RU2736649C1 - Method for genetic differentiation of yersinia pseudotuberculosis strains by molecular-genetic typing - Google Patents

Abstract

FIELD: medical microbiology.SUBSTANCE: proposed invention refers to medical microbiology, namely molecular diagnostics and genetic engineering, and can be used in laboratory studies of newly detected strains of Yersinia pseudotuberculosis and when characterizing strains, which are in collections of cultures of cells of institutions involved in their study. Presented is a method for genetic differentiation of Yersinia pseudotuberculosis strains by molecular-genetic typing.EFFECT: method of genotyping enables reliable and fast differentiation of Yersinia pseudotuberculosis strains isolated in different regions, regions and countries.1 cl, 4 tbl, 2 ex

Description

The alleged invention relates to the field of medical microbiology, namely molecular diagnostics and genetic engineering, and can be used in laboratory studies of newly identified strains of Yersinia pseudotuberculosis and in characterizing the strains in the culture collections of institutions involved in their study.

The causative agent of pseudotuberculosis is one of three species of the genus Yersinia that can cause severe infectious diseases in humans. The incidence of pseudotuberculosis is recorded in most subjects of the Russian Federation, while the nosoareal of the disease is distinguished by the presence of regions in the Far East, Siberia, the Urals and the North-West of the country, characterized by the highest incidence rate. The epidemic process of pseudotuberculosis manifests itself in the form of sporadic cases and group diseases. Group diseases occur mainly in organized groups - preschool, suburban, health institutions, schools, boarding schools, military units, enterprises or educational institutions, united by a single food source. The study of Y. pseudotuberculosis strains isolated during outbreaks or in sporadic cases of pseudotuberculosis is an important task of epidemiological investigation and prevention of new diseases. An in-depth characterization of Y. pseudotuberculosis strains suggests the need for their genotyping. Currently, there are a large number of methods for genotyping Y. pseudotuberculosis strains. However, in most cases, the methods are complex and require special equipment and highly qualified personnel.

There is a known method for genotyping Y. pseudotuberculosis strains using VNTR typing (1), which is based on obtaining in PCR the genotypic characteristics of strains using primers that detect loci that include variable tandem repeats, while the totality of the results obtained on the length of different VNTR loci in different strains and is one of the genetic characteristics of the strain.

However, the method is simple in execution, but in some cases, requires taking into account the results with the determination of the exact length of the amplified products of PCR products. It is not always possible to determine the difference in the length of the amplified fragments in different strains without the use of special expensive methods carried out for a long time.

For the prototype, the method of multlocus sequencing-typing (MLST) [2] was chosen, including genotyping of strains of the causative agent of pseudotuberculosis when comparing the sequences of 7 "housekeeping" genes (glnA, thrA, tmk, trpE, adk, argA, aroA).

The disadvantage of this method is the complexity of its execution, since it requires sequencing to read the nucleotide sequence of genes, which is available only to well-equipped diagnostic laboratories with highly qualified personnel, is an economically expensive type of analysis and takes a long time. Sequencing is carried out using expensive imported instruments and reagents.

The technical objective of the present invention is to develop a new method of genotyping that allows for reliable, fast and low cost differentiation of Y. pseudotuberculosis strains isolated in different regions, regions and countries.

The task is achieved by the fact that in the method of genetic differentiation of Y. pseudotuberculosis strains by molecular genetic typing, including the isolation of DNA from the investigated Y. pseudotuberculosis strain, PCR with specific primers and registration of the reaction using electrophoresis, the DNA of the investigated Y. pseudotuberculosis strain is detected in the DNA of the studied Y. pseudotuberculosis strain. seven INDEL markers (loci) ps397, ps866, ps1105, ps1452, ps1509, ps1969, ps1779, having two or three alternative alleles:

with primers for the YPK_0397 gene

Forward: GGGGCCACAAAAAGAGAGTT

Reverse: GTTTTCACGCAGGAACCACT

with an amplification fragment length of 97 bp. or 79 p.o .;

with primers for the YPK_0866 gene

Forward: CACCGCCAGTGTGTGTCTAA

Reverse: TAACTCGGGCGACTGACAAC

with a length of the amplification fragment of 148 bp, 124 bp. or 0;

with primers for the YPK_1105 gene

Forward: CCGAACAGCATGCACAGA

Reverse: AACCCTCTCGGGTGCTATTT

with a fragment length of 81 bp. or 72 p.o .;

with primers for the YPK_1452 gene

Forward: GCGAGGAAAATCTGATTGTGA

Reverse: CAGCGGCTACAATAGGGTGT

with a fragment length of 103 bp. or 88 p.o .;

with primers for the YPK_1509 gene

Forward: TGGCCGTGGCTTTTATTTAT

Reverse: GCCGGAGAATTCCCATTTT

with an amplification fragment length of 90 bp. or 72 p.o .;

with primers for the YPK_1969 gene

Forward: CTCCGATATTGATCCATTCCT

Reverse: GGTATCAATCGCCATTTCCA

with a length of the amplification fragment of 92 bp, 70 bp. or 0;

with primers for the YPK_1779 gene

Forward: TGGATTGATGGCGGTATTCT

Reverse: CTGTAAAGGGGGTATTGTTTCA

with a fragment length of 92 bp. or 71 p. o.

in this case, the results of the reaction are taken into account visually after electrophoresis in 2% agarose gel in the presence of DNA molecular weight markers and a unique INDEL genotype is set for each strain according to seven INDEL markers, and by comparing the seven INDEL genotypes found among themselves and with known genotypes of identification the tables establish the common or different origin of the studied strains of Yersinia pseudotuberculosis.

In this case, PCR is carried out in a volume of 25 μl and the reaction mixture contains:

10 μl 2.5x buffer

1.0 mM MgCl ₂ ,

0.25 mM dNTP mixture,

0.5 units of Tag DNA polymerase,

25 ng of the analyzed DNA in a volume of 5 μl.

In addition, PCR is carried out in compliance with the following steps and modes:

1) 95 ° С denaturation stage - 3 min (1 cycle),

2) 95 ° С denaturation stage - 15 sec,

3) 60 ° C primer annealing stage - 15 sec,

4) 72 ° C elongation stage - 15 sec,

5) Repeat steps 2, 3 and 4 (40 cycles),

6) 72 ° C elongation stage - 3 min.

Rationale for the choice of primers.

When analyzing genome-wide sequences of 30 Y. pseudotuberculosis strains deposited in the GenBank databases, using proprietary computer programs developed at the Rostov-on-Don Anti-Plague Institute of Rospotrebnadzor "GeneExpert" and "ContigSearcher", mutations associated with the occurrence of insertions ( INDEL mutations) at certain loci. Among all detected mutations, seven were selected, which made it possible to differentiate strains of the causative agent of pseudotuberculosis by different genetic groups (INDEL-types). These seven loci contained specific sequences designated as INDEL markers. Using the Primer M and BLAST NCBI computer programs, specific primers were designed to varying regions of the indicated loci ps397, ps866, ps1105, ps1452, ps1509, ps1969, and ps1779, which were used in PCR for genotyping of Y. pseudotuberculosis strains (Table 1).

The use of each pair of primers made it possible to differentiate Y. pseudotuberculosis strains into two or three genetic variants, in accordance with the allele of a specific INDEL marker, as a result of the synthesis of DNA fragments specific for each variant. Analysis of the PCR results using the proposed primers and 30 Y. pseudotuberculosis strains of various serovariants and isolated from various sources in different geographic zones made it possible to present sets of amplification fragments with which it is possible to compare the results of future determinations (Table 2).

Identification table 2 shows the results of PCR using primers designed on the basis of INDEL markers and DNA of Y. pseudotuberculosis strains. In addition, in table 2, INDEL-types are reflected that combine the studied strains of Y. pseudotuberculosis and are designated as genetic groups (I, II-XVI). The method is carried out as follows. Before setting up the method of differentiation of Y. pseudotuberculosis strains, the DNA of the test culture is isolated. The bacterial suspension of the strain in distilled water is introduced into a 1.5 ml microtube, after which the material is disinfected and DNA is isolated according to MU 1.3.2569-09 (3).

Then in PCR in separate tubes, amplification of the isolated DNA is carried out with the following primers:

ps0397

Forward: GGGGCCACAAAAAGAGAGTT

Reverse: GTTTTCACGCAGGAACCACT

with an amplification fragment length of 97 bp. or 79 p.o .;

ps866

Forward: CACCGCCAGTGTGTGTCTAA

Reverse: TAACTCGGGCGACTGACAAC

with a length of the amplification fragment of 148 bp, 124 bp. or 0;

ps1105

Forward: CCGAACAGCATGCACAGA

Reverse: AACCCTCTCGGGTGCTATTT

with a fragment length of 81 bp. or 72 p.o .;

ps1452

Forward: GCGAGGAAAATCTGATTGTGA

Reverse: CAGCGGCTACAATAGGGTGT

with a fragment length of 103 bp. or 88 p.o .;

ps1509

Forward: TGGCCGTGGCTTTTATTTAT

Reverse: GCCGGAGAATTCCCATTTT

with an amplification fragment length of 90 bp. or 72 p.o .;

ps1969

Forward: CTCCGATATTGATCCATTCCT

Reverse: GGTATCAATCGCCATTTCCA

with a length of the amplification fragment of 92 bp, 70 bp. or 0;

ps1779

Forward: TGGATTGATGGCGGTATTCT

Reverse: CTGTAAAGGGGGTATTGTTTCA

with a fragment length of 92 bp. or 71 p. o.

Conditions for carrying out the amplification reaction

Prepare seven tubes for PCR reaction mixtures. Reaction mixtures with a volume of 25 μl include: oligonucleotide primers presented in Table 1, for each pair per separate tube (mixture), 2.5 × PCR buffer - 10 μl, MgCl ₂ - 1.0 mM, dNTP mixture - 0.25 mM, Taq DNA polymerase - 0.5 units, analyzed DNA - 25 ng in a volume of 5 μl.

After that, the amplification reaction is set up in an amplifier, in which the following amplification conditions are set:

1) 95 ° С denaturation stage - 3 min (1 cycle),

2) 95 ° С denaturation stage - 15 sec,

3) 60 ° C primer annealing stage - 15 sec,

4) 72 ° C elongation stage - 15 sec,

5) Repeat steps 2, 3 and 4 (40 cycles),

6) 72 ° C elongation stage - 3 min.

Recording of the typing results is carried out visually after electrophoretic separation of the fragments obtained by PCR in 2% agarose gel in the presence of molecular weight markers, which make it possible to estimate the molecular weights of the obtained amplificates in transmitted UV light when staining DNA with ethidium bromide in the gel.

The analysis of the results consists in obtaining for each investigated strain a set of seven amplification fragments of a certain size and determining the strain to one genetic group (INDEL-type), which is characterized by a set of amplifications identical in molecular weights, presented in the identification table 2. Inclusion of the investigated strain in one of the genetic groups (I, II-XVI) confirms the relationship of this strain with those in this group.

The essence of the invention is illustrated by examples.

Example 1. Genotyping of the Y. pseudotuberculosis T 197 (17854) strain in a model experiment. The strain was obtained from the collection of the FKUZ of the Rostov-on-Don anti-plague institute of Rospotrebnadzor.

Isolation of the DNA of the Y. pseudotuberculosis T 197 (17854) strain is carried out according to the standard procedure [3]. The main stage is PCR with the isolated DNA in an amplifier using seven pairs of primers. PCR is carried out using the amplification program: 1) 95 ° C - 3 min, 2) 95 ° C - 15 sec, 3) 60 ° C - 15 sec, 4) 72 ° C - 15 sec, 5) repeat 2 and 3, and 4 stages 40 times, 6) 72 ° С - 3 min. After the PCR reaction, the reaction mixtures of 7 tubes, each of which contains one of the pairs of the proposed primers and the DNA of the Y. pseudotuberculosis T 197 (17854) strain, are applied to a 2% agarose gel and electrophoresis is carried out with ethidium bromide staining in the presence of molecular weight markers and visualization in passing UV light. Accounting for the separation performed (table 3) determined the set of fragments of molecular weights amplified in PCR:

Thus, a comparative analysis of the results obtained with identification table 2 indicates that the Y. pseudotuberculosis T 197 (17854) strain has a set of amplification fragments and, therefore, the alleles of loci with INDEL markers, which are identical to the Y. pseudotuberculosis Pa3606, T1779 strains (17848) and IP33250, which allows to combine these strains into one genetic group - X and consider them closely related.

Example 2. Genotyping of the Y. pseudotuberculosis IP 33131 (379) strain in a model experiment. The strain was obtained from the collection of the Pasteur Research Institute of Epidemiology and Microbiology of the Federal Service for Supervision of Consumer Rights Protection and Human Welfare.

Isolation of DNA strains Y. pseudotuberculosis IP 33131 (379) is carried out according to the standard procedure [3]. The main stage is PCR with the isolated DNA in an amplifier using seven pairs of primers. PCR is carried out using the amplification program: 1) 95 ° C - 3 min, 2) 95 ° C - 15 sec, 3) 60 ° C - 15 sec, 4) 72 ° C - 15 sec, 5) repeat 2 and 3, and 4 stages 40 times, 6) 72 ° С - 3 min. After PCR, the reaction mixtures of 7 tubes, each of which contains one of the pairs of the proposed primers and DNA of the Y. pseudotuberculosis IP 33131 (379) strain, are applied to a 2% agarose gel and electrophoresis is carried out with ethidium bromide staining in the presence of molecular weight markers and visualization in the passage UV light. Accounting for the separation performed (Table 4) determined the set of fragments of molecular weights amplified in PCR:

Conclusion Comparison of the results obtained with identification table 2 indicates that the Y. pseudotuberculosis IP 33131 (379) strain has a set of amplification fragments and, therefore, the alleles of the loci with INDEL markers are identical to the Y. pseudotuberculosis N912, IP 33131 (604) and SP93422 strains. , which makes it possible to combine these strains into one genetic group - I and consider them closely related, which makes it possible to determine the place of their isolation and origin.

The use of the present invention allows to carry out genetic differentiation of Y. pseudotuberculosis strains reliably, quickly, with low cost, at any stage of laboratory diagnostics through the use of the developed primers. As a result, an individual genotypic characterization of the strain is obtained based on seven marker INDEL loci, the totality of which constitutes an independent genetic group (INDEL type).

Sources of information.

1. Evseeva V.V., Platonov M.E., Dentovskaya S.V., Anisimov A.P. Typing Yersinia pseudotuberculosis using multilocus analysis of the variable number of tandem repeats // Problems of especially dangerous infections, vol. 4, 2015.S. 55-57.

2. Laukkanen-Ninios R, Didelot X, Jolley KA, Morelli G, Sangal V, Kristo P, Brehony C, Imori PF, Fukushima H, Siitonen A, Tseneva G, Voskressenskaya E, Falcao JP, Korkeala H, Maiden MC, Mazzoni C, Carniel E, Skurnik M, Achtman M. 2011. Population structure of the Yersinia pseudotuberculosis complex according to multilocus sequence typing. Environ Microbiol 13: 3114-3127.

3. Organization of the work of laboratories using methods of amplification of nucleic acids when working with material containing microorganisms of I-IV pathogenicity groups: Methodical instructions. MU 1.3.2569-09. - Moscow: Federal Service for Supervision of Consumer Rights Protection and Human Welfare, 2009. - 35 p.

Claims (43)

1. A method of genetic differentiation of Yersinia pseudotuberculosis strains by molecular genetic typing, including the isolation of DNA from the investigated Yersinia pseudotuberculosis strain, PCR with specific primers and accounting for the reaction after electrophoresis, characterized in that seven common markers are identified from the DNA of the investigated Yersinia pseudotuberculosis strain (loci) ps397, ps1452, ps1779, ps866, ps1105, ps1509, ps1969, having two or three alternative alleles: with primers for the YPK_0397 gene Forward: GGGGCCACAAAAAGAGAGTT Reverse: GTTTTCACGCAGGAACCACT with an amplification fragment length of 97 bp. or 79 p.o .; with primers for the YPK_0866 gene Forward: CACCGCCAGTGTGTGTCTAA Reverse: TAACTCGGGCGACTGACAAC with a length of the amplification fragment of 148 bp, 124 bp. or 0; with primers for the YPK_1105 gene Forward: CCGAACAGCATGCACAGA Reverse: AACCCTCTCGGGTGCTATTT with a fragment length of 81 bp. or 72 p.o .; with primers for the YPK_1452 gene Forward: GCGAGGAAAATCTGATTGTGA Reverse: CAGCGGCTACAATAGGGTGT with a fragment length of 103 bp. or 88 p.o .; with primers for the YPK_1509 gene Forward: TGGCCGTGGCTTTTATTTAT Reverse: GCCGGAGAATTCCCATTTT with an amplification fragment length of 90 bp. or 72 p.o .; with primers for the YPK_1969 gene Forward: CTCCGATATTGATCCATTCCT Reverse: GGTATCAATCGCCATTTCCA with a length of the amplification fragment of 92 bp, 70 bp. or 0; with primers for the YPK_1779 gene Forward: TGGATTGATGGCGGTATTCT Reverse: CTGTAAAGGGGGTATTGTTTCA with a fragment length of 92 bp. or 71 p. o., in this case, the results of the reaction are taken into account visually after electrophoresis in 2% agarose gel in the presence of markers of molecular weights of DNA and a unique INDEL genotype is set for each strain using seven INDEL markers, and by comparing the seven INDEL genotypes found among themselves and with known genotypes of identification the tables establish the general or different origin of the studied strains of Yersinia pseudotuberculosis. 2. The method according to claim 1, characterized in that the PCR is carried out in a volume of 25 μl and the reaction mixture contains: 10 μl 2.5x buffer 1.0 mM MgCl ₂ , 0.25 mM dNTP mixture, 0.5 units of Tag DNA polymerase, 25 ng of the analyzed DNA in a volume of 5 μl. 3. The method according to claim 1, characterized in that the PCR is carried out in compliance with the following steps and modes: 1) 95 ° С denaturation stage - 3 min (1 cycle), 2) 95 ° С denaturation stage - 15 sec, 3) 60 ° C primer annealing stage - 15 sec, 4) 72 ° C elongation stage - 15 sec, 5) repeat steps 2, 3 and 4 (40 cycles), 6) 72 ° C elongation stage - 3 min.