540

TCAAGGAATA ACTGGACTCC ACCTCCTCTT CAGTTTCCCC CAATACCATC CCCGGTGGCA 600

CAACTCGTGC AACTAGGATG CACTTTCGAA GAGTCTCAGG AAGCTGCGAA CGTATTTGCA 660

TCACGTGTGA AAGATCTGCA GTCGACTTAT GAGCGTCACT ATGAGAAACT TTTCCGACGG 720

CTCAGTAAAT 730

<210>4

<211>737

<212>DNA

<213> Artificial sequence

<400>4

ATCGTCGCAA GGGTAGGTAA GATCGATAAA AGTCTTGCAC AGAGAAGTGA TGCGCGACGA 60

GACAATATCA GCCAAGGATT TATCTTCCGG CGACATTTGG TTGGCACTGG TCGCTTTCAC 120

AATGTCGACT GCCAATGTGT TCCAAGTTTG CTCGAAGTCC TCCATAAAAC GCTCATTTGA 180

AGCGGCGAGA AATGATTCTT CAGCCTGAAG TAGACGCTTT CGTATCGACG AGACAGTCAT 240

ATGGGAGATG AAGATAGCCA AGGTTGCAGC GTGCCACGGT GTATGCAAAG GAAATGGAGA 300

GAGAGAAAAG CAGACAATGG GCAATCTCGA GCATATGACT GATTATGTAA GACAATGGGA 360

CATTCACGAA TCACGGATGC ACCTGACTGT TGTCACTCTC GCACTCCTTC CCCCCTACTA 420

GTTCTTACCT CCCTCACCAT GTCTCCTAAA ATCCAAGAAA CTTGTCAAGC TATCTTGGAT 480

TCGCTGAGAG TGCCCTCATT CAATATCTCT AGGCCAGCTC TTCAATTCGG CGGACTTTCT 540

AATTCATCAA GGAATAACTG GGACTCTACC TCCTCTACAG TTTCCCCCAA TACCATCCCC 600

GGCGGCCCAA CTCGTGCAAC TAGGATGCGC TTTCGAAGAG TCTCAGGAAG CCGCGAACAT 660

ATTTGCATCA CGTGTGAAAG ATTTGCAGTC GACTTACGAG CGTCACTATG AAAAACTCTT 720

CCGACGGCTC AGTAAAT 737

Claims

1. A primer for identifying the homonuclear sterile single spore strain and the mating type of the agaricus bisporus is characterized in that: the primer comprises:

ABA1F1：ATCGTCGCAAGGGTAGGTAAGA；

ABA1R1：ATTTACTGAGCCGTCGGAAGAG。

2. a method for identifying the homonuclear sterile single spore strain of agaricus bisporus and the mating type thereof is characterized in that: extracting genome DNA of agaricus bisporus, carrying out PCR amplification by using a primer ABA1F1 and a primer ABA1R1, carrying out enzyme digestion on an obtained PCR amplification product by using endonuclease, and detecting the enzyme digestion product by 1-2% agarose gel electrophoresis;

ABA1F1：ATCGTCGCAAGGGTAGGTAAGA；

ABA1R1：ATTTACTGAGCCGTCGGAAGAG；

the enzyme digestion reaction conditions are as follows: (1) a. the⁺Factor endonuclease 0.5. mu.l, A^-The endonuclease content of factor was 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11. mu.l in a total volume of 20. mu.l, incubated at 37 ℃ for 3 hours; carrying out electrophoresis on the enzyme digestion product by using 1-2% agarose gel, dyeing by using a GeneFinder fluorescent dye and photographing; (2) a. the⁺Factor endonuclease 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11.5. mu.l, total volume 20. mu.l, incubation at 37 ℃ for 3 hours, electrophoresis of the enzyme digestion product on 1-2% agarose gel, staining with GeneFinder fluorescent dye and photography; (3) a. the^-The endonuclease content of factor was 0.5. mu.l, M Buffer 2. mu.l, PCR amplification product 6. mu.l, ddH₂O11.5. mu.l, total volume 20. mu.l, incubation at 37 ℃ for 3 hours, electrophoresis of the enzyme digestion product on 1-2% agarose gel, staining with GeneFinder fluorescent dye and photography;

if the PCR amplification product can only be A⁺The enzyme digestion of the factor is carried out, so that the strain is A of the homonuclear sterile monospore strain⁺Mating types of factors; if the PCR amplification product can only be A^-The enzyme digestion of the factor is carried out, so that the strain is A of the homonuclear sterile monospore strain^-Mating types of factors, if the PCR amplification product can be substituted by A⁺The factor endonuclease can be cut by A^-The endonuclease of the factor is used for enzyme digestion, so that the strain is a double-nucleosomal strain;

A⁺the endonuclease of the factor is selected from endonucleases BsaHI, BtsSaI, BsmI, BspHI, EcoRV, StyI, NdeI, BanI, BpmI; a. the^-The endonuclease of the factor is selected from the group consisting of endonucleases XmnI, DrdI, TsoI, TliI, AraI, SmlI, XhoI, BsoBI, PaeR7I, BmeT110, PshAI, SpeI, BaeGI, Bsp1286I, Bme1580I, SapI, BspQI, SfcI.

3. The method for identifying homonuclear sterile single spore strains of Agaricus bisporus and their mating types according to claim 2, wherein: the PCR amplification reaction system comprises: 50 ng/. mu.l of Agaricus bisporus genomic DNA 0.5. mu.l, 10. mu. mol/L of primer 2. mu.l, 0.1mmol/L dNTP 2. mu.l, high fidelity enzyme pfu 0.5. mu.l, 5. mu.l of PCR buffer using ddH₂The amount of O was adjusted to 50. mu.l.

4. The method for identifying homonuclear sterile single spore strains of Agaricus bisporus and their mating types according to claim 2, wherein: the conditions of the PCR amplification reaction are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles.

5. The method for identifying homonuclear sterile single spore strains of Agaricus bisporus and their mating types according to claim 2, wherein: a. the⁺The endonuclease of the factor is endonuclease EcoRV,A^-the endonuclease of the factor is endonuclease XhoI, BmeT110I or SpeI.

6. The method for identifying homonuclear sterile single spore strains of Agaricus bisporus and their mating types according to claim 2, wherein: the method for extracting the genome DNA of the agaricus bisporus comprises the following steps: collecting spores of mature Agaricus bisporus fruiting body with spore collector, and adding ddH₂Diluting O to 10⁵And (3) coating 100 mu l of spore suspension on a PDA (personal digital assistant) plate after cfu/ml of spore suspension, transferring a single colony growing on the PDA plate to a new PDA plate, directly picking hyphae after the culture is finished, putting the hyphae in a DNA lysate, and carrying out warm bath at 80 ℃ for 5min to obtain the bacillus coagulans.

7. The method for identifying homonuclear sterile single spore strains of Agaricus bisporus and their mating types according to claim 2, wherein: the method for extracting the genome DNA of the agaricus bisporus comprises the following steps: culturing mycelium of Agaricus bisporus strain in liquid PDA at 25 deg.C for 5-7 days, collecting mycelium, and performing enzyme digestion with muramidase with mass concentration of 1.5%, wherein the enzymolysis temperature is 30 deg.C and the enzymolysis time is 3 h; washing the protoplast with 0.6M mannitol, collecting, and diluting the protoplast to 10⁵Spore suspension with cfu/ml concentration, then coating 100 mul spore suspension on PDA plate, and culturing at 25 deg.C; placing single colony hypha germinated by protoplast in DNA lysate, and performing warm bath at 80 deg.C for 5min to obtain the final product.