RU2404256C1 - Method of subspecific differentiation of plague causative agent strains by sequencing method - Google Patents
Method of subspecific differentiation of plague causative agent strains by sequencing method Download PDFInfo
- Publication number
- RU2404256C1 RU2404256C1 RU2009116913/10A RU2009116913A RU2404256C1 RU 2404256 C1 RU2404256 C1 RU 2404256C1 RU 2009116913/10 A RU2009116913/10 A RU 2009116913/10A RU 2009116913 A RU2009116913 A RU 2009116913A RU 2404256 C1 RU2404256 C1 RU 2404256C1
- Authority
- RU
- Russia
- Prior art keywords
- rhas
- arac
- subspecies
- strains
- differentiation
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области медицинской микробиологии, в частности к подвидовой дифференциации штаммов возбудителя чумы и к молекулярному типированию чумного микроба.The invention relates to the field of medical microbiology, in particular to subspecies differentiation of strains of the plague pathogen and molecular typing of the plague microbe.
По существующей в настоящее время классификации возбудитель чумы на основании ряда биохимических признаков делится на биовары и подвиды. Однако проявление фенотипических признаков может значительно изменяться в зависимости от условий существования возбудителя. Более надежными являются способы, основанные на генетических свойствах, отличающихся большей консервативностью и поэтому дающих более стабильные и хорошо воспроизводимые результаты.According to the current classification, the plague pathogen is divided into biovars and subspecies based on a number of biochemical characteristics. However, the manifestation of phenotypic characters can vary significantly depending on the conditions of the pathogen. More reliable are methods based on genetic properties that are more conservative and therefore give more stable and well reproducible results.
Штаммы возбудителя чумы, циркулирующие в природных очагах Российской Федерации и ближнего зарубежья, делятся на 5 подвидов: основной и 4 неосновных подвида - кавказский, алтайский, гиссарский и улегейский. Несмотря на то что все пять подвидов очень близки по свойствам, они значительно отличаются по вирулентности и эпидемической значимости. В связи с этим, важное значение имеет разработка надежных и эффективных методов генетической подвидовой дифференциации Yersinia pestis. Используемые для этих целей генетические способы основаны на сравнительном анализе числа вариабельных тандемных повторов (VNTR) - небольших повторяющихся последовательностей ДНК, расположенных в различных участках генома чумного микроба. Но эти последовательности либо отличаются очень высокой вариабельностью, не позволяющей определять подвидовую принадлежность штаммов Y.pestis, либо сами расположены в нестабильных областях генома, которые могут утрачиваться в результате протяженных делеций (Брюханов с соавт., 2001; Klevitska et al., 2001; Сучков с соавт. 2006, Булгакова с соавт., 2008). Использование VNTR анализа для молекулярного типирования штаммов бактерий необходимо сочетать с анализом других более консервативных участков ДНК. Для этого чаще всего используются гены вирулентности и жизнеобеспечения (Achtman et al., 1999; Kotetishwili et al., 2005), однако эти гены отличаются высоким консерватизмом, ограничивающим их применение для генотипирования возбудителя чумы. Кроме того, в литературе отсутствуют публикации об использовании каких-либо генов жизнеобеспечения для дифференциации именно неосновных подвидов Y.pestis.The plague pathogen strains circulating in the natural foci of the Russian Federation and neighboring countries are divided into 5 subspecies: the main and 4 non-main subspecies - Caucasian, Altai, Hissar and Ulegei. Despite the fact that all five subspecies are very similar in properties, they differ significantly in virulence and epidemic significance. In this regard, the development of reliable and effective methods of genetic subspecies differentiation of Yersinia pestis is important. The genetic methods used for these purposes are based on a comparative analysis of the number of variable tandem repeats (VNTRs) - small repeating DNA sequences located in different parts of the plague microbe genome. But these sequences either differ in very high variability, which does not allow us to determine the subspecies affiliation of Y. pestis strains, or are themselves located in unstable regions of the genome that may be lost as a result of extended deletions (Bruchanov et al., 2001; Klevitska et al., 2001; Suchkov et al. 2006, Bulgakova et al., 2008). The use of VNTR analysis for the molecular typing of bacterial strains must be combined with the analysis of other more conservative DNA regions. For this, the virulence and life support genes are most often used (Achtman et al., 1999; Kotetishwili et al., 2005), however, these genes are highly conservative, limiting their use for genotyping of the plague pathogen. In addition, there are no publications in the literature on the use of any life support genes for differentiating precisely the non-main subspecies Y. pestis.
Известен способ дифференциации иерсиний методом секвенирования фрагментов генов жизнедеятельности glnA, gyrB, recA, Y-HSP60, полученных в полимеразной цепной реакции (Kotetishwili et al. Multilocus sequence typing for studying genetic relationships among Yersinia species. J. Clin. Microbiol. 2005. Vol.43, N 6. P.2674-2684). Однако использование этих генов позволяет дифференцировать возбудителя чумы от других представителей рода Yersinia, но не проводит внутривидовую дифференциацию чумного микроба и не позволяет определять подвидовую принадлежность штамма. В литературе отсутствуют и другие публикации об использовании каких-либо генов жизнеобеспечения для подвидовой дифференциации возбудителя чумы методом секвенирования.A known method of differentiating Yersinia by sequencing fragments of the vital activity genes glnA, gyrB, recA, Y-HSP60 obtained in the polymerase chain reaction (Kotetishwili et al. Multilocus sequence typing for studying genetic relationships among Yersinia species. J. Clin. Microbiol. 2005. Vol. 43, N 6. P.2674-2684). However, the use of these genes makes it possible to differentiate the plague pathogen from other representatives of the genus Yersinia, but does not conduct intraspecific differentiation of the plague microbe and does not allow to determine the subspecies belonging of the strain. There are no other publications in the literature on the use of any life support genes for subspecies differentiation of the plague pathogen by sequencing.
Задачей изобретения является поиск в геноме чумного микроба менее консервативных генов, отличающихся большей вариабельностью их нуклеотидных последовательностей, использование которых позволяет проводить подвидовую дифференциацию штаммов Y.pestis.The objective of the invention is a search in the plague microbe genome of less conservative genes that are more variable in their nucleotide sequences, the use of which allows for subspecies differentiation of Y. pestis strains.
Впервые предложен способ дифференциации штаммов возбудителя чумы по подвидам, основанный на использовании в качестве ДНК-мишеней для секвенирования генов rhaS и araC, контролирующих ферментацию рамнозы и арабинозы. Гены rhaS и araC входят в состав rha и ara оперонов, кодирующих утилизацию моносахаридов - рамнозы и арабинозы. Ферментация рамнозы и арабинозы является дифференциально-диагностическим признаком, используемым в биохимических схемах внутривидовой дифференциации возбудителя чумы. Различные подвиды Y.pestis отличаются по фенотипическому проявлению этих признаков, что позволяет предположить наличие у некоторых из них генетических дефектов в пути биосинтеза моносахаридов и вариабельность нуклеотидной последовательности генов rha и ara оперонов, а также указывает на возможность использования этих генов жизнеобеспечения для подвидовой дифференциации чумного микроба.For the first time, a method is proposed for differentiating strains of the plague pathogen by subspecies, based on the use of rhaS and araC genes that control rhamnose and arabinose fermentation as target DNAs. The rhaS and araC genes are part of the rha and ara operons encoding the utilization of monosaccharides - rhamnose and arabinose. The fermentation of rhamnose and arabinose is a differential diagnostic feature used in biochemical schemes of intraspecific differentiation of the plague pathogen. The different subspecies of Y. pestis differ in the phenotypic manifestation of these characters, which suggests that some of them have genetic defects in the biosynthesis of monosaccharides and the variability of the nucleotide sequence of the rha and ara operon genes, and also indicates the possibility of using these life support genes for subspecies differentiation of the plague microbe .
Технический результат предлагаемого изобретения заключается в возможности проведения подвидовой дифференциации штаммов чумного микроба.The technical result of the invention is the ability to conduct subspecies differentiation of strains of the plague microbe.
Технический результат достигается способом дифференциации штаммов возбудителя чумы методом секвенирования, который предусматривает выделение хромосомной ДНК исследуемого штамма, проведение полимеразной цепной реакции, амплификацию фрагментов генов rhaS и araC, регулирующих экспрессию ферментации рамнозы и арабинозы, при этом олигонуклеотидные праймеры на гены rhaS и araC имеют следующие последовательности:The technical result is achieved by the method of differentiation of strains of the plague pathogen by sequencing, which involves the isolation of the chromosomal DNA of the studied strain, the polymerase chain reaction, amplification of fragments of rhaS and araC genes that regulate the expression of rhamnose and arabinose fermentation, while the oligonucleotide primers for rhaS and araC genes have the following :
RhaS s CAAATAAAGTGCTTGATTGCTTGTCTDRhaS s CAAATAAAGTGCTTGATTGCTTGTCTD
RhaS as GCTATTGTCGCTGTAACACAGTTGATGRhaS as GCTATTGTCGCTGTAACACAGTTGATG
AraC s - ATTGTTGGTATCACCGCTGAraC s - ATTGTTGGTATCACCGCTG
AraC as - TACTGGCATAACCGTAGC,AraC as - TACTGGCATAACCGTAGC,
в полученной нуклеотидной последовательности фрагментов генов rhaS и araC по нуклеотидам, находящихся в позициях 482, 494, 671 гена rhaS и в позиции 773 гена araC, определяют генотип штамма, после чего проводят дифференциацию штаммов путем сравнения полученного генотипа с генотипами основного и неосновных подвидов.in the obtained nucleotide sequence of fragments of rhaS and araC genes by the nucleotides located at positions 482, 494, 671 of the rhaS gene and at position 773 of the araC gene, the strain genotype is determined, after which the strains are differentiated by comparing the obtained genotype with the genotypes of the main and non-main subspecies.
Способ осуществляют следующим образом.The method is as follows.
Выделение хромосомной ДНК исследуемого штамма чумного микроба проводят по стандартной методике в соответствии с МУ 1.3.1794-03 «Организация работы при исследованиях методом ПЦР материала, инфицированного микроорганизмами I-II групп патогенности».Isolation of chromosomal DNA of the studied strain of plague microbe is carried out according to the standard method in accordance with MU 1.3.1794-03 “Organization of work during PCR studies of material infected with microorganisms of pathogenicity groups I-II”.
Полимеразную цепную реакцию осуществляют по стандартной методике (МУ 1.3.1794-03) с применением вышеуказанных праймеров на гены rhaS и araC.The polymerase chain reaction is carried out according to the standard method (MU 1.3.1794-03) using the above primers for the rhaS and araC genes.
Олигонуклеотидные праймеры, используемые для амплификации в ПЦР фрагментов генов rhaS и araC, рассчитаны на основе нуклеотидных последовательностей этих генов у штаммов чумного микроба CO92 и Pestoides F, представленных в базе данных GenBank. С помощью рассчитанных праймеров проводят в ПЦР амплификацию фрагментов генов rhaS и araC и определяют нуклеотидные последовательности полученных фрагментов генов. Олигонуклеотидные праймеры на гены rhaS и araC имеют следующий состав:Oligonucleotide primers used for PCR amplification of fragments of rhaS and araC genes were calculated based on the nucleotide sequences of these genes in plague microbe strains CO92 and Pestoides F, presented in the GenBank database. Using the calculated primers, amplification of fragments of rhaS and araC genes is carried out in PCR and the nucleotide sequences of the obtained gene fragments are determined. Oligonucleotide primers for the rhaS and araC genes have the following composition:
RhaS s CAAATAAAGTGCTTGATTGCTTGTCTGRhaS s CAAATAAAGTGCTTGATTGCTTGTCTG
RhaS as GCTATTGTCGCTCTAACACAGTTGATGRhaS as GCTATTGTCGCTCTAACACAGTTGATG
AraC s - ATTGTTGGTATCACCGCTGAraC s - ATTGTTGGTATCACCGCTG
AraC as - TACTGGCATAACCGTAGCAraC as - TACTGGCATAACCGTAGC
Полимеразную цепную реакцию с амплификацией фрагментов генов rhaS и araC с применением праймеров RhaS-s и RhaS-as, AraC-s и AraC-as осуществляют по следующей программе: 1-й цикл - 95°С, 5 мин; затем 35 циклов - 95°С, 45 сек; 58°С, 45 сек; 72°С, 1 мин и завершающий цикл - 72°С, 5 мин.The polymerase chain reaction with amplification of fragments of rhaS and araC genes using primers RhaS-s and RhaS-as, AraC-s and AraC-as is carried out according to the following program: 1st cycle - 95 ° C, 5 min; then 35 cycles - 95 ° C, 45 sec; 58 ° C, 45 sec; 72 ° С, 1 min and the final cycle - 72 ° С, 5 min.
Определение нуклеотидных последовательностей ПЦР - фрагментов генов rhaS и araC проводят на автоматическом секвенаторе по методу F. Sanger et al. (1977) с использованием прямых и обратных праймеров.The determination of the nucleotide sequences of PCR fragments of the rhaS and araC genes is carried out on an automatic sequencer according to the method of F. Sanger et al. (1977) using forward and reverse primers.
Для определения генотипа исследуемого штамма и сравнения его с генотипами основного и неосновных подвидов проводят анализ нуклеотидов, находящихся в позициях 482, 494, 671 гена rhaS и в позиции 773 гена araC. Затем устанавливают генотип штамма и сравнивают с генотипом основного и неосновных подвидов возбудителя чумы. Совпадение генотипа исследуемого штамма с генотипом одного из подвидов свидетельствует о принадлежности изучаемого штамма к этому подвиду.To determine the genotype of the studied strain and compare it with the genotypes of the main and minor subspecies, nucleotides located at positions 482, 494, 671 of the rhaS gene and at position 773 of the araC gene are analyzed. The genotype of the strain is then established and compared with the genotype of the main and minor subspecies of the plague pathogen. The coincidence of the genotype of the studied strain with the genotype of one of the subspecies indicates the belonging of the studied strain to this subspecies.
ШтаммыStrains
основного подвида имеют генотип rhaS: 482-G. 494-Т, 671-А, araC: 773-Т,the main subspecies have the rhaS: 482-G genotype. 494-T, 671-A, araC: 773-T,
кавказского подвида имеют генотип rhaS: 482-G. 494-С, 671-G, araC: 773-Т,Caucasian subspecies have the rhaS: 482-G genotype. 494-C, 671-G, araC: 773-T,
алтайского подвида имеют генотип rhaS: 482-G. 494-T, 671-G, araC: 773-G,Altai subspecies have the rhaS: 482-G genotype. 494-T, 671-G, araC: 773-G,
гиссарского подвида имеют генотип rhaS: 482-A. 494-Т, 671-G, araC: 773-G,the Hissar subspecies have the rhaS: 482-A genotype. 494-T, 671-G, araC: 773-G,
улегейского подвида имеют генотип rhaS: 482-G. 494-Т, 671-G, araC: 773-Tthe Ulegean subspecies have the rhaS: 482-G genotype. 494-T, 671-G, araC: 773-T
Результаты сравнения нуклеотидных последовательностей фрагментов генов rhaS и araC у штаммов различных подвидов Y.pestis представлены в таблице 1. Интерпретацию полученных результатов осуществляют в соответствии с таблицей 2. Принцип подвидовой дифференциации наглядно отражен на представленном чертеже.The results of comparing the nucleotide sequences of fragments of rhaS and araC genes in strains of different subspecies of Y. pestis are presented in table 1. The results are interpreted in accordance with table 2. The principle of subspecies differentiation is clearly reflected in the drawing.
Сущность изобретения поясняется примерами.The invention is illustrated by examples.
Пример 1. Подвидовая дифференциация штамма Y.pestis M-231 (Модельный эксперимент).Example 1. Subspecies differentiation of the strain Y. pestis M-231 (Model experiment).
Выделение ДНК штамма Y.pestis M-231 проводят стандартным методом с помощью лизирующего раствора на основе 6М гуанидинизотиоцианата с предварительным обеззараживанием культуры путем добавления мертиолята натрия до концентрации 1:10000 с последующим прогреванием при температуре 56°С в течение 30 мин. (Организация работы при исследованиях методом ПЦР материала, инфицированного микроорганизмами I-II групп патогенности (МУ 1.3.1794-03)).DNA isolation of strain Y. pestis M-231 is carried out by the standard method using a lysing solution based on 6M guanidine isothiocyanate with preliminary disinfection of the culture by adding sodium thiolate to a concentration of 1: 10000, followed by heating at 56 ° C for 30 min. (Organization of work during PCR studies of material infected with microorganisms of pathogenicity groups I-II (MU 1.3.1794-03)).
Полимеразную цепную реакцию проводят в объеме 25 мкл; реакционная смесь содержит: 1 × буфер (10 × ПЦР-буфер - 2,5 мкл), MgCl2 - 2,0 мМ, смесь dNTP - 0,3 мМ, олигонуклеотидные праймеры - 2 пмол, Taq DNA полимераза - 0,1 ед., исследуемой ДНК - 10 мкл. Продукты амплификации анализируют в 1-2% агарозном геле с добавлением этидиум бромида и просматриваются в УФ свете.The polymerase chain reaction is carried out in a volume of 25 μl; the reaction mixture contains: 1 × buffer (10 × PCR buffer - 2.5 μl), MgCl 2 - 2.0 mm, dNTP mixture - 0.3 mm, oligonucleotide primers - 2 pmol, Taq DNA polymerase - 0.1 unit ., the investigated DNA - 10 μl. Amplification products are analyzed on a 1-2% agarose gel with the addition of ethidium bromide and viewed in UV light.
Нуклеотидные последовательности образованных в ПЦР фрагментов генов rhaS и araC определяют на автоматическом секвенаторе по методу F. Sanger et al. (1977) с использованием прямых и обратных праймеров. В определенных с помощью вышеуказанных манипуляций нуклеотидных последовательностях генов rhaS и araC устанавливают нуклеотиды, находящиеся в позициях 482, 494, 671 гена rhaS и 773 гена araC и определяют генотип штамма. Штамм Y.pestis M-231 имеет генотип rhaS: 482-G, 494-Т, 671-А, araC: 773-Т. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы основного подвида чумного микроба, из чего делают вывод о принадлежности штамма Y.pestis M-231 к основному подвиду возбудителя чумы.The nucleotide sequences of rhaS and araC genes generated in PCR are determined on an automated sequencer according to the method of F. Sanger et al. (1977) using forward and reverse primers. In the nucleotide sequences of the rhaS and araC genes determined using the above manipulations, nucleotides are located at positions 482, 494, 671 of the rhaS gene and 773 of the araC gene and the genotype of the strain is determined. Strain Y. pestis M-231 has the genotype rhaS: 482-G, 494-T, 671-A, araC: 773-T. According to table 2, it is established that strains of the main subspecies of the plague microbe have such a genotype, from which it is concluded that the strain Y.pestis M-231 belongs to the main subspecies of the plague pathogen.
Пример 2. Дифференциацию штамма Y.pestis 818 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis 818 имеет генотип rhaS: 482-G, 494-С, 671-G, araC: 773-Т. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы кавказского подвида чумного микроба, что свидетельствует о принадлежности штамма Y.pestis 818 к кавказскому подвиду возбудителя чумы.Example 2. The differentiation of strain Y. pestis 818 is carried out analogously to example 1. In the obtained nucleotide sequences of the rhaS and araC genes, the nucleotides located at positions 482, 494, 671 of the rhaS gene and 773 of the araC gene are determined, and the genotype of the strain is determined. Strain Y. pestis 818 has the genotype rhaS: 482-G, 494-C, 671-G, araC: 773-T. According to table 2, it is established that strains of the Caucasian subspecies of the plague microbe have such a genotype, indicating that the strain Y. pestis 818 belongs to the Caucasian subspecies of the plague pathogen.
Пример 3. Дифференциацию штамма Y.pestis И2359 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis И2359 имеет генотип rhaS: 482-G, 494-T/C, 671-G, araC: 773-G. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы алтайского подвида чумного микроба. Делают вывод о принадлежности штамма Y.pestis И2359 к алтайскому подвиду возбудителя чумы.Example 3. The differentiation of the strain Y. pestis I2359 is carried out analogously to example 1. In the obtained nucleotide sequences of the rhaS and araC genes, the nucleotides located at positions 482, 494, 671 of the rhaS gene and 773 of the araC gene are determined, and the strain genotype is determined. Strain Y.pestis I2359 has the genotype rhaS: 482-G, 494-T / C, 671-G, araC: 773-G. According to table 2, it is established that strains of the Altai subspecies of the plague microbe have such a genotype. The conclusion is drawn that the strain Y. pestis I2359 belongs to the Altai subspecies of the plague pathogen.
Пример 4. Дифференциацию штамма Y.pestis A-1728 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis А-1728 имеет генотип rhaS: 482-А, 494-Т, 671-G, araC: 773-G. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы гиссарского подвида чумного микроба. Делают вывод о принадлежности штамма Y.pestis А-1728 к гиссарскому подвиду возбудителя чумы.Example 4. The differentiation of strain Y. pestis A-1728 is carried out analogously to example 1. In the obtained nucleotide sequences of the rhaS and araC genes, the nucleotides located at positions 482, 494, 671 of the rhaS gene and 773 of the araC gene are determined, and the genotype of the strain is determined. Strain Y. pestis A-1728 has the genotype rhaS: 482-A, 494-T, 671-G, araC: 773-G. According to table 2, it is established that strains of the Hissar subspecies of the plague microbe have such a genotype. The conclusion is drawn that the strain Y. pestis A-1728 belongs to the Hissar subspecies of the plague pathogen.
Пример 5. Дифференциацию штамма Y.pestis И-3131 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis И-3131 имеет генотип rhaS: 482-G, 494-Т, 671-G, araC: 773-T. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы улегейского подвида чумного микроба. Делают вывод о принадлежности штамма Y.pestis И-3131 к улегейскому подвиду возбудителя чумы.Example 5. The differentiation of the strain Y. pestis I-3131 is carried out analogously to example 1. In the obtained nucleotide sequences of the rhaS and araC genes, the nucleotides located at positions 482, 494, 671 of the rhaS gene and 773 of the araC gene are determined and the genotype of the strain is determined. Strain Y. pestis I-3131 has the genotype rhaS: 482-G, 494-T, 671-G, araC: 773-T. According to table 2, it is established that strains of the Ulegeic subspecies of the plague microbe have such a genotype. The conclusion is drawn that the strain Y. pestis I-3131 belongs to the Ulegeic subspecies of the plague pathogen.
Отличительной особенностью заявляемого способа является использование в качестве ДНК мишеней для секвенирования последовательностей генов - rhaS и araC, ранее никогда не применявшихся для подвидовой дифференциации возбудителя чумы. Преимущество использования этих генов заключается в том, что они позволяют дифференцировать не только основной и неосновные подвиды, но и проводить разделение среди неосновных подвидов с точным установлением подвидовой принадлежности изучаемого штамма и отнесением его к одному из пяти подвидов Y.pestis (основной, кавказский, алтайский, гиссарский и улегейский). Использование в заявляемом способе генов rhaS и araC, имеющих большую вариабельность нуклеотидных последовательностей по сравнению с другими генами жизнеобеспечения, применяемыми в настоящее время для генотипирования возбудителя чумы, впервые дает возможность проводить генетическую дифференциацию по подвидам, что значительно повышает эффективность внутривидового типирования Y.pestis по подвидам. Применение рассчитанных нами праймеров на гены rhaS и araC позволяет проводить секвенирование относительно небольших (соответственно 360 и 829 п.н.), но наиболее вариабельных фрагментов этих генов. Заявленный способ успешно апробирован на тридцати двух штаммах возбудителя чумы основного и неосновных подвидов.A distinctive feature of the proposed method is the use of DNA targets for sequencing of gene sequences - rhaS and araC, previously never used for subspecies differentiation of the plague pathogen. The advantage of using these genes is that they allow us to differentiate not only the main and non-main subspecies, but also to carry out the division among non-main subspecies with the exact establishment of the subspecies of the studied strain and assigning it to one of the five subspecies of Y. pestis (main, Caucasian, Altai , Hissar and Ulegeic). The use of the rhaS and araC genes in the claimed method, which have greater variability of nucleotide sequences compared to other life support genes currently used for genotyping of the plague pathogen, makes it possible for the first time to carry out genetic differentiation by subspecies, which significantly increases the efficiency of intraspecific typing of Y.pestis by subspecies . The use of the rhaS and araC primers calculated by us allows sequencing of relatively small (360 and 829 bp, respectively), but the most variable fragments of these genes. The claimed method has been successfully tested on thirty-two strains of the causative agent of the plague of the main and minor subspecies.
Таким образом, заявленный способ, основанный на определении нуклеотидной последовательности фрагментов генов rhaS и araC, регулирующих ферментацию рамнозы и арабинозы, позволяет быстро, эффективно и надежно проводить дифференциацию подвидов возбудителя чумы, отличающихся по вирулентному и эпидемическому потенциалу.Thus, the claimed method, based on the determination of the nucleotide sequence of fragments of rhaS and araC genes that regulate the fermentation of ramnose and arabinose, allows quickly, efficiently and reliably to differentiate subspecies of the plague pathogen, which differ in virulent and epidemic potential.
Claims (1)
RhaS s CAAATAAAGTGCTTGATTGCTTGTCTG;
RhaS as GCTATTGTCGCTGTAACACAGTTGATG;
AraC s - ATTGTTGGTATCACCGCTG;
AraC as - TACTGGCATAACCGTAGC,
на гены rhaS и araC, регулирующие ферментацию рамнозы и арабинозы, амплификацию фрагментов генов, установление их нуклеотидной последовательности и определение генотипа штамма по нуклеотидам, находящимся в позициях 482, 494, 671 гена rhaS и в позиции 773 гена araC, после чего проводят дифференциацию штаммов путем сравнения полученного генотипа с генотипами основного и неосновных подвидов. The method of subspecies differentiation of strains of the plague pathogen by sequencing, including the isolation of chromosomal DNA of the studied strain, the polymerase chain reaction using primers:
RhaS s CAAATAAAGTGCTTGATTGCTTGTCTG;
RhaS as GCTATTGTCGCTGTAACACAGTTGATG;
AraC s - ATTGTTGGTATCACCGCTG;
AraC as - TACTGGCATAACCGTAGC,
to rhaS and araC genes that regulate rhamnose and arabinose fermentation, amplification of gene fragments, determination of their nucleotide sequence and determination of the strain genotype by nucleotides located at positions 482, 494, 671 of the rhaS gene and at position 773 of the araC gene, after which the strains are differentiated by comparing the obtained genotype with the genotypes of the main and minor subspecies.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2009116913/10A RU2404256C1 (en) | 2009-05-04 | 2009-05-04 | Method of subspecific differentiation of plague causative agent strains by sequencing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2009116913/10A RU2404256C1 (en) | 2009-05-04 | 2009-05-04 | Method of subspecific differentiation of plague causative agent strains by sequencing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2404256C1 true RU2404256C1 (en) | 2010-11-20 |
Family
ID=44058447
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2009116913/10A RU2404256C1 (en) | 2009-05-04 | 2009-05-04 | Method of subspecific differentiation of plague causative agent strains by sequencing method |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2404256C1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2471872C1 (en) * | 2011-09-08 | 2013-01-10 | Российская Федерация, от имени которой выступает Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека | Method for differentiating yersinia pestis strains of various subspecies and biovars by polymerase chain reaction and multilocus sequence typing |
| RU2496882C2 (en) * | 2012-09-17 | 2013-10-27 | Российская Федерация, от имени которой выступает Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека | Method to differentiate strains of plague agent of primary subtype of medieval and antique biovars by method of polymerase chain reaction |
-
2009
- 2009-05-04 RU RU2009116913/10A patent/RU2404256C1/en not_active IP Right Cessation
Non-Patent Citations (1)
| Title |
|---|
| LM KUKLEVA "A study of the nucleotide sequence variability of rha locus genes of Yersinia pestis main and non-main subspecies" Mol Gen Mikrobiol Virusol 2008; (2):23-7, реферат. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2471872C1 (en) * | 2011-09-08 | 2013-01-10 | Российская Федерация, от имени которой выступает Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека | Method for differentiating yersinia pestis strains of various subspecies and biovars by polymerase chain reaction and multilocus sequence typing |
| RU2496882C2 (en) * | 2012-09-17 | 2013-10-27 | Российская Федерация, от имени которой выступает Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека | Method to differentiate strains of plague agent of primary subtype of medieval and antique biovars by method of polymerase chain reaction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9523131B2 (en) | PCR diagnostics of dermatophytes and other pathogenic fungi | |
| Platonov et al. | Molecular typing of Yersinia pestis | |
| US20220325324A1 (en) | Systems and methods for the detection of infectious diseases | |
| RU2016112354A (en) | NUCLEIC ACID PROBE | |
| Book et al. | Monitoring infection: from blood culture to polymerase chain reaction (PCR) | |
| Pisal et al. | Detection of mycoplasma contamination directly from culture supernatant using polymerase chain reaction | |
| RU2415948C1 (en) | METHOD OF SUBSPECIFIC DIFFERENTIATION OF Yersinia pestis STRAINS BY MULTILOCUS SEQUENCE TYPING | |
| RU2612137C1 (en) | Method for identification of tularemia pathogen subspecies francisella tularensis subsp tularensis, francisella tularensis subsp mediasiatica and francisella tularensis subsp holarctica | |
| RU2471872C1 (en) | Method for differentiating yersinia pestis strains of various subspecies and biovars by polymerase chain reaction and multilocus sequence typing | |
| RU2404256C1 (en) | Method of subspecific differentiation of plague causative agent strains by sequencing method | |
| Singh et al. | Multilocus sequence typing of Salmonella strains by high-throughput sequencing of selectively amplified target genes | |
| US20130157265A1 (en) | Composition, method and kit for detecting bacteria by means of sequencing | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| RU2332464C1 (en) | Method of plague and pseudotuberculosis microbe differentiation with parallel interspecies differentiation of plague microbe strains | |
| RU2551208C1 (en) | SET OF OLIGONUCLEOTIDE PRIMERS AND FLUORESCENTLY LABELLED PROBE FOR IDENTIFICATION OF Burkholderia mallei AND ITS DIFFERENTIATION FROM Burkholderia pseudomallei | |
| RU2736649C1 (en) | Method for genetic differentiation of yersinia pseudotuberculosis strains by molecular-genetic typing | |
| RU2496882C2 (en) | Method to differentiate strains of plague agent of primary subtype of medieval and antique biovars by method of polymerase chain reaction | |
| RU2552611C2 (en) | Method of subspecies differentiation of plague agent strains using polymerase chain reaction method | |
| RU2393231C1 (en) | Method for determination of genetic relationship of comma bacilli strains by sequencing genes flanking cluster of o-antigen biosynthesis genes | |
| RU2425891C1 (en) | Method of differentiation of strains of principal and nonprincipal causative plague agent and pseudotuberculosis agent by polymerase chain reaction | |
| RU2765495C1 (en) | Method for the determination of francisella tularensis subspecies by multi-primer pcr | |
| RU2756854C1 (en) | Differentiation of francisella tularensis strains by molecular genetic typing | |
| RU2804111C1 (en) | Set of oligonucleotide primers for determining methylation of human ccr5 gene promoter in samples of biological material that has undergone preliminary bisulfite conversion using pyrosequencing | |
| RU2621869C1 (en) | Method for plague agent strains subspecies differentiation by pcr with real time hybridization-fluorescent account of results | |
| CN103757110A (en) | Vibrio cholera analysis typing kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20110505 |