RU2615449C1 - Biological dna marker for determining impurities of soft wheat flour in flour durum wheat and its processing products - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to biochemistry, in particular to biological DNA marker for detecting impurities of soft wheat flour in flour durum wheat and its processing products, as well as to method of detecting impurities soft wheat flour in flour durum wheat and its processing products in analyzed samples using it.

EFFECT: invention can be used to assess quality of supplied raw material at flour mills and pasta plants, also to assess quality of products from durum wheat throughout whole production chain including sanitary and epidemiological examination, certification tests.

2 cl, 4 dwg, 1 ex

Description

Technical field

The invention relates to the field of biotechnology and the food industry and is intended to detect an impurity of soft wheat flour (T. aestivum) in durum wheat flour (T. durum) and its processed products (pasta, cereals, etc.).

The invention is a biological DNA marker, including highly specific oligonucleotide sequences, for determining the quality of durum wheat flour and the quality of food products (pasta, cereals) made from it by PCR analysis.

The invention is intended for high-quality detection of DNA of soft wheat in durum wheat flour and food products made from it (pasta, cereals, etc.). Using a biological DNA marker allows you to determine the DNA content of durum and soft wheat in the test sample and to avoid the possibility of obtaining a false result. The original selection of oligonucleotide sequences for the qualitative determination of the presence of genomic DNA of soft wheat in durum wheat flour and food products made from it provides high specificity of the proposed marker and the reliability of the results. Due to its high sensitivity, the method allows to detect the presence of at least 0.1% impurities of soft wheat DNA in the total DNA of the studied material.

The invention can be used in flour mills and pasta factories to assess the quality of incoming raw materials, as well as to assess the quality of finished products from durum wheat, including for sanitary-epidemiological examinations and certification tests.

State of the art

According to the standards (GOST 52668-2006 - Durum wheat flour for pasta. Specifications and GOST P 31743-2012 - Pasta. General specifications) raw materials for the production of pasta group A, as well as a number of cereals (semolina, couscous, bulgur) is T. durum durum wheat flour, which is associated with the features of the consistency of the endosperm of T. durum grains, namely, vitreousity, due to the close connection of protein substances with starch grains. Vitreous grain has a dense structure, is characterized by high mechanical strength and has high technological qualities during processing, which determines its advantages in the production of pasta and cereals. With special varietal grinding, the vitreous grain of durum wheat is transformed into premium pasta or grains. The use of durum wheat flour affects the physical and mechanical properties of pasta dough. Products made of it have great strength (do not crumble), great digestibility (a significant increase in volume without loss of particles and sludge), good shape retention.

Due to the high price of durum wheat flour, soft wheat flour can often be added to the raw materials during the production of pasta, which significantly reduces the cost of the final product and significantly reduces the consumer qualities of pasta. The quality of pasta is inversely proportional to the amount of impurities of soft wheat flour in the feedstock.

Currently, methods based on the qualitative identification of either foreign proteins or nucleic acids are used to detect foreign impurities in plant material and products based on it (cereals, extracts, etc.).

Most modern methods for differentiating DNA from soft and durum wheat are based on differences in their genomic composition. Durum wheat Triticum durum is a tetraploid species with haploid genomic composition AB, while durum wheat Triticum aestivum is a hexaploid species with haploid genomic composition ABD.

The present invention is a biological DNA marker for determining the impurity of soft wheat flour in durum wheat flour and its processed products. The marker is a set of two synthetic oligonucleotides homologous to the wheat Lr34 gene sequence (Fig. 4). Orthologous Lr34 genes are localized both in genome B (Lr34B gene) and in D genome (Lr34D gene) and differ in their nucleotide sequence. The approach is based on differences in the primary sequences of the Lr34B gene in T. durum durum genome B and the Lr34D gene sequence in the T. aestivum D genome.

When carrying out a PCR reaction in the presence of only durum wheat DNA in the sample (grain, flour and processed products) as a result of amplification, only one fragment homologous to the Lr34B B gene sequence of the T. durum genome 1027 bp in length will be identified, if the sample is present only common wheat DNA — a 622 bp fragment homologous to the sequence of the Lr34D D gene of the T. aestivum genome. In the presence of DNA impurities of soft wheat in a durum wheat sample, two fragments of 1027 bp in length will be amplified. and 622 bp The sensitivity of the proposed method for determining is at least 0.1% of DNA impurities of soft wheat in the total DNA of the analyzed sample.

Thus, the proposed biological DNA marker for determining the presence of impurities of genomic DNA of soft wheat in durum wheat flour and in products derived from it allows one to detect the presence of DNA of both soft and durum wheat in one PCR reaction and to avoid false negative results on the presence of impurities of soft wheat.

The possibility of detecting in one PCR reaction of DNA of both durum and soft wheat significantly reduces the diagnostic time by reducing the number of technological operations during the analysis.

A patent search was carried out, which showed the presence of a number of methods for determining the quality of durum wheat flour and its processed products, including the possibility of detecting soft wheat impurities.

There is a method for determining the quality of durum wheat flour, which is based on the study of protein, gluten, color, ash content, grinding size, activity of a number of enzymes, etc. [Irwin G.N. Durum wheat and pasta // In: Wheat and its quality assessment. - M .: Kolos. - 1968. - S. 459-475]. The method is characterized by high complexity and does not allow to talk about the absence of impurities of soft wheat in durum flour.

Currently, approaches based on the qualitative identification of secondary metabolites, proteins, or nucleic acid sequences are used to detect impurities in flour and durum wheat processed products (cereals, extracts, etc.).

A number of methods are known to determine the presence of soft wheat impurities in durum wheat products. Most of them are based on the detection of gene expression products present in the D-genome of common wheat and absent in the genome of durum wheat. Similar methods are based on the detection of the presence of specific albumin and gliadins characteristic of common wheat in the test material (P. Resmini, Tec Molitona (1968) 19, 145-150, P. Resmini et al. Tec. Molitona 27. 97-109). Protein methods can also be based on determining the presence of polyphenol oxidase and esterase enzymes that are encoded by the common wheat D genome (Feillet. P and Kobrehel, K. (1972) Ann. Technol. Agπc. 21, 17-24, Feillet, P and Kobrehel , K. (1974). Cereal Chem. 51. 203-209) and (Cooke, RJ Smith, TM and Ainsworth, CC (1986). Seed Sci Technol. 14, 693-704.). However, protein methods are quite laborious and often do not have high sensitivity, which is associated with possible differences in protein expression under different wheat growing conditions. Also, protein detection methods have significant drawbacks, since in the process of pasta production, proteins are mostly destroyed due to the use of high temperature and rapid drying, which suggests the impossibility of establishing a single standard for protein detection of soft wheat impurities.

A large group of methods for detecting soft wheat impurities in durum wheat flour and products of its processing is based on PCR identification of specific DNA regions characteristic of the D wheat genome.

A known method for the detection of soft wheat impurities using DNA of a highly repeating Dgas44 sequence, which is believed to be localized exclusively on the D genome of hexaploid wheat (Patent WO 1998004737).

It is worth noting that a significant drawback of the method is the need to use several primer pairs to achieve a reliable result. In addition, the analysis of sequences represented in the genome in multiple copies can lead to ambiguous amplification results.

Monocopy DNA sequences (untranslated region of the WaxyD gene, TaSUT1, CbpIII, and Lr1 genes) are used to more accurately detect DNA sequences specific for the D wheat genome. However, the resulting developed system of many primers is rather laborious and difficult to use (Patent EP 1736543).

The closest analogue (prototype) of the invention is a method for determining the impurity of soft wheat flour in semolina (durum) of durum wheat and in the finished product of the pasta industry, based on PCR detection using a pair of oligonucleotide primers specific for the D genome of soft wheat, homologous to the region of the outer highly transcribed spacer of highly repeating genes of ribosomal RNA of the NorD3 locus. Upon detection of the corresponding DNA sequence of 791 bp in PCR products judge the contamination ("falsification") of durum wheat grains with soft wheat flour. The disadvantage of this method is the possibility of obtaining a false negative result, since the absence of reaction products can indicate not only the absence of the D genome (soft wheat) in the test sample, but also be a consequence of poor-quality PCR, which is associated with the need to conduct separate control reactions (RU patent 2249046).

In our proposed method, the possibility of a similar error is excluded, since the developed test system based on the sequence of the Lr34 monocopy gene already carries internal control, and a 1027 bp DNA fragment will be visualized on electrophoresis. (in the presence of DNA only durum wheat), or 622 bp (in the presence of DNA only of soft wheat), or both fragments (in the presence of DNA of both types of wheat). The absence of amplified fragments indicates an incorrect reaction.

Disclosure of invention

The objective of the invention is the creation of a biological DNA marker for the detection of impurities of genomic DNA of soft wheat in durum wheat flour and in products derived from it, as well as a method based on the use of a marker.

The problem is solved by creating a biological DNA marker for determining the presence of impurities of soft wheat flour in durum wheat flour and products of its processing, which is oligonucleotide primers - primers of polymerase reaction - SEQ ID No. 1 5'-CCTCAAATGATCAATTATGTGCAAC-3 'and SEQ ID No. 2 5'GTCAGTGTGGACACTTAGTTC -3 '.

Also, the problem is solved by the method of determining the presence of an impurity of soft wheat flour in durum wheat flour and its processed products by PCR analysis, including DNA extraction, amplification using a biological DNA marker according to claim 1, and if DNA is detected in the products, amplification of the studied samples of the fragment of the Lr34 ortholog gene 622 bp in length conclude that there is an admixture of soft wheat flour.

The technical result consists in increasing the accuracy of determining the presence of impurities of soft wheat flour in durum wheat flour and its processed products while reducing the risk of obtaining a false negative result.

An original selection of oligonucleotide sequences for the qualitative determination of the presence of genomic DNA of soft wheat in durum wheat flour and food products produced from it ensures high specificity of the proposed marker and the reliability of the results obtained. Due to its high sensitivity, the method allows to detect the presence of at least 0.1% impurities of soft wheat DNA in the total DNA of the studied material.

Our proposed method has a clear advantage over previous inventions by reducing analysis time and increasing the accuracy of diagnostics.

On the filing date of the application for the proposed invention in the patent and scientific literature on the totality of signs was not found similar, identical or equivalent to the claimed.

Brief Description of the Drawings

In FIG. 1 shows the DNA fragments identified using the oligonucleotide sequences of SEQ ID No. 1 and SEQ ID No. 2 from DNA samples of T.aestivum soft wheat varieties (1 - Rodina, 2 - Chining Spring, 3 - Chernyava, 4 - Marathon, 5 - Galina, 6 - Novosibirsk 40, 7 - In memory of Fedin, 8 - Zarya, 9 - Omsk winter, 10 - Beauty, 11 - Harvest of Altai, 12 - Princess, 13 - Umka) and durum wheat T. durum (14 - Mironovskaya 808, 15 - Moskovskaya 39, 16 - Altai 60, 17 - Albidum 28, 18 - Bashkirskaya 24, 19 - Novosibirsk 29, 20 - Polyushko, 21 - Prikumskaya 124, 22 - Krasnokutka 10, 23 - Donchanka, 24 - Bezenchukskaya steppe). M - molecular weight marker (fragments with a molecular weight of 1000, 500 bp are marked).

In FIG. 2 shows DNA fragments identified using oligonucleotide sequences of SEQ ID No. 1 and SEQ ID No. 2 from pasta from various manufacturers: 1. Ambra (Italy) *, 2. Dell Castello (Italy) *, 3. Barilla (Italy) *, 4. La molisana (Italy) *, 5. Udon noodles (China) **, 6. Relish extra (Russia, group B) ***, 7. Noble (Russia, group A) *, 8. Doshirak (Russia, group A) *, 9. Globus (Russia, group A) *. M - molecular weight marker (fragments with a molecular weight of 1000 and 500 bp are marked)

* - on the labeling is marked “premium durum wheat flour”

** - on the labeling is indicated “premium wheat flour”

*** - on the labeling is marked “baking wheat flour, durum wheat flour of the second grade”

In FIG. 3 shows the DNA fragments identified using the oligonucleotide sequences of SEQ ID No. 1 and SEQ ID No. 2 from samples with different impurities of soft wheat flour in durum wheat flour. M - molecular weight marker (fragments with a molecular weight of 1000 and 500 bp are marked).

The implementation of the invention

In order to detect impurities of soft wheat in the research object, DNA is extracted from the tested products (flour, pasta, cereals, etc.).

1. Extraction of DNA from the test object.

Isolation of DNA from soft and durum wheat grains and processed products (flour, pasta, cereals, etc.)

Object of study

As the objects of study used crushed grains of durum and soft wheat varieties, as well as processed products: flour, pasta made by various manufacturers (Russia, China and Italy).

DNA extraction

DNA was isolated according to the protocol of Bulygin et al., 2009. Samples were ground in a mortar if necessary. A small amount of a sample (75-100 mg) was suspended in 200 μl of buffer I (50 mM Tris-HCl pH 8.0; 5 mM EDTA; 50 μg / ml pancreatic RNase) using a homogenizer (Vortex, Germany) for 3-5 minutes ( until a homogeneous suspension is obtained), after which 300 μl of lysis buffer II (0.2 M NaOH, 1% sodium dodecyl sulfate solution, pH 12.0) was added to the resulting suspension and thoroughly mixed by pipetting. Then, 300 μl of neutralizing buffer III (2.5 M potassium acetate solution, pH 4.5) was added and resuspended for 20 sec. The mixture was centrifuged at 11000g for 3 minutes. The supernatant was further purified using a Wizard DNA Preps reagent kit (Promega, USA) according to the manufacturer's recommendations.

2. Assessment of the quality and quantity of extracted DNA.

The quality and quantity of extracted DNA was assessed by measuring the optical density of the DNA solution on a spectrophotometer (Bio Photometer, Eppendorf or SmartSpec 3000, Bio-Rad, USA, Qubit, Invitrogen) or by analytical electrophoresis.

3. Polymerase chain reaction (PCR).

Isolated DNA was used as a matrix in the amplification reaction.

DNA amplification was carried out in a 15 μl reaction mixture containing 10x buffer for the corresponding polymerase, 0.16 mM of each dNTP, 1.2 mM MgCl ₂ , 0.6 μM biological DNA marker (in the equimolar ratio of each of the oligonucleotide primers), 0.3 units of DreamTaq polymerase ( Fermentas, Lithuania) and 100 ng of genomic DNA in the Applied Biosystems 2700 DNA Amplifier (USA) in the mode: denaturation - 30 s - 94 ° C; annealing - 40 s - 59 ° C; DNA synthesis - 1 min 20 s - 72 ° C (35 cycles) with preliminary denaturation - 5 min (94 ° C) and final elongation of PCR fragments 10 min - 72 ° C.

4. Electrophoretic separation and visualization of PCR products.

Amplification products were analyzed by analytical electrophoresis on a 1% agarose gel containing ethidium bromide in 1x TBE buffer. Gene Ruler ™ DNA Ladder Mix (Fermentas, Lithuania) was used as molecular weight markers. The separation of fragments in the gel was carried out for 30-45 minutes at 75-100V.

Visualization was carried out by staining the gels with ethidium bromide according to the manufacturer's instructions, followed by photo-documentation.

The size of amplified products was determined using a GeneRuler ™ DNA Ladder mix molecular weight marker (Fermentas, Lithuania).

Detection for each sample was carried out in triplicate. As a negative control, ddH ₂ O was used.

Example. A method for the identification of impurities of soft wheat flour in durum wheat flour and its processed products

From grains of 11 varieties of durum wheat Triticum durum and 13 varieties of common wheat Triticum aestivum, as well as from 9 samples of pasta, DNA was obtained by the above method. Rice DNA was used as a negative control.

DNA of plants of any kind (for example, oats, rye, rice) or their processed products (flour, cereal, etc.) can be taken as a negative control. These species presumably carry the most similar homologous sequences of the Lr 34 gene. Thus, the absence of fragment amplification will confirm the high specificity of the amplification reaction.

DNA isolated from each test sample was used as a template for the polymerase chain reaction under the conditions described above using a biological DNA marker represented by the sequences SEQ ID No. 1 and SEQ ID No. 2.

The resulting amplification products were visualized by gel electrophoresis. The size of the obtained fragments in the presence of Triticum durum durum wheat DNA in the sample should be 1027 bp, in the presence of Triticum aestivum common wheat DNA - 622 bp (Fig. 1).

In the case of DNA impurities of soft wheat flour, two fragments will be present in durum wheat flour and products of its processing (Fig. 2, 3). When determining the sensitivity of the method, an artificial model system was used in which, during the PCR reaction, DNA of durum wheat was added to DNA of durum wheat at concentrations of 10%, 1%, 0.1%, 0.01%, 0.001% (Fig. 3).

When analyzing commercial products (Fig. 2), in some cases, a mismatch was found between the composition indicated on the package and the actual presence of soft wheat impurities in pasta.

Thus, the use of a biological DNA marker leads to specific amplification of fragments of various lengths in samples of soft and durum flour, which allows us to unambiguously determine the presence of impurities of soft wheat flour in durum wheat and its processed products by the presence of DNA amplification of the studied samples of two fragments ( 1027 and 622 bp).

Claims (2)

1. Biological DNA marker for determining the presence of impurities of soft wheat flour in durum wheat flour and products of its processing, which is oligonucleotide primers - polymerase reaction seeds - SEQ ID No. 1 5'-CCTCAAATGATCAATTATGTGCAAC-3 'and SEQ ID No. 2 5'- GTCAGTGTGGACACTTAGTTC-3 '. 2. A method for determining the presence of an impurity of soft wheat flour in durum wheat flour and its processed products in the samples under study, including DNA extraction, amplification using a biological DNA marker according to claim 1, and in case of detection of a fragment fragment in the DNA amplification products the ortholog gene Lr34 with a length of 622 bp conclude that there is an admixture of soft wheat flour.

Images