RU2552611C2 - Method of subspecies differentiation of plague agent strains using polymerase chain reaction method - Google Patents
Method of subspecies differentiation of plague agent strains using polymerase chain reaction method Download PDFInfo
- Publication number
- RU2552611C2 RU2552611C2 RU2014100735/10A RU2014100735A RU2552611C2 RU 2552611 C2 RU2552611 C2 RU 2552611C2 RU 2014100735/10 A RU2014100735/10 A RU 2014100735/10A RU 2014100735 A RU2014100735 A RU 2014100735A RU 2552611 C2 RU2552611 C2 RU 2552611C2
- Authority
- RU
- Russia
- Prior art keywords
- ypdsf
- strains
- subspecies
- differentiation
- wzye
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области медицинской микробиологии, в частности к подвидовой дифференциации и молекулярному типированию штаммов Y. Pestis, и может быть использовано в научно-исследовательских учреждениях и службах Роспотребнадзора.The invention relates to the field of medical microbiology, in particular to subspecies differentiation and molecular typing of Y. Pestis strains, and can be used in research institutions and services of Rospotrebnadzor.
Возбудитель чумы - Yersinia pestis отличается сложной внутривидовой структурой, которая включает, согласно отечественной номенклатуре, основной подвид - subspecies (ssp.) pestis и группу неосновных: кавказский - ssp. caucasica, алтайский - ssp. altaica, гиссарский - ssp.v hissarica, улегейский - ssp. ulegeica. Штаммы возбудителя чумы, относящиеся к разным подвидам, отличаются по вирулентности и эпидемической значимости. Так штаммы Y. pestis ssp. pestis (основной подвид) характеризуются высокой вирулентностью для человека и высоким эпидемическим потенциалом. В отличие от них штаммы Y. pestis неосновных подвидов имеют избирательную вирулентность и эпидемически малозначимы. В связи с этим дифференциация подвидов Y. pestis и, в частности детекция среди них высоковирулентных штаммов основного подвида, представляет важную в практическом отношении задачу. Кроме того, выявление принадлежности исследуемых штаммов к одному из пяти подвидов (основному, кавказскому, алтайскому, гиссарскому или улегейскому) позволяет установить их происхождение, а также возможные пути заноса в рамках молекулярно-эпидемиологического мониторинга чумы.The causative agent of the plague - Yersinia pestis is characterized by a complex intraspecific structure, which includes, according to domestic nomenclature, the main subspecies - subspecies (ssp.) Pestis and a group of minor: Caucasian - ssp. caucasica, Altai - ssp. altaica, Hissar - ssp.v hissarica, Uleghean - ssp. ulegeica. The plague pathogen strains belonging to different subspecies differ in virulence and epidemic significance. So strains of Y. pestis ssp. pestis (the main subspecies) are characterized by high virulence for humans and high epidemic potential. In contrast, strains of Y. pestis of minority subspecies have selective virulence and are epidemiologically insignificant. In this regard, the differentiation of Y. pestis subspecies and, in particular, the detection of highly virulent strains of the main subspecies among them, is an important practical problem. In addition, the identification of the belonging of the studied strains to one of five subspecies (the main, Caucasian, Altai, Hissar, or Ulegei) allows us to establish their origin, as well as possible paths of introduction within the framework of molecular epidemiological monitoring of plague.
В диагностической практике индикацию штаммов Y. pestis и их подвидовую дифференциацию проводят с учетом различной экспрессии ряда биохимических признаков (ферментация сахаров и многоатомных спиртов, редукция нитратов, продукция изоцитрат-лиазы и др.). Однако большинство фенотипических признаков, применяемых для внутривидового разделения штаммов Y. pestis, отличается вариабельностью, и часто зависит от условий культивирования, качества питательных сред, а также требует выделения культур возбудителя в чистом виде. В связи с этим более надежными являются методы дифференциации, основанные на генетических особенностях штаммов, которые отличаются большим консерватизмом и поэтому их применение дает более стабильные и хорошо воспроизводимые результаты.In diagnostic practice, the indication of Y. pestis strains and their subspecies differentiation is carried out taking into account the different expression of a number of biochemical characters (fermentation of sugars and polyhydric alcohols, reduction of nitrates, production of isocitrate lyase, etc.). However, most phenotypic characters used for the intraspecific separation of Y. pestis strains are variable, and often depend on cultivation conditions, the quality of culture media, and also require isolation of the pathogen cultures in a pure form. In this regard, differentiation methods based on the genetic characteristics of strains that are more conservative and more reliable are therefore more reliable and reproducible.
В настоящее время для индикации и внутривидовой дифференциации штаммов Y.pestis применяется ряд способов, основанных на полимеразной цепной реакции (ПЦР) и мультилокусном секвенировании.Currently, a number of methods based on polymerase chain reaction (PCR) and multilocus sequencing are used to indicate and intraspecific differentiation of Y. pestis strains.
Зарегистрирована тест-система («ГенПест», ТУ8895-005-0189), предназначенная для экспресс-диагностики штаммов Y.pestis методом ПЦР с использованием двух пар праймеров на комплиментарные участки генов caf1 (плазмида pFra) и pla (плазмида pPst). Однако эта система предназначена исключительно для детекции вида Y.pestis, но не для проведения его внутривидовой дифференциации.A test system (GenPest, TU8895-005-0189) was registered for express diagnostics of Y. pestis strains by PCR using two pairs of primers for complementary regions of the caf1 (plasmid pFra) and pla (plasmid pPst) genes. However, this system is intended solely for the detection of the species Y. pestis, but not for its intraspecific differentiation.
Известен способ экспресс диагностики бактерий рода Yersinia, который основан на методе мультиплексной ПЦР с последующим анализом длин амплифицированных фрагментов гена порина - OmpF (патент RU 2385941, опубл. 10.04.2010). Метод позволяет осуществлять одновременную детекцию и дифференциальную диагностику патогенных и непатогенных видов иерсиний, а также видовую идентификацию патогенных для человека видов: Y.pestis, Y.pseudotuberculosis и Y.enterocolitica. Однако этот способ не предназначен для проведения подвидовой дифференциации штаммов Y.pestis.A known method for the rapid diagnosis of bacteria of the genus Yersinia, which is based on the method of multiplex PCR with subsequent analysis of the lengths of amplified fragments of the porin gene - OmpF (patent RU 2385941, publ. 04/10/2010). The method allows simultaneous detection and differential diagnosis of pathogenic and non-pathogenic species of Yersinia, as well as species identification of pathogenic for humans species: Y. pestis, Y. pseudotuberculosis and Y.enterocolitica. However, this method is not intended for subspecies differentiation of strains of Y. pestis.
Известен способ дифференциации штаммов возбудителя чумы основного и неосновных подвидов и возбудителя псевдотуберкулеза методом полимеразной цепной реакции (патент RU 2425891, опубл. 10.08.2011). Разделение исследуемых штаммов, согласно этому способу, проводят путем сравнения размеров полученных фрагментов генов terC, ilvN и inv с аналогичными фрагментами у типичных штаммов возбудителей чумы основного и неосновных подвидов. Предложенный метод позволяет быстро, эффективно и надежно проводить дифференциацию штаммов Y.pestis основного и неосновных подвидов и Y.pseudotuberculosis, однако, не разделяет штаммы возбудителя чумы кавказского, алтайского, гиссарского и улегейского подвидов.There is a method of differentiating strains of the plague pathogen of the main and minor subspecies and the causative agent of pseudotuberculosis by polymerase chain reaction (patent RU 2425891, publ. 10.08.2011). The separation of the studied strains, according to this method, is carried out by comparing the sizes of the obtained fragments of the terC, ilvN and inv genes with similar fragments in typical strains of the plague pathogens of the main and minor subspecies. The proposed method allows the fast, efficient and reliable differentiation of strains of Y. pestis of the main and minor subspecies and Y. pseudotuberculosis, however, does not separate the strains of the causative agent of the plague of the Caucasian, Altai, Hissar and Ulegei subspecies.
Известен способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования (RU 2404256, опубл. 20.11.2010), который предусматривает амплификацию фрагментов генов rhaS и araC, а также определение их нуклеотидных последовательностей. Генотип исследуемого штамма устанавливают по нуклеотидам, находящимся в позициях 482, 494, 671 гена rhaS и 773 гена araC. Подвидовую принадлежность штамма определяют путем сравнения его генотипа с генотипами штаммов Y.pestis основного и неосновных подвидов.A known method of subspecies differentiation of strains of the plague pathogen by sequencing (RU 2404256, publ. 20.11.2010), which provides for the amplification of fragments of rhaS and araC genes, as well as the determination of their nucleotide sequences. The genotype of the studied strain is determined by the nucleotides located at positions 482, 494, 671 of the rhaS gene and 773 of the araC gene. The subspecies affiliation of the strain is determined by comparing its genotype with the genotypes of Y. pestis strains of the main and non-main subspecies.
Также известен способ подвидовой дифференциации штаммов Yersinia pestis методом мультилокусного сиквенс-типирования (RU 2415948, опубл. 10.04.2011),Also known is a method of subspecies differentiation of strains of Yersinia pestis by multilocus sequence typing (RU 2415948, publ. 10.04.2011),
предусматривающий определение нуклеотидных последовательностей ряда генов жизнеобеспечения (rhaS, araC, metB, aspA, thiH) с применением секвенационных технологий. Генотип исследуемого штамма устанавливают по нуклеотидам, находящимся в позициях 482, 494, 671 гена rhaS, в позиции 773 гена агаС, в 988 и 989 гена metB, в 1087-1089 гена aspA и 552 гена thiH. По аллелям генов rhaS, агаС, metB, asp А и thiH определяют сиквенс-тип (ST) штамма Y.pestis с его последующей подвидовой дифференциацией путем сравнения с сиквенс-типами основного и неосновных подвидов. Данные методы позволяют определять подвидовую принадлежность штаммов возбудителя чумы, однако, являются трудоемкими, дорогостоящими, а также требуют соответственного технического оснащения и кадрового состава лаборатории.providing for the determination of the nucleotide sequences of a number of life support genes (rhaS, araC, metB, aspA, thiH) using sequencing technologies. The genotype of the studied strain is determined by the nucleotides located at positions 482, 494, 671 of the rhaS gene, at position 773 of the ahaC gene, in 988 and 989 in the metB gene, in 1087-1089 in the aspA gene and 552 thiH gene. The alleles of the rhaS, ahaC, metB, asp A, and thiH genes determine the sequence type (ST) of the Y. pestis strain with its subsequent subspecies differentiation by comparison with the sequence types of the main and minor subtypes. These methods make it possible to determine the subspecies of strains of the plague pathogen, however, they are laborious, expensive, and also require appropriate technical equipment and personnel of the laboratory.
Известен способ дифференциации чумного и псевдотуберкулезного микробов с одновременной внутривидовой дифференциацией штаммов чумного микроба (RU 2332464, опубл. 27.08.2008). Согласно этому методу дифференциацию исследуемых штаммов проводят по размеру амплификатов вариабельной области hutG-YP01967, полученных с помощью праймеров TAN1 и TAN2. Однако недостаток способа заключается в том, что локус hutG-YP01967 расположен в нестабильной области генома Y.pestis, которая может часто утрачиваться у штаммов основного подвида, что делает невозможным их индикацию этим методом. Кроме того, способ сложен в интерпретации результатов и требует использования большой группы референтных штаммов. Другие данные об использовании метода ПЦР для подвидовой дифференциации штаммов Y.pestis в литературе отсутствуют, как отсутствует и информация о локусах в геноме возбудителя чумы, применение которых позволило бы осуществить такое разделение.A known method of differentiation of plague and pseudotuberculosis microbes with simultaneous intraspecific differentiation of strains of the plague microbe (RU 2332464, publ. 27.08.2008). According to this method, differentiation of the studied strains is carried out according to the size of amplitudes of the variable region hutG-YP01967 obtained using primers TAN1 and TAN2. However, the disadvantage of this method is that the hutG-YP01967 locus is located in the unstable region of the Y. pestis genome, which can often be lost in strains of the main subspecies, which makes it impossible to indicate them by this method. In addition, the method is difficult to interpret the results and requires the use of a large group of reference strains. Other data on the use of the PCR method for subspecies differentiation of Y. pestis strains are absent in the literature, as there is no information on loci in the genome of the plague pathogen, the use of which would allow such a separation.
Задачей изобретения является разработка простого в интерпретации, но надежного и эффективного способа быстрой дифференциации штаммов Y.pestis основного, кавказского, алтайского, гиссарского и улегейского подвидов методом ПЦР.The objective of the invention is to develop an easy-to-interpret, but reliable and effective method for the rapid differentiation of Y. pestis strains of the main, Caucasian, Altai, Hissar and Ulegei subspecies by PCR.
Технический результат заключается в повышении эффективности и сокращении времени подвидовой дифференциации штаммов возбудителя чумы.The technical result consists in increasing the efficiency and reducing the time of subspecies differentiation of strains of the plague pathogen.
Заявленный способ основан на использовании в качестве ДНК-мишеней вариабельных участков хромосомной ДНК, локализованных в межгенных пространствах wzyE-dapF и YPDSF_0064-YPDSF_0065.The claimed method is based on the use of variable regions of chromosomal DNA localized in the intergenic spaces wzyE-dapF and YPDSF_0064-YPDSF_0065 as target DNA.
Технический результат достигается способом дифференциации штаммов Y.pestis основного, кавказского, алтайского, гиссарского и улегейского подвидов методом полимеразной цепной реакции, который предусматривает выделение ДНК штамма, проведение полимеразной цепной реакции с амплификацией межгенных участков wzyE-The technical result is achieved by the method of differentiation of strains of Y. pestis of the main, Caucasian, Altai, Hissar and Ulegei subspecies by the method of polymerase chain reaction, which involves the isolation of strain DNA, the polymerase chain reaction with amplification of wzyE
dapF и YPDSF_0064-YPDSF_0065 исследуемого изолята, при этом праймеры на эти гены имеют следующие последовательности нуклеотидов:dapF and YPDSF_0064-YPDSF_0065 of the studied isolate, while the primers for these genes have the following nucleotide sequences:
wzyE-dapF-S - ACATACGATGGCCGATCATG,wzyE-dapF-S - ACATACGATGGCCGATCATG,
wzyE-dapF-As - CTGATTATGTGGGGCGCT,wzyE-dapF-As - CTGATTATGTGGGGCGCT,
YPDSF_0064-YPDSF_0065-S - CTGAAGGGCGAGGAGAGAC,YPDSF_0064-YPDSF_0065-S - CTGAAGGGCGAGGAGAGAC,
YPDSF_0064-YPDSF_0065-As - AGGGTGTTGTTGGTTTTGGT;YPDSF_0064-YPDSF_0065-As - AGGGTGTTGTTGGTTTTGGT;
последующую дифференциацию штаммов проводят путем сравнения размеров амплифицированных фрагментов межгенных участков wzyE-dapF и YPDSF 0064-YPDSF 0065 с размерами аналогичных фрагментов, характерных для типичных штаммов основного (151 п.н. и 374 п.н.), кавказского (185 п.н. и 434 п.н.), алтайского и гиссарского (202 п.н. и 374 п.н.), а также улегейского (185 п.н. и 374 п.н.) подвидов.subsequent differentiation of the strains is carried out by comparing the sizes of the amplified fragments of the wzyE-dapF and YPDSF 0064-YPDSF 0065 intergenic regions with the sizes of similar fragments characteristic of typical strains of the main (151 bp and 374 bp), Caucasian (185 bp . and 434 bp), Altai and Hissar (202 bp and 374 bp), as well as Ulegei (185 bp and 374 bp) subspecies.
Способ осуществляют следующим образом.The method is as follows.
Выделение ДНК исследуемого штамма Y. pestis проводят по стандартной методике в соответствии с МУ 1.3.2569-09 «Организация работ лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».DNA isolation of the studied strain of Y. pestis is carried out according to the standard method in accordance with MU 1.3.2569-09 "Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV".
Полимеразную цепную реакцию осуществляют по стандартной методике (МУ 1.3.1794-03) с применением вышеуказанных пар праймеров на межгенные участки wzyE-dapF и YPDSF 0064-YPDSF 0065, рассчитанных на основе последовательностей штаммов Y. pestis С092, A1122, KIM10, Antiqua, Nepal516, Harbin35, Z176003, D182038, D106004, Pestoides F, 91001, Angola, представленных в базе данных NCBI GenBank. С помощью рассчитанных пар праймеров в ПЦР проводят амплификацию фрагментов межгенных участков wzyE-dapF и YPDSF 0064-YPDSF 0065 и определяют размеры полученных ампликонов. Праймеры на межгенные участки wzyE-dapF и YPDSF 0064-YPDSF 0065 имеют следующий состав:The polymerase chain reaction is carried out according to the standard method (MU 1.3.1794-03) using the above pairs of primers for the wzyE-dapF and YPDSF 0064-YPDSF 0065 intergenic regions, calculated on the basis of the sequences of the strains Y. pestis С092, A1122, KIM10, Antiqua, Nepal516 , Harbin35, Z176003, D182038, D106004, Pestoides F, 91001, Angola, presented in the NCBI GenBank database. Using the calculated pairs of primers in PCR, fragments of the wzyE-dapF and YPDSF 0064-YPDSF 0065 intergenic regions are amplified and the sizes of the resulting amplicons are determined. The primers for the wzyE-dapF and YPDSF 0064-YPDSF 0065 intergenic regions have the following composition:
wzyE-dapF-S - ACATACGATGGCCGATCATG,wzyE-dapF-S - ACATACGATGGCCGATCATG,
wzyE-dapF-As - CTGATTATGTGGGGCGCT,wzyE-dapF-As - CTGATTATGTGGGGCGCT,
YPDSF_0064-YPDSF_0065-S - CTGAAGGGCGAGGAGAGAC,YPDSF_0064-YPDSF_0065-S - CTGAAGGGCGAGGAGAGAC,
YPDSF_0064-YPDSF_0065-As - AGGGTGTTGTTGGTTTTGGT;YPDSF_0064-YPDSF_0065-As - AGGGTGTTGTTGGTTTTGGT;
Полимеразную цепную реакцию с амплификацией межгенных участков wzyE-dapF и YPDSF_0064-YPDSF_0065 выполняют в следующих условиях: 1 цикл 94°С в течение 5 мин, затем 35 циклов при 94°С 45 с, 57°С 1 мин, 72°С 45 с и завершающий цикл 3 мин при 72°С. Определение размеров образованных в ПЦР амплификатов проводят методом электрофореза в 2,5% агарозном геле относительно стандартных маркеров молекулярных масс с размером от 100 до 1000 п.н.A polymerase chain reaction with amplification of the wzyE-dapF and YPDSF_0064-YPDSF_0065 intergenic regions is performed under the following conditions: 1 cycle 94 ° C for 5 min, then 35 cycles at 94 ° C 45 s, 57 ° C 1 min, 72 ° C 45 s and a final cycle of 3 minutes at 72 ° C. Sizing of amplifications formed in PCR is carried out by electrophoresis in a 2.5% agarose gel relative to standard molecular weight markers with sizes from 100 to 1000 bp.
Штаммы Y. pestis основного подвида имеют размеры образуемых в ПЦР амплификатов локусов wzyE-dapF и YPDSF_0064-YPDSF_0065 соответственно 151 п.н. и 374 п.н.; штаммы кавказского подвида соответственно 185 п.н. и 434 п.н.; штаммы алтайского и гиссарского подвидов 202 п.н. и 374 п.н.; штаммы улегейского подвида 185 п.н. и 374 п.н.The strains of Y. pestis of the main subspecies have the sizes of amplitudes of wzyE-dapF and YPDSF_0064-YPDSF_0065 loci formed in PCR, respectively, 151 bp and 374 bp; strains of the Caucasian subspecies respectively 185 bp and 434 bp; strains of Altai and Hissar subspecies 202 bp and 374 bp; strains of the Ulegeic subspecies 185 bp and 374 bp
Сущность изобретения поясняется примерами на исследуемых штаммах с неустановленной внутривидовой принадлежностью.The invention is illustrated by examples on the studied strains with unidentified intraspecific affiliation.
Пример 1. Дифференциация штамма №1 по подвидовой принадлежности.Example 1. Differentiation of strain No. 1 by subspecies.
Выделение ДНК штамма №1 проводят общепринятым способом в соответствии с МУ 1.3.2569-09 «Организация работ лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности» с предварительным обеззараживанием культуры возбудителя чумы путем добавления мертиолята натрия до концентрации 1:10000 и прогреванием при температуре 56°С в течение 30 мин. После обработки мертиолятом натрия к образцу добавляют лизирующий раствор на основе 6М гуанидинтиоизоцианата (в трехкратном объеме) и инкубируют при 65°С в течение 15 мин. Далее выделение генетического материала проводят в соответствии с МУ 1.3.2569-09.DNA isolation of strain No. 1 is carried out in a generally accepted manner in accordance with MU 1.3.2569-09 "Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of I-IV pathogenicity groups" with preliminary disinfection of the plague pathogen culture by adding sodium merthiolate to a concentration of 1: 10000 and heating at a temperature of 56 ° C for 30 minutes After treatment with sodium merthiolate, a lysis solution based on 6M guanidine thioisocyanate (in triplicate) was added to the sample and incubated at 65 ° C for 15 min. Further, the selection of genetic material is carried out in accordance with MU 1.3.2569-09.
Полимеразную цепную реакцию проводят в объеме 25 мкл; реакционная смесь содержит: 1х буфер (10х ПЦР-буфер - 2,5 мкл), MgCl2 - 2,0 мМ, смесь dNTP - 0,3 мМ, олигонуклеотидные праймеры - 2 пмол, Taq DNA полимераза - 0,1 ед., исследуемой ДНК - 10 мкл. Продукты амплификации анализируют в 2,5% агарозном геле с добавлением бромистого этидия и визуализируют в УФ-спектре.The polymerase chain reaction is carried out in a volume of 25 μl; the reaction mixture contains: 1x buffer (10x PCR buffer - 2.5 μl), MgCl2 - 2.0 mm, dNTP mixture - 0.3 mm, oligonucleotide primers - 2 pmol, Taq DNA polymerase - 0.1 units, studied DNA - 10 μl. Amplification products are analyzed on a 2.5% agarose gel with the addition of ethidium bromide and visualized in the UV spectrum.
Определяют размеры образовавшихся фрагментов межгенных участков wzyE-dapF и YPDSF_0064-YPDSF_0065. Они составляют 151 п.н. и 374 п.н., что соответствует размерам фрагментов этих локусов у штаммов Y. pestis основного подвида. Делается вывод о принадлежности исследуемого штамма №1 к основному подвиду.The sizes of the formed fragments of the wzyE-dapF and YPDSF_0064-YPDSF_0065 intergenic regions are determined. They are 151 bp and 374 bp, which corresponds to the sizes of fragments of these loci in Y. pestis strains of the main subspecies. It is concluded that the studied strain No. 1 belongs to the main subspecies.
Пример 2. Дифференциацию штамма №2, по подвидовой принадлежности, проводят аналогично примеру №1.Example 2. Differentiation of strain No. 2, by subspecies, is carried out analogously to example No. 1.
Размеры образуемых в ПЦР фрагментов межгенных участков wzyE-dapF и YPDSF 0064-YPDSF 0065 составляют 185 п.н. и 434 п.н., что соответствует размерам амплификатов этих локусов у штаммов Y. pestis кавказского подвида. Делается вывод о принадлежности исследуемого штамма №2 к кавказскому подвиду.The sizes of wzyE-dapF and YPDSF 0064-YPDSF 0065 intergenic fragments formed in PCR are 185 bp. and 434 bp, which corresponds to the sizes of amplitudes of these loci in strains of Y. pestis of the Caucasian subspecies. It is concluded that the studied strain No. 2 belongs to the Caucasian subspecies.
Пример 3. Дифференциацию штамма №3, по подвидовой принадлежности, проводят аналогично примеру №1.Example 3. Differentiation of strain No. 3, by subspecies, is carried out analogously to example No. 1.
Размеры образуемых в ПЦР фрагментов межгенных участков wzyE-dapF и YPDSF_0064-YPDSF_0065 составляют 202 п.н. и 374 п.н., что соответствует размерам амплификатов этих локусов у штаммов Y.pestis алтайского и гиссарского подвидов. Делается вывод о принадлежности исследуемого штамма №3 к алтайскому или гиссарскому подвидам.The sizes of wzyE-dapF and YPDSF_0064-YPDSF_0065 intergenic fragments formed in PCR are 202 bp and 374 bp, which corresponds to the sizes of amplitudes of these loci in Y. pestis strains of the Altai and Hissar subspecies. It is concluded that the studied strain No. 3 belongs to the Altai or Hissar subspecies.
Пример 4. Дифференциацию штамма №4, по подвидовой принадлежности, проводят аналогично примеру №1.Example 4. Differentiation of strain No. 4, by subspecies, is carried out analogously to example No. 1.
Размеры образуемых в ПЦР фрагментов межгенных участков wzyE-dapF и YPDSF_0064-YPDSF_0065 составляют 185 п.н. и 374 п.н., что соответствует размерам амплификатов этих локусов у штаммов Y.pestis улегейского подвида. Делается вывод о принадлежности исследуемого штамма №4 к улегейскому подвиду.The sizes of wzyE-dapF and YPDSF_0064-YPDSF_0065 intergenic fragments formed in PCR are 185 bp. and 374 bp, which corresponds to the sizes of amplificates of these loci in Y. pestis strains of the Ulegei subspecies. It is concluded that the studied strain No. 4 belongs to the Ulegei subspecies.
Таким образом, заявленный способ дифференциации штаммов Y.pestis основного, кавказского, алтайского, гиссарского и улегейского подвидов методом ПЦР, основанный на вариабельности нуклеотидной последовательности межгенных участков wzyE-dapF и YPDSF 0064-YPDSF 0065 позволяет быстро и эффективно проводить определение подвидовой принадлежности штаммов возбудителя чумы.Thus, the claimed method for the differentiation of strains of Y. pestis of the main, Caucasian, Altai, Hissar and Holegean subspecies by PCR, based on the variability of the nucleotide sequence of the wzyE-dapF and YPDSF 0064-YPDSF 0065 intergenic regions, allows the fast and efficient determination of the subspecies of the plague pathogen strains .
Claims (1)
wzyE-dapF-S - ACATACGATGGCCGATCATG,
wzyE-dapF-As - CTGATTATGTGGGGCGCT,
YPDSF_0064-YPDSF_0065-S - CTGAAGGGCGAGGAGAGAC,
YPDSF_0064-YPDSF_0065-As - AGGGTGTTGTTGGTTTTGGT;
дифференциацию штаммов Y.pestis проводят путем сравнения размеров амплифицированных фрагментов wzyE-dapF и YPDSF_0064-YPDSF_0065 с размерами аналогичных фрагментов, характерных для типичных штаммов основного (151 п.н. и 374 п.н.), кавказского (185 п.н. и 434 п.н.), алтайского и гиссарского (202 п.н. и 374 п.н.), а также улегейского (185 п.н. и 374 п.н.) подвидов. A method for the subspecies differentiation of strains of the plague pathogen, including the isolation of the DNA of the studied strain, polymerase chain reaction, amplification of fragments of intergenic regions, analysis of the results, characterized in that when conducting PCR, oligonucleotide primers for intergenic regions wzyE-dapF and YPDSF_0064-YPDSF_0065 with the following sequence are used: :
wzyE-dapF-S - ACATACGATGGCCGATCATG,
wzyE-dapF-As - CTGATTATGTGGGGCGCT,
YPDSF_0064-YPDSF_0065-S - CTGAAGGGCGAGGAGAGAC,
YPDSF_0064-YPDSF_0065-As - AGGGTGTTGTTGGTTTTGGT;
differentiation of strains of Y. pestis is carried out by comparing the sizes of amplified fragments of wzyE-dapF and YPDSF_0064-YPDSF_0065 with the sizes of similar fragments characteristic of typical strains of the main (151 bp and 374 bp), Caucasian (185 bp and 434 bp), Altai and Hissar (202 bp and 374 bp), as well as the Ulegei (185 bp and 374 bp) subspecies.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2014100735/10A RU2552611C2 (en) | 2014-01-09 | 2014-01-09 | Method of subspecies differentiation of plague agent strains using polymerase chain reaction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2014100735/10A RU2552611C2 (en) | 2014-01-09 | 2014-01-09 | Method of subspecies differentiation of plague agent strains using polymerase chain reaction method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| RU2014100735A RU2014100735A (en) | 2014-06-20 |
| RU2552611C2 true RU2552611C2 (en) | 2015-06-10 |
Family
ID=51213800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2014100735/10A RU2552611C2 (en) | 2014-01-09 | 2014-01-09 | Method of subspecies differentiation of plague agent strains using polymerase chain reaction method |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2552611C2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2736649C1 (en) * | 2019-12-30 | 2020-11-19 | Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | Method for genetic differentiation of yersinia pseudotuberculosis strains by molecular-genetic typing |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004106553A2 (en) * | 2002-08-01 | 2004-12-09 | The Regents Of The University Of California | Nucleotide sequences specific to yersinia pestis and methods for the detection of yersinia pestis |
| RU2332464C1 (en) * | 2007-08-20 | 2008-08-27 | Федеральное государственное учреждение здравоохранения "Российский научно-исследовательский противочумный институт "Микроб" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (РосНИПЧИ "Микроб") | Method of plague and pseudotuberculosis microbe differentiation with parallel interspecies differentiation of plague microbe strains |
| RU2415948C1 (en) * | 2009-12-11 | 2011-04-10 | Федеральное государственное учреждение здравоохранения "Российский научно-исследовательский противочумный институт "Микроб" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека ("РосНИПЧИ "Микроб") | METHOD OF SUBSPECIFIC DIFFERENTIATION OF Yersinia pestis STRAINS BY MULTILOCUS SEQUENCE TYPING |
-
2014
- 2014-01-09 RU RU2014100735/10A patent/RU2552611C2/en active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004106553A2 (en) * | 2002-08-01 | 2004-12-09 | The Regents Of The University Of California | Nucleotide sequences specific to yersinia pestis and methods for the detection of yersinia pestis |
| RU2332464C1 (en) * | 2007-08-20 | 2008-08-27 | Федеральное государственное учреждение здравоохранения "Российский научно-исследовательский противочумный институт "Микроб" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (РосНИПЧИ "Микроб") | Method of plague and pseudotuberculosis microbe differentiation with parallel interspecies differentiation of plague microbe strains |
| RU2415948C1 (en) * | 2009-12-11 | 2011-04-10 | Федеральное государственное учреждение здравоохранения "Российский научно-исследовательский противочумный институт "Микроб" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека ("РосНИПЧИ "Микроб") | METHOD OF SUBSPECIFIC DIFFERENTIATION OF Yersinia pestis STRAINS BY MULTILOCUS SEQUENCE TYPING |
Non-Patent Citations (1)
| Title |
|---|
| GenBank, Acc. no. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2736649C1 (en) * | 2019-12-30 | 2020-11-19 | Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | Method for genetic differentiation of yersinia pseudotuberculosis strains by molecular-genetic typing |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2014100735A (en) | 2014-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9523131B2 (en) | PCR diagnostics of dermatophytes and other pathogenic fungi | |
| Vuran et al. | Identification of Malassezia species from pityriasis versicolor lesions with a new multiplex PCR method | |
| EP2721170A2 (en) | Compositions and methods for detection of cronobacter spp. and cronobacter species and strains | |
| US20110165568A1 (en) | Sequences of e.coli 055:h7 genome | |
| Derzelle et al. | Use of high-resolution melting and melting temperature-shift assays for specific detection and identification of Bacillus anthracis based on single nucleotide discrimination | |
| JP5522820B2 (en) | Method for detecting pathogens of strawberry important diseases and primers for detection | |
| Singh et al. | Multilocus sequence typing of Salmonella strains by high-throughput sequencing of selectively amplified target genes | |
| RU2471872C1 (en) | Method for differentiating yersinia pestis strains of various subspecies and biovars by polymerase chain reaction and multilocus sequence typing | |
| RU2415948C1 (en) | METHOD OF SUBSPECIFIC DIFFERENTIATION OF Yersinia pestis STRAINS BY MULTILOCUS SEQUENCE TYPING | |
| CN109735645B (en) | Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Sporothrix globosum | |
| JP2016500276A (en) | Isolation of probability-directed nucleotide sequences | |
| RU2552611C2 (en) | Method of subspecies differentiation of plague agent strains using polymerase chain reaction method | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| RU2332464C1 (en) | Method of plague and pseudotuberculosis microbe differentiation with parallel interspecies differentiation of plague microbe strains | |
| Wang et al. | Dinoflagellate community analysis of a fish kill using denaturing gradient gel electrophoresis | |
| RU2736649C1 (en) | Method for genetic differentiation of yersinia pseudotuberculosis strains by molecular-genetic typing | |
| RU2737775C1 (en) | Method for identifying yersinia pestis and yersinia pseudotuberculosis and simultaneous differentiation of yersinia pestis of main and central asian subspecies by multiplex pcr | |
| RU2496882C2 (en) | Method to differentiate strains of plague agent of primary subtype of medieval and antique biovars by method of polymerase chain reaction | |
| RU2404256C1 (en) | Method of subspecific differentiation of plague causative agent strains by sequencing method | |
| JP2006061134A (en) | Primer for detection of mycobacterium tuberculosis and method for detecting and identifying the same bacterium | |
| RU2425891C1 (en) | Method of differentiation of strains of principal and nonprincipal causative plague agent and pseudotuberculosis agent by polymerase chain reaction | |
| Alcoba-Flórez et al. | Yeast molecular identification and typing | |
| RU2732425C1 (en) | Method of genetic indel-typing of strains of brucella melitensis | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit | |
| RU2621869C1 (en) | Method for plague agent strains subspecies differentiation by pcr with real time hybridization-fluorescent account of results |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PD4A | Correction of name of patent owner | ||
| TK4A | Correction to the publication in the bulletin (patent) |
Free format text: CORRECTION TO CHAPTER -PD4A- IN JOURNAL 22-2018 FOR INID CODE(S) (73) |