KR20230150062A - Real-time PCR primer sets for detection of genetically modified rice and uses thereof - Google Patents

Abstract

The present invention relates to a real-time PCR primer set for detecting genetically modified rice and its use. The detection composition comprising the primer and probe set for detecting genetically modified rice of the present invention is suitable for use in the Pre-Spotted Plate test. Accuracy and reproducibility can be improved through law. In addition, the present invention replaces the existing genetically modified rice screening test method, shortens the time required for analyzing genetically modified rice, increases convenience and reduces analysis costs, and provides a positive standard sample for testing. Reliability can be secured.

Description

Real-time PCR primer sets for detection of genetically modified rice and uses thereof}

The present invention relates to a real-time PCR primer set for detecting genetically modified (GM) rice and its use.

Rice ( Oryzae sativa ) is an important crop in many parts of Asia and a major food source, and biotechnology methods have been applied to rice to improve agronomic traits and product quality.

Korea is highly dependent on foreign countries for major grains such as soybeans, corn, barley, and wheat, but in the case of rice, the self-sufficiency rate is relatively high at 82.3%, and there is not a single genetically modified rice item that has been approved for food use after a domestic safety review. Thorough safety management is required for these.

In order to manage genetically modified foods and guarantee consumers' right to know, countries around the world, including Korea, are implementing labeling systems and are conducting tests to prevent the introduction of genetically modified foods that have not been safety reviewed. However, with the development and increase in imports of various genetically modified rice items, the amount of testing has continued to increase.

Accordingly, the introduction and distribution of genetically modified rice into Korea is strictly controlled and an effective detection method for genetically modified rice is required for efficient management.

Korean Patent No. 10-1820077 (registered on January 12, 2018)

The object of the present invention is to provide a composition for detecting genetically modified rice containing as an active ingredient an agent capable of measuring the expression levels of SPS, CpTi, Bt63, NNBt, KMD1, Kefneg6, LLRice62 and LLRice601, and genetically modified rice containing the composition. The aim is to provide a detection kit and a method for detecting genetically modified rice using the same.

In order to achieve the above object, the present invention provides a composition for detecting genetically modified rice containing as an active ingredient an agent capable of measuring the expression levels of SPS, CpTi, Bt63, NNBt, KMD1, Kefneg6, LLRice62 and LLRice601.

Additionally, the present invention provides a kit for detecting genetically modified rice comprising the composition.

Additionally, the present invention provides a biochip for detecting genetically modified rice containing the composition.

In addition, the present invention includes the steps of (1) isolating DNA from a sample; (2) using the isolated DNA as a template, a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, and a probe represented by SEQ ID NO: 3; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 5 and a probe represented by SEQ ID NO: 6; Primer sets represented by SEQ ID NO: 7 and SEQ ID NO: 8 and a probe represented by SEQ ID NO: 9; A primer set represented by SEQ ID NO: 10 and SEQ ID NO: 11 and a probe represented by SEQ ID NO: 12; A primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14 and a probe represented by SEQ ID NO: 15; A primer set represented by SEQ ID NO: 16 and SEQ ID NO: 17 and a probe represented by SEQ ID NO: 18; A primer set represented by SEQ ID NO: 19 and SEQ ID NO: 20 and a probe represented by SEQ ID NO: 21; And performing PCR amplification using the primer set represented by SEQ ID NO: 22 and SEQ ID NO: 23 and the probe represented by SEQ ID NO: 24; and (3) analyzing the PCR amplification product.

The present invention relates to a real-time PCR primer set for detecting genetically modified rice and its use. The detection composition comprising the primer and probe set for detecting genetically modified rice of the present invention is suitable for use in the Pre-Spotted Plate test. Accuracy and reproducibility can be improved through law. In addition, the present invention replaces the existing genetically modified rice screening test method, shortens the time required for analyzing genetically modified rice, increases convenience and reduces analysis costs, and provides a positive standard sample for testing. Reliability can be secured.

Figure 1 schematically shows the qPCR array layout.
Figures 2 and 3 schematically show the positive standard plasmid and the corresponding base sequence used to detect genetically modified rice.

Accordingly, in the present invention, we established a new model to improve and strengthen the GM rice screening test method and developed a pre-spotted plate test method that can utilize it efficiently. In the above invention, it was confirmed that the GM rice confirmation test can be performed immediately without any additional manipulation, and the event can be specified or judged as non-detection as a result, so the analysis can be carried out quickly and efficiently, and the present invention has been completed. .

The present invention provides a composition for detecting genetically modified rice containing as an active ingredient an agent capable of measuring the expression levels of SPS, CpTi, Bt63, NNBt, KMD1, Kefneg6, LLRice62 and LLRice601.

Preferably, the agent capable of measuring the expression level may be a primer or probe that specifically binds to the SPS, CpTi, Bt63, NNBt, KMD1, Kefneg6, LLRice62 and LLRice601 genes, but is not limited thereto.

More preferably, the agent capable of measuring the expression level of SPS includes a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 and a probe represented by SEQ ID NO: 3; Agents capable of measuring the expression level of CpTi include a primer set represented by SEQ ID NO: 4 and SEQ ID NO: 5 and a probe represented by SEQ ID NO: 6; The agent capable of measuring the expression level of Bt63 includes a primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8 and a probe represented by SEQ ID NO: 9; The agent capable of measuring the expression level of NNBt includes a primer set represented by SEQ ID NO: 10 and SEQ ID NO: 11 and a probe represented by SEQ ID NO: 12; The agent capable of measuring the expression level of KMD1 includes a primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14 and a probe represented by SEQ ID NO: 15; The agent capable of measuring the expression level of Kefneg6 includes a primer set represented by SEQ ID NO: 16 and SEQ ID NO: 17 and a probe represented by SEQ ID NO: 18; The agent capable of measuring the expression level of LLRice62 includes a primer set represented by SEQ ID NO: 19 and SEQ ID NO: 20 and a probe represented by SEQ ID NO: 21; And the agent capable of measuring the expression level of LLRice601 may be a primer set represented by SEQ ID NO: 22 and SEQ ID NO: 23 and a probe represented by SEQ ID NO: 24, but is not limited thereto.

In the present invention, "probe" refers to a nucleic acid fragment, such as DNA, of as short as a few bases or as long as several hundred bases, that can specifically bind to DNA, and is labeled to determine the presence or absence of a specific DNA and its expression level. can confirm. Probes may be manufactured in the form of oligonucleotide probes, single strand DNA probes, double strand DNA probes, RNA probes, etc. Selection of appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.

In the present invention, “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be amplified, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow for initiation of synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target desired as well as the conditions under which the primer is used, such as temperature and ionic strength. In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or May contain an intercalating agent.

In the present invention, the term “primer set” is used to refer simultaneously to forward and reverse primers. The design of primers is subject to various restrictions, such as A, G, C, and T content ratio, prevention of primer complex (dimer) formation, and prohibition of repeating the same base sequence more than three times. In addition, conditions such as the amount of template DNA, concentration of primers, concentration of dNTPs, concentration of Mg ²⁺ , reaction temperature, and reaction ^time must be appropriate.

The primer set can hybridize to a specific gene present in the target raw material, and when the target raw material is present in the sample, the base sequence of the characteristic gene is amplified by polymerase chain reaction, thereby producing the amplified product (amplicon). Through this, the presence or absence of the raw materials can be determined.

Additionally, the present invention provides a kit for detecting genetically modified rice comprising the composition.

The detection kit may have the form of a solution, lyophilized powder, frozen solution, or strip, and each form can be formulated by a conventional method in the art. For example, a kit for detection in the form of a solution can be formulated by separately or mixing proteins or primers in buffer solutions such as sodium-phosphate, potassium-phosphate, Tris-hydrochloric acid, and various other types of buffers, depending on need. It can also be frozen or freeze-dried.

The detection kit may be one using an immunolateral flow strip method. Lateral flow assay is a method for detecting proteins or nucleic acids based on chromatography. This lateral flow analysis method is widely used in various fields such as pregnancy diagnosis, cancer diagnosis, the presence of other specific proteins or genes, or microorganism detection. Lateral flow analysis is based on a specific reaction between two substances, such as an antigen-antibody reaction. It has high sensitivity and specificity, and has the advantage of being able to confirm results in a short time, making it possible to diagnose diseases and take rapid preventive measures. .

The detection kit may be a qRT-PCR kit. Specifically, the detection kit may additionally include experiments required to detect genetically modified rice using the primer and probe set of the present invention (e.g., qPCR) and instruments required to confirm the results (e.g., fluorescence photometer, etc.). there is. Specifically, the composition may include an appropriate amount of DNA polymerase (eg, AmpliTaq Gold DNA polymerase, etc.), dNTP, PCR buffer solution, and water (dH ₂ O) in addition to the qPCR primer and probe set. The PCR buffer solution may include Tris-HCl, MgCl ₂ , KCl, etc.

In addition, the kit may further include appropriate reagents and tools used for analysis, in addition to a composition containing qRT-PCR components. These reagents and tools include suitable carriers, labels capable of producing a detectable signal, solubilizers, detergents, etc. Suitable carriers include, but are not limited to, soluble carriers such as physiologically acceptable buffers known in the art such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, polyester. , polyacrylonitrile, fluororesin, cross-linked dextran, polysaccharide, polymers such as magnetic fine particles plated with metal on latex, other paper, glass, metal, and combinations thereof.

Additionally, the present invention provides a biochip for detecting genetically modified rice containing the composition.

In the present invention, the "biochip", also called a DNA chip, is a product in which very small DNA fragments are integrated on a solid surface, and a sample solution and reagent are placed on a substrate made of a transparent or translucent material such as plastic, glass, or silicon. It may have a form including a chamber and a channel that can accommodate.

Biochips are thin and transparent, and have a large contact area with the heater block, so they can greatly shorten PCR time and have the advantage of being able to search for at least hundreds of genes in a short time. In addition, by using solid materials, very small amounts of genetic material can be attached at high density, large numbers of genes can be searched simultaneously, the expression levels of large amounts of genes can be measured simultaneously, or genotypes of various parts of the genome can be determined. It can be used to do this.

Biochips can be classified into cDNA (complementary DNA) chips and oligonucleotide chips depending on the size of the genetic material attached. A cDNA chip may contain a gene (full-length open reading frame, or EST) of at least 500 bp. An oligonucleotide consisting of 10 to 50 bases, specifically 10 to 30 bases, and more specifically 15 to 20 bases may be attached to the oligonucleotide chip, and may be contained in a solution contained within the chip, but in the form described above. It is not limited and can be appropriately modified as needed.

In addition, the present invention includes the steps of (1) isolating DNA from a sample; (2) using the isolated DNA as a template, a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, and a probe represented by SEQ ID NO: 3; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 5 and a probe represented by SEQ ID NO: 6; Primer sets represented by SEQ ID NO: 7 and SEQ ID NO: 8 and a probe represented by SEQ ID NO: 9; A primer set represented by SEQ ID NO: 10 and SEQ ID NO: 11 and a probe represented by SEQ ID NO: 12; A primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14 and a probe represented by SEQ ID NO: 15; A primer set represented by SEQ ID NO: 16 and SEQ ID NO: 17 and a probe represented by SEQ ID NO: 18; A primer set represented by SEQ ID NO: 19 and SEQ ID NO: 20 and a probe represented by SEQ ID NO: 21; And performing PCR amplification using the primer set represented by SEQ ID NO: 22 and SEQ ID NO: 23 and the probe represented by SEQ ID NO: 24; and (3) analyzing the PCR amplification product.

Preferably, the PCR may be real time PCR, but is not limited thereto.

Methods known in the art can be used to isolate DNA from a sample. In addition, PCR is a method of amplifying a target nucleic acid from a set of primers that specifically bind to the target nucleic acid using polymerase. These PCR methods are well known in the art, and commercially available kits can also be used.

In the present invention, “genetically modified (GM)” crops or genetically modified agricultural products are crops that have been given new properties that do not exist in nature through genetic modification technology, in particular, improved productivity and enhanced product quality.

GMO (Genetically Modified Organism) is an abbreviation for 'genetically modified organism', but since it mainly targets agricultural crops, it is usually called 'genetically modified crop'. In 1994, the U.S. company Calgene commercialized hard-wearing tomatoes for the first time, and in 1996, Monsanto commercialized soybeans and Novartis commercialized rice. Genetically modified crops accounted for more than 50% of soybeans, rice, and cotton in the United States in the five years since they first appeared in the general consumer market. It has the advantage of being resistant to pests and diseases and having a large yield, which can help alleviate food shortages, but groups opposing GMOs continue to raise concerns about food safety and environmental hazards.

As concerns about the safety and environmental risks of GMOs and GMO foods rapidly increase, the GMO labeling system is being implemented in Korea in accordance with the Food Sanitation Act and the Agricultural Agricultural Products Quality Control Act, and qualitative and quantitative analysis of genetically modified ingredients is provided. Domestic GMO analysis is carried out in two steps: The first step is to perform a primary confirmation test by performing PCR with specific primers for endogenous genes and GM structural genes (35S promoter, NOS terminator). The next step is to conduct a secondary confirmation test for genetic recombination events according to the screening test results. At this time, if both the endogenous gene and the introduced recombinant gene-specific PCR product are confirmed through the first and second confirmation tests, it is judged as 'detection'. All PCR products of the endogenous gene are detected, but no recombinant gene-specific PCR product is detected. If not, it is judged as ‘non-detection’. If the PCR product of the endogenous gene is not detected, the test is judged as ‘unable to test’.

Recently, with the increase in GMO development and imports, the amount of tests for GMO confirmation is increasing, and in the case of screening tests for processed foods, even if the sample does not contain GM rice, the existing 35S promoter derived from GM soybean and GM corn, etc. and NOS terminator were detected, and additional tests are being conducted to analyze GM rice events.

In the present invention, “event” is used in the same sense as “lineage,” which is a term referring to a population with the same common ancestor and genotype. Among experimental organisms, it is usually derived from a common ancestor and accumulates generations while retaining certain traits. refers to a thin population.

In the present invention, an “endogenous gene” refers to a gene that naturally exists in the genome of a specific crop and exists as a single copy in the entire genome, so that it can be used as a positive control to indicate the presence of a specific crop in genetic analysis of a specific crop. means.

In the present invention, the "Pre-Spotted Plate test method" is a model in which all components necessary for real time polymerase chain reaction (qPCR) are immobilized on a plate in premix form. (Figure 1).

In the present invention, “real time polymerase chain reaction (qPCR)” is a principle of measuring the amount of fluorescence by dissociating the fluorescent substance from the probe during PCR amplification using a probe linked to a specific primer and a fluorescent substance. . The qPCR method is the same as the qualitative PCR method in that it detects the specific DNA of the introduced gene, but it has the advantage of being able to quantitatively analyze the amount of the introduced gene because it measures the ratio of the detected genes based on the plant's endogenous genes. In practice, the qPCR method can be used to quantitatively test the mixing rate of genetically modified agricultural products and genetically modified organisms in processed food products.

Components required for the qPCR include primers, probes, templates, DNA polymerase (e.g., AmpliTaq Gold DNA polymerase, etc.), dNTPs, and optimized buffer components such as PCR buffer (Tris-HCl). , MgCl ₂ , KCl, etc.), water (dH ₂ O), passive reference dye (e.g. ROX dye), etc., but is not limited thereto and may include components required for qPCR without limitation.

Below, the present invention will be described in detail according to examples that do not limit the present invention. Of course, the following examples of the present invention are only intended to embody the present invention and do not limit or limit the scope of the present invention. Accordingly, what can be easily inferred by an expert in the technical field to which the present invention belongs from the detailed description and examples of the present invention is interpreted to fall within the scope of the rights of the present invention.

< Experiment example >

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Sample preparation

For specificity testing, GM soybean events (RRS, MON89788, A2704-12, DP356043-5, DP305423-1, A5547-127, MON87701, CV127, MON87769, MON87705, MON87708, FG72, SYHT0H2, DAS-44406-6, DAS- 68416-4, DAS-81419-2, MON87751, GMB151), GM corn events (MON810, GA21, TC1507, NK603, MON863, Bt11, T25, Bt176, DLL25, DAS-59122-7, MON88017, MIR604, Bt10, MON893 04 , MIR162, DP098140-6, 3272, MON87460, 5307, MON87427, DAS-40278-9, DP-004114-3, MON87411, VCO01981-5, MON87403, MON87419, MZHG0JG, MZIR098, MON87 429, DP-202216-6), GM cotton events (MON531, MON1445, MON15985, 281/3006, LLcotton25, MON88913, GHB614, T304-40×?GHB119, COT102, MON88701, GHB119, DAS-81910-7, GHB811, MON88702) and GM cars Nola Event (GT73, T45, MON88302, DP-073496-4, MS8, RF3, MS11, LBFLFK, NS-B50027-4) were selected as negative controls, and the certified reference material (CRM) (71 cases) for this event was obtained from the Reference Material Measurement Laboratory ( IRMM, Geel, Belgium) and the American Society of Petroleum Chemists (AOCS, Urbana, Illinois, USA) or provided by the developer.

2. DNA extraction

Genomic DNA of the sample was extracted from the CRM of each event using the Fast genomic DNA extraction kit (Pinucle, Yongin, Korea) and analyzed with the Quant-iT™dsDNA HS analysis kit and Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA) was used to quantify it. The purity of the extracted genomic DNA was measured using a NanoDrop ^TM One UV-Vis spectrophotometer (Applied Biosystems, Foster City, CA, USA). Extracted DNA was diluted to 20 ng/μL and stored at -20°C until use.

3. Specific primer and probe

Event-specific primer sets and probes for Bt63, KMD1, Kefeng6, and LLRice62 were designed using the Primer Designer program version 3.0 (Scientific and Educational Software, Durham, NC, USA). Other primer sets and probes were used that were adopted as standard detection methods. All primer sets and probes were synthesized by Bioneer (Daejeon, Korea). The sequences and standards of primers and probes are shown in Table 1 below.

target primer / probe Sequence (5'→3') sequence number SPS OsSPS-F GATCGGTTCCGCCATTAGCA One OsSPS-KRr GATCGCCGGTTAATCGCTTC 2 SPS-p FAM-TCTCGATCGAACAGGGGTAG-TAMRA 3 CpTi CpTi-1F CGTGTCACTCGGCTTGCA 4 CpTi-1R AACGACACTTGCCTGGCATT 5 CpTi-P FAM-ATCCTGCATGTGTACACG-TAMRA 6 Bt63 Bt63-KF CGCGCCACATAGCAGAACTT 7 Bt63-KRr ATCAATGGCCGCATAACAGC 8 Bt63-p FAM-AACATCGCCTCGCTCCAGTC-TAMRA 9 NNBt T51-SF GCAGGAGTGATTATCGACAGTTC 10 OsNOS-R2 AAGACCGGCAACAGGATTCA 11 NGMr-Taq FAM-AATAAGTCGAGGTACCGAGCTCGAATTT CCC-TAMRA 12 KMD1 KMD1-KFr CATTAAAACGTCCGCAATGTG 13 KMD1-KRr TACGCCGATATGCCTGCCCCA 14 KMD1-p FAM-GCGTCAATTTGTTTACACCACAATA-TAMRA 15 Kefeng6 Kef6-KFr CCTCTGTGAGCATCGGTGTAG 16 Kef6-KRr CAGCCAGCAGCGGCGTTTTC 17 Kef6-p FAM-TGTTGCAACCAACCTAGGAG-TAMRA 18 LLRice62 LL62-KFr TGCTAAGGGGTGCATCGGTCT 19 LL62-KR CAGCTGGCGTAATAGCGAAG 20 LL62-p FAM-GTATAAATAATCGGTGCGGGC-TAMRA 21 LLRice601 SHA040 TCTAGGATCCGAAGCAGATCGT 22 SHA041 GGAGGGGCGGAGGTGT 23 TM098 FAM-CCACCTCCCCAACAATAAAAGCGCCTG-TAMRA 24

4. PCR condition

Viia7 real-time PCR (Applied Biosystems, Foster City, CA, USA) was used to develop a specific detection method for genetically modified rice using TaqMan ^® probes. PCR analysis was performed in a final ^volume of 25 μL using UNG (Applied Biosystems), 1

The qPCR conditions were 50°C for 2 min, 95°C once for 10 min, and 95°C for 15 s and 60°C for 1 min 45 times, and data were analyzed with QuantaStudio ^™ Real-Time PCR software.

< Example >

One. qPCR Check specificity through

To detect events in genetically modified rice that have been detected around the world and whose import is prohibited in Korea due to lack of safety review, 2 genetic elements [cowbean trypsin inhibitor ( CpTi ) gene, NNBt], 5 genetic modifications A total of eight screening assays ( SPS , CpTi , Bt63, NNBt, KMD1, Kefneg6, LLRice62, and LLRice601) were prepared by selecting rice events (Bt63, KMD1, Kefneg6, LLRice62, and LLRice601) and rice endogenous reference genes ( SPS genes). did. For sample analysis, 8 targets were distributed to each well of a 96-well PCR plate, and the above essays were combined into one set (Figure 1) to determine the mixture of crops and non-genes from GMO events approved in Korea or undergoing safety review. Seven types of modified crops and a positive standard plasmid were tested to evaluate the specificity of the present invention for detecting genetically modified rice.

genetic recombination
event Ct value SPS CpTi Bt63 NNBt KMD1 Kefeng6 LLRice62 LLRice601 Non-GMO Rice 21.23 - - - - - - - Non-GMO Soybeans - - - - - - - - Non-GMO Corn - - - - - - - - Non-GMO Cotton - - - - - - - - Non-GMO canola - - - - - - - - non-genetically modified wheat - - - - - - - - Non-GMO Barley - - - - - - - - Positive standard plasmid 24.70 25.79 26.08 26.31 24.33 25.24 25.04 24.33 GM soybean mixture - - - - - - - GM corn mixture - - - - - - - - GM cotton blend - - - - - - - - GM canola blend - - - - - - -

As a result, as shown in Table 2 above, positive signals were shown only in non-genetically modified rice and positive standard plasmids, and in particular, successful amplification was confirmed in the selection method using Bt63, KMD1, Kefeng6, and LLRice62 developed in the present invention. did.

2. qPCR Check sensitivity through

In the case of genetically modified rice, there are no certified standard materials for sale, making it difficult to secure standard samples. Therefore, the amplification sequence for each test method was secured and a positive standard plasmid to be used as a positive control was developed.

To determine the LOD of the endogenous reference gene ( SPS ) of rice, plasmid DNA diluted from 10 ⁵ to 10 ² and 10 ¹ was tested, and 10 ¹ copies were determined as the LOD of SPS . Afterwards, the LOD test was performed three times on other targets with three different experimenters to determine the LOD.

target template
(copies) Experimenter A Experimenter B Experimenter C Positive signal CT mean Positive signal CT mean Positive signal CT mean SPS 100 9/9 34.32 9/9 34.21 9/9 34.95 10 9/9 39.02 8/9 37.70 9/9 38.52 CpTi 100 9/9 35.33 9/9 35.18 9/9 35.71 10 9/9 38.96 9/9 39.21 9/9 38.70 Bt63 100 9/9 36.79 9/9 36.14 9/9 36.91 10 5/9 40.96 8/9 40.50 9/9 40.45 NNBt 100 9/9 38.18 9/9 37.29 9/9 37.31 10 9/9 40.85 9/9 39.62 6/9 40.74 KMD1 100 9/9 33.53 9/9 35.09 9/9 34.61 10 9/9 38.09 8/9 38.15 8/9 38.77 Kefeng6 100 9/9 34.89 9/9 35.10 9/9 35.79 10 9/9 38.48 9/9 39..03 9/9 39.39 LLRice62 100 9/9 34.58 9/9 34.76 9/9 35.82 10 9/9 38.72 9/9 38.49 9/9 38.98 LLRcice601 100 9/9 33.74 9/9 33.07 9/9 34.36 10 9/9 37.33 8/9 37.68 9/9 38.73

3. Applicability test using processed foods

Twenty-three processed foods containing rice were collected to test the applicability of the screening analysis. Twenty-three types of processed foods, including grain powder, tofu, soy milk, and snacks, were purchased from Korea (20 samples), Japan (2 samples), and Thailand (1 sample). Food samples purchased in Korea were produced using rice imported from the United States, Canada, India, and Australia. The samples were purchased from domestic markets in Korea, Japan, and the United States, and do not include any other GM crops other than soybeans. The collected processed foods were divided into five groups according to the type of product: rice powder, dry cereal, soy milk, tofu, and snacks.

For accurate detection, samples were analyzed in duplicate for eight screening assays. Samples that were amplified in one well and had a Ct value greater than 40 were determined to be negative.

product sample
no. result SPS CpTi Bt63 NNBt KMD1 Kefeng6 LLRice62 LLRice601 rice powder One + - - - - - - - 2 + - - - - - - - 3 + - - - - - - - dry
Serial 4 + - - - - - - - 5 + - - - - - - - 6 + - - - - - - - 7 + - - - - - - - 8 + - - - - - - - 9 + - - - - - - - 10 + - - - - - - - 11 + - - - - - - - soy milk 12 + - - - - - - - tofu 13 + - - - - - - - 14 + - - - - - - - 15 + - - - - - - - 16 + - - - - - - - 17 + - - - - - - - 18 + - - - - - - - 19 + - - - - - - - 20 + - - - - - - - 21 + - - - - - - - 22 + - - - - - - - snack 23 + - - - - - - - positive standard
plasmid 24 + + + + + + + +

As a result, as shown in Table 4 above, no positive signals were observed in all 23 processed foods excluding the positive standard plasmid, confirming that unapproved genetically modified rice is not included among all rice-containing foods distributed domestically.

Through the above experiments, it was confirmed that the primer and probe set of the present invention can successfully detect genetically modified substances in food and feed.

The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive. For example, each component described as unitary may be implemented in a distributed manner, and similarly, components described as distributed may also be implemented in a combined form.

<110> KOREA FOOD & DRUG ADMINISTRATION University-Industry Cooperation Group of Kyung Hee University <120> Real-time PCR primer sets for detection of genetically modified rice and uses it <130> ADP-2022-0024 <160> 24 <170>CopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsSPS-F primer <400> 1 gatcggttcc gccattagca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsSPS-KRr primer <400> 2 gatcgccggt taatcgcttc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPS-p probe <400> 3 tctcgatcga acaggggtag 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CpTi-1F primer <400> 4 cgtgtcactc ggcttgca 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CpTi-1R primer <400> 5 aacgacactt gcctggcatt 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CpTi-P probe <400> 6 atcctgcatg tgtacacg 18 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bt63-KF primer <400> 7 cgcgccacat agcagaactt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bt63-KRr primer <400> 8 atcaatggcc gcataacagc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bt63-p probe <400> 9 aacatcgcct cgctccagtc 20 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> T51-SF primer <400> 10 gcaggagtga ttatcgacag ttc 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsNOS-R2 primer <400> 11 aagaccggca acaggattca 20 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> NGMr-Taq probe <400> 12 aataagtcga ggtaccgagc tcgaatttcc c 31 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KMD1-KFr primer <400> 13 cattaaaaac gtccgcaatg tg 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KMD1-KRr primer <400> 14 tacgccgata tgcctgccca 20 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> KMD1-p probe <400> 15 gcgtcaattt gtttacacca caata 25 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Kef6-KFr primer <400> 16 cctctgtgag catcggtgta g 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Kef6-KRr primer <400> 17 cagccagcag cggcgttttc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Kef6-p probe <400> 18 tgttgcaacc aacctaggag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL62-KFr primer <400> 19 tgctaacggg tgcatcgtct 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LL62-KR primer <400> 20 cagctggcgt aatagcgaag 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LL62-p probe <400> 21 gtataaataa tcggtgcggg c 21 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SHA040 primer <400> 22 tctaggatcc gaagcagatc gt 22 <210> 23 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> SHA041 primer <400> 23 ggagggcgcg gagtgt 16 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> TM098 probe <400> 24 ccacctccca acaataaaag cgcctg 26

Claims (8)

A composition for detecting genetically modified rice comprising as an active ingredient an agent capable of measuring the expression levels of SPS, CpTi, Bt63, NNBt, KMD1, Kefneg6, LLRice62 and LLRice601. Detection of genetically modified rice according to claim 1, wherein the agent capable of measuring the expression level is a primer or probe that specifically binds to the SPS, CpTi, Bt63, NNBt, KMD1, Kefneg6, LLRice62 and LLRice601 genes. Composition for. The method of claim 2, wherein the agent capable of measuring the expression level of SPS includes a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 and a probe represented by SEQ ID NO: 3; Agents capable of measuring the expression level of CpTi include a primer set represented by SEQ ID NO: 4 and SEQ ID NO: 5 and a probe represented by SEQ ID NO: 6; The agent capable of measuring the expression level of Bt63 includes a primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8 and a probe represented by SEQ ID NO: 9; The agent capable of measuring the expression level of NNBt includes a primer set represented by SEQ ID NO: 10 and SEQ ID NO: 11 and a probe represented by SEQ ID NO: 12; The agent capable of measuring the expression level of KMD1 includes a primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14 and a probe represented by SEQ ID NO: 15; The agent capable of measuring the expression level of Kefneg6 includes a primer set represented by SEQ ID NO: 16 and SEQ ID NO: 17 and a probe represented by SEQ ID NO: 18; The agent capable of measuring the expression level of LLRice62 includes a primer set represented by SEQ ID NO: 19 and SEQ ID NO: 20 and a probe represented by SEQ ID NO: 21; And the agent capable of measuring the expression level of LLRice601 is a composition for detecting genetically modified rice, characterized in that the primer set represented by SEQ ID NO: 22 and SEQ ID NO: 23 and the probe represented by SEQ ID NO: 24. A kit for detecting genetically modified rice comprising the composition of any one of claims 1 to 3. The kit for detecting genetically modified rice according to claim 4, wherein the kit further includes reagents for performing an amplification reaction. A biochip for detecting genetically modified rice comprising the composition of any one of claims 1 to 3. (1) separating DNA from the sample;
(2) using the isolated DNA as a template, a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, and a probe represented by SEQ ID NO: 3; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 5 and a probe represented by SEQ ID NO: 6; Primer sets represented by SEQ ID NO: 7 and SEQ ID NO: 8 and a probe represented by SEQ ID NO: 9; A primer set represented by SEQ ID NO: 10 and SEQ ID NO: 11 and a probe represented by SEQ ID NO: 12; A primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14 and a probe represented by SEQ ID NO: 15; A primer set represented by SEQ ID NO: 16 and SEQ ID NO: 17 and a probe represented by SEQ ID NO: 18; A primer set represented by SEQ ID NO: 19 and SEQ ID NO: 20 and a probe represented by SEQ ID NO: 21; And performing PCR amplification using the primer set represented by SEQ ID NO: 22 and SEQ ID NO: 23 and the probe represented by SEQ ID NO: 24; and
(3) A method for detecting genetically modified rice comprising the step of analyzing the PCR amplification product. The method of detecting genetically modified rice according to claim 7, wherein the PCR is real time PCR.