RU2539756C1 - Highly specific dna marker, used as endogenous reference control for detecting potato genomic dna in plant material and food products, including in gmo identification - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly a biological DNA marker for detecting potato genomic DNA S. tuberosum and related wild-growing types of Solanum sect. Petota in plant material and food products, which is oligonucleotide primers of the polymerase reaction SEQ ID No. 1 - 5'-CAAAAACAAACTGAACGAACATGCATTC-3' SEQ ID No. 2 - 5'GCGTTGACGTTCACACGGATG-3', which enable to amplify the Sus4 gene in potato S. tuberosum and related wild-growing types of Solanum sect. Petota, as well as in potato processing products, and thereby identify potato DNA.

EFFECT: invention enables to efficiently detect potato genomic DNA S tuberosum and related wild-growing types of Solanum sect Petota in plant material and food products.

4 dwg, 1 ex

Description

The invention is a biological DNA marker for detecting the genomic DNA of potato S. tuberosum and related wild species of the genus Solanum sect. Petota in plant material and food products. The invention relates to molecular biology and plant biotechnology and represents the original nucleotide sequence of the Sus4 gene fragment encoding sucrose synthase, a key enzyme for the breakdown of sucrose in potato tubers, and a pair of oligonucleotide PCR primers for amplification of this DNA fragment.

Sucrose synthase (sucrose-uridine diphosphate glycosyltransferase EC 2.4.1.13) is an enzyme that catalyzes the reversible conversion of sucrose in tubers in the presence of UDP to UDP-glucose and fructose. The main function of the enzyme is to provide the plant with a substrate for the synthesis of starch. According to sequencing of the potato genome, it was shown that the enzyme is encoded by the monocopy Sus4 gene located on the 12th potato chromosome, and its sequence is highly specific for the potato genome (Potato Genome Sequencing Consortium, 2011).

The invention is intended for the qualitative and quantitative detection of genomic copies of target (potato) DNA (including genetically modified), both in the plant material of cultivated potato varieties of the genus Solanum, section Petota, and in its processed products (cereals, extracts, etc.), by mass analysis by polymerase chain reaction (PCR) and / or PCR with real-time detection.

Currently, to determine the presence of DNA of a given object, including GMO (genetically modified object), in the studied material, including food products and processed products of plant material (cereals, extracts, etc.), two alternative methods based on on the qualitative identification of either proteins or nucleic acids.

A known method for identifying plant proteins using appropriate antibodies (Stave J.W., Food Control, 1999, vol. 10, pp. 367-374). A known method for the detection of recombinant foreign proteins in foods using specific antibodies to these proteins (patent No. WO 0198523 (A2) - DETECTION METHOD OF GENETIC RECOMBINANT FOOD AND DETECTION KIT OF THAT, authors PARK HEE-YOUNG [KR], GD BIOTECH CO LTD [KR]; PARK HER YOUNG [KR], 2001).

Also known is a method for determining the presence of GMOs based on an analysis of the protease cleavage map of recombinant proteins that are expressed in genetically modified plants (patent No. KR 20020000127 (A) - DETECTION METHOD OF GENETICALLY MODIFIED ORGANISM AND DETECTION KIT THEREOF, author PARK HUI YEONG [KR], GD BIOTECH CO LTD [KR], 2006).

The disadvantages of the above methods is the inability to detect recombinant / foreign proteins in food products, in plant materials and its processed products that have undergone thermal, chemical or microbiological processing. This is due to the fact that during chemical and / or physical influences, the proteins of an object are able to decompose and change their conformation, secondary structure. In addition, these methods are characterized by low sensitivity, take a lot of time and require significant material costs.

Closest to the proposed method are inventions based on the detection of nucleic acids (DNA) specific for the detection of genomic copies of the target DNA of an object in a test plant material, its processed products and food products. This approach involves analysis using the method of polymerase chain reaction (PCR) / hybridization with specific oligonulotide primers or DNA probes characteristic of foreign DNA. Specific oligonulotide primers or DNA probes are used both for the detection of the most foreign (transgenic) DNA itself, and as an endogenous reference control for the presence of DNA from a cultivated plant - a carrier of GMOs in its processed products. Such endogenous reference controls are highly specific gene markers of cultivated plants.

Currently, there is a known method for the quantitative and qualitative analysis of genetically modified plants (beans, corn) and their processed products based on mass spectrometry and rcPCR (real-competitive PCR) using specific primer sets (patent No. KR 20110126306, A METHOD FOR ANALYZING GMO USING COMPETITIVE PCR, authors Lee Myung Hoon; Han Sang Mi; Lee Soo Bin; Lee Hyun Chul, D & AMP P BIOTECH LTD.).

Also known is the method of qualitative and quantitative detection of genetically modified potatoes in the products of its processing using primers and a standard plasmid. For detection, NLL, Cry3A, UGP-pb primer sets are used, including primers based on the UDP-glucose phosphorylase gene (patent No. KR 20040079053, PRIMER SETS AND PROBES FOR DETECTION OF GMO, AND STANDARD PLASMID FOR QUALITATIVE AND QUANTITATIVE DETECTION OFO TO Efficient 2004).

In addition, a number of applications for similar inventions were identified in the domestic database.

A method for identifying DNA sequences of transgenic plants in food products is described, which involves the use of a biochip and specific oligonucleotides for the detection and amplification of the 35S promoter marker from cauliflower mosaic virus, the NOS marker, mainly to identify the 3 ′ untranslated region of the nopalin synthase gene, the OCS marker, mainly for identification 3 ′ The untranslated region of the octopinsynthase gene, the NPTII marker, primarily for identifying the gene encoding neomycin phosphotransferase II, GUS marker - mainly for identifying a gene encoding beta-glucuronidase, Lectin marker - mainly for identifying a gene of the Lel family from Glycine max, Zein marker - mainly for identifying a gene of the Zein family from Zea mays, bar marker - mainly for identifying a gene from Streptomyces hygroscopicus, encoding phosphotricin acetyltransferase, cry1Ab marker - primarily for identifying a gene from Bacillus thuringiensis encoding a Bt toxin, EPSPS marker - mainly for identifying a gene from Agrobacterium tumefaciens encoding 5-enolpyruvilshikimate-3-fo Patatin marker sfatsintazu and - preferably pat1 to identify the gene encoding the precursor patatin (patent 2007134194/13, differentiate and specific oligonucleotides FOR IDENTIFICATION OF DNA SEQUENCES OF TRANSGENIC PLANTS IN FOOD PRODUCTS, METHOD FOR IDENTIFICATION OF TRANSGENIC PRODUCTS biochip COMBINATION OLIGONUCLEOTIDES (VARIANTS) AND KIT TO IMPLEMENT THIS METHOD, authors Granovsky I.E., Beletsky I.P., Shlyapnikova E.A., Shlyapnikov Yu.M., Gavryushkin A.V., Biryukov S.V., September 14, 2007).

There is another method for identifying transgenic DNA sequences in plant material and products based on it using specific primers and fluorescently labeled probes complementary to sequences of foreign (transgenic) DNA (patent application 2008146091/13, METHOD FOR IDENTIFICATION OF TRANSGENICALLY PERFORMED DNA ITS BASIS, authors - Abramov D.D., Kuznetsov V.V., Mitrokhin I.A., Tsydendambaev V.D. 11/24/2008).

A known method for detecting genetically modified organisms of plant origin by PCR using primers and fluorescently labeled probes specific for a specific unique transformation event, namely for a specific genetic construct with a strictly defined localization in the genomes of genetically modified organisms, the cauliflower 35S promoter of the cauliflower mosaic virus (cauliflower mosaic virus), the genomic DNA of this virus, the terminus of NOS agrobacteria (Agrobacterium tumefasciens), or the genomic DNA of this agrob kterii (application 2009123913/10 patent way to identify genetically modified organisms and sources of plant origin, are not registered in '' State Register FOOD, MATERIALS AND PRODUCTS AUTHORIZED FOR MANUFACTURING IN THE RUSSIAN FEDERATION OR IMPORT IN THE RUSSIAN FEDERATION AND TURNOVER ′ ′, THE GENOM OF WHICH CONTAINS THE 35S PROMOTOR AND / OR NOS TERMINATOR (authors Abramov D.D., Kuznetsov V.V., Kolin V.V., Mitrokhin I.A., Tsydendambaev V.D., June 24, 2009).

Thus, patents and applications for both protein and DNA markers were identified in patent databases for the identification of GMOs in plants of plant origin, monitoring of food products, animal feed and other consumer goods obtained from various cultivated plants.

Protein markers are usually unstable and detection methods using them are not very sensitive. DNA markers, in turn, are highly specific. But currently known DNA markers, as a rule, refer either to other cultures and do not extend their effect to potatoes, or are based on the sequences of foreign DNA included in the construct (cry1Ab, EPSPS, 35S promoter sequences, etc.), in while no specific reference markers for the presence of the Solanum tuberosum genomic DNA and related Solanum species of the Petota section were described in patents regarding GMO analysis methods.

In this regard, highly specific for potato and other Solanum Sus4 gene sequences are of particular interest. The monocopy state of the gene, as well as its high specificity, makes DNA markers based on it the most effective as an endogenous reference control in the identification of potato genomic DNA, both in plant material (including GMOs) and in its processed products.

In addition, the marker and the system based on it are simple to use and do not require large time, labor and money costs.

The objective of the invention is the detection of genomic copies of the target (potato) DNA of representatives of the genus Solanum, Petota section in plant material, including genetically modified, as well as in potato products using endogenous reference control - DNA marker of the Sus4 sucrose synthase gene by analysis by PCR and / or PCR with real-time detection.

Thus, this invention is a biological DNA marker, should be presented:

a) oligonucleotide primers of the following composition:

SusF3a 5-CAAAAACAAACTGAACGAACATGCATTC-3

Sus4R: 5-GCGTTGACGTTCACACGGATG-3

which are used to amplify the Sus4 gene and its homologs in plant material and in potato products;

b) TaqMan probe of the following composition:

SusZp2 5′-FAM-AGCGATTGTTCTGCCCCCT-BHQ 3 ′

which is used to quantify the Sus4 gene and its homologs in plant material and in potato products using TaqMan technology;

c) the original nucleotide sequence of 233 bp potato gene fragment Sus4

CAAAAACAAACTGAACGAACATGCATTCGAAGAACTCCTGAAAT CCACTCAGGTAATTTTGCTTTGTCTATATGTGTCACCAAAAGATCATAT ATGTATCATTTTTGAGTTTATATATGAATGCTACTATGATATGTTATATA CTAGGAAGCGATTGTTCTGCCCCCTTGGGTTGCACTTGCTATTCGTTTG AGGCCTGGTGTCTGGGAATACATCCGTGTGAACGTCAACGC

representing an endogenous reference control, unequivocally confirming the presence of potato genomic DNA in the test material;

e) the marker must be specific for Solanum tuberosum and for related wild-growing species of tuber-forming potato of the genus Solanum of the Petota section;

f) the marker should be applicable for the detection of DNA of both Solanum tuberosum cultivated potato and related wild-growing species of tuber-forming potato of the genus Solanum in the Petota section.

The above result is achieved in that the use of a biological DNA marker leads to specific amplification of the Sus4 sucrose synthase gene fragment in Solanum tuberosum potato varieties and related tuber-forming potato species, thus confirming the presence of genomic copies of the target (potato) DNA.

The invention can find application in conducting sanitary-epidemiological examinations, certification tests, as well as in conducting production quality control of plant materials and products of its processing, which will ensure continuous monitoring of the quality of plant materials, food and animal feed and other consumer goods produced from potatoes throughout the production chain.

The methodology of using the invention.

In order to detect the target (potato) DNA, living plant material of known potato varieties (individual plants of 10-15 varieties of Solanum tuberosum) is collected in the research object. The best material for subsequent DNA isolation is young leaf tissue. When DNA is extracted from tuberous material, tubers are first germinated before 1-2 leaves appear from the eye buds.

DNA is also extracted from the tested products of its processing (starch, baby food, chips, etc.).

1. Extraction of DNA from the test object.

Isolation of total DNA from plant tissues was carried out according to the following procedure.

1. Lysis of cells.

400 μl of lysis buffer (200 mM Tris-HCl, pH = 7.5; 250 mM NaCl; 25 mM EDTA; 0.5% SDS) was added to a sheet die cut (~ 0.05 mg) in a 1.5 ml Eppendorf tube. The plant material in the buffer at room temperature was homogenized using special pestles. The mixture was incubated in a thermostat or water bath for 20 minutes at 65 ° C.

2. Deproteinization of DNA.

In a test tube with a mixture containing lysed cells and nuclei, 200 μl of pre-chilled 5 M potassium acetate was added, mixed and incubated in an ice bath for 20 min. After incubation, the mixture was centrifuged for 15 min at 16,000 g. The resulting supernatant (about 450 μl) was transferred to a new tube and purified twice with an equal volume of phenol (containing 0.1% antioxidants 8-hydroxyquinoline and 0.2% mercaptoethanol) / chloroform (mixture of chloroform and isoamyl alcohol (24: 1, v / v) ) The supernatant and the phenol / chloroform mixture were gently mixed until an emulsion formed, and then centrifuged for 5 minutes at 16,000 g. After that, the upper phase with dissolved DNA was pipetted into a clean tube. Phenol-chloroform deproteinization was repeated 2-3 times until the DNA solution was completely purified from proteins.

3. Precipitation of DNA.

DNA was precipitated by adding 0.6 volume of isopropanol to the purified supernatant; the mixture was stirred and centrifuged for 15 min at 16,000 g. The alcohol was drained and the precipitate was washed three times with 1 ml of 70% ethanol, dried in air and dissolved in 20-25 μl of bidistilled sterile water.

Isolation of DNA from potato products

Object of study

The objects of study used products that included potatoes or potato-based food additives. All products were obtained from various Moscow supermarkets.

DNA extraction

DNA was isolated according to (Bulygina et al., 2009). A small amount of a sample (75-100 mg) was suspended in 200 μl of buffer I (50 mM Tris-HCl pH 8.0; 5 mM EDTA; 50 μg / ml pancreatic RNase) using a homogenizer (Vortex, Germany) for 3-5 minutes ( until a homogeneous suspension is obtained), after which 300 μl of lysing buffer II (0.2 M NaOH, 1% sodium dodecyl sulfate solution, pH 12.0) was added to the resulting suspension and thoroughly mixed by pipetting. Then, 300 μl of neutralizing buffer III (2.5 M potassium acetate solution, pH 4.5) was added and resuspended for 20 s. The mixture was centrifuged at 11000 g for 3 minutes. The supernatant was further purified using a Wizard DNAPreps reagent kit (Promega, USA) according to the manufacturer's recommendations.

DNA Extraction from High Fat Samples

Samples with a high fat content (> 20%) were pretreated with chloroform. For this, at the first stage of isolation, a sample of the sample was dissolved in 500 μl of buffer I, 1 ml of chloroform was added, and incubated for 1 h at 60 ° C. The mixture was precipitated by centrifugation for 10 min at 11000 g, after which the supernatant was purified as described above. The DNA concentration in the resulting preparations was 50-150 μg / ml. RNA in the preparations was present in trace amounts - less than 1%, according to electrophoretic analysis.

2. Assessment of the quality and quantity of extracted DNA.

The quality and quantity of extracted DNA is estimated by measuring the optical density of the DNA solution on a spectrophotometer (Bio Photometer, Eppendorf or SmartSpec 3000, Bio-Rad, USA) or by analytical electrophoresis.

3. Polymerase chain reaction (PCR).

Classical PCR reaction is carried out for a preliminary assessment of the presence of target DNA in the object according to the following method:

1. PCR

Isolated DNA was used as a matrix in the amplification reaction.

DNA amplification was carried out in a 15 μl reaction mixture containing 10x buffer for the corresponding polymerase, 0.16 mM of each dNTP, 1.2 mM MgCl ₂ , 0.6 μM biological DNA marker, 0.3 units. DreamTaq polymerase (Fermentas, Lithuania) and 100 ng of genomic DNA in the DNA-amplifier "Applied Biosystems 2700" (USA) in the mode: denaturation - 30 s - 94 ° C; annealing - 45 s - 57 ° C; DNA synthesis - 3 min 20 s - 72 ° C (35 cycles) with preliminary denaturation - 5 min (94 ° C) and final elongation of PCR fragments 10 min - 72 ° C.

2. Electrophoretic separation and visualization of PCR products.

Amplification products were analyzed by analytical electrophoresis in 0.8% agarose gel with a thickness of 5-7 mm containing ethidium bromide in 1x TBE buffer. Gene Ruler ™ DNA Ladder Mix (′ ′ Fermentas ′ ′, Lithuania) was used as molecular weight markers. The entry of fragments into the gel was carried out at 50V for 10-20 minutes, and the separation of fragments within 1-2 hours at 75-90V.

Visualization was carried out by staining the gels with ethidium bromide according to the manufacturer's instructions, followed by photo-documentation.

A positive result is the production of a unique DNA fragment of about 233 bp in size. The size of the amplified products is determined using the GeneRuler ™ DNA Ladder mix molecular weight marker (Fermentas, Lithuania).

For quantitative determination of the target DNA in the sample, the real-time PCR method was used, using TaqMan technology using the above oligonucleotide primers and TaqMan probe:

SusZp2 5′-FAM-AGCGATTGTTCTGCCCCCT-BHQ 3 ′

The reaction was carried out on a CFX96 ™ Real-Time PCR System DNA amplifier (Bio-Rad, USA) in 25 μl of 1x TaqMan PCR buffer (Synthol, Russia) containing 7.5 pcM of each primer, 5 pcM probe and 20 ng of target DNA at temperature mode: polymerase activation for 5 min at 95 ° C, the next 40 cycles - 25 s at 95 ° C, 60 s at 60 ° C.

Detection for each sample was carried out in triplicate. As a negative control (NTC-reaction mixture without a DNA template), ddH ₂ O was used (Synthol, Russia).

4. The correspondence of the obtained fragments to the desired sequence of the Sus4 gene is verified by the following procedure:

1. Cloning of the obtained fragments into a vector.

The resulting PCR reaction products were cloned using the QIAGEN cloning plus kit system (QIAGEN, Netherlands). Ligation with the vector was carried out in 10 μl of the reaction mixture, which included 1 μl of the vector (pDrive Cloning Vector (50 ng / μl)), 3 μl of PCR product, 5 μl of Ligation Master Mix and purified water.

For the transformation used QIAGEN EZ Competent Cells (from the appropriate set). To 1 ml of a solution containing competent cells, 2 μl of ligase mixture was added and incubated on ice for 5 minutes. The mixture was then heated in a water bath at 42 ° C for 30 s, followed by cooling on ice for 2 minutes. 250 μl of SOC medium (from the appropriate kit) was added to chilled cells. The resulting mixture was spread in Petri dishes with LBA medium containing ampicillin (100 mg / ml), XGal (40 mg / ml) and IPTG (100 mm) in 100 μl per cup.

Colonies were selected for the presence of an insert using the color selection method. Petri dishes were held at 37 ° C for 12 hours, then white colonies were selected. White colonies are used as a matrix in the amplification reaction.

2. Amplification of cloned Sus4 sucrose synthase genes

DNA amplification was performed in a 15 μl reaction mixture containing 10x buffer for the corresponding polymerase, 0.16 mM of each dNTP, 1.2 mM MgCl ₂ , 0.3 μM biological DNA marker, represented by RXUF and RXUR sequences, 0.3 units. DreamTaq polymerase (Fermentas, Lithuania) and bacterial colony cells (~ 0.3 μl) in the DNA-amplifier “Applied Biosystems 2700” (USA) in the mode: denaturation - 30 s - 94 ° C; primer annealing - 45 s - 57 ° C; DNA synthesis - 3 min 20 s - 72 ° C (35 cycles) with preliminary denaturation - 5 min (94 ° C) and final elongation of PCR fragments 10 min - 72 ° C.

The use of a primer pair should result in the formation of a 233 bp DNA fragment.

Amplification products were analyzed by analytical electrophoresis in 0.8% agarose gel with a thickness of 5-7 mm containing ethidium bromide in 1x TBE buffer. Gene Ruler ™ DNA Ladder Mix (Fermentas, Lithuania) was used as molecular weight markers. The entry of fragments into the gel was carried out at 50V for 10-20 minutes, and the separation of fragments within 1-2 hours at 75-90V.

The primary DNA sequences of the obtained PCR products were determined by Sanger sequencing on an ABI3730 automated DNA analyzer (Applied Biosystems, USA).

The identified DNA sequences were analyzed using the BLAST program (Altschul et al., 1990) for compliance with the known sequences of the functional potato suc4synthase synthase genes Sus4.

An example of the proposed method.

Sus4 sucrose synthase gene identification method in potato samples.

DNA from the plant material of 15 varieties of Solanum tuberosum, as well as samples of 2 species of tuber-forming potatoes S. megistacrolobum, S. acaule, is obtained using the method described above. Plants of any species can be taken as a negative control; plants of closely related species from the family Solanaceae (S. lycopersicum (tomato), S. melongena (eggplant)) can be used as an additional negative control. These species are believed to carry the most similar homologous sequences of the Sus4 gene due to the highest evolutionary phylogenetic relationship to Solanum tuberosum. Thus, the absence of fragment amplification in tomato and eggplant will confirm the high specificity of the amplification reaction. DNA from processed products is obtained by the method described above.

Further, the DNA isolated from each sample is used as a template for the polymerase chain reaction under the conditions described above using a biological DNA marker represented by the sequences susF3a and susR4. The resulting amplification products are visualized by gel electrophoresis. The size of the obtained fragments in Solanum tuberosum and related wild species of tuber-forming potatoes of the genus Solanum of the Petota section should be ~ 233 bp (Fig. 1). A similar DNA fragment will also be amplified in a material containing potato DNA (Fig. 2, 3). Accordingly, in any other material that does not contain potato DNA, the desired fragment will be absent (Fig. 1).

The nature of the amplified fragment is confirmed by sequencing on an ABI3730 automated DNA analyzer (Applied Biosystems, USA). The correspondence of the obtained sequences to the Potato Sus4 gene was verified using the BLAST program [Altschul et al, 1990] (Fig. 4).

Thus, the use of a biological DNA marker leads to specific amplification of only a fragment of the Potato Sus4 gene, both from potato plants (including genetically modified ones) and from products of its processing. This marker can also be used as an endogenous positive control when testing for the presence of GMO potatoes.

Literature.

1. Potato Genome Sequencing Consortium, Xu X, Pan S, Cheng S, Zhang B, Mu D, Ni P, Zhang G, Yang S, Li R, Wang J, Orjeda G, Guzman F, Torres M, Lozano R, Ponce O, Martinez D, De la Cruz G, Chakrabarti SK, Patil VU, Skryabin KG, Kuznetsov BB, Ravin NV, Kolganova TV, Beletsky AV, Mardanov AV, Di Genova A, Bolser DM, Martin DM, Li G, Yang Y, Kuang H, Hu Q, Xiong X, Bishop GJ, Sagredo B, Mejía N, Zagorski W, Gromadka R, Gawor J, Szczesny P, Huang S, Zhang Z, Liang C, He J, Li Y, He Y, Xu J , Zhang Y, Xie B, Du Y, Qu D, Bonierbale M, Ghislain M, Herrera Mdel R, Giuliano G, Pietrella M, Perrotta G, Facella P, O′Brien K, Feingold SE, Barreiro LE, Massa GA, Diambra L, Whitty BR, Vaillancourt B, Lin H, Massa AN, Geoffroy M, Lundback S, DellaPenna D, Buell CR, Sharma SK, Marshall DF, Waugh R, Bryan GJ, Destefanis M, Nagy I, Milbourne D, Thomson SJ, Fiers M, Jacobs JM, Nielsen KL, Sønderkaer M, Iovene M, Torres GA, Jiang J, Veilleux RE, Bachem CW, de Boer J, Borm T, K loosterman B, van Eck H, Datema E, Hekkert Bt, Goverse A, van Ham R C, Visser R G. Genome sequence and analysis of the tuber crop potato. Nature. 2011 Jul 10; 475 (7355): 189-95. Altschul, S; Gish, w; Miller, W; Myers, E; Lipman, D (October 1990). ′ ′ Basic local alignment search tool ′ ′. Journal of Molecular Biology 215 (3): 403-410.

2. Bulygina E.C., Kolganova T.B., Sukhacheva M.B., Panteleeva AN, Patutina E.O., Kuznetsov BB Isolation of DNA from various food products using a modified alkaline method. Biotechnology. No. 2, pp. 83-90, 2009.

Claims (1)

Biological DNA marker for the detection of genomic DNA of potato S. tuberosum and related wild species of the genus Solanum sect. Petota in plant material and food products, which is oligonucleotide primers — primers of the polymerase reaction SEQ ID No. 1 - 5′-CAAAAACAAACTGAACGAACATGCATTC-3 ′ SEQ ID No. 2 - 5′GCGTTGACGTTCACACGGATG-3 ′, which allow the amplification of S. potato culture 4 and related wild species of the genus Solanum sect. Petota, as well as in products potato processing, and thus identify the potato DNA with the original nucleotide sequence Sus4 potato gene fragment can be used as a reference control for detecting target DNA potatoes of test plants and products potato processing and represents: CAAAAACAAACTGAACGAACATGCATTCGAAGAACTCCTGAAA TCCACTCAGGTAATTTTGCTTTGTCTATATGTGTCACCAAAAGA TCATATATGTATCATTTTTGAGTTTATATATGAATGCTACTATG ATATGTTATATACTAGGAAGCGATTGTTCTGCCCCCTTGGGTTG CACTTGCTATTCGTTTGAGGCCTGGTGTCTGGGAATACATCCGTGTGACGTC

Images